USER GUIDE › wp-cont… · USER GUIDE, Target SelectorTM EGFR Mutation Test Kit for ctDNA and Tissue USG 2383 / Rev. 01 Page 4 of 28 Date: 06Apr2020 MANUFACTURER The Target SelectorTM

USG 2383 / Rev. 01 Page 1 of 28 Date: 06Apr2020

USER GUIDE

Target SelectorTM EGFR Mutation Test Kit for ctDNA and Tissue

Catalog number: 2383

USER GUIDE, Target SelectorTM EGFR Mutation Test Kit for ctDNA and Tissue


For Research Use Only. Not for use in diagnostic procedures.

Copyright © 2020 by Biocept, Inc.

All rights reserved. This document or any portion thereof may not be reproduced in any form or transmitted outside of the recipient’s organization in any form by any means – electronic, mechanical, photocopy, recording, or used in any manner whatsoever without the express written permission of the company.



TABLE OF CONTENTS Manufacturer ............................................................................................................................................ 4

Product Description .................................................................................................................................. 4

Assay Principle ......................................................................................................................................... 4

EGFR Mutation Kit Components and Storage Conditions ........................................................................ 5

User-supplied reagents and consumables ................................................................................................ 6

Sample Collection, Handling and Storage ................................................................................................. 6

Notes for the Assay Research Use Only Kit ............................................................................................... 7

EGFR Research Use Only Kit Protocol ....................................................................................................... 7

IMPORTANT! ............................................................................................................................................ 7

Preparing Standards ................................................................................................................................. 8

Preparing Master Mix .............................................................................................................................. 8

Plate set up for EGFR mutant assays ....................................................................................................... 9

Plate set up for Wild Type assay .............................................................................................................. 9

Setup run on QuantStudio 5 .................................................................................................................. 10

Target SelectorTM Assay Data Analysis .................................................................................................... 13

Quantitative Analysis ............................................................................................................................. 13

Specificity Analysis ................................................................................................................................. 16

Target selectorTM assay -Troubleshooting .............................................................................................. 20

Technical Support/Questions.................................................................................................................. 20

Sanger sequencing protocol ................................................................................................................... 21

PCR Purification ...................................................................................................................................... 21

PCR Template Quantitation ................................................................................................................... 21

Cycle Sequencing ................................................................................................................................... 21

BigDye Xterminator Purification ............................................................................................................ 23

Sequencing run on 3500Dx .................................................................................................................... 24

Review Sequencing Results ..................................................................................................................... 27

Export Sequencing Results ...................................................................................................................... 27

Sanger sequencing -Troubleshooting ..................................................................................................... 28



MANUFACTURER The Target SelectorTM ctDNA and tissue EGFR Test Research Use Only Kit (the “EGFR Mutation Kit”) is manufactured by Biocept, Inc. at 5810 Nancy Ridge Dr., San Diego, CA 92121.

PRODUCT DESCRIPTION The EGFR Mutation Kit allows selective amplification and identification of most common epidermal growth factor (EGFR) mutations such as exon 19 deletions (Del19), L858R and T790M from either genomic DNA, circulating tumor DNA (ctDNA) or tissue DNA. It also includes an EGFR Wild Type assay (EGFR WT) to determine total genomic DNA copy numbers. The EGFR Mutation Kit combines Real time-PCR as well as melt curve analysis of the mutant PCR product and is followed by Sanger sequencing to verify the presence of the mutation.

ASSAY PRINCIPLE The EGFR Mutation Kit is a Real-Time PCR based mutation enrichment assay and is based on selective blocking of wild-type amplification with a blocker that contains a sensor (switch) and an anchor portion. In contrast to blocked wild-type amplification, mutant templates are readily amplified in the presence of the same blocker allowing for selective enrichment. A mismatch in the mutant template leads to a significant reduction in the melting temperature of the sensor (switch) portion of the blocker allowing the forward primer to extend with the mutant template. Under the same conditions, the forward primer extension is blocked, due to the stability of the sensor (switch) region since it is fully complementary with Wild type. When the temperature is raised above the melting temperature of the forward primer, as shown in the left panel of figure 1, the non-extended forward primer on the wild-type template falls off before the blocker. However, with the mutant template the extended forward primer has a high enough melting temperature that it remains bound to the template when the blockers fall off, thus extending further and supporting amplification as shown in right panel of figure 1. Detection of the amplification product is done by unquenching the fluorophore (F) signal when the blocker is bound to the template. The location of the quencher (Q) is at the 5’ end as show in figure 1 below. Total DNA copies in the sample DNA are quantified using the EGFR WT assay which allows amplification of mutant and wild-type EGFR using primers and a blocker for a region on EGFR exon 20.

Since any mutation of the DNA template in the region covered by the sensor portion of the blocker can potentially lead to amplification of this template, Sanger sequencing is necessary to confirm identity of the EGFR mutants Del19, L858R and T790M. The amplification products are therefore purified after the EGFR Target SelectorTM assay and used for templates in Sanger sequencing reactions to confirm the presence of mutations.



Figure 1: Mechanism of the “Foot-print” version of the selector assay

EGFR MUTATION KIT COMPONENTS AND STORAGE CONDITIONS The EGFR Mutation Kit contains enough reagents to perform 24 test (RUO) samples for each Target SelectorTM assay. This includes 12 reactions for standards, 1 NTC and 24 test samples for a total of 37 reactions.

Table 1: EGFR Mutation Research Use Only Kit components with recommended storage conditions Reagent Part no Volume total (µl) Storage (◦C)

Del19 Oligo Mix PN2271 135 -20 L858R Oligo Mix PN2272 135 -20 T790M Oligo Mix PN2273 135 -20

Wild Type Oligo Mix PN2274 135 -20 Premix PN2278 275 -20

Premix with MgCl2 PN2280 275 -20 Selector DNA Polymerase PN2290 75 -20 Del19 Sequencing Primer PN2401 30 -20 L858R Sequencing Primer PN2402 30 -20 T790M Sequencing Primer PN2403 30 -20

Del19 Standard A PN2391 150 -20 L858R Standard A PN2392 150 -20 T790M Standard A PN2393 150 -20

Wild Type Standard A PN2394 150 -20 DNA Suspension buffer PN2390 1200 -20



USER-SUPPLIED REAGENTS AND CONSUMABLES – MicroAmp Optical 96-well Reaction plate with barcode (for Sanger sequencing), Thermo Fisher

Scientific- Catalog number 4306737

– Eppendorf twin.tec PCR plate 96 LoBind, Semi-Skirted (for QPCR), Eppendorf- Catalog number 0030129504

– MicroAmp Optical Adhesive Film Kit, Thermo Fisher Scientific Catalog number -4313663 or Microseal 'B' PCR Plate Sealing Film, Bio-Rad, Catalog number- MSB1001

– MicroAmp Clear Adhesive Film, Thermo Fisher Scientific, Catalog number - 4306311

– DNA Lo-bind tubes, PCR clean, Eppendorf, Catalog number – 022431021

– MinElute PCR Purification Kit (50), QIAGEN, Catalog number – 28004

– BigDye Terminator v1.1 Cycle Sequencing Kit, Thermo Fisher Scientific, Catalog number – 4336774

– BigDye Xterminator Purification Kit, Thermo Fisher Scientific, Catalog number - 4376486

SAMPLE COLLECTION, HANDLING AND STORAGE The EGFR Mutation Kit can be used with DNA extracted from the following sample types:

– Genomic DNA from Formalin-fixed paraffin-embedded tumor tissue samples (FFPE slides & blocks) or fresh-frozen tissue samples.

– Circulating tumor DNA (ctDNA) from plasma or serum. – Genomic DNA from cell lines.

Extract and purify DNA samples according to your research protocols. For FFPE tissue recommended methods for DNA extraction include the MagMAX™ FFPE DNA/RNA Ultra Kit (Thermo Fisher Scientific) or the GeneRead™ DNA FFPE treatment kit in combination with the QIAsymphony DSP DNA Mini kit (QIAGEN). It is optional to quantitate the gDNA or cfDNA by measuring the UV absorbance (A260/A280) or by fluorescence-based quantitation. The Wild Type assay can serve as an assay to quantitate total genomic DNA EGFR copies.



NOTES FOR THE ASSAY RESEARCH USE ONLY KIT – The EGFR Mutation Kit has been optimized using the QuantStudio5 (QS5) Real-Time PCR system,

however, other QPCR systems such as the CFX96 (Bio-Rad) can be used with adjustment of the cycling conditions and ramping speeds to the conditions as described on pages 11 and 12.

– It is recommended to use “Low ROX” normalization for QuantStudio5. – A single sequencing primer is provided for each of the mutant assays. – The Selector DNA Polymerase is a heat-activated high-fidelity polymerase and is recommended

for use with the Assay research use only kit. – Each EGFR Target SelectorTM assay is run on an individual 96 well plate. – Effective range of DNA template input for this assay is up to 250ng for DNA prepared from cell

lines or 50ng for FFPE DNA. – It is recommended to run the standard curve the first time for each Assay Research use Only Kit.

For future experiments repeat standard curve dilution series or run a Standard C as the calibrator for each corresponding assay.

– The analytical sensitivity and specificity of each assay is > 99 %. – For more information on Sensitivity, Specificity and Limit of Detection on each Target SelectorTM

assay, please refer to the analytical validation report published in Poole JC, et al. (2019) Analytical validation of the Target SelectorTM ctDNA platform featuring single copy detection sensitivity for clinically actionable EGFR, BRAF, and KRAS mutations. PLoS ONE 14(10):e0223112. https://doi.org/10.1371/journal.pone.0223112

– For more information regarding FFPE DNA and use with the Target SelectorTM research use only kit please see AMP Annual Meeting poster 2019 (https://1dzi041pbrf98jfu01xrpf3k-wpengine.netdna-ssl.com/wp-content/uploads/2019/11/AMP2019_G021_TargetSelectorDNAHandoutFinal.pdf)

EGFR RESEARCH USE ONLY KIT PROTOCOL IMPORTANT! The following procedures are optional but highly recommended prior to PCR setup:

– Use a dedicated room/hood for selector assay reaction set up to avoid contamination from post PCR products.

– Use clean lab coat and be aware of possible contamination of samples and change gloves. – Wipe the hood/bench and pipettes with 0.5% bleach and let sit for 15 min. – Wipe the hood/bench and pipettes with 70% ethanol, wipe dry. – Wipe the inside of microcentrifuge lid, microcentrifuge rotor and vortex with 0.5% bleach soaked

kimwipe. – Wipe the inside of microcentrifuge lid, microcentrifuge rotor and vortex with 70% ethanol and let

dry. – Racks used for holding Eppendorf tubes should be soaked in 0.5% bleach for 15 min, washed with

diH20, sprayed with ethanol and patted dry onto paper towel.

https://1dzi041pbrf98jfu01xrpf3k-wpengine.netdna-ssl.com/wp-content/uploads/2019/11/AMP2019_G021_TargetSelectorDNAHandoutFinal.pdf





PREPARING STANDARDS 1. Each Target SelectorTM assay is provided with an assay standard (StdA) with a pre-determined

number of copies for the respective assay. The assay standards are diluted as described below to generate a standard curve.

2. Remove Target SelectorTM assay standards (Std A) and thaw on ice. 3. Once thawed, vortex all standards ~3-5 seconds to mix thoroughly and briefly centrifuge for 5

seconds to collect all liquid to bottom of the tube. 4. Implement the following controls for each set-up: No Template control (NTC) and a four-point

standard curve diluted from Std A. 5. Use Table 2 as a guide for preparing three additional standards in a sequential 8-fold serial dilution

for each Target SelectorTM assay (Del19, L858R, T790M and Wild Type) using Std A provided with the research use only kit.

Table 2: Example of a 40 µl Serial Dilution of EGFR Target SelectorTM assay standards Standard Standard Input DNA suspension buffer Fold Dilution

Std A undiluted N/A N/A Std B 5µl Std A 35 µl 1:8 Std C 5µl Std B 35 µl 1:8 Std D 5µl Std C 35 µl 1:8

Note: The starting copy number of Std A for each Target SelectorTM assay is 5000 +/- 500 copies. The prepared Standards (Std A, Std B, Std C and Std D) are run in triplicates.

PREPARING MASTER MIX 1. For each Target SelectorTM assay thaw Premix, Premix with MgCl2 and Oligo Mixes on ice, vortex

and centrifuge briefly before pipetting. Note: Del19 Mastermix requires “Premix” (see Table 3). The other assays in the research use

only kit (L858R, T790M and Wild Type Oligo) require “Premix with MgCl2” to prepare the respective Mastermix (see Table 4).

2. Please refer to the online calculator for assay setup on our website at https://biocept.com/products/Target-Selector-Kits for reaction volumes. Alternatively, follow the instructions below for preparing Master mix.

3. Use Tables 3 and 4 below as a reference to calculate reagent volumes of Master mix for each EGFR Target SelectorTM assay (Del19, T790M, L858R and Wild Type). Determine the number of samples including standards and test for each Target SelectorTM assay to calculate the reagent volumes.

4. Prepare each EGFR Target SelectorTM assay Master mix into a labeled 1.5 mL microfuge tube, mix well and centrifuge briefly.

Table 3: Del19 Mastermix preparation Component Volume per reaction (1X reaction*)

Premix 6.2 µl Del19 Oligo Mix 3 µl

Selector DNA polymerase 0.8 µl Total volume (excluding template) 10 µl

*Multiply volumes in this table by the number of samples being tested (including controls)

https://biocept.com/



Table 4: L858R, T790M or Wild Type Mastermix preparation Component Volume per reaction (1X reaction*)

Premix with MgCl2 6.2 µl L858R, T790M or Wild Type Oligo Mix 3 µl

Selector DNA polymerase 0.8 µl Total volume (excluding template) 10 µl

*Multiply volumes in this table by the number of samples being tested (including controls)

Notes:

∗ Calculate extra 10% of reagent volumes for the final master mix to allow for losses during pipetting. ∗ DO NOT VORTEX SELECTOR DNA POLYMERASE. Briefly centrifuge, mix by pipetting up and down

before adding to master mix. ∗ Always place the premix and enzyme on ice while preparing the master mix. ∗ Mix the Master mix by pipetting up and down or by gently vortexing and centrifuge briefly to collect

the contents to the bottom of the tube. Vigorous vortexing can result in loss of enzyme activity.

PLATE SET UP FOR EGFR MUTANT ASSAYS 1. Label an individual 96 well plate for each of the EGFR Target SelectorTM Assays (Del19, L858R,

T790M) with appropriate sample and target information. 2. Pipette 10 µl of Master mix (see Table 5) into each well required. 3. Add 10 µl of the prepared Standards into the respective wells labeled as Std A, Std B, Std C and

Std D as shown in Table 5. The Standards are run in triplicates. 4. Add up to 10 µl of DNA template for the test samples (make DNA volume to 10 µl using DNA

suspension buffer) into each well labeled as Test for a total volume of 20 µl per well. 5. For wells marked NTC add 10 µl of the DNA suspension buffer to make up final volume to 20 µl.

PLATE SET UP FOR WILD TYPE ASSAY 1. Label a 96 well plate for the Wild Type assay. 2. Pipette 10 µl of Master mix (see Table 5) into each well required. 3. Add 3 µl of the prepared Standards and 7 µl of DNA suspension buffer (to fill up the volume to 10

µl) into the respective wells labeled as Std A, Std B, Std C and Std D as shown in Table 5. The prepared Standards are run in triplicates.

4. Add up to 10 µl of DNA template (make DNA volume to 10 µl using DNA suspension buffer) for the Wild Type assay plate into each well labeled as Test for a total volume of 20 µl per well. Note:

∗ Briefly vortex and spin the DNA template tubes before adding on the plate. Use separate tips for each sample and avoid cross contamination of the samples by splashing.

5. For wells marked NTC add 10 µl of the DNA suspension buffer to make up final volume to 20 µl. 6. Below is an example of plate layout with the standards, test sample and NTC.



Table 5: Example Plate layout with standards and test samples

7. Seal the 96 well plate with optical adhesive film and vortex the plate briefly using an Eppendorf MixMate or any other plate mixer.

8. Spin the plate at 2000rpms for 2 minutes. Note: It is optional to run replicates of NTC and test samples.

SETUP RUN ON QUANTSTUDIO 5 The QuantStudio design and analysis software template documents (.edt files) for each Target SelectorTM assay provided with the research use only kit are available on our website at https://biocept.com/products/Target-Selector-Kits. The template files include all the below mentioned settings. Please use the following passwords to unlock the template files:

– EGFR Wild Type Assay – EGFRWT – Ii. EGFR Del 19 Assay – Del19 – iii. EGFR L858R Assay – L858R – iv- EGFR T790M assay – T790M

1. Launch the QuantStudio Design and Analysis Software v1.4 from the icon on the desktop. 2. On the home screen, select “Create New Experiment” if using first time or “Open Existing

Experiment” if using the provided (.edt) template. 3. Select “Enter run experiment information” from the menu and select “ok”. 4. The workflow bar used for navigation through experiment design and analysis.

5. Under the “Properties” tab, name the experiment with the assay, plate id, data and initials with an underscore between each and select other properties as below from drop-down lists.

a. Instrument type - QuantStudio 5 system b. Block type - 96-well 0.2 mL Block c. Experiment Type - Standard Curve d. Chemistry - SYBR Green Reagents e. Run Mode - Standard

1 2 3 4 5 6 7 8 9 10 11 12AB Std A Std A Std A Test 1 Test 7 Test 13 Test 19C Std B Std B Std B Test 2 Test 8 Test 14 Test 20D Std C Std C Std C Test 3 Test 9 Test 15 Test 21E Std D Std D Std D Test 4 Test 10 Test 16 Test 22F NTC Test 5 Test 11 Test 17 Test 23G Test 6 Test 12 Test 18 Test 24H

https://biocept.com/



6. Under the “Method” tab, adjust the reaction volume to 20 µl and the cycling conditions are as follows for each Target SelectorTM assay.

Table 6: Cycling conditions for Del19 and L858R Assay

Table 7: Cycling conditions for T790M and EGFR WT Assay

Stages (number of cycles) T790M EGFR WT Stage 1 (1x) 95°C 2 min 1.6°C/s 95°C 2 min 1.6°C/s

Stage 2 (45x) - Data collections at 50°C step

for T790M and EGFR WT

98°C 10 secs 1.6°C/s 98°C 10 secs 1.6°C/s 71°C 10 secs 1.6°C/s 71°C 10 secs 1.6°C/s 50°C 13 secs 1.6°C/s 50°C 13 secs 1.6°C/s 66°C 1 min 1.6°C/s 66°C 1 min 1.6°C/s

- - - - - - Stage 3 (1x)-

Data collection at 0.15°C/s ramp from 40°C to 95°C

95°C 15 secs 1.6°C/s 95°C 15 secs 1.6°C/s 40°C 15 secs 1.6°C/s 40°C 15 secs 1.6°C/s 95°C 1 sec 0.15°C/s to 95°C 95°C 1 sec 0.15°C/s to 95°C

Infinite hold 4°C ∞ 1.6°C/s 4°C ∞ 1.6°C/s

Duration 2 hr 5 min 2 hr 5 min

Note: WT and T790M have the same cycling conditions and could be run on the same plate provided appropriate cautions are taken to prevent cross-contamination.

Stages (number of cycles) Del 19 L858R Stage 1 (1x) 95°C 2 min 1.6°C/s 95°C 2 min 1.6°C/s

Stage 2 (45x) - Data collection for Del 19 at 45°C step, for L858R at 60°C

step

98°C 10 secs 1.1°C/s 98°C 10 secs 1.1°C/s 72°C 10 secs 1.1°C/s 76°C 10 secs 1.1°C/s 45°C 13 secs 1.1°C/s 60°C 13 secs 1.1°C/s 60°C 1 min 1.1°C/s 62°C 1 min 1.1°C/s

- - - 70°C 10 secs 1.1°C/s Stage 3 (1x)-

Data collection at 0.15°C/s ramp from 40°C to 95°C

95°C 15 secs 1.6°C/s 95°C 15 secs 1.6°C/s 40°C 15 secs 1.6°C/s 40°C 15 secs 1.6°C/s 95°C 1 sec 0.15°C/s to 95°C 95°C 1 sec 0.15°C/s to 95°C

Infinite hold 4°C ∞ 1.6°C/s 4°C ∞ 1.6°C/s

Duration 2 hr 30 min 2 hr 17 min



7. Under the “Plate” tab: Set up standards as follows:

a. Select “Action” -> Define and Set up Standards. b. Select “Singleplex” from the Model drop-down list. c. Define the standard curve, enter the parameters for the dilution series.

i. Number of dilution points: 4 ii. Number of replicates: 3

iii. Starting Quantity: 5000 iv. Serial dilution factor: 1:8

d. Under “Select” and arrange wells for the standard, select the option “Let me select wells” then drag the cursor to select the appropriate block of wells.

e. Select “Apply” and close the window. The standards should now be populated in the wells selected and displayed on the plate map.

f. Define and assign well attributes in the Quick setup pane of the Plate tab. i. Assign the sample name as Std A, Std B, Std C and Std D for the wells with task

“Standard”. ii. Drag the cursor to select appropriate sample well. Enter new sample and target

names in the selected wells. iii. In the plate attributes, select the passive reference to “ROX”.

Note: When entering a new sample or target name in the Quick Set up pane, the software automatically populates default values for Reporter (FAM) and Quencher (NGQ-MGB) assigns the task (Unknown) which can be viewed in advanced Setup tab.

g. For No-template control, select the target from drop down menu, then under the “Action” tab select the task “Negative Control”.

8. Under the “Export” tab, confirm the file name is the same as the experiment name and that “Auto Export” and “Results” are selected. Also make sure the file is saved as a “.txt file” and set the export location.

9. Open the QS5 instrument drawer and load the plate, ensuring A1 is oriented towards the top left corner.

10. Under the “Run” section select “START RUN” and select a specific QS5 instrument to start. 11. When the run is done, select “STOP RUN” either on QS5 screen or in QS Analysis software in the

computer.

12. Select “Done” after file is transferred on QS5 instrument. Retrieve plate and save at -20◦C for downstream analysis.



TARGET SELECTORTM ASSAY DATA ANALYSIS 1. Launch the QuantStudio Design & Analysis software v1.4, select “Open” in open Existing

information tab. Select the plate run (.eds or .edt file) from the saved folder. 2. Select “Edit” option and enter the password if there is a password set up.

Note: If the provided .edt templates were used, please use the following passwords to unlock the run files:

– EGFR Wild Type Assay – EGFRWT – ii. EGFR Del 19 Assay – Del19 – iii. EGFR L858R Assay – L858R – iv- EGFR T790M assay – T790M

QUANTITATIVE ANALYSIS 3. In the “Results” tab, by default the amplification plot is displayed for the selected wells. Note: If no data are displayed, select “Analyze”.

4. Select the “ ”to configure the plot. 5. Confirm or correct baseline and threshold values. Identify any outliers. 6. It is optional to use below Table 8 to manually preset threshold (∆Rn) for threshold cycle (Ct)

determination or to use provided (.edt) templates.

Table 8: Threshold values for Ct determination Target name ∆Rn

Del19 0.04 L858R 0.04 T790M 0.44

EGFR WT 0.36

7. Identify and examine abnormal amplification, including: a. Increased fluorescence (amplification) in negative control wells. b. Absence of detectable fluorescence at an expected cycle.

Note: If an abnormal amplification or a complete absence of fluorescence is detected or notices, refer to the QS5 user guide for troubleshooting information.

8. In the “Results” tab, select Standard curve from the drop-down list. It displays the standard curve for samples designated as standards.

9. Confirm that the slope, R2-value, amplification efficiency and error meet the expected criteria. Note: Please refer to Chapter 3 in QuantStudio Design and Analysis desktop software user guide

(Pub.no. MAN0010408) to evaluate the results in the Standard Curve Plot.



10. Visually check if all the test sample Ct values fall within the standard curve range. a. Example standard curve for each EGFR target is shown below (Figures 2-5). b. Linear regression results of the below standard curve plots are shown in table 9 below:

Table 9: Linear Regression Results of 4-point standard curve Target name y. intercept slope Efficiency (%) R2

EGFR WT 38.644 -3.306 100.652 0.998 EGFR L858R 39.271 -3.74 85.073 0.993 EGFR T790M 43.104 -3.725 85.548 0.996 EGFR Del19 39.228 -3.687 86.743 0.995

Note: Calibrator method ∗ It is highly recommended to run a 4-point standard curve (master curve) the first time for

each Assay or each lot of reagents. ∗ For future experiments, it is optional to repeat 4-point standard curve or run Std C in

triplicates as a calibrator (QC measure) for each Target SelectorTM assay plate. ∗ Verify if the median value of calibrator is within 3 standard deviations of mean value of Std C

from the master curve.

Figure 2: Standard curve of EGFR Del19



Figure 3: Standard curve of EGFR L858R

Figure 4: Standard curve of EGFR T790M



Figure 5: Standard curve of EGFR WT

SPECIFICITY ANALYSIS 11. In the “Results” tab, select the Melt Curve plot from the drop-down list. The Melt curve plot is

displayed for the selected wells of the selected stage. 12. Select “Analysis” -> Analysis settings and select the “Melt curve settings” tab. 13. Check the box for “Enable Multi-peak calling”. It is optional to set either the dominant peak

percent or a peak calling threshold as below. a. EGFR WT: Peak level relative to dominant peak = 10.0 b. Del 19: Peak level relative to dominant peak = 10.0 c. L858R: Peak calling threshold =1600.0 d. T790M: Peak calling threshold = 1500.0

14. Multiple peak melting temperature for the targets are as below: a. L858R = 68.0◦C < t < 70.0 ◦C b. T790M = 68.4◦C < t < 69.7◦C or 72.8◦C < t < 73.9◦C Note: The above cut off values are only general guidelines based on our internal validation of

the assay. These values should be verified and adjusted according to the results. Results may vary according to the sample type.



15. Examples of melt profiles of the four-point standards for each Target SelectorTM assay are shown below:

Notes: ∗ T790M and Wild Type Target SelectorTM assays show 2 melting peaks indicating the

melting temperature of the sensor and anchor region of the blocker. ∗ No specific melting temperature profile for Del19 Target SelectorTM assay. ∗ The specific L858R product peak is observed between 68.0◦C and 70.0 ◦C. The smaller peaks

observed in L858R target assay melt profile is from low concentration samples which is an artifact of the Target SelectorTM technology.

∗ There is a synonymous mutation at L858 position (CTG to TTG). Sanger sequencing is required to distinguish this alteration from the L858R mutation.

Select “File” -> save to save the analysis. 16. Navigate to the “Export” tab of the QS5 software. Set the export location to the desired folder.

Under “File Type” select “.txt” then select the “Export” button.

Figure 6: Melt curve plot of EGFR Del19 standards



Figure 7: Melt curve plot of EGFR L858R standards

Figure 8: Melt curve plot of EGFR T790M standards



Figure 9: Melt curve plot of EGFR WT Standards



TARGET SELECTORTM ASSAY -TROUBLESHOOTING Issue Cause Possible resolution

Amplification in No Template Control (NTC) wells

Random contamination of wells by template when loading PCR

plate

Follow the procedures recommended prior to PCR set

up in protocol Reagent contamination with

template No PCR product is evident

either on the qPCR graph or on a gel

The protocol was not followed correctly

Verify that all steps have been followed and the correct

reagents, dilutions, volumes and cycling parameters have

been used DNA contained PCR inhibitors or

was otherwise degraded Re-purify the DNA sample or

repeat the DNA extraction PCR product is evident on a gel,

but not in the qPCR graph qPCR instrument settings were

incorrect Confirm that the correct

instrument settings are being used and refer to the

instrument manual to tips and troubleshooting

There was an issue with the specific qPCR instrument

Increased fluorescence (early Ct values) in one of the wells

Possible background signal from uneven distribution of ROX dye

Mix the reagents thoroughly, Repeat the assay for the well

with early Ct values Technical replicates are not

overlapping and have a difference in Ct values > 1 cycles

Pipetting error, insufficient mixing of solutions or low

expression of target resulting in stochastic amplification

Calibrate pipettes, use positive-displacement pipettes, mix all solutions thoroughly during preparation and during use.

TECHNICAL SUPPORT/QUESTIONS For any questions regarding the Research Use Only Kit, please contact us at 1-888-332-7729 or email [email protected]



SANGER SEQUENCING PROTOCOL This section of the protocol describes the steps necessary to sequence the Target SelectorTM assay products. The first step is to purify the PCR products following which the purified PCR product is used in a Sanger cycle sequencing reaction with a sequencing primer for each target provided with the assay. After the Sanger cycle sequencing reaction, the product is purified using BigDye Xterminator purification kit and loaded for sequence analysis on the 3500Dx Genetic Analyzer or the SeqStudio (Thermo Fisher Scientific).

PCR PURIFICATION The PCR purification should be performed in a post-PCR area. For purification of Target SelectorTM QPCR reactions the MinElute PCR purification kit from Qiagen or the GeneJet PCR purification kit from Thermo Fisher Scientific are recommended. It is the user’s option to use these kits or any other preferred PCR purification method. Please refer to the kit handbooks from respective manufacturers for detailed purification instructions. Recommended elution volume for the PCR purification product is 10µl.

PCR TEMPLATE QUANTITATION The purified product is quantified by using Nanodrop 1000. Check the instrument manual for instructions on how to quantify the DNA.

CYCLE SEQUENCING 1. Thaw out BigDye Terminator mix v1.1 from the BigDye Terminator v1.1 Cycle Sequencing Kit,

sequencing primers from Target SelectorTM assay kit and the purified PCR templates for each Target SelectorTM assay. Vortex the reagents and samples briefly. Spin down the tubes.

2. Make 30ng/µl dilutions of purified PCR templates for each Target SelectorTM assay. 3. Use Table 10 as a guide to prepare master mix for each Target SelectorTM assay.

Table 10: Sequencing reaction Master mix Master mix Volume per reaction 1X

Big Dye Terminator mix v1.1 Ready Reaction Mix 4 µl Sequencing buffer 4 µl Nuclease-free H20 7 µl

Total reaction volume 15 µl Notes:

∗ Multiply volumes in this table by the number of samples being tested plus the pGEM control.

∗ Calculate extra 10% of reagent volumes for the final master mix to allow for losses during pipetting.



4. Use a MicroAmp 96-well plate (same plate to be loaded on 3500Dx or SeqStudio) and prepare the sequencing reaction for each Target SelectorTM assay samples as shown in Table 11, starting with column 1 (A1 to H1), then continue to column 2 (A2 to H2) and so on respectively.

Table 11: Cycle Sequencing Mix Components Volume per well

Nuclease-free H20 3 µl PCR template (30ng/µl) 1 µl

Sequencing primer (3.2 µM) 1 µl Master mix (from table 10) 15 µl

Total volume 20 µl Notes:

∗ If the concentration of PCR template from Target SelectorTM assay is different that 30ng/ µl, make the final amount to 30ng and adjust the amount of nuclease-free H20 accordingly, so that final combined volume of PCR template and H20 are 4 µl.

∗ Add 20 µl water to the empty wells of a column containing samples.

5. In the same 96 well plate, prepare the sequencing reaction for pGEM control as shown in Table 12.

Table 12: pGEM Control Reaction Mix Components Volume per well

pGEM 3Zf (+) dsDNA control 1 µl M13(-21) control primer 4 µl

Master mix (from table 10) 15 µl Total volume 20 µl

6. Seal the 96 well plate with optical adhesive film and spin the plate at 2000rpms for 2 minutes. 7. Place the plate on Veriti thermocycler, place a microamp optical film compression pad on top and

close lid. Start the run with cycling conditions as shown below:

Stage 1 96◦C 1 min

Stage 2 (25 cycles)

96◦C 10 secs 50◦C 5 secs 60◦C 4 min

Infinite hold 4◦C ∞

8. After the run finishes, take out the plate and spin down at 2000rpms for 2 minutes.



BIGDYE XTERMINATOR PURIFICATION This step is performed to clean-up the sequencing reaction products of salts, unincorporated dye terminators and dNTP’s which can interfere with base calling.

1. Take out the SAM solution provided with the BigDye Xterminator Purification kit from the refrigerator and equilibrate to room temperature.

2. Use Table 13 as a guide to determine the amount of SAM solution and Big Dye Xterminator beads to make the premix.

3. Briefly vortex the SAM solution and pipette the volume calculated in to a clean 5 mL Eppendorf tube. Vortex the bottle of Big Dye Xterminator beads for 20 seconds to mix well. Pipette the calculated volume of Xterminator solution using a wide-bore filter tip to mix with the SAM solution in 5mL tube.

Table 13: SAM/BigDye Xterminator Premix Component Volume per reaction (1X)

SAM Solution 85 µl Xterminator Solution 25 µl

Total volume 110 µl Notes: ∗ Multiply volumes in this table by the number of reactions required. ∗ Calculate extra 10% of reagent volumes for the final working solution to allow for losses

during pipetting.

4. Carefully remove the optical adhesive film from the sequencing plate. 5. Vortex the premix from Table 13 for 20 seconds at high speed. Pipette 110 µl of Xterminator

premix to each reaction well and mix gently up and down several times. Note: Fill empty wells in last column with 110 µl of nuclease-free H20. IMPORTANT! The premix needs to be vortexed before adding to each well for optimal performance.

6. Seal the plate using optical adhesive film. Carefully seal each well to prevent cross-contamination. Invert the plate a few times, then vortex on Eppendorf MixMate at 2500 rpm for 40 minutes.

7. Centrifuge the plate at 2000 x g for 5 minutes. Remove the plate seal and place a septum for loading on 3500X. Note: Purification with Centri-Sep plates or purification with ethanol/EDTA precipitation are other

alternate methods to purification by BigDye Xterminator. Please refer to BigDye Terminator v3.1 Cycle Sequencing kit user guide for more information on alternate methods of purification.



SEQUENCING RUN ON 3500DX The EGFR research use only kit user guide describes the sequencing run on 3500Dx, but the SeqStudio can also be used for reactions prepared using the Sanger sequencing protocol described in this manual. It is assumed that the 3500Dx instrument has been set up and 3500 Dx series software has been installed. For any questions on instrument and software set up please refer to Applied Biosystems 3500 Genetic Analyzer user guide or contact their technical support.

1. If the instrument is not already on, click the power “ON/OFF” button on the front of the instrument and wait for the green status light to turn on.

2. Select the “TRAY” button on the outside of the instrument to bring the autosampler to forward position. Wait until the autosampler stops at the forward position.

3. Check the instrument status, ensure the green light is on and not flashing before proceeding. 4. Select on the “3500 Dx software” icon on desktop, enter username and password in the 3500 Log

in dialog box. Select “Ok”. In the Mode selection dialog box, select “Research Use Only (RUO)” Mode. This launches the 3500-series data collection software 2011 v1.0.

5. In Dashboard, check consumable status to ensure that consumables are not expired, and adequate buffer levels are at the fill lines. Note: For detailed instructions on maintenance tasks, consumable status please refer to chapter 2

in Applied Biosystems 3500 Genetic Analyzer user guide. 6. In the Dashboard, set the oven temperature to 60°C and select “Start Pre-Heat”. Pre-heat the

oven for at least 30minutes before starting a run if the instrument is cold.



7. In the Dashboard, select “Create New Plate”, and in the Define plate properties screen, enter the plate name and select the number of wells, plate type, capillary length and polymer as shown below:

Note: For SeqStudio capillary length is 28cm and Polymer is POP1.

8. Select on the “Assign Plate Contents”, at the bottom of this page and proceed to the next screen. 9. A 96 well plate layout will pop up, enter the sample name for each reaction well on 96 well plate

map. 10. At the bottom right of the assign plate contents screen, expand customize sample info pane. 11. Select the wells with sample names and assign Assays, File Name Conventions and Results

Groups. 12. Enable the checkbox next to selected assay name, file name conventions and results group to

assign it to selected wells. 13. Select “Save Plate” and select “Save as” to assign a plate name. 14. Prepare plate assembly as follows:

Align the holes in the septa strip with the wells of the plate, then firmly press downward onto the plate. Place the sample plate into the plate base. Snap the plate retainer (cover) onto the plate, septa and plate base as shown in Figure 10.

Figure 10: Plate Assembly for sequencer

15. Verify that the holes of the plate retainer and the septa strip are aligned. If holes are not aligned, re-assemble and then assemble the plate assembly.

16. Load the assembled plate unit in the instrument: Place the plate unit in the autosampler with labels facing the instrument door and the notched corner of the plate in the notched corner of the autosampler.

17. Close the instrument door to re-initialize the instrument. 18. In the Assign Plates for Run screen, select “Link Plate for Run”. A message will pop up “Plate

loaded successfully”. Select “ok”.



19. In “Load plates for Run” screen, review the consumables information, the calibration information and ensure the status is acceptable for a run.

20. Enter a run name (MMDDYY_SequencingPrimer_Initial_specific info). 21. Access the Preview run screen from the navigation pane by selecting Preview Run. 22. The preview run screen contains an injection list and a plate view. The injection list is linked to

the plate view. Select an injection to select the associated wells in the plate view.

23. To modify the injection list at any time before a run, select an injection, then select Move up,

Move down and delete as needed. 24. Select “Start Run”. The Monitor run screen is now automatically displayed.

Note: It takes, approximately, 10 seconds for the instrument to initialize after the instrument door is closed. Do not start a run until the instrument status light is green.

25. The current injection is highlighted in green in the plate view, the injection list is linked to the plate view.

26. When an injection is complete, it is flagged with in the injection and analysis columns.



REVIEW SEQUENCING RESULTS 1. Open Sequencing Analysis Software 6 and enter Username and Password. 2. Under File, select “Add Samples” and open the folder containing the sequencing results. Select

all samples of interest, then select “Add Selected Samples” and Select “OK”. 3. Select “green arrow” to analyze the sequencing data. 4. Enable check box under “show” to display sequence. 5. Adjust sequence display using the toggle buttons.

6. A snipping tool can be used to crop the mutation sequence region of interest. Then select the

save icon to save the image. 7. Review sequence quality such as Metric Analysis results – Sample base calling and trimming

results. Note: For detailed data review information and to understand the Quality Values please refer to

chapter 4 in Applied Biosystems 3600/2500xL Genetic Analyzer User Guide. 8. Reference traces for each EGFR Target SelectorTM assay are shown below in Figures 11, 12 and 13.

EXPORT SEQUENCING RESULTS 1. Filter the table of interest. 2. Select an export option: Results, Reports or Traces. 3. Select the export options and location for the export file, select “OK”.

Figure 11: Del19 Sequencing Region AGTTAAAATTCCCGTCGCTATCAAGGAATTAAGAGAAGCAACATCTCC (Del 746-750); deleted region shown in red



Figure 12: T790M Sequencing Region

Figure 13: L858R Sequencing Region GCAGTTTGGCCAGCCCAAAATCTGTGATCTTGACATGCTG (CAG: A>C or AG>CT or CA>AC)

Note: There is also a synonymous mutation that is sometimes observed at L858 position (CTG to TTG).

SANGER SEQUENCING -TROUBLESHOOTING For troubleshooting information on both instrument and sequencing run, please refer to Appendix E in Applied Biosystems 3600/2500xL Genetic Analyzer User Guide.

Documents

USER GUIDE › wp-cont… · USER GUIDE, Target SelectorTM EGFR Mutation Test Kit for ctDNA and Tissue USG 2383 / Rev. 01 Page 4 of 28 Date: 06Apr2020 MANUFACTURER The Target SelectorTM