UNIVERSIDADE FEDERAL DA BAHIA FACULDADE DE … Luiz Barbosa Báfica...mediators of IL-12 regulation and resistance/susceptibility to the pathogen. An experimental mouse model of aerosol

UNIVERSIDADE FEDERAL DA BAHIA FACULDADE DE MEDICINA

FUNDAÇÃO OSWALDO CRUZ CENTRO DE PESQUISAS GONÇALO MONIZ

Curso de Pós-Graduação em Patologia

TESE DE DOUTORADO

MECANISMOS INATOS DE REGULAÇÃO DA IL-12 DURANTE A INFECÇÃO POR MYCOBACTERIUM

TUBERCULOSIS

ANDRE LUIZ BARBOSA BAFICA

Salvador - Bahia - Brasil2006

UNIVERSIDADE FEDERAL DA BAHIA

FACULDADE DE MEDICINA

FUNDAÇÃO O SW A L D O CRUZ

CENTRO DE PESQUISAS G O N Ç A LO M ONIZ

CURSO DE PÓS-GRADUAÇÃO EM PATOLOGIA

TESE DE DOUTORADO

MECANISMOS INATOS DE REGULAÇÃO DA IL-12 DURANTE A INFECÇÃO VOK MYCOBACTERIUM TUBERCULOSIS

ANDRE LUIZ BARBOSA BAFICA

ORIENTADOR: Dr. MANOEL BARRAL-NETTO

Tese apre: Cur'^ ie Pós-graduação em Patologi. a a obtenção do grau de Doutor.

Salvador - Bahia - Brasil

2006

Ircv I o 1

Ficha Catalográfica elaborada pela Biblioteca do Centro de Pesquisas Gonçalo Moniz / FIOCRUZ - Salvador - Babia.

Báfica, AndréB143m M ecanism os inatos de regulação da i l - 12 durante a in fecção por

mycobacterium tuberculosis [manuscrito] / André Báfica. - 2006.90 f . : i l . ; 30 cm.

Datilografado (fotocopia).

Tese (doutorado) - Universidade Federal da Bahia. Fundação Oswaldo Cruz. Centro de Pesquisas Gonçalo Moniz, 2006.

Orientador; Prof. Dr. M anoel Barrai-Netto, Laboratorio de Imunorregulaçãc e Microbiología.

1. Mycobacterium tuberculosis. 2. Citocina. 3. IL. 4. Lipoxinas. LTítulo.

CDU 616.982.2:575

MECANISMOS INATOS DE REGULAÇÃO DA IL-12 DURANTE A INFECÇÃO POR MYCOBACTERIUM TUBERCULOSIS.

ANDRE LUIZ BARBO SA BAFICA

FOLHA DE APROVAÇÃO

COMISSÃO EXAMINADORA

Este trabalho foi realizado na Immunobiology Section do Laboratory o f Parasitic Diseases,

National Institutes o f Allergy and Infectious Diseases, National Institutes o f Health,

Bethesda, Estados Unidos, sob a orientação do Dr. Alan Sher (nos Estados Unidos) e do

P rof Manoel Barral-Netto (no Brasil) e contou com o apoio financeiro do National

Institutes of Health, da Fogarty Foundation e do Conselho Nacional de Desenvolvimento

Científico e Tecnológico (CNPq).

■‘Embora ninguém possa voltar atrás e fazer um novo começo, qualquer um pode começaragora e fazer um novo fím.”

Francisco Cândido Xavier

Ko?. mexxç, pa\s, "Duiia e 'HeVsorv Aos meus irmãos

E a minha esposa, Cris.

O trabalho dessa tese foi desenvolvido na Immunobiology Section e no Centro de Pesquisas

Gonçalo Moniz (LIMI). Eu gostaria de agradecer a todos que, de alguma maneira, contribuiram

para esse trabalho, em particular:

Ao meu orientador nos Estados Unidos, Dr. Alan Sher, pelo seu criticismo, idéias e discussões,

além de sempre estimular o meu lado clínico. Thank you veiy much chefe!

Ao meu orientador no Brasil, Dr. Manoel Barral-Netto, por ter iniciado o meu despertar pela ciência

e sempre estar presente para orientação, discussões e críticas pertinentes ao trabalho.

A Dra. Aldina Barrai, pelos conselhos, apoio e praticidade em resolver tudo que sempre necessitei.

Ao Dr. Johan Van Weyenbergh, pela seu criticismo e ensinamentos ciêntificos.

Ao Dr. Chuck Scanga, a friend from whom I have leamed experimental TB models, BSL-3 facility

stuff as well as long-term experiments (e.g. the 9-month drug design exp.!). Our discussions on TB

results including our HIV project were great!!!

Ao Dr. Júlio Aliberti, colega de laboratorio no NIH, que de forma direta ou indireta sempre me deu

ótimas idéias no desenvolvimento dos projetos do laboratório.

Fríends and colleagues from NIH, Carl Feng (The king!), Tony Rothfuchs (valeupapito!!!), Romina

Goldszmid, Dragana Jankovic, Damien Chaussabel, Sara Hieny, Pat Casper, Dr. José Marcos

Ribeiro, Jesus, Rob, Mallika and Svenja for their contribution to make my scientific life much

easier at the USA. Thank you all!!!!

A todos os amigos e colegas do LIMI e LIP, em especial Almério, Ricardo, Cláudia, Silvinha (in

memorian), Andrea, Camila, Jorginho, Jânia, Theolis, Viviane, Daniele, Clanssa, Régis, Cecilia,

George, Sebastião, Lucas, Dirceu, Deby, Tati, Fernanda, e Edvaldo pela convivência e apoio do dia-

a-dia no LIMI-LIP.

Ao Dr. Jackson Costa, pelas discussões enriquecedoras sobre a leishmaniose humana.

AGRADECIMENTOS

A todo os amigos da secretaria: Rosália, Camilla, Jackson e Elze (CPqGM), Kim e Gail (NIH) por

facilitarem a minha papelada de trabalho (doutorado e pos-doc), além da grande força nos últimos 4

anos; ao amigo Jorge Tolentino, pelo apoio técnico e por proporcionar um descontraído ambiente de

trabalho no LIMI.

Aos colaboradores e amigos que de alguma forma influenciaram a minha carreira eiêntifica: Allen

Cheever (o grande inventor das “chiveirinhas”), Washington Luis, Nathanael, Ana Cristina

Saldanha, Ali Costa, Fabiana, Tie Chen, Cindy Leifer, Rajen, Steve, Marco Schito e Charles Serhan

dentre outros.

Aos meus amigos nos “states”: Ivão, Fabiano, Homer e os demais componentes/moradores do

Pooks Hill, 5121 Strathmore e 3906 Lantern Dr, que compartilharam milhares de horas de “papo

furado” permeados de conversas científicas, anedotas, discussões, reclamações e muita psicologia

(às vezes psiquiatria!).

À minha família pelo apoio durante todos esses anos e em especial à minha mãe Duda e ao meu pai

Nelson pelo carinho e amor.

Aos meus irmãos Neto, Aline e Dal pelo carinho compartilhado em todos esses anos e à minha

esposa, Cris, pela paciência e suporte.

Ao apoio financeiro do CNPq, Fogarty, CAPES e Fiocruz.

Obrigado!!!

fviecanismos inatos de reguiação da iL -i2 durante a infecção \iot Mycobacterium tuberculosis.

André Báfica

A citocina IL-12 desempenha um papel importante na indução de urna rede de genes da resposta imune envolvidos na resistência a infecções por patógenos intracelulares. IL-12, citocina produzida principalmente por células dendríticas (DCs) e fagocitos, é uma das citocinas responsáveis pela ativação de uma resposta do tipo T hl, levando à produção de IFN-y e subsequente ativação de macrófagos, que se tornará um ambiente desfavorável para o sobrevivência de agentes invasores. Um exemplo desses microorganismos é o Mycobacterium tuberculosis, um importante patógeno humano causador da tuberculose. O M. tuberculosis induz a produção de IL-12 em células apresentadoras de antígeno profissionais, entretanto, os mecanismos envolvidos na regulação dessa citocina durante o curso da infecção pelo bacilo não são complementamente entendidos. O objetivo geral desse projeto de tese é investigar os mecanismos imunes inatos que controlam a produção de IL-12 em resposta ao M. tuberculosis. A hipótese testada foi que os receptores do tipo Toll (TLR) e as lipoxinas são mediadores centrais da regulação de IL-12 influenciando a resistência/susceptibilidade ao bacilo. Um modelo experimental de infecção pulmonar e um modelo de infecção in vitro foram usados para esse propósito, amundongos deficientes em lVIyD88 se mostraram altamente susceptíveis à infecção via aerosol com M tuberculosis, implicando assim, a sinalização via TLR/IL-IR como um determinante da resposta do hospedeiro contra esse importante patógeno humano. Associado ao aumento de susceptibilidade, pulmões dos animais deficientes em MyD88 infectados com o bacilo apresentaram um significativa redução na indução de IL-12 e células T CD4+ secretoras de IFN-y. Observou-se também, que DCs de camundongos deficientes em MyD88 apresentaram uma falha na produção de IL-12 em resposta ao M. tuberculosis in vitro. Apesar de trabalhos recentes indicarem que M. tuberculosis contêm diversos ligantes como PIMs e DNA, os quais, podem ativar diferentes TLR, animais deficientes em TLR (TLR2, TLR4 ou TLR9) e infectados com micobacteria, exibem apenas leves defeitos imunológicos e na resistência quando comparados com camundongos deficientes em MyD88. Assim, a hipótese de que a colaboração entre mais que um TLR pode ser necessário para gerar um efeito na resistência do hospedeiro foi testada. Observou- se que camundongos duplos KO para TLR2 e TLR9 (TLR2/9 DKO) infectados com M. tuberculosis exibiram um aumento significativo na susceptibilidade à infecção comparada com animais TLR2 KO, TLR9 KO ou controles selvagens. Além disso, foi observada uma falha na produção de IL-12 pelas DCs dos camundongos DKO expostos a M. tuberculosis in vitro. Esses dados sugerem que diversos TLR colaboram na indução da produção de lL-12 e na imunidade contra M. tuberculosis.Meàxaáores anti- infiamatórios podem desempenhar um importante papel no controle de uma excessiva produção de citocinas pró-inflamatórias as quais levariam a dano tecidual, um fator contribuidor para a sobrevivência da micobactéria. Infecção por M tuberculosis induz a produção de lipoxina A4, um eicosanoide anti- infiamatório, dependente de 5-lipoxigenase (LO). Em uma análise paralela por imunofluorescência, a expressão de 5-LO foi detectada em macrófagos e células endoteliais pulmonares seguindo a infecção com o bacilo. Três e seis semanas após a infecção, os camundongos com deleção no gene 5-LO, apresentaram um número de bactérias marcantemente reduzido (10 vezes) nos pulmões comparando com os animais controles. Esse aumento na resistência estava associado a um aumento da produção de IL-12 e IFN-y além de uma diminuição na inflamação pulmonar. Esses dados sugerem que as lipoxinas funcionam como mediadores químicos chaves na resistência à infecção por M tuberculosis e sugerem que a via da 5-LO pode ser um alvo em potencial para intervenção terapêutica em tuberculose. Em sumário, cooperação entre diversos TLR é crítica na resistência a M. tuberculosis através da indução de IL-12, e que leva a uma resposta imune do tipo Thl efetiva. Por outro lado, lipoxinas são importantes mediadores químicos induzidos pelo bacilo que podem servir como mecanismo de escape do hospedeiro.

RESUMO

Innate mechanisms by which Mycobacterium tuberculosis infection regulates lL-12 production.

André Báfica

SUMMARY

The cytokine IL-12 plays a critical role in the induction o f an amazing program o f immune response genes involved in resistance to intracellular pathogens. IL-12, produced mostly by dendritic cells, is one o f the important cytokines responsible to the cell-mediated Th I immunity, leading to the production o f IFN-y and activation o f macrophages, making them into inhospitable habitats for the invader agents’ survival. Such micro-organism is called Mycobacterium tuberculosis, an important human pathogen. M. tuberculosis induces IL-12 production by professional antigen presenting cells, however the mechanisms involved in the regulation o f this cytokine during M. tuberculosis infection is not fully understood. The overall aim o f this thesis is to investigate the innate mechanisms controlling IL-12 synthesis upon M. tuberculosis infection. Specific focus was placed on the role o f Toll-like receptors and lipoxins as central mediators o f IL-12 regulation and resistance/susceptibility to the pathogen. An experimental mouse model o f aerosol infection and a dendritic cell/macrophage model o f in vitro infection were used for this matter. Mice deficient in MyD88, a signaling adaptor protein, were found to be highly susceptible to M. tuberculosis infection, which implies that triggering via TLR/IL-IR family plays a role in the responses against this agent. A significant reduction in IL-12 synthesis as well as % IFN-y+CD4+ T cells was associated with the enhanced susceptibility. In addition, DC from MyD88-/- animals displayed a marked decreased in IL-12 responses when in vitro exposed to the bacterium. Although our data indicate that M. tuberculosis contain several ligands such as PIM, 19 KD-lipoprotein and DNA, which can activate TLR, mice deficient in TLR and infected with mycobacteria, exhibit only minor immunological defects when compared to MyD88-deficient animals. Therefore, a hypothesis that cooperation between multiple TLR is required in generating host resistance was tested. We have observed that M. tuberculosis-'mftcttd double KO (TLR2/9-/-) mice displayed a significant enhanced susceptibility in comparison with wild-type or single TLR KO animals. Moreover, dendritic cells from DKO mice present a marked reduction in IL-12 secretion when exposed to live mycobacteria in vitro. Anti-inflammatory mediators may play an important role in controlling excessive production o f pro-inflammatory cytokine such as IL-12 and tissue damage, which could contribute to the bacilli survival. M. tuberculosis infection induces lipoxin (LX)A4 secretion, an anti-inflammatory eicosanoid, 5-lipoxygenase-dependent pathway. Three and six weeks post-infection, lungs from mice lacking 5-LO displayed ~1 log less bacteria compared to the same tissue from wild-type animals. This increased in resistance was associated with enhanced expression of 11-12 and IFN-y as well as decreased lung inflammation. Importantly, these effects were reversible when 5-LO KO mice were treated with an exogenous lipoxin analog. These data establish lipoxins as key mediators in resistance to M. tuberculosis and suggest 5-LO pathway as a potential target in tuberculosis. In summary, cooperation between TLR is a critical step in resistance to M. tuberculosis through induction of IL-12 as well as other mechanisms, leading to effective Thl responses. Lipoxins are important chemical mediators that may be utilized by the bacilli as a scape mechanism o f host immune responses.

Essa tese é baseada nos seguintes manuscritos,

os quais serão referidos pelos seus numerais romanos.

LISTA DOS ARTIGOS

I. Scanga, C.A., Bafíca, A., Feng, C.G., Cheever, A.W., Hieny, S., and Sher, A.

M yD88 -deficient mice display a profound loss in resistance to M ycobacterium

tubercu losis associated with partially impaired Thl cytokine and nitric oxide

synthase 2 expression. Infect. Immun. 72:2400, 2004.

II. Bafica, A., Scanga, A., Feng, C., Leifer, C., Cheever, A., and Sher, A. TLR9

regulates Thl responses and co-operates with TLPv2 in optimal responses to host

resistance to M ycobacterium tuberculosis. J. Exp. Med. 202:1715, 2005

III. Bafica, A., Scanga, C.A, White, S., Serhan, C., Sher, A., and Aliberti, J. Host

control o f M ycobacterium tubercu losis is regulated by 5-lipoxygenase-

dependent lipoxin production. J. Clinical Invest. 116:1601, 2005.

IV. Aliberti, J. and Bafíca, A. 2005. Anti-inflammatory pathways as a host evasion

mechanism for pathogens. Prostaglandin Leukot. Essent. Fatty Acidj'. 73:233,

2005.

Reconhecimento de Padrões Moleculares pelo Sistema Im une...................................04

Receptores do Tipo Toll e seus ligantes....................................................... 05

Sinalização via TLR........................................................................................ 07

TLR na Defesa do Hospedeiro.................................................................. ....11

Mycobacterium tuberculosis..............................................................................................12

Infecção p o rM tuberculosis..........................................................................13

Resposta Imune contra M tuberculosis....................................................... 13

lL-12........................................................................................................................................18

Fontes deIL -12 ................................................................................................ 18

Regulação da Produção de IL-12.................................................................. 19

Funções Biológicas de IL-12..........................................................................22

Lipoxinas................................................................................................................................ 23

Fontes de Lipoxinas........................................................................................ 23

Funções Biológicas de Lipoxinas.................................................................. 25

Hipótese e Objetivos da Tese....................................................................................................28

Discussão dos resultados obtidos.............................................................................................29

TLR no controle da produção de IL-12 induzido p o rM tuberculosis................29

Lipoxinas no controle da produção de IL-12 induzido porM . tuberculosis.......32

Considerações Finais e Perspectivas.......................................................................................33

Conclusões Gerais......................................................................................................... 35

Referências Bibliográficas......................................................................................................... 36

INDICE

Introdução..................................................................................................................................... 01

INDICE DAS SIGLAS

APC Célula apresentadora de antígeno

DC Célula dendrítica

IFN Interferon

IkB Inibidor de kB

IKK IkB cinase

IL Interleucina

IRAK Cinase associada ao receptor de IL-1

IRF Fator regulador de IFN

JAK Cinase Janus

LPS Lipopolissacarídeo

LX Lipoxina

MAMP Padrão molecular associado ao patógeno

MAPK Proteína cinase ativada por mitogéno

MHC Complexo principal de histocompatibilidade

MyD88 Fator de diferenciação mielóide 88

NF-kB Fator nuclear k B

NK Matadora natural

NO Óxido nítrico

PRR Receptor de reconhecimento de padrões

R Receptor

STAT Ativador de trasncrição è transdutor de sinal

TCR Receptor de célula T

TICAM Molécula adaptadora contendo TIR

TIR Domínio Toll/IL-IR

TIRAP Proteína adaptadora contendo TIR

TLR Receptor do tipo Toll

INF Fator de necrose tumoral

TRAF Fator associado ao receptor de TNF

TRAM Molécula adaptadora relacionada a TRIF

TRIF Adaptador contendo TIR indutor de IFN-P

TB Tuberculose

Os patógenos são microorganismos altamente especializados em viver às custas

do hospedeiro mamífero, sendo que ainda hoje, as infecções persistem como umas das

principais causas de morte no mundo. Por outro lado, para se proteger desses complexos

agentes, o hospedeiro apresenta células dedicadas à defesa: as células do sistema imune.

Com o intuito de manter um ambiente livre de doença, o sistema imune deve primeiro

reconhecer o invasor, em seguida montar uma resposta apropriada, multi-regulada e

integrada, que terá como consequência a eliminação ou o controle do crescimento do

patógeno. Entretanto, a maioria dos agentes infecciosos lança mão de uma série de

mecanismos com a finalidade de escapar do sistema de reconhecimento, por vezes até

utilizando mediadores produzidos pelo próprio hospedeiro em prol de sua sobrevivência.

O sistema imune inato é um componente evolutivamente conservado do sistema

de defesa do hospedeiro, presente em plantas e animais (HOFFMAN et al., 1999).

Durante a infecção primária, as repostas pré-determinadas (fixas) são as primeiras que

entram em cena. Essas respostas são compostas não só pelas células da imunidade inata

mas também pela ação das barreiras epiteliais que servem de proteção física, mecânica,

química e microbiológica, além da ação das vias de ativação de complemento

independentes de anticorpos. Em mamíferos, o componente celular da imunidade inata

consiste de células mielóides e linfóides apresentando receptores de especificidades pré-

determinadas (do inglês, germ line-encoded receptors): células fagocíticas (granulócitos,

monócitos/macrófagos e células dendríticas [DCs]), linfócitos sem especificidades dos

rearranjos genéticos dos receptores: células matadoras naturais (do inglês Natural Killer

INTRODUÇÃO

cells [NK]) e linfócitos que apresentam uma baixa especificidade de rearranjos genéticos

dos receptores: células T y:5 e células B CD5+ (B-1). Essas células respondem

rapidamente à infecção, servindo como a primeira linha de defesa para prevenir o

estabelecimento dos patógenos no hospedeiro. Muitas vezes, os agentes invasores

conseguem escapar da imunidade inata, porém as respostas “tardias” , entretanto,

específicas e clonáis do sistema imune adaptativo são requiridas para controlar o

crescimento do patógeno, frequentemente levando à eliminação do parasita e ao

desenvolvimento de memória à uma possível re-infecção. As células do sistema imune

adaptativo são linfócitos que apresentam receptores rearranjados somáticos com

especificidades geradas randomicamente e são clonalmente distribuídas nas células

individuais. Essas são as células T educadas no timo que expressam a : 3 TCRs e os co-

receptores CD4 ou CD8 e as células CD5- (B-2) células B que produzem anticorpos.

Uma gama de sinais são importantes para alertar o hospedeiro sobre patógenos

infectantes e para a ativação específica dos linfócitos. O sistema imune inato, que medeia

o reconhecimento dos agentes invasores através dos seus receptores germ line-encoded,

provê os dois sinais, desempenhando assim, um papel central na iniciação das respostas

imunes. De um lado, isso é mediado pela indução de citocinas pro-inflamatórias e

quimicionas (isto é, inflamação) e do outro lado, através da apresentação de antígenos e

indução de moléculas co-estimulátorias (isto é, ativação da imunidade adaptativa). As

citocinas são fundamentais na iniciação das respostas contra os patógenos intracelulares e

indução de uma resposta linfocitária efetiva. Nesse interim, é importante destacar a IL-

12 , que é um dos principais mediadores do arsenal imunológico produzido durante uma

resposta imune.

o bojo dessa tese destaca as diferentes vias de regulação da IL-12, e sua

importância na resistência à infecção intracelular. Os artigos reportados aqui focam na

resposta imune contra um dos principais patógenos humanos: Mycobacterium

tuberculosis, o agente causador da tuberculose que mata cerca de 2 milhões de pessoas

por ano no mundo (THE WORLD HEALTH REPORT, 2004). O entendimento da

regulação da resistência ao M. tuberculosis é uma passo importante para o

desenvovimento de estratégias vacinais assim como terapêuticas contra a tuberculose.

Além disso, comprender os diferentes aspectos da biologia do bacilo pode ser usado na

erradicação do M. tuberculosis e outras micobactérias.

0 reconhecimento imune inato é especializado em mediar as interações entre

produtos dos diferentes microrganismos e do hospedeiro. Uma pressão evolutiva tem

levado a um efetivo reconhecimento de estruturas que são essenciais para a sobrevivência

do micróbio, assim, uma tentativa de variar essas estruturas para escapar do

reconhecimento imune pode ser letal ou muito desvantajoso para a sobrevivência ou

crescimento do agente invasor. Essas estruturas são chamadas de padrões moleculares

associados aos micróbios (do inglês, m icrob ia l-associa ted m olecular p a tte rn s [MAMPs])

e são compartilhados por diversos grupos de microrganimos. Os MAMPs são

reconhecidos por um número relativamente limitado de receptores germ lin e-en coded

presentes na células da imunidade inata como DCs e macrófagos (mas também em

células epiteliais e endoteliais) chamados receptores de reconhecimento dos padrões

moleculares (do inglês, pa ttern -recogn ition recep tors [PRRs]. Existem várias famílias de

PRR que podem estar expressos na superfície celular ou em compartimentos

.intracelulares. As diferentes famílias incluem lectinas do íipo C, proteínas que contêm

domínios ricos em Leucina (Leucine-rich repea t [LRR]), receptores do tipo scavenger,

pentraxinas, transferases lipídicas e integrinas (MEDZHITOV AND JANEWAY, 1997).

Reconhecimento de PAMP frequentemente leva à indução direta de funções efetoras

como opsonização, ativação da via complemento, fagocitose e apoptose (MEDZHITOV

AND JANEWAY, 1997a; MEDZHITOV AND JANEWAY, 1997b), além da ativação

das vias sinalizadoras pró-infiamatórias, discutidas abaixo.

RECONHECIMENTO MOLECULAR PELO SISTEMA IMUNE

Receptores do tipo Toll (do inglés, Toll-like receptors [TLR]) constituem uma

família relacionada de PRR transmembranários presentes em mamíferos que respondem a

urna vasta diversidade de produtos microbianos (MEDZHITOV AND JANEWAY, 2002;

AKIRA et al., 2001; TAKEDA et al., 2003). Os TLR são estruturalmente caracterizados

por um dominio extracelular LRR e um dominio citoplasmático chamado Toll/ILIR

(TIR) (TAKEDA et al., 2003; O ’NEILL, 2002). Os dominios TIR estão também

envolvidos na sinalização dos receptores para IL-1 e IL-18, que compartilham muitas

similaridades com os TLR (O ’NEILL, 2002). Os domínios TIR também participam na

defesa de plantas, sugerindo que eles podem ter sido um dos primeiros domínios

envolvidos na defesa do hospedeiro (O ’NEILL, 2000). Não está claro se todos os TLR se

ligam com os seus MAMPs particulares, entretanto, uma característica especial desses

PRRs é sua função como receptores sinalizadores. Os TLR medeiam os eventos da

transdução de sinal que levam a produção de respostas inflamatórias, como a produção de

citocinas pro-inflamatórias, • quimiocinas e expressão de moléculas co-estimulatórias.

Assim, os TLR são considerados os principais PRR envolvidos na ativação da imunidade

inata e iniciação da resposta imune adaptativa.

No presente momento, a familia dos TLR contêm 13 receptores identificados em

mamíferos e diversos produtos já foram descritos como sendo ligantes de TLR

específicos (BARTON AND MEDZHITOV, 2002) (Figura 1). O TLR2 reconhece uma

classe variada de MAMPs, que incluem peptideoglicanos de bactéria (ALIPRANTS et

al., 1999; BRIGHBILL et al., 1999), parede celular de fungo (UNDERHILL et al., 1999),

Receptores do tipo Toll e seus ligantes

âncoras de glicosilfosfatidilinosotol de Trypanosoma cruzi (CAMPOS et al., 2001),

lipoarabinomanose de micobactéria (MEANS et al., 1999; UNDERHILL et al, 1999) e a

lipoproteína 19-KD de M tuberculosis (KIRSCHING AND SCHUMANN, 2002). Essa

capacidade do TLR2 em reconhecer diferentes classes de ligantes se baseia no fato de que

esse TLR pode formar dímeros com o TLRl ou TLR6. A dimerização com TLRl ou

TLR6 permite que TLR2 discrimine entre lipoproteínas di- ou tri-acetiladas (AKIRA et

al., 2001; KIRSCHING AND SCHUMANN, 2002).

Figura 1. A familia Toll-like receptor/IL-1 receptor

o TLR3 está situado em compartimentos intracelulares e reconhece RNA de fita

dupla (dsRNA) e dsRNA sintéticos como o ácido poli-inosínico-poli-citidílico [poly(I;C)]

(ALEXOPOULOU et al., 2001). O TLR4 reconhece lipopolisacarídeo (LPS) de bactérias

Gram-negativas como a Escherichia coli (ULEVITCH AND TOBIAS, 1999); O TLR5

reconhece uma proteína: a flagelina (HAYASHI et al., 2001). Flagelina é um

componente do flagelo que pode ser encontrado em bactérias Gram-positivas e negativas.

TLR7 e TLR8 reconhecem ácidos nucléicos (HEMMI et al., 2002; DIEBOLD et a l,

2004). O TLR9 foi descrito como o receptor de dominios CpG não-metilados (HEMMI

et al., 2000), que são infrequentes em DNA de vetebrados porém muito comuns em DNA

bacteriano. Recentemente, foi demonstrado que o DNA purificado de M tuberculosis ou

BCG (manuscrito II) ou de T. cruzi (BAFICA et al., dados não publicados) ativam TLR9

e induzem uma resposta inflamatoria em células apresentadoras de antigeno. Até o

presente momento, ligantes para TLRIO não foram descritos. T L R ll, um receptor

presente em camundongos mas não no homem, reconhece uma proteina semelhante a

profilina presente em Toxoplasma gondii (YAROVINSKY et al., 2005).

Sinalização via TLR

A ativação dos TLR por produtos dos agentes invasores leva á indução de uma

série de genes que agem ñas respostas inflamatorias e imunes. A indução gênica ativada

pelos TLR é mediada por vários fatores de transcrição incluindo o NF-kB e a familia das

MAPKinascs. Os fatores de transcrição NF-kB incluem as proteínas p50, p52, p65/RelA,

RelB e c-Rel e são reguladores chaves das respostas imunes (CAAMANO et al., 2002).

Esses fatores de transcrição apresentam um domínio de homología Rei, o qual contem

uma sequência de localização nuclear e está envolvido na ligação com DNA, dímerização

com outras proteínas Re! e interações com a família de inibidores de NF-kB (IkB). Em

células não estimuladas, esses fatores são encontrados como homo ou hetero-dímeros

(primariamente a combinação p50/p65). A família Ik B inclue ÍK B -a (o principal ator)

bem como Ik-B-P, IkB - s e Bcl-3. Essas moléculas estão associadas com dimeros NF-kB

e são conservados no citoplasma. Após estimulação, IkB se toma fosforilado (Serina 32 e

36 para o iK B -a ) que então será ubiquitinado e degradado (KARIN AND BEN-NERIAH,

2000). Isso faz com os dimeros NF-kB, agora livres, sejam translocados do citosol para o

núcleo, onde se ligarão a sítios kB nos genes alvos que medeiam transcrição. Várias

proteínas tem sido implicadas na fosforilação de IkB, ou seja, ativar NF-kB, porém a

clássica unidade fosforiladora IkB é composta do complexo IkB cíñase (líCK),

constituído de IK K -a, IKK-P e uma terceira subunidade regulatória, chamado IKK-y ou

NEMO.

Após reconhecimento de MAMPs, o domínio TIR de todos os TLR interagem

com o domínio TIR presente no fator mielóíde de diferenciação 88 (do inglês, myeloid

differentiation fa c to r [MyD]88 ). Essa molécula adaptadora citossólica inicia uma cascata

de sinalização que, subsequentemente, leva à translocação nuclear do NF-kB. Esses

mesmos passos de sinalização fazem parte também da ativação do receptores de IL-1 ou

IL-18. Via seu domínio de morte (do inglês, death domain [DD]), M yD88 recruta a

cíñase associada ao IL -IR (do inglês, IL-lR -associated kinase [1RAK])-1 e IRAK-2 (ou

em células míelóides, IRAK-M) para a cauda citoplasmátíca do receptor. A importância

de M yD88 no recrutamento de lRAK-1 é confirmado em camundongos MyD88-/-, que

apresentam deficiência na ativação de NF-kB após estimulação com IL-1, IL-18 ou LPS

(ADACHI et al., 1998). Células de animais IRAKI-/- apresentam respostas diminuidas

quando estimulados com IL-1, IL-18 e LPS (THOMAS et a l, 1999; SWANTEK et a l,

2000). No entanto, essa falha não é completa em resposta à estimulação dos TLR e um

membro recentemente descrito da família IRAK, o IRAK4, foi demonstrado como um

componente necessário na resposta mediada por IL-1, TLR2, TLR3, TLR4 e TLR9

(SUZUKI et al., 2002) e para a ativação de IRAK-1 (LI et al., 2002), tomando-o o

membro IRAK mais proximal ao domínio TIR.

Após o recrutamento de IRAK, o fator associado ao receptor do TNF (do inglês,

tum or necrosis fac tor recep tor-assoc ia ted fa c to r [TRAF]6) é fosforilado e

consequemente leva à ativação de IKK-P, degradação de IkB, translocação de NF-kB e

indução de genes alvos envolvidos na defesa do hospedeiro. Esses incluem a expressão

de citocinas pró-inflamatórias como IL-I2, IL-1, IL-6 e TNF, quimiocinas, IFN-P, oxido

nítrico sintetase induzível (do inglês, nitric oxide sinthase II [NOSII]) além de moléculas

co-estimulatórias (GHOSH et al., 1998).

A sinalização downstrearíi de TRAF6 também leva à ativação da cascata dos

membros da família proteína cíñase ativada por mitógenos (do inglês, m itogen -activa ted

p ro te in kinase [MAPK]) (WANG et al., 2001). Essa é uma sequência complexa de

eventos, envolvendo múltiplos passos no citossol das células levando à ativação das

MAPK que podem se translocar para o núcleo e regular expressão gênica. As duas

MAPK mais importantes são a p38 e a cíñase N-tenninal c-Jun (do inglês, c~Jun N-

term inal K inase [JNK]). Essas moléculas estão envolvidas primariamente na proliferação

e diferenciação celulares, porém apresentam importantes funções na inflamação.

Aiém das vias dependentes de MyD88 , os mecanismos de sinalização

independentes de M yD88 também são de grande importância nas respostas do

hospedeiro. Foi demonstrado que camundongos deficientes em M yD8 8 , apresentam

algumas respostas intactas (ex. indução de IFN tipo I) quando ativados via TLR3 ou

TLR4 sugerindo a presença de moléculas adaptadoras que medeiam esses sinais

(KAWAI et al., 1999). Atualmente, são reconhecidos 4 outros adaptadores: TIR-

containing adaptor protein (TIRAP/Mal), TIR-domain-containing adaptor (TRIP), TRIF-

related adaptar molecule (TRAM) e Sterile a and Armadillo m o tif (SARM) (O ’NEILL at

al., 2003). Dentre eles, TRIP foi a molécula adaptadora mais bem estudada até o presente

momento. Os camundongos deficientes nessa proteína apresentam defeitos na expressão

de moléculas co-estimulatórias e genes induzidos via o fator regulador de interferon

{interferon regulator fa c to r [IRF]-3) quando estimulados com ligantes que ativam TLR3

ou TLR4 (YAMAMOTO et al., 2002; OSHIUMI et al., YAMAMOTO et al., 2003;

HOEBE et al., 2003). Ainda não está claro porque células de camudongos deficientes em

TRIP apresentam uma expressão reduzida de citocinas proinflamatórias quando

estimulados com LPS, já que este é considerado um efeito dependente de M yD88 . Um

outro adaptador chamado de TRIF-related adaptor molecule (TRAM) foi recentemente

descrito e sabe-se que o mesmo atua em conjunto com TRIF na ativação específica de

lRF-3 e NF-kB (FITZGERALD et al., 2003) sugerindo que TRIF/TRAM funcionam em

conjunto com M yD 88 para a a expressão de citocinas pró-infiamatórias.

10

Os TLR desempenham um papel crucial na resistência inata e iniciação da

imunidade adaptativa a patógenos. Animais deficientes em M yD88 se mostraram

altamente susceptíveis a vários agentes infecciosos, dentre eles, parasitas e bactérias. Por

exemplo, camundongos M yD88-/- infectados com T. gondii ou T. cruzi apresentaram

uma mortalidade aumentada associada a uma produção defeituosa de IL-12 sugerindo um

importante papel para sinalização dos TLR no controle desses protozoários. No entanto, o

TLR responsável pela indução de IL-12 em ambos modelos in vivo não foi descrito. No

caso de T. gondii, TLR 11 foi descrito como receptor de uma molécula encontrada no

extrato solúvel do parasita (profilina), porém camundongos T L R ll-/- infectados com T.

gondii não apresentam o mesmo grau de susceptibilidade dos camundongos deficientes

em M yD88 (YAROVINSKY et al., 2005). Por outro lado, no caso do T. cruzi, uma

colaboração entre dois TLR (TLR2 e TLR9) é necessária para respostas imunes ótimas

contra esse parasita (BAFICA et al., dados não publicados). Em outros modelos

experimentais com bactérias intrecelulares como na infecção com M , tuberculosis, foi

demonstrado que camundongos MyD88 -/- são susceptíveis a esse agente, apresentando

uma sobrevivência reduzida e um maior acúmulo de bactérias nos orgãos (manuscrito I).

Em contraste, quando camudongos deficientes em TLR2, TLR4 ou TLR6 foram

infectados com micobactéria, nao se observou o mesmo fenotipo. Esses dados sugerem

que TLR ou outros membros da família IL-IR ou IL-18R podem estar agindo

conjuntamente para conferir resistência a agentes infecciosos, em particular M.

tuberculosis. Apesar das evidências recentes sugerirem que múltiplos TLR são requeridos

TLR na defesa do hospedeiro

11

para a resistência inata contra patógenos intracelulares, não está claro como os TLR

orquestram seus sinais para gerar uma resposta protetora. Foi determinado na presente

tese quais TLR podem estar envolvidos na resposta imune contra M. tuberculosis in vitro

e in vivo (manuscrito II).

M YCO B ATE R IU M TUBERCULOSIS

M ycobacterium tuberculosis é um bacilo facultativo intracelular, de lento

crescimento e é caracterizado por uma complexa parede celular rica em lipídios que

promovem uma proteção parcial para as ações antibacterianas de macrófagos além de

bloquear a entrada de diversas drogas. O complexo M. tuberculosis é composto de M.

tuberculosis, M. bovis, M. africanum e M. microti.

M. tuberculosis contêm vários produtos incluindo lipoarabinomanam,

lipoproteina de 19 Kda, fosfatidil-inositol-fosfato (PIM), que são capazes de induzir uma

resposta inflamatoria em células do sistema imune inato do hospedeiro. Esses ligantes

foram descritos como ativadores de TLR2 (ALIPRANTS et al., 1999; BRIGHBILL et al.,

1999 UNDERHILL et al., 1999) ou TLR4 (ABEL et al., 2002). Como denotado acima,

DNA de micobactéria foi recentemente descrito como um ligante de TLR9 (manuscrito

II), sugerindo que a atividade imuno-estimulatória do DNA pode estar ligada a ativação

da resposta imune inata e reconhecimento de invasão do agente.

12

A tuberculose (TB) é uma doença primariamente pulmonar. Recém-nascidos

podem desenvolver uma doença grave e progressiva enquanto indivíduos

imunocompetentes desenvolvem a doença a partir da reativação de um foco bacilar que

persistiu após a infecção primária. A TB é conhecida como uma doença da antiguidade

(DANIEL et al., 1994) e está entre as doenças infecciosas que mais matam no mundo,

representando 25% de todas as causas preveniveis de morte (SNIDER et al., 1994) e foi

declarada como uma emergência global pela Organização Mundial de Saúde (THE

WORLD HEALTH REPORT, 2004). Estima-se que um terço da população mundial está

infectada pelo M. tuberculosis (THE WORLD HEALTH REPORT, 2004), porém apenas

10% desses indivíduos desenvolverão uma doença ativa durante a vida (COMSTOCK,

1992). A TB foi previamente associada à má-nutrição e pobreza nos países em

desenvolvimento, entretanto, casos da doença aumentaram em países desenvolvidos

devido principalmente à co-infecção com o vírus da imunodeficiência humana (HIV) e o

aumento de cepas de M. tuberculosis multi-droga-resistentes (SNIDER et al., 1994).

Resposta imune contra raicobactéria

A principal resposta imune protetora contra bactérias intracelulares como o M.

tuberculosis é a imunidade mediada por células (SCHAIBLE et al., 1999). A produção da

interleucina (ÍL)-12 por células apresentadoras de antígeno (ÁPC) como as DCs, é

essencial para a geração de respostas T do tipo Thl (COOPER et al. 1995; COOPER et

Infecção por M. tuberculosis

13

al. 1997). A importância fundamental da IL-12 na imunidade contra micobactérias é

indicada através de modelos experimentais, os quais mostraram que camundongos

deficientes nessa citocina são altamente susceptíveis à infecção com o bacilo e estudos

clínicos, os quais demonstraram que pacientes apresentando uma mutação no receptor de

IL-12 são propensos a desenvolver micobacterioses atípicas. A IL-12 induz a produção

de interferon (IFN)-y pelas células T ativadas que estimula os macrófaôs a produzir

espécies reativas de oxigênio e enzimas que matam a bactéria fagocitada (FENTON et

a l , 1997; FLESCH AND KAUFMANN, 1987; ROOK et al., 1986). Segue abaixo, um

breve resumo dos principáis tipos celulares envolvidos na resposta imune contra o M.

tuberculosis.

Células D endríticas. A capacidade impar das DCs de fagocitar agentes invasores no sitio

de infecção e ativar células T naive nos orgãos linfóides locais sugere que esse tipo

celular é um p iv o t na geração da imunidade protetora contra os patógenos (REIS E

SOUSA et al., 1996). A fagocitose de micobactéria induz a maturação e a migração de

• DCs. Isso é caracterizado pelo aumento dos níveis d e -expressão das moléculas co-

estimulátorias B7-1 e B7-2, CD40 e moléculas do complexo de principal de

histocompatibilidade (MMC) classe I e II (DEMANGEL et al., 1999; HENDERSON et

al., 1997; TASCON et al., 2000). Além disso, a infeçcão micobacteriana de DC induz a

urna aumento na produção de IL-12 e outras citocinas (DEMANGEL et al., 1999;

HENDEFvSON et al., 1997). Além disso, a DC infectada expressa quimiocinas

inflamatorias como MCP-3 e M lP -la (DEMANGEL et al., 1999). Essas citocinas e

quimiocinas são importantes na geração de uma imunidade do tipo Tlil (principalmente

14

IL-12) e desenvolvimento de granulomas (principalmente TNF) durante a infecção por

M. tuberculosis (COOPER AND FLYNN, 1995; ORME AND COOPER, 1999). A

importância das DCs na resposta imune contra M. tuberculosis tem sido demonstrado in

vivo. Por exemplo, foi observado que camundongos depletados de DCs são mais

susceptíveis à infecção por M. tuberculosis e apresentam um retardo na geração de

respostas do tipo Thl (TIAN et al, 2005). Esses dados sugerem que DCs desempenham

um papel importante na indução de respostas imunes anti-micobacterianas.

M acrófagos. Pouco menos que 10% dos bacilos inalados são capazes de chegar na

periferia dos pulmões onde serão fagocitados por macrófagos alveolares. Entre os

receptores que medeiam a fagocitose estão o receptor Fc, o complemento e o receptor

para manóse (FENTON AND VERMEULEN, 1996). No modelo murino, a morte dos

bacilos induzida por macrófagos ativados como uma consequência da ajuda de células T

já é bem documentada (CHAN et al., 1995; CHAN et al., 1992; O'BRIEN et al., 1996).

Macrófagos ativados produzem radicais livres de oxigênio e nitrogênio que podem

induzir a morte dos organismos (CHAN et al., 1995; CHAN et al., 1992; O'BRIEN et al.,

1996). Entretanto, não existem evidências conclusivas que monócitos humanos possam

matar os bacilos in vitro por mecanismos similares (ASTON et al., 1998; BERMUDEZ,

1993; DENIS, 1991; NOZAKI et al., 1997). Além da eliminação direta da micobactéria,

macrófagos ativados possuem a capacidade de apresentar antigenos de M. tuberculosis

para células T e produzir citocinas como IL-1, IL-6, TFN e IL-12 (WANG et al., 1997;

BARNES et al., 1993), as quais promovem uma resposta inflamatória local ã infecção.

Entretanto, alguns produtos de macrófagos ativados podem suprimir a resposta imune

15

pulmonar. Por exemplo, após a fagocitose do bacilo ou exposição a produtos

micobacterianos, essas células produzem aumentadas quantidades de IL-10 (ROACH et

a l , 1999) e TGF-P (DAHL et al., 1996; TOOSSI et al., 1995), que foram demonstrados

como fatores inibitórios da proliferação linfocitária e produção de IFN-y (KIRSCH et al.,

1996).

Linfócitos T CD4+ e CD8+. As células T CD4+ e CD8+ respondem a peptideos

micobaterianos processados a partir do bacilo internalizado e apresentados no contexto

das moléculas de MHC classe II ou classe I, respectivamente. Após reconhecimento do

MHCIl+Ag cognato, a interação entre CD40 e CD40L, e a resposta à IL-12, as células T

CD4+ se tomarão predominantemente do tipo T hl, caracterizado por uma expansão dos

linfócitos ativados e de memória produtores de IFN-y (BARNES et al., 1989). As células

T CD4+ são fundamentais no controle de M. tuberculosis, pois camundongos depletados

de linfócitos T CD4+, deficientes em CD4 ou em MHCII, são altamente susceptíveis e

não sobrevivem à infecção pelo bacilo (MULLER et al., 1987; PEDRAZZINI et al.,

1987; CARUSO et al., 1999; LADEL et al., 1995). Além disso, uma deficiência de T

CD4+ observada em humanos, como descrito na infecção pelo HIV, leva pacientes

susceptíveis a TB primário ou reativação do foco (BARNES et al., 1991). Estudos

diversos têm demonstrado que os linfócitos CD8+ também desempenham um papel

importante em modelos murinos e em pacientes com tuberculose. Por exemplo, quando

cepas diferentes de camundongos deficientes em CD8 foram infectados com M.

tuberculosis, observou-se uma necrose massiva nos pulmões e consequente morte dos

animais, sugerindo que as células CD8+ são importantes na proteção contra a

16

micobactéria nos pulmões (FLYNN et al., 1992; BEHAR et al., 1999; D'SOUZA AND

IVANYI, 1993). Além disso, os estudos realizados em células humanas sugerem que os

linfócitos CD 8+ são também importantes para a manutenção da imunidade contra a

infecção por M. tuberculosis (BOTHAMLEY et al., 1992; CANADAY et al., 1999).

Resposta granulom atosa pulm onar. Urna resposta granulomatosa apropriada é essencial

para que o hospedeiro contenha a replicação da micobactéria (KAUFMANN AND

LADEL, 1994). A formação do granuloma é a resposta tecidual característica na infecção

micobacteriana. O centro do granuloma é tipicamente composto de macrófagos

(infectados ou não) circundados por um anel de linfócitos. Por vezes se encontram debris

celulares no centro, com a presença de bacterias vivas, a chamada necrose caseosa.

Infiltração de macrófagos e linfócitos nos granulomas é crucial para a resistência a

infecção em humanos (SAUNDERS et al., 2000; RANDHAWA et al., 1990) e

camundongos (ORME AND COOPER, 1995; ULRICHS AND KAUFMANN, 2006;

GORDON et al. 1994). Além disso, as citocinas como o TNF são essenciais para a

geração de granulomas (ORME AND COOPER, 1995). Em camundongos deficientes em

IL-12 (COOPER et al., 1997), IFN-y (COOPER et al., 1993; FLYNN et a l, 1993) ou

TNF (BEAN et al., 1999), os granulomas apresentam-se mal-formados ou

desestruturados. Essa inabilidade de formar granulomas apropriados leva a uma

replicação progressiva de micobactéria virulenta e morte dos animais. Esses dados

sugerem que a resposta granulomatosa deve ser finamente regulada para a contenção do

organismo intracelular.

17

o entendimento dos mecanismos inatos envolvidos no controle da infecção por

M. tuberculosis é importante para o desenvolvimento de estratégias terapêuticas contra a

doença.

INTERLEUCINA-12

Fontes de IL-12

A IL-12 foi primeiramente identificada como sendo um produto de células B de

linhagem transformadas pelo virus Epstein-Barr que ativava células NK além de induzir

IFN-y e proliferação de linfócitos T (KOBAYASHI et al., 1989). DCs e fagocitos

(monócito/macrógafo e neutrófilos) são as principais fontes fisiológicas de IL-12

(D'ANDREA et al., 1992; MACATONIA et al., 1995). A IL-12 é composta de um

heterodimero formado por uma cadeia leve de 35-Kda (conhecida como p35 ou IL-12a) e

urna cadeia pesada de 40-Kda (conhecida como p40 ou IL-12p). p35 apresenta

homología com outras citocinas de cadeias simples, porém p40 tem homología com o

dominio extra-celular dos membros da familia de receptores das citocinas

hematopoiéticas (MERBEG et al., 1992). A estrutura incomum da IL-12 pode ter se

desenvolvido da citocina primordial da familia da IL-6 e um dos seus receptores. IL-23 e

IL-27 são duas citocinas relacionadas a IL-12 que foram recentemente identificadas

(OPPMANN et al., 2000; PFLANZ et al., 2002), sugerindo que IL-12 é um prototipo de

uma pequena familia de citocinas heterodiméricas.

18

o receptor de lL-12 é composto de duas cadeias - IL-12RB1 e IL-12RB2 - que

ativa Janus Kinase (JAK)-STAT {signal trasnducer and activator o f transcription)

(PRESKY et al., 1996). STAT4 é o principal fator de transcrição responsável pelos

efeitos celulares specífícos da IL-12, como indicado pelo fato de que camundongos

deficientes em STAT4 tem um fenotipo idéntico ao fenotipo de animais deficientes em

IL-12p40 (THIERFELDER et al., 1996; KAPLAN et al., 1996). O receptor de IL-12 está

expresso principalmente em linfócitos T ativados e células NK.

Regulação da produção de IL-12

IL-12 é conhecido como o principal produto de células inflamatorias ativadas

(monócitos, macrófagos, neutrófílos, microglia e DCs). A habilidade das DCs produzirem

IL-12 durante interações com linfócitos T e induzir respostas Thl foi primeiramente

demonstrado in vitro (MACATONIA et al., 1995). Logo após, foi demonstrado in vivo

que DCs do subtipo CD8a+, e não macrófagos, são as primeiras células a sintetizar IL-12

em baços de camundongos injetados com um extrato solúvel de Toxoplasma gondii ou

lipopolissacarídeo (LPS) (REIS E SOUSA et al., 1997). Essa primeira produção de IL-12

ocorre independentemente de IFN-y ou sinais provenientes de células T (GAZZINELLI

et al., 1994; SCHARTON-KERSTEN et al., 1996), apesar da síntese do heterodimero de

IL-12 ser facilitado pela estimulação via CD40L (SCHULZ et al., 2000). Outros

estímulos microbianos como Brucella abortus ou oligos DNA contendo CpG são capazes

de induzir a produção de lL-12 a partir de DCs dos subtipos CD8a + e CD8a-. As

subpopulações de DCs produtoras de IL-12 após a infecção por M. tuberculosis não

19

foram bem caracterizadas. Entretanto, experimentos preliminares mostraram que as duas

populações de DCs (CD8a + e CD8a-) produzem IL-12 após infecção in vitro com a M.

tuberculosis (A. Bafica e A. Rothfuchs, dados não publicados).

Produtos provenientes de microrganismos incluindo bactérias, parasitas

intracelulares, fungos, RNA de dupla fita, oligos DNA contendo CpG são potentes

indutores de IL-12 por DCs, macrófagos e neutrófílos (MA AND TRINCHIERI, 2001).

A eficiência relativa dos diversos indutores dessa citocina depende da expressão

diferencial dos TLR nos vários subtipos de DCs e fagocitos (JARROSSAY et al., 2001;

KADOWAKl et al., 2001). Entretanto, em fagocitos, agonistas de TLR sozinhos não são

capazes de estimular o heterodímero de IL-12 e eles produzem baixos níveis de p40,

porém citocinas como IFN-y e IL-4 podem aumentar a capacidade dessas células de

produzirem IL-12p70 (HAYES et al., 1998; MA et al., 1996). As células T também são

capazes de induzir IL-12 por DCs e fagocitos, e isso pode ser feito via a produção de

citocinas como IFN-y e interações celulares com membros da família do TNF; o exemplo

mais comum é a interação entre CD40L nos linfócitos T ativados e CD40 na superfície

das DCs e fagócitos. Outras citocinas como IFNs do tipo I induzem 'a secreção de altos

níveis de p35 por DCs, sendo uma alça de alimentação positiva na produção de IL-12p70

já que reconhecimento via TLR-MyD88 induz principalmente a produção de p40

(GAUTIER et al., 2005).

Regulação negativa. IL-10, uma citocina crucial no balanço entre a resposta efetiva

contra patógenos e inflamação sistêmica detrimental, é um potente inibidor da síntese de

IL-12 através do bloqueio na trancrição de ambos p35 e p40 (ASTE-AMEZAGA et al.,

20

1998; D'ANDREA et al., 1993). Outras citocinas como TGF-p foram demonstrados como

inibidores de IL-12 (TRINCHIERI et al., 2003). Além de citocinas, outros mediadores

como as lipoxinas tem a capacidade de inibir a produção de IL-12 por DCs in vivo e in

vitro (ALIBERTI et a l , 2002).

Regulação transcripcional de p40 e p35. O promotor do gene de p40 foi estudado em

maior detalhe que a região promotora do gene de p35. Após estimulação com LPS em

macrófagos, o nucleossomo 1 sofre remodelamento o qual permite o acesso do fator de

transcrição C/EBP (Figura 2). Entretanto, apenas o remodelamento do nucleosomo não é

suficiente para a transcrição do gene que codifica p40, o qual contem vários outros

elementos que são funcionalmente importante para a expressão induzida de p40 (Figura

2) (TRINCHIERI et al., 2003).

Figura 2. Regulação transcricional do gene que codifica IL-12p40

2 7

As regiões promotoras do gene que codifica p35 foram clonadas tanto em

camundongos quanto em humanos (HAYES et al., 1998; TONE et al., 1996;

YOSHIMOTO et al., 1996) e contêm regiões que se ligam aos fatores de transcrição Spl,

IFN-y response element (IRF), PU.l e C/EBP (TRINCHIERl et a l , 2003). A transcrição

de p35 parece ser iniciada em pelo menos dois sitios em humanos e 4 sitios em

camundongos sendo que o gene é regulado por mecanismos transducionais (HAYES et

al., 1998; YOSHIMOTO et al., 1996; BABIK et at., 1999). A presença de múltiplos sitios

iniciadores da transcrição sugere diferentes usos dos promotores em diversos tipos

celulares.

Funções Biológicas da IL-12

IFN-y induzido por IL-12 medeia muitas das ações pro-inflamatórias de IL-12,

apesar de sua capacidade de favorecer o estabelecimento de uma resposta Thl

exemplificar sua função com citocina regulatória que liga a resistência inata e a

imunidade adaptativa. Foi demonstrado que a IL-12 apresenta um papel importante na

resposta Thl em modelos experimentais de auto-imunidade e em infecções,

particularmente por parasitas e bactérias intracelulares (revisto em TRINCHIERl et al.,

1998). A IL-12 induz linfócitos T e células NK a produzirem várias citocinas incluindo

GM-CSF e TNF, além de ser eficiente na indução de IFN-y por essas células. A

importância da IL-12 como um indutor de IFN-y é sustentada não só pelo fato da sua alta

eficiência em baixas concentrações, mas também pela sua capacidade de sinergizar com

22

vários estímulos ativadores como IL-2, interações TCR-CD3 e ativação do receptor

CD28 na indução de altos níveis de IFN-y (CHAN et a l, 1992).

Como denotado acima, a IL-12 é um mediador crítico em infecções por

microrganismos intracelulares como M. tuberculosis. Dados provenientes de modelos

experimentais e estudos genéticos em humanos indicam que essa citocina apresenta um

papel importante no desenvolvimento de respostas efetivas em infecções micobacterianas

(COOPER et al., 1997; ALTARE et al., 1998). Além disso, a IL-12 foi demonstrada

como sendo um fator crucial na infecção por M. tuberculosis in vivo (COOPER et al.,

1997). Recentemente, demonstrou-se que a produção contínua de IL-12 é necessária para

a manutenção de uma resposta Thl pulmonar para o controle da infeção por M.

tuberculosis in vivo (FENG et al., 2005). Entretanto, pouco se sabe quais os receptores

envolvidos na indução dessa citocina no curso da infecção p o r M. tuberculosis.

LIPOXINAS

Fontes das Lipoxinas

Lipoxinas, mediadores lipidíeos derivados da enzimas chamadas lipoxigenases

(LO), são formadas a partir de respostas multi-celulares do hospedeiro à infecção ou

estímulos inflamatorios. O ácido aracdônico e seus produtos de oxigenação podem ser

transferidos de uma célula a outra durante interação célula-célula levando a

transformação de substâncias pró- e anti-ínflamatórias. As lipoxinas são produtos

formados in vitro e in vivo a partir de fontes endógenas do aracdonato em diversas

espécies incluindo peixes e humanos (FIERRO AND SERHAN et al., 2001).

23

As lipoxinas apresentam diversas funções como agentes vasodilatadores e

imunomoduladores. Diferente da maioria dos mediadores lipídicos que são

primariamente pro-inflamatórios, como os leucotrienos, o fator-ativador de plaquetas

(PAF) e os prostanóides, as lipoxinas, em particular LXA4, são potentes sinais contra

reguladores de mediadores pro-inflamatórios endógenos (LTs e PAF) e de citocinas (TNF

e IL-6), resultando na inibição das ações dos leucócitos (SERHAN, 1997).

As lipoxinas se ligam a um receptor transmembranário acoplado a proteina G

chamado LXARypPRL-l (MADDOX et al., 1997), e a um receptor nuclear chamado

AhR (SCHALDACH et al., 1999). Camundongos que super-expressam o receptor LXAR

apresentam uma resposta inflamatória com menor duração e menos intensa, indicando

que esse receptor medeia algumas, porém náo todas, as ações anti-inflamatórias das

lipoxinas (MADDOX et al., 1997). Entretanto, apesar de intensa investigação, a

contribuição de cada receptor (membranário vs nuclear) envolvida na sinalização da

resposta anti-inflamatória das lipoxinas ainda não foi dissecada.

Um dos principais produtos da 5-LO, a LXA4 apresenta ações seletivas em

leucócitos que incluem a) inibição da quimiotaxia de neutrófllos (LEE et al., 1989) b)

transmigração através de células epiteliais (COLGAN et al., 1993) c) e adesão e

transmigração em células endoteliais (PAPAYIANNI, 1996). Dentre suas ações no

sistema imune, LXA4 foi demonstrado como sendo um potente inibidor da produção de

IL-12 induzida por um extrato do parasita T. gondii por DCs in vivo (ALIBERTI et al.,

2002). Além disso, LXA4 é capaz de induzir o recrutamento de monócitos humanos

Funções Biológicas das Lipoxinas

26

(SERHAN et al., 1999) que poderia estar envolvido com a resolução e cicatrização dos

processos inflamatórios. Lipoxinas apresentam também outras atividades anti-

inflamatórias em modelos experimentais diferentes incluindo periodontite, artrite, nefrite

e doença intestinal inflamatória (KIERAN et al., 2004; SAMUELS SON, 1991; GOH et

al., 2003; VAN DYKE et al., 2003). Apesar da existência desses dados, as vias de

sinalização envolvidas na resposta pró-inflamatória ainda não foi esclarecida até o

presente momento. No entanto, sabe-se que um fator de transcrição chamado suppressors

o f cytokine signaling (S0CS)-2 é induzido em células dendriticas após a estimulação com

LXA4 in vitro (MACHADO et al., 2006). Interessantemente, quando DCs de

camundongos SOCS-2 KO foram, tratadas com LXA4 in vitro, as m.esmas apresentam

defeito na inibição da produção de IL-12 induzido por STag (MACHADO et al., 2006).

Esses dados evidenciam que SOCS-2 pode estar envolvido na inibição da resposta

inflamatória mediada pelas lipoxinas na resposta contra T. gondii. Atualmente não se

sabe se essa molécula está envolvida na resposta à infecções pelo M. tuberculosis.

A formação das lipoxinas é observada quando as células são expostas a estímulos

solúveis (ativação de receptores) ou fagocíticos. A infecção por microorganismos é um

dos principais estímulos para a indução de lipoxinas, no entanto pouco se sabe sobre o

papel das lipoxinas em modelos de infecções. O parasita T. gondii induz altos níveis de

LXA4 no plasma e camundongos deficientes em 5-LO sucumbem devido a inflamação

íncontrolável e sistêmica associado a um aumento significante da produção de IL-12 por

DCs (ALIBERTI et al., 2002). Esses dados sugerem que a LXA4 regula a produção de

IL-12 por DCs in vivo e que o parasita intracelular T. gondii possivelmente explora a

indução de lipoxinas como mecanismo de evasão da resposta imune do hospedeiro. Foi

26

determinado na presente tese se o patógeno humano M. tuberculosis induz a produção de

lipoxinas e se essas participam da resposta imune contra micobactéria (manuscrito III).

Além disso, uma revisão com enfoque nas lipoxinas como mediadores anti-inflamatórios

envolvidos na evasão dos patógenos intracelulares (manuscrito IV) foi realizada.

27

Hipótese: Os receptores do tipo Toll (TLR) e as lipoxinas são determinantes da

resistência/susceptibilidade na infecção p o r Mycobacterium tuberculosis.

O objetivo gerai dessa tese foi caracterizar os mecanismos inatos que controlam a

produção de IL-12 durante a infecção experimental por M. tuberculosis. Os objetivos

específicos foram:

I) Investigar se a molécula M yD88 , uma proteína adaptadora envolvida na sinalização

dos TLR/IL-IR, participa na resistência do hospedeiro a M. tuberculosis num modelo

murino de infecção assim como na indução de uma resposta imune Thl.

II) Identificar o(s) TLR envolvidos na regulação da produção de IL-12 mediada pela

infecção por M. tuberculosis in vitro e in vivo.

III) Identificar os TLR participantes da resistência dependente do MyD88 no controle

da infecção por M. tuberculosis.

IV) Investigar o possível papel das lipoxinas, eicosanoides anti-inflamatórios, na

regulação da produção da IL-12 durante a infecção porM . tuberculosis in vivo.

HIPÓTESE E OBJETIVOS DESSA TESE

28

A importância dos PRR como receptores centrais na regulação da síntese de IL-12

por células apresentadoras profissionais de antigenos induzida por M. tuberculosis in

vitro e in vivo foi investigada, assim como o papel das lipoxinas na defesa do hospedeiro

contra M. tuberculosis num modelo experimental. As DCs, que expressam PRR, devem

ser importantes na resposta imune contra patógenos intracelulares, em particular, M.

tuberculosis. O entendimento dos mecanismos de controle da IL-12 mediada por M.

tuberculosis pode ser fundamental para revelar a imunidade contra esse patógeno. [Deve

ser notado que para o entendimiento dessa seção o leitor deve !er os mânuscritos I - IV,

pois um sumario de cada trabalho foi omitido],

TLR no controle da produção de IL-12 induzido por M. tuberculosis

Envolvimento fundamental de MyD88 na imunidade contra M. tuberculosis

(manuscritos I e II)

Com o intuito de investigar o papel dos TLR na resiténcia a M. tuberculosis,

camudongos M yD88 -/- foram infectados com baixas doses do bacilo da tuberculose (50 -

100 unidades formadoras de colônia/animal) num modelo de infecção via aerosol, que

simula a transmissão em humanos. Nesse contexto, os camundongos KG em MyD88-/-

são altamente susceptíveis quando expostos a micobactéria. Concomitantemente, esses

animais apresentam um aumento na carga bacilar em pulmões, baço e fígado quando

DISCUSSÃO DOS RESULTADOS OBTIDOS

29

comparados com camundongos controles. Além disso, observou-se que os níveis na

mensagem para IL-12p40 e IFN-y se encontram significativamente diminuidos nos

camudongos MyD8 8 -/-. Esses dados sugerem que a molécula adaptadora MyD88 é

crítica na proteção contra M. tuberculosis além de regular as respostas do tipo T hl. IFN-y

é um dos principais atores na indução de NOSII com consequente produção de NO, um

metabólito com atividades anti-micobacterianas in vitro e in vivo (FLYNN et al., 2001).

Foi determinado então se um defeito na síntese de NO poderia contribuir para a

susceptibilidade aumentada dos camudongos deficientes em M yD8 8 . Após 3 semanas de

infecção com M. tuberculosis, esses camundongos apresentaram uma redução nos níveis

da mensagem para NOSII comparados com os níveis dos animais controles. Além disso,

uma análise histoquímica do tecido pulmonar mostrou que os camundongos MyD88-/-

apresentam uma diminuição da marcação para NOSII. Esses resultados mostram que a

resistência à infecção por M. tuberculosis é dependente de M yD88 e implicam a

sinalização via TLR e/ou IL -IR como um fator determinante na proteção contra esse

bacilo. Apesar do M yD88 estar envolvido na regulação da resistência à M. tuberculosis,

não se sabe quais os receptores específicos que sustentam essa resposta. Com o intuito de

se investigar qual a contribuição de TLR específicos na resposta a M. tuberculosis,

experimentos foram realizados em camundongos deficientes em diversos TLR.

30

Papel dos TLR na regulação das respostas Thl contra M tuberculosis (manuscrito

II)

Baseado no falo que M. tuberculosis contêm uma série de ligantes que ativam

especificamente diversos TLR, estudos utilizando principalmente camundongos KO em

uní único TLR foram realizados por grupos diferentes nos últimos 5 anos. Apesar dos

resultados que sugerem que M yD88 está criticamente envolvido na resposta imune a

micobactéria, esses estudos revelaram que TLR2, TLR4 ou TLR6 apresentam uma

influência apenas marginal no controle inicial da infecção por M. tuberculosis. Na

presente tese, foi testada então a hipótese que os diversos TLR colaboram na resposta

imune contra o M. tuberculosis. Para isso, o papel do TLR9 na resistência à micobactéria

foi testado (Tokunaga e cois, demonstraram em 1984 que o DNA micobacteriano é capaz

de induzir uma resposta inflamatoria anti-tumoral [TOKUNAGA et al., 1984]), e sua

colaboração com TLR2, receptor esse que reconhece uma grande quantidade de ligantes

expressos na parede celular de M. tuberculosis. Observou-se que o DNA purificado de M.

tuberculosis ou de M. bovis induz a produção de IL-12 e TNF em APC sendo que esse

efeito é totalmente dependente de TLR9. Os camundongos TLR9K0 (mas não os

TLR2K0) infectados com M. tuberculosis apresentaram um defeito na indução de IL-

12p40 e IFN-y in vivo. No entanto, foi observado apenas leves reduções na resiténcia

aguda à infecção com baixas doses do referido patógeno. Quando comparados com os

camundongos KO para TLR2 ou TLR9, animais duplo KO para TLR2 e TLR9

apresentaram uma aumentada suscetibilitade à infecção em associação com defeitos

combinados na produção de citocinas pro-inflamatórias in vitro, na produção de IFN-y

especifica contra M. tuberculosis e patologia pulmonar alterada. Além disso, observou-se

31

uma menor atividade das células Thl (produtoras de IFN-y) específicas contra

micobatéria em camundongos TLR9-/-, TLR2/9-/- e MyD88 -/-. Esses dados sugerem que

TLR9 controla a geração das respostas T hl, e que isso pode ser via a regulação da

produção de IL-12 in vivo.

Lipoxinas no controle da produção de IL-12 induzido por M. tuberculosis

Lipoxinas como mediadores chave na imunidade contra M. tuberculosis (manuscrito

III)

Como descrito acima, as respostas Thl são fundamentais no controle da infecção

por M. tuberculosis. Como achados recentes indicam que as lipoxinas, mediadores

químicos dependentes da 5-LO, regulam a produção de IL-12 in vivo, propôs-se nessa

tese analisar o papel dessas substâncias anti-inflamatórias na modulação dessa citocina e

resistência à infecção por M. tuberculosis. Altos níveis de lipoxina A4 (LXA4) foram

detectados no soro de camudongos selvagens mas não em animais KO para 5-LO. Além

disso, os pulmões dos camundongos 5L0-/- apresentaram um aumento nos níveis de

RNAm de IL-12 quando comparados com os mesmos tecidos dos animais selvagens.

Mais importante, a carga bacteriana pulmonar de animais 5-LO-/- se encontravam

significavamente mais baixa que camundongos selvagens e esse aumento na resistência

dos camundongos KO foi completamente prevenido quando uma , análogo estável da

lipoxina foi administrado no grupo experimental. Esses resultados mostram que as

lipoxinas regulam negativamente as respostas protetoras do tipo Thl contra M.

32

tuberculosis in vivo e sugerem que a inibição da vía biossintética das lipoxinas podem

servir como urna estrategia de estímulo da resiténcia à infecção por M. tuberculosis.

CONSIDERAÇÕES FINAIS E PERSPECTIVAS

De urna maneira geral, os dados apresentados nessa tese sustentam o conceito de

que a ativação da imunidade inata é fundamental para a geração de uma resposta

adaptativa protetora contra M. tuberculosis. A indução de IL-12 ñas fases iniciais e

durante o curso da infecção com M. tuberculosis é um passo crítico na ativação e

manutenção da resposta imune (FENG et al., 2005), a qual proporciona uma resposta

ótima com indução da proliferação de células T específicas levando a um controle do

microrganismo invasor.

Em conjunto, os manuscritos apresentados nessa tese mostram que o M

tuberculosis induz vários níveis de controle inato da produção de IL-12. Assim, de um

lado, 0 reconhecimento de padrões moleculares como lipoproteina e/ou DNA do agente

infeccioso devem ser importantes na indução dessa citocina, e por outro, mediadores

químicos induzidos pelo bacilo como as lipoxinas agem inibindo a produção de IL-12 e

facilitando a sobrevida do M. tuberculosis. Não foi investigado se o bacilo usa os TLR

para induzir a produção de lipoxinas pelas células do hospedeiro.

Desvendar os mecanismos pelos quais os receptores envolvidos na ativação da

imunidade inata (ex.: cooperação) é importante no desenvolvimento de estratégias

terapêuticas e vacinais contra o bacilo. Como exemplo, a regulação da

expressão/sinalização via M yD88 , em particular TLR2 e TLR9, pode servir como

33

mecanismo de eliminação do bacilo. Ainda é possivel que o uso de adjuvantes específicos

para esses dois TLR in vivo possam desempenhar um papel no desenvolvimento de

respostas imunes contra M. tuberculosis.

Além disso, o entendimento das vias pelas quais o M. tuberculosis utilizam para

inibir a resposta imune pode ser um passo fundamental para essas estratégias. Assim, as

lipoxinas são canditados que podem ser inibidos em pacientes infectados com o bacilo.

Nesse interim, bloqueadores específicos da enzima 5-LO como o zileuton estão

disponíveis no mercado para o tratamento de asma, porém não foram testadas em

pacientes portadores de tuberculose ou outras doenças infecciosas.

34

Um conjunto de conclusões básicas podem ser retirados dos manuscritos apresentados

nessa tese e estão resumidos abaixo;

1. A produção de IL-12 é regulada por MyDS8 in vivo e in vitro;

2. A produção de TNF induzida por M. tuberculosis por macrófagos depende de

TLR2 in vitro;

3. O DNA de M. tuberculosis e M. bovis (BCG) induz uma resposta inflamatória

dependente de TLR9 em células apresentadoras de antígeno;

4. A sinalização via TLR2 e TLR9 por M. tuberculosis in vivo induz respostas

protetoras contra M. tuberculosis',

5. TLR9 controla a resposta protetora do tipo Thl (produção de IL-12 e IFN-y)

contra M. tuberculosis in vivo;

6 . M. tuberculosis induz altos níveis de lipoxinas no soro;

1. As lipoxinas são mediadores chaves na regulação de IL-12 no curso da infecção

p o rM tuberculosis',

8 . As lipoxinas são agentes antí-inflamatórios que negativamente modulam a

resistência a M. tuberculosis.

Conclusões Gerais

35

REFERÊNCIAS BIBLIOGRÁFICAS

ABEL, B , N. THIEBLEMONT, V.J. QUESNIAUX, N. BROWN, J. MPAGI, K.

MIYAKE, F. BIHL, AND B. RYFFEL. Toll-like receptor 4 expression is required to

control chronic M ycobacterium tuberculosis infection in mice. J. Immunol.

169:3155.2002.

ADACHI, O., T. KAWAI, K. TAKEDA, M. MATSUMOTO, H. TSUTSUI, M.

SAKAGAMI, K. NAKANISHI, AND S, AKIRA. Target disruption o f the M yD88

gene results in loss o f IL-1 and IL-18-mediated function. Immunity 9:143. 1998.

AKIRA, S., K. TAKEDA, AND T. KAISHO. Toll-like receptors: critical proteins

linking innate and acquire immunity. Nat. Immunol. 2:675. 2001.

ALIBERTI, J., C.- SERHAN, AND A. SHER. Parasite-induced lipoxin A4 is an

endogenous regulator o f IL-12 production and immunopathology in Toxoplasma

gondii infection. J. Exp. Med. 196:1253. 2002.

ALIPRANTS, A.O., R.B. VAN, M.R. MARK, S. SUGGET, B. DEVAUX, J.D.

RADOLF, G.R. KLIMPEL, P. GODOWSKl, AND R. MODLIN. Host defense

mechanisms triggered by microbial lipoproteins through toll-like receptor-2. Science.

285:736. 1999.

36

ALEXOPOULOU, L., A.C. HOLT, R. MEDZITOV, AND R. FLAVELL.

Recognition o f double-stranded RNA and activation of NF-kappaB by Toll-like

receptor 3. Nature. 413:732. 2001.

ALTARE, F., A. DURANDY, D. LAMMAS, J.F. EMILE, S. LAMHAMEDI, F. LE

DEIST, P. DRYSDALE, E. JOUANGUY, R. DOFFINGER, F. BERNAUDIN, O.

JEPPSSON, J.A. GOLLOB, E. MEINL, A.W. SEGAL, A. FISCHER, D.

KUMARARATNE, J.L. CASANOVA. Impairment o f mycobacterial immunity in

human interleukin-12 receptor deficiency. Science. 280:1432. 1998.

ASTE-AMEZAGA, M., X. MA, A. SARTORI, AND G. TRINCHIERI. Molecular

mechanisms o f the induction o f IL-12 and its inhibition by IL-10. J. Immunol.

160:5936. 1998.

ASTON, C., W.N. ROM, A.T. TALBOT, AND J. REIBMAN. Early inhibition of

mycobacterial growth by human alveolar macrophages is not due to nitric oxide. Am.

J. Rcspir. Grit. Care Med. 157:1943. 1998.

BAFICA, A., H.C. SANTIAGO, R. GOLDSZMID, C. ROPERT, R. GAZZINELLI,

AND A. SHER (Manuscrito em preparação).

37

BABIK, J.M., E. ADAMS, Y. TONE, P.J. FAIRCHILD, M. TONE, AND H.

WALDMANN. Expression o f murine IL-12 is regulated by translational control of

thep35 subunit. J. Immunol. 162:4069. 1999.

BARNES, P.P., S. LU, J.S. ABRAMS, E. WANG, M. YAMAMURA, AND R.L.

MODLIN.. Cytokine production at the site of disease in human tuberculosis. Infect.

Immun. 61:3482. 1993.

BARNES, P.P., A.B. BLOCH, P.T. DAVIDSON, AND D.E. SNIDER JR..

Tuberculosis in patients with human imjuunodeficiency virus infection. N. Engl. J.

Med. 324:1644. 1991

BARNES, P.P., V. MEHRA, G.R. HIRSCHFIELD, S.J. PONG, C. ABOU-ZEID,

G.A. ROOK, S.W. HUNTER, P.J. BRENNAN, AND R.L. MODLIN.

Characterization o f T cell antigens associated with the cell wall protein-peptidoglycan

complex o f M ycobacterium tuberculosis. J. Immunol.'143:2656. 1989.

BARTON, G.M. AND R. MEDZHITOV. Toll-like receptors and their ligands. Curr.

Top. Microbiol. Immunol. 270:81. 2002.

BEAN, A.G., D.R. ROACH, H. BRISCOE, M.P. FRANCE, H. KORNER, J.D.

SEDGWICK, AND W.J. BRITTON. Structural deficiencies in granuloma fomiation

in TNF gene-targcted mice underlie the heightened susceptibility to aerosol

38

Mycobacterium tuberculosis infection, which is not compensated for by lymphotoxin.

J. Immunol. 162:3504. 1999.

BEHAR, S.M., C.C. DASCHER, M.J. GRUSBY, C.R. WANG, M.B. BRENNER.

Susceptibility o f mice deficient in CD ID or TAPI to infection with Mycobacterium

tuberculosis. J. Exp. Med. 189:1973.1999.

BERMUDEZ, L.E. Differential mechanisms o f intracellular killing o f Mycobacterium

avium and Listeria monocytogenes by activated human and murine macrophages. The

role of nitric oxide. CHn. Exp. Im m unol. 91:277. 1993.

BOTHAMLEY, G.H., E. FESTENSTEIN, AND A. NEWLAND. Protective role for

CD8 cells in tuberculosis. Lancet. 339:315. 1992.

BRIGHBILL, H.D., D.H. LIBRATY, S.R. KRUTZIK, R.B. YANG, J.T. BELISLE,

J.R. BLEHARSKI, M. MAITLAND, M.V. NOGARD, S.E. PLEVY, S.T. SMALE,

P.J. BRENNAN, B.R. BLOOM, P.J. GODOWSKI, AND R. MODLIN. Host defense

mechanisms triggered by microbial lipoproteins through toll-like receptors. Science.

285:732. 1999.

CANADAY, D.H., C. ZIEBOLD, E.H. NOSS, K.A. CHERVENAK, C.V.

HARDING, AND W.H. BOOM. Activation of human CD8+ alpha beta TCR+ cells

39

by M ycobacterium tuberculosis via an alternate class I MHC antigen-processing

pathway. J. Immunol. 162:372. 1999.

CARUSO, A.M., N. SERBINA, E. KLEIN, K. TRIEBOLD, B.R. BLOOM, AND

J.L. FLYNN. Mice deficient in CD4 T cells have only transiently diminished levels of

IFN-gamma, yet succumb to tuberculosis. J. Immunol. 162:5407. 1999.

CHAN, J., K. TANAKA, D. CARROLL, J. FLYNN, AND B.R. BLOOM. Effects of

nitric oxide synthase inhibitors on murine infection with M ycobacterium tuberculosis.

Infect. Im raun. 63:736. 1995.

CHAN, J., Y. XING, R.S. MAGLIOZZO, AND B.R. BLOOM. Killing o f virulent

M ycobacterium tuberculosis by reactive nitrogen intermediates produced by activated

murine macrophages. J. Exp. Med. 175:1111. 1992.

CHAN, S.H., M. KOBAYASHI. D. SANTOLI, B. PERUSSIA, AND G.

TRINCHIERI. Mechanisms of IFN-y induction by natural killer cell stimulatory

factor (NKSF/IL-12): role o f transcription and mRNA stability in the synergistic

interaction between NKSF and IL-2. J. Immunol. 148:92. 1992.

CAAMANO, J. AND C. A. FIUNTER.. NF-kappaB family of transcription factors

central regulators of innate and adaptive immune functions. Clin. Microbiol. Rev.

15:414. 2002.

40

CAMPOS, M.A., I .e . ALMEIDA, O. TAKEUCHI, S. AKIRA, E.P. VALENTE,

D.O. PROCOPIO, L.R. TRAVASSOS, J.A. SMITH, D.T. GOLENBOCK, AND R.T.

GAZZINELLI. Activation of Toll-like receptor-2 by glycosylphosphatidylynositol

anchors from a protozoan parasite. J. Immunol. 167:416. 2001.

COMSTOCK, G. Prevention of tuberculosis. Bull. Int. Union Tuberc. Lung Dis.

6 6 -.l9 9 0 .S u p p l:9 - ll.\9 9 2 .

COLGAN, S.P., C.N. SERHAN, C.A. PARKOS, C. DELP-ARCHER, AND J.L.

MADARA. Lipoxin A4 modulates iransm.igraiion o f hum_an neutrophils across

intestinal epithelial monolayers. J. Clin. Invest. 92:75. 1993.

COOPER, A.M., AND J.L. FLYNN. The protective immune response to

M ycobacterium tuberculosis. Curr. Opin. ImmunoL 7:512. 1995.

COOPER, A.M., D.K. DALTON, T.A. STEWART, J.P. GRIFFIN, D.G. RUSSELL,

AND l.M. ORME. Disseminated tuberculosis in interferon gamma gene-disrupted

mice. J. Exp. Med. 178:2243, 1993.

COOPER, A.M., A.D. ROBERTS, E.R. RHOADES, J.E. CALLAHAN, D.M.

GETZY, l.M. ORME. The role of interleukin-12 in acquired immunity to

M ycobacterium tuberculosis infection. Immunology. 84:423. 1995.

41

COOPER, A.M., J. MAGRAM, J. FERRANTE, I.M. ORME. Interleukin 12 (IL-12)

is crucial to the development of protective immunity in mice intravenously infected

with M ycobacterium tuberculosis. J. Exp. Med. 186:39. 1991.

DANDREA, A., M. ASTE-AMEZAGA, N.M. VALIANTE, X. MA, M. KUBIN,

AND G. TRINCHIERI. Interleukin-10 inhibits human lymphocyte IFN-y production

by suppressing natural killer cell stimulatory factor/interleukin-12 synthesis in

accessory cells. J. Exp. Med. 178:1041. 1993.

DANDREA, A., RENGARAJU, M., VALIANTE, N.M., CHEHIMI, J., KUBIN, M.,

ASTE, M., CHAN, S.H., KOBAYASHI, M., YOUNG, D., NICKBARG, E., ET AL.

Production o f natural killer cell stimulatory factor (interleukin-12) by peripheral-

blood mononuclear cells. J. Exp. Med. 176:1387. 1992.

DAHL, K.E., H. SHIRATSUCHI, B.D. HAMILTON, J.J. ELLNER, AND Z.

TOOSSI. Selective induction of transforming growth factor beta in human monocytes

by lipoarabinomannan o f Mycobacterium tuberculosis. Infect. Immun. 64:399. 1996.

DANIEL, T.M., A.A. SIPPOLA, A. OKWERA, S. KABENGERA, E. HATANGA,

T. AISU, S. NYOLE, F. BYEKWASO, M. VJECHA, L.E. FERGUSON ET AL.

Reduced sensitivity o f tuberculosis serodiagnosis in patients with AIDS in Uganda.

Tuber. Lunii. Dis. 75:33. 1994.

42

DEMANGEL, C., A.G. BEAN, E. MARTIN, C.G. FENG, A.T. KAMATH, AND

W.J. BRITTON. Protection against aerosol Mycobacterium tuberculosis infection

using Mycobacterium bovis Bacillus Calmette Guerin-infected dendritic cells. Eur. J.

Im m unol. 29:1972. 1999.

DENIS, M. Growth o f Mycobacterium avium in human monocytes: identification o f

cytokines which reduce and enhance intracellular microbial growth. Eur. J.

Im m unol. 21:391. 1991.

DIEBOLD, S.S., T. KAISHO, H. HEMMI, S. AKIRA, AND C. REIS E SOUSA.

Innate antiviral responses by means o f TLR7-mediated recognition o f single-stranded

RNA. Science. 303:1529. 2004.

D'SOUZA, S., AND J. IVANYI. Antigen-dependent in vitro culture o f protective T

cells from BCG-primed mice. Clin. Exp. Im m unol. 91:68. 1993.

FENG, C.G., D. JANKOVIC, M. KULLBERG, A. CHEEVER, C.A. SCANGA, S.

HIENY, P. CASPAR, G.S. YAP, AND A. SHER. Maintenance o f pulmonary Thl

effector function in chronic tuberculosis requires persistent IL-12 production. J.

Im m unol. 174:4185. 2005.

43

FENTON, M.J., M.W. VERMEULEN, S. KIM, M. BURDICK, R.M. STRIETER, H.

KORNFELD. Induction o f gamma interferon production in human alveolar

macrophages by Mycobacterium tuberculosis. Infect. Im m un. 65:5149. 1997.

FENTON, M.J., AND VERMEULEN, M.W. Immunopathology o f tuberculosis: roles

o f macrophages and monocytes. Infect. Immun. 64:683. 1996.

FIERRO, I.M. AND C.N. SERHAN. Mechanisms in anti-inflammation and

resolution: the role o f lipoxins and aspirin-triggered lipoxins. Braz. J. Med. Biol.

Res. 34:555. 2001.

FITZGERALD, K.A., D.C. ROWE, B.J. BARNES, D.R. CAFFREY, A. VISINTIN,

E. LATZ, B. MONKS, P.M. PITHA, AND D.T. GOLENBOCK. LPS-TLR4

signaling to IRF-3/7 and NF-kappaB involves the toll adapters TRAM and TRIF. J.

Exp. M ed. 198:1043. 2003.

FLESCH, I., AND S.FI. KAUFMANN. Mycobacterial growth inhibition by

interferon-gamma-activated bone marrow macrophages and differential susceptibility

among strains o í Mycobacterium tuberculosis. J. Im m unol. 138:4408. 1987.

FLYNN, J. L., AND J. CHAN. Immunology o f tuberculosis. Annu. Rev. Immunol.

19:93-129. 2001.

44

FLYNN, J.L., J. CHAN, K.J. TRIEBOLD, D.K. DALTON, T.A. STEWART, AND

B.R. BLOOM. An essential role for interferon gamma in resistance to Mycobacterium

tuberculosis infection. J. Exp. Med. 178:2249. 1993.

FLYNN, J.L., M.M. GOLDSTEIN, K.J. TRIEBOLD, B. ROLLER, AND B.R.

BLOOM. Major histocompatibility complex class I-restricted T cells are required for

resistance to Mycobacterium tuberculosis infection. Proc. NatL Acad. Sci. USA.

89:12013. 1992.

GORDON, S., S. KESHAV, M. STEIN. BCG-induced granuloma formation in

murine tissues. Im m unobiology. 191:369. 1994

GAUTIER, G., M. HUMBERT, F. DEAUVIEAU, M. SCUILLER, J. HISCOTT,

E.E. BATES, G. TRINCHIERI, C. CAUX, AND P. GARRONE. A type I interferon

autocrine-paracrine loop is involved in Toll-like receptor-induced interleukin-12p70

secretion by dendritic cells. J. Exp. Med. 201:1435. 2005.

GAZZINELLI, R.T., M. WYSOCKA, S. HAYASHI, E.Y. DENKERS, S. HIENY, P.

CASPAR, G. TRINCHIERI, AND A. SHER. Parasite-induced IL-12 stimulates early

IFN-y synthesis and resistance during acute infection with Toxoplasma gondii. J.

ImmunoL 153:2533. 1994.

45

GOH, J , C. GODSON, H.R. BRADY AND P. MACMATHUNA. Lipoxins: pro-

resolution lipid mediators in intestinal inflammation. G astroenterology. 124:1043.

2003.

GHOSH, S., M.J. MAY, AND E.B. KOPP. NF-kappaB and Rel proteins:

evolutionary conserved mediators o f immune responses. Annu. Rev. Im m unol.

16:225. 1998.

HAYES, M.P., F.J. MURPHY, AND P.R. BURD. Interferon-y-dependent inducible

expression o f the human inteleukin-12 p35 gene in monocytes initiates from a TATA-

containing promoter distinct from de CpG-rich promoter active in Epstein-Barr virus-

transformed lymphoblastoid cells. Blood. 91:4645. 1998.

HAYASHI, F. K.D. SMITH, A. OZINSKY, T.R. HAWN, B.C. YI, D.R.

GOODLETT, J.K. ENG, S. AKIRA, D.M. UNDERHILL, AND A. ADEREM. The

innate immune response to bacterial flagellin is mediated by Toll-like receptor 5.

Nature. 410:1099. 2001.

HEMMI, H. T. KAISHO, O. TAKEUCHI, S. SATO, H. SANJO, K. HOSHINO, T.

HORIUCHI, H. TOMIZAWA, K. TAKEDA, AND S. AKIRA. Small anti-viral

compounds activate immune cells via the TLR7 MyD88-dependent signaling

pathway. Nat. Im m unol. 3:196. 2002.

46

HEMMI, H., O. TAK EUCm , T. HAWAI, T. KAISHO, S. SATO, H. SANJO, M.

MATSUMOTO, K. HOSHINO, H. WAGNER, K, TAKEDA, AND S. AKIRA. A

Toll-like receptor recognizes bacterial DNA. Nature. 408:740. 2000.

HENDERSON, R. A., S.C. WATKINS, AND J.L. FLYNN. Activation o f human

dendritic cells following infection with Mycobacterium tuberculosis. J. Immunol.

159:635. 1997.

HIRSCH, C.S., R. HUSSAIN, Z. TOOSSI, G. DAW OOD, F. SHAHID, AND J.J.

ELLNER. Cross-modulation by transforming growth factor beta in human

tuberculosis: suppression o f antigen-driven blastogenesis and interferon gamma

production. Proc. Natl. Acad. Sci. USA. 93:3193. 1996.

HOEBE, K., X. DU, P. GEORGEL, E. JANSSEN, K. TABETA, S.O. KIM, J.

GOODE, P. LIN, N. M ANN, S. MUDD, K. CROZAT, S. SOVATH, J. HAN, AND

B. BEUTLER. Identification o f Lps2 as a key transducer o f MyD88-independent TIR

signaling. N ature. 424:743. 2003.

HOFFMAN, J.A., F.C. KAFATOS, C.A. JANEWAY, AND R.A. EZEKOWITZ.

Phylogenetic perspectives in innate immunity. Science. 284:1313. 1999.

JARROSSAY, D., G. NAPOLÍTANI. M. COLONNA, F. SALLUSTO, AND A.

LANZAVECCHIA. Specialization and complementarity in microbial molecule

47

recognition by human myeloid and plasmacytoid dendritic cells. Eur. J. Immunol.

KAUFMANN SH, AND C.H. LADEL. Role o f T cell subsets in immunity against

intracellular bacteria: experimental infections o f knock-out mice with Listeria

monocytogenes 'àwá Mycobacterium bovis BCG. Im m unobiology. 191:509. 1994.

KAPLAN, M.H., Y. L. SUN, T. HOEY, AND M.J. GRUSBY. Impaired IL-12

responses and enhanced development o f Th2 cells in Stat4-deficient mice. Nature.

382:174. 1996.

KADOWAKI, N., S. HO, S. ANTONENKO, R.W. MALEFYT, R.A. KASTELEIN,

F. BAZAN, AND Y.J. LIU. Subsets o f human dendritic-cell precursors express

different Toll-like receptors and respond to different microbial antigens. J. Exp.

Med. 194:863. 2001.

KARIN, M., AND Y. BEN-NERIAH. Phosphorilation meets ubiquitination: the

control o f NF-kappaB activity. Annu. Rev. Immunol. 18:621. 2000.

KAWAI, T. O. ADACH l, T. OGAWA, K, TAKEDA, AND S. AKIRA.

Unresponsiveness o f M yD88-deficient mice to endotoxin. Immunity. 11:115. 1999.

KIERAN, N.E., P. MADERNA AND C. GODSON. Lipoxins: potential anti

inflammatory, proresoiution, and antifibrotic mediators in renal disease. Kidney Int.

65:1154. 2004.

KIRSCHING, C.J., AND R.R. SCHUMANN. TLR2: cellular sensor for microbial

and endogenous molecular patterns. Curr. Top. M icrobiol. Im m unol. 270:121.

2002.

KOBAYASHI, M., FITZ, L., RYAN, M., HEWICK, R.M., CLARK, S.C., CHAN,

S., LOUDON, R., SHERMAN, F., PERUSSLA, B., AND TRINCHIERL G.

Identification and purification o f natural killer cell stimulatory factor (NKSF), a

cytokine with multiple biologic effects on human lymphocytes. J. Exp. Med.

170:827. 1989.

LADEL, C.H., C. BLUM, A. DREHER, K. REIFENBERG, AND S.H.

K AUFM ANN. Protective role o f gamma/delta T cells and alpha/beta T cells in

tuberculosis. Eur. J. Im m unol. 25:2877. 1995.

LEE, T.H., C.E. HORTON, U. KYAN-AUNG, D. HASKARD, A.E. CREA AND

B.W. SPUR. Lipoxin A4 and lipoxin B4 inhibit chemotactic responses o f human

neutrophils stimulated by leukotriene B4 and N-formyl-L-niethionyl-L-leucyl-L-

phenylalanine. C linical Science. 77:195. 1989.

49

LI, S., A. STRELOW, E J. FONTANA, AND H. WESCHE. IRAK-4: a novel

member o f the IRAK family with the properties o f an IRAK-kinase. Proc. Nat.

Acad. Sci. USA. 99:5567. 2002.

MA, X., J.M. CHOW, G. GRI, G. CARRA, F. GEROSA, S.F. WOLF, R. DZIALO,

AND G. TRINCHIERI. The interleukin-12 p40 gene promoter is primed by

interferon-y in monocytic cells. J. Exp. Med. 183:147. 1996.

MA, X., AND G. TRINCHIERI. Regulation o f interleukin-12 production in antigen-

presenting cells. A dv. im m unoL 79:55. 2001.

MACATONIA, S.E., HOSKEN, N.A., LITTON, M., VIEIRA, P., HSIEH, C.S.,

CULPEPPER, J.A., WYSOCKA, M., TRINCHIERI, G., MURPHY, K.M.,

O'GARRA, A. Dendritic cells produce IL-12 and direct the development o f Thl cells

from naive CD4+ T cells. J. Immunol. 154:5071. 1995.

MACHADO, F.S., JOHNDROW, J.E., ESPER, L., DIAS, A., BAFICA, A.,

SERHAN, C.N. A ND ALIBERTI, J. Anti-inflammatory actions o f lipoxin A(4) and

aspirin-triggered lipoxin are SOCS-2 dependent. N at M ed. 2006 Jan 15; [Epub ahead

o f print]

MADDOX, J.F., M. HACHICHA, T. TAKANO, N.A. PETASIS, V.V. FOKIN AND

C.N, SERHAN. Lipoxin A4 stable analogs are potent mimetics that stimulate human

50

monocytes and THP-1 cells via a G-protein-linked lipoxin A4 receptor. J. Biol.

Chem. 272:6972. 1997.

MEANS, T.K., E. LIEN, A. YOSHIMURA, S. WANG, D.T. GOLENBOCK, AND

M.J. FENTON. The CD 14 ligands lipoarabinomannan and lipopolysaccharide differ

in their requirement for Toll-like receptors. J. Immunol. 163:6748. 1999.

MEDZHITOV, R. AND C.A. JANEWAY, JR. Innate immunity: the virtues o f a

nonclonal system o f recognition. Cell. 91:295. 1997a.

MEDZHITOV, R. AND C. A. JANEWAY, JR.. Innate Immunity: impact on the

adaptive immune response. Curr. Opin. Immunol. 9:4. 1997b.

MEDZHITOV, R. AND C. A. JANEWAY, JR. Innate immune recognition. A nna.

Rev. Im m unol. 20:197.2002.

MERBEG, D.M., WOLF, S.F., AND CLARK, S.C. Sequence similarity betvi'een

NKSF and the IL-6/G-CSF family. Im m unol. Today 13:77. 1992.

MULLER, I., S.P. COBBOLD, H. W ALDMANN, AND S.H. KAUFM ANN.

Impaired resistance to Mycobacterium tuberculosis infection after selective in vivo

depletion o f L3T4+ and Lyt-2+ T cells. Infect. Immun. 75:2037. 1987.

51

NOZAKI, Y., Y. HASEGAWA, S. ICHIYAMA, I. NAKASHIMA, AND K.

SHIMOKATA. Mechanism of nitric oxide-dependent killing of Mycobacterium bovis

BCG in human alveolar macrophages. Infect. Immun. 65:3644. 1997.

O'BRIEN, L., B. ROBERTS, AND P.W. ANDREW. In vitro interaction of

Mycobacterium tuberculosis and macrophages: activation of anti-mycobacterial

activity of macrophages and mechanisms of anti-mycobacterial activity. Curr. Top.

Microbiol. Immunol. 215:97. 1996,

O’NEILL, L.A. Signal transduction pathways activated by IL-1 receptor/ioll-like

receptor superfamily. Curr. Top. Microbiol. Immunol. 270:47. 2002.

O’NEILL, L.A. The IL-1 receptor/Toll-like receptor superfamily: signal transduction

during inflammation and host defense. Science’s Stke: Signal Transduction

Knowledge Environment 2000:RE1. 2000.

O’NEILL, L.A., K. A. FITZGERALD, AND A.G. BOWIE. The Toll-IL-1 receptor

adaptor family grows to five members. Trends Immunol. 24:286. 2003.

OSHIUMI, H., M. MATSUMOTO, K. FUNAMI, T. AKAZAWA, AND T. SEYA.

TICAM-1, an adaptor molecule that participates in the Toll-like receptor 3-mediated

IFN-beta induction, [comment], Nat. Immunol. 4:161. 2003.

52

ORME, I.M,, AND A.M. COOPER. Cytokine/chemokine cascades in immunity to

tuberculosis. Immunol. Today. 20:307. 1999.

OPPMANN, B., LESLEY, R., BLOM, B., TIMANS, J.C., XU, Y., HUNTE, B.,

VEGA, P., YU, N., WANG, J., SINGH, K., ZONIN, F., VAISBERG, E.,

CHURAKOVA, T., LIU, M., GORMAN, D., WAGNER, J., ZURAWSKI, S., LIU,

Y., ABRAMS, J.S., MOORE, K.W., RENNICK, D., DE WAAL-MALEFYT, R.,

HANNUM, C., BAZAN, J.F., AND KASTELEIN, R.A. Novel p i9 protein engages

IL-12p40 to form a cytokine, IL-23, with biological activities similar as well as

distinct from IL-12. Immunity. 13:715. 2000.

PAPAYIANNI, A., C.N. SERHAN, AND H.R. BRADY. Lipoxin A4 and B4 inhibit

leukotriene-stimulated interactions of human neutrophils and endothelial cells. J.

Immunol. 156:2264. 1996.

PEDRAZZINI, T., K. HUG, AND ].A. LOUIS. Importance of L3T4+ and Lyt-2+

cells in the immunologic control of infection with Mycobacterium bovis strain

bacillus Calmette-Guerin in mice. Assessment by elimination of T cell subsets in

vivo. J. Immunol. 139:2032. 1987.

53

PFLANZ, S., J.C. TIMANS, J. CHEUNG, R. ROSALES, H. KANZLER, J.

GILBERT, L. HIBBERT, T. CHURAKOVA, M. TRAVIS, E. VAISBERG, W.M.

BLUMENSCHEIN, J.D. MATTSON, J.L. WAGNER, W. TO, S. ZURAWSKI, T.K.

MCCLANAHAN, D.M. GORMAN, J.F. BAZAN, R. DE WAAL MALEFYT, D.

RENNICK, R.A. KASTELEIN. IL-27, a heterodimeric cytokine composed of EB/3

and novel p28 protein, induces proliferation of naive CD+4 T cells. Immunity.

16:779.2002.

PRESKY, D.H., H. YANG, L.J. MINETTI, A.O. CHUA, N. NABAVI, C.Y. WU,

M.K. GATELY, AND U. GUBLER. A functional interleukin-12 receptor complex is

composed of two beta-type cytokine receptor subunits. Proc, Natl. Acad. ScL USA.

93:14002. 1996.

RANDHAWA, P.S. Lymphocyte subsets in granulomas of human tuberculosis: an in

situ immunofluorescence study using monoclonal antibodies. Pathology. 22:153.

1990.

REIS E SOUSA, C., A. SHER, AND P. KAYE. The role of dendritic cells in the

induction and regulation of immunity to microbial infection. Curr. Opln. Immunol.

11:392. 1999.

54

REIS E SOUSA, C., S. HIENY, T. SCHARTON-KERSTEN, D. JANKOVIC, H.

CHAREST, R.N. GERMAIN, A. SHER. In vivo microbial stimulation induces rapid

CD40 ligand-independent production of interleukin-12 by dendritic cells and their

redistribution to T-cell areas. J. Exp. Med. 186:1819. 1997.

ROACH, T.I., C.H. BARTON, D. CHATTERJEE, F.Y. LIEW, AND J.M.

BLACKWELL. Opposing effects of interferon-gamma on iNOS and interleukin-10

expression in lipopolysaccharide- and mycobacterial lipoarabinomannan-stimulated

macrophages. Immunology. 85:106. 1995.

ROOK, G.A., J. STEELE, M. AINSWORTH, AND B.R. CHAMPION. Activation of

macrophages to inhibit proliferation of Mycobacterium tuberculosis: comparison of

the effects of recombinant gamma-interferon on human monocytes and murine

peritoneal macrophages. Immunology. 59:333. 1986.

SAMUELSSON, B.. Arachidonic acid metabolism: role in inflammation, Z.

Rheumatol. 50:6. 1991.

SAUNDERS, B.M., AND A.M. COOPER. Restraining mycobacteria: role of

granulomas in mycobacterial infections. Immunol. Cell. BioL 78:334. 2000.

55

SCHARTON-KERSTEN, T.M, T.A. WYNN, E.Y. DENKERS, S. BALA, E.

GRUNVALD, S. HIENY, R.T. GAZZINELLI, AND A. SHER. In absence of

endogenous IFN-y, mice develop unimpaired IL-I2 responses to Toxoplasma gondii

while failing to control acute infection. J. Immunol. 157:4045. 1996.

SCHULZ, O., A.D. EDWARDS, M. SCHITO, J. ALIBERTI, S.

MANICKASINGHAM, A. SHER, C. REIS E SOUSA. CD40 triggering of

heterodimeric IL-12p70 production by dendritic cells in vivo requires a microbial

priming signal. Immunity. 13:453. 2000.

SCHAIBLE, U.E., H. L. COLLINS, AND S.H. KAUFMANN. Confrontation

between intracellular bacteria and the immune system. Adv. Immunol. 71:267. 1999.

SCHALDACH, C.M., J. RIBY AND L.F. BJELDANES. Lipoxin A4: a new class of

ligand for the Ah receptor. Biochemistry. 38:7594. 1999.

SERHAN, C.N. Lipoxins and aspirin-triggered 15-epi-lipoxins. Em: Gallin, J.I. and

Snyderman, R. (Editors), Inflammation. Basic Principles and Clinical Correlates.

Lippincot Williams and Wilkins, Philadelphia. 1999.

SERHAN, C.N. Lipoxins and novel aspirin-triggered 15-epi-lipoxins (ATL): a jungle

of cell-cell interactions or a therapeutic opportunity? Prostaglandins. 53:107. 1997.

56

SNIDER, D.E. JR, AND J.R. LA MONTAGNE. The neglected global tuberculosis

problem: a report of the 1992 World Congress on Tuberculosis. J. Infect. Dis.

169:1189. 1994.

SUZUKI, N. S. SUZUKI, G.S. DUNCAN, D.G. MILLAR, E. WADA, C. MIRTSOS,

H. TAKADA, A. WAKEHAM, A. ITIE, S. LI, J.M. PENNINGER, H. WESHE, P.S.

OHASHI, T.W. MAK, AND W.C. YEH. Severe impairment of interleukin-1 and

Toll-like receptor signaling in mice lacking IRAK-4. Nature 416:750. 2002.

SWANTEK, J.L., M.F. TSEN, M.H. COBB, AND J.A. THOMAS. IL-1 receptor-

associated kinase modulates host responsiveness to endotoxin. J. Immunol.

164:4301.2000

TAKEDA, K, T. KAISHO, AND S. AKIRA. Toll-like receptors. Annu. Rev,

Immunol. 21:335. 2003.

TASCON, R.E., C.S. SOARES, S. RAGNO, E. STAVROPOULOS, E.M. HIRST,

AND M..I. COLSTON. Mycobacterium tuberculosis-aciivãteá dendritic cells induce

protective immunity in mice. Immunology. 99:473. 2000.

THIERFELDER, W.E., J.M. VAN DEURSEN, K. YAMAMOTO, R.A. TRIPP, S.R.

SARAWAR, R.T. CARSON, M.Y. SANGSTER, D.A. VIGNALI, P.C. DOHERTY,

57

G.C. GROSVELD, AND J.N. IHLE. Requirement for Stat4 in interleukin-12-

mediated responses of natural killer and T cells. Nature. 382:171. 1996.

THOMAS, J.A., J.L. ALLEN, M. TSEN, T. DUBNICOFF, J. DANAO, X.C. LIAO,

Z. CAO, AND S.A. WASSERMAN. Impaired cytokine signaling in mick lacking IL-

1 receptor-associated kinase. J. ImmunoL 163:978, 1999.

TIAN, T„ J. WOODWORTH, M. SKOLD, AND S.M. BEHAR. In vivo depletion of

C D llc+ cells delays the CD4+ T cell response to Mycobacterium tuberculosis and

exacerbates the outcome of infection. J. Immunol. 175:3268. 2005.

TOKUNAGA, T., YAMAMOTO, S., SHIMADA, S., ABE, H., FUKUDA, T.,

FUJISAWA, Y., FUTURANI, Y., YANO, O., KATAOKA, T., SUDO, T. ET AL.

Antitumor activity of deoxyribonucleic acid fraction from Mycobaterium bovis BCG.

I Isolation, physicochemical characterization, and antitumor activity. J. Natl. Cancer

Inst. 72:955. 1984,

TONE, Y,, S,A. THOMPSON, J.M. BABIK, K.F. NOLAN, M. TONE, C. RAVEN,

AND H. WALDMANN. Structure and chromosomal location of the mouse

interleukin-12 p35 andp40 subunit genes. Ear. J. Immunol. 26:1222. 1996

TOOSSI Z, YOUNG TG, AVERILL LE, HAMILTON BD, SHIRATSUCHI H,

AND ELLNER JJ. Induction of transforming growth factor beta 1 by purified protein

derivative of Aiycobacterium tuberculosis. Infect. Immun. 63:224. 1995.

58

TRINCHIERI, G. Interleukin-12: a cytokine at the interface of inflammation and

immunity. Adv. Immunol. 70:83. 1998.

TRINCHIERI, G. Interleukin-12 and the regulation of innate resistance and adaptive

immunity. Nat. Rev. Immunol. 3:133. 2003.

ULEVITCH, R.J., AND P.S. TOBIAS. Recognition of gram-negative bacteria and

endotoxin by the innate immune system. Curr. Opin. Immunol. 11:19. 1999.

UNDERHILL, D.M., A. OZINSKY, A.M. HA.T.IAR, A. STEVENS, C.B. WILSON,

M. BASSETTI, AND A. ADEREM. The Toll-like receptor 2 is recruited to

macrophage phagosomes and discriminates between pathogens. Nature. 401:811.

1999

UNDERHILL, D.M., A. OZINSKY, K.D. SMITH, AND A. ADEREM. Toll-like

receptor-2 mediates mycobacteria-induced proinflammatory signaling in

macrophages. Proc. Nat. Acad. Sci. USA. 96:14459. 1999.

ULRICHS, T., AND S.H. KAUFMANN. New insights into the function of

granulomas in human tuberculosis. J. Pathol. 208:261. 2006.

YAMAMOTO, M., S. SATO, K. MORI, K. HOSHINO, O. TAKEUCHI, K.

TAKEDA, AND S. AKIRA. Cutting Edge; a novel Toll/IL-1 receptor domain-

59

containing adapter that preferentially activates IFN-beta promoter in the Toll-like

receptor signaling. J. Immunol. 169:6668. 2002.

YAMAMOTO, M., S. SATO, H. HEMMI, K. HOSHINO, T. KAISHO, H. SANJO,

O. TAKEUCHI, M. SUGIYAMA, M. OKABE, K. TAKEDA, AND S. AKIRA. Role

of adaptor TRIP in the MyD88-independent toll-like receptor signaling pathway.

Science. 301:640. 2003.

YAROVINSKY, P., D. ZHANG, J.F. ANDERSEN, G.L. BANNENBERG, C.N.

SERHAN, M.S. HAYDEN, S. HIENY, F.S. SUTTERWALA, R.A. PLAVELL, S.

GHOSH, AND A. SHER. TLRll activation of dendritic cells by a protozoan profilin-

like protein. Science. 308:1626. 2005.

YOSHIMOTO, T., K. KOJIMA, T. FUNAKOSHI, Y, ENDO, T. FUJITA, H.

NARIUCHI. Molecular cloning and characterization of murine IL-12 genes. J.

Immunol. 156:1082. 1996.

VAN DYKE, T.E., AND C.N. SERHAN. Resolution of inflammation: a new

paradigm for the pathogenesis of periodontal diseases. J. Dent. Res. 82:82. 2003.

WANG, C., L. DENG, M. HONG, G.R. AKKARAJU, J. INOUE, AND Z.J. CHEN.

TAKl is an ubiquitin-dependent kinase of MKK and IKK. Nature 412:346. 2001.

60

WANG, J., J. WAKEHAM, R. HARKNESS, AND Z. XING. Macrophages are a

significant source of type 1 cytokines during mycobacterial infection. J. Clin. Invest.

103:1023. 1999.

WORLD HEALTH ORGANIZATION, The World Health Report. Geneva. 32pp.

2004.

61

iM-tx. riON AND Im m u n it y , A pr. 2004. p. 2 4 0 0 -2 4 0 4 0019-9567/04/.S08.00-t 0 D O l: 10.112S,'lA1.72.4.2400-2404.2004

V o l. 72. K o . 4

M y D 8 8 - D e f ic ie n t M ic e D is p la y a P ro fo u n d L o s s in R e s is ta n c e to M y co b a c te riu m tu b e rcu lo s is A s s o c ia te d w ith P a r t ia l ly Im p a ir e d

T h l C y to k in e a n d N it r ic O x id e S y n th a s e 2 E x p re s s io nCharles A. Scanga,'* Andre Bafica,’ Carl G. Feng,’ Allen W. Cheever,^ Sara Hieny/

and Aian SherÎm m w iob io log )’ Section, Labora io iy o f Parasitic Diseases, N a tio n a l Institute o f A llergy and Infectious Diseases,

N a tio n a l Institutes o f Health, Bethesda, M ary land 20892, * and B iom edical Research Institute,Rockville, M a iy land 20852~

R eceived 22 D ecem b er 2003/A ccep ted 13 Jan u a ry 2004

Mycobacterium tuberculosis possesses agon ists fo r several Toll-like recep to rs (TLR s), yet m ice w ith single TLR d e le tions a rc re s is ta n t to acu te tubercu losis. M yD 88“ ' “ m ice w ere used to exam ine w h e th er T L R s play any ro le in p ro tec tio n ag a in s t aerogenic M. tuberculosis H37Rv infection . M yD88~^“ m ice failed to con tro l m ycobactcria l rep lica tio n and rap id ly succum bed. M oreover, expressions of in te rleu k in 12, tu m o r n ecrosis facto r a lp h a , gam m a in te rfero n , and n itr ic oxide sy n th ase 2 w ere m arked ly d ecreased in the knockout an im a ls . T hese re su lts a rg u e th a t re sis tan ce to M . tuberculosis m u st depend on M yD88-d ep enden t signals m ed ia ted by an a s -y e t-u n d e te rm in ed T L R o r a com bina tion of TLR s.

Studies o f bo th experim en ta l m odels and p a tien ts with g e netic defects have ind ica ted a m ajo r role fo r gam m a in te rferon (IF N -7 ) in host resistance to M ycobacterium tuberculosis (5, 7, 11), This typically T -ly m phocy te-dependen t response is thought to be d riven prim arily by p ro in flam m ato iy cytokines such as in te rleu k in 12 (IL -12) and IL-18 th a t a re stim u la ted by innate recognition events occurring soon a fte r initial infection. W hile an tig en -p resen tin g cells (A P C ) such as d endritic cells and m acrophages a re likely sources o f these in itiating C5'to- kines, the recep to r-m y co b ac te ria l ligand in te rac tio n s resp o n sib le for A P C triggering in vivo have no t b een clearly defined. M em bers o f th e T oll-like re ce p to r (T L R ) fam ily a re m ajo r can d idates for th e h o st recep to rs involved in the innate reco g nition of m ycobacteria . T L R s are cvolutionarily conserved p ro teins that have b een show n to d e tect m olecu lar p a tte rn s in nearly every class o f in fec tious m icroorgan ism (15). T h eir ligation leads to p ro in flam m ato ry cytokinc p ro d u c tio n and up- regu lated co stim ulato ry m olecu le expression by A P C (15). In v itro studies have show n th a t M. tuberculosis possesses p o ten t agonists for a n u m b er o f T L R s, including T L R 2 (4, 12, 17, 28, 29) and T L R 4 (1, 17), Surprisingly, m ice defic ient in T L R 2 (18, 25), T L R 4 (1, 6 , 18, 23), o r T L R 6 (25) show no defects in acu te resistance to a c ro g e n ic M tuberculosis infections. A dditionally , a rccen t rep o rt has show n th a t gene expression in m acrophages infccted with M. tuberculosis in v itro is largely in d ep en d en t of the T L R in trace llu la r a d a p to r m olecu le m yeloid d ifferen tia tion factor 88 (M yD 88) (22). T h ese stud ies raise the question o f w h e th er T L R signaling plays any role in resistance to M. tu berculosis.

All I 'L R s th a t have so fa r b een identified have a t least one signaling pathw ay d e p e n d e n t on M yD 88 (15), and thus mice deficient in M yDSS offer a system to test the hypothesis th a t

’ C o rre sp o n d in g a u th o r . M ailing add ress: B uild ing 50, R oom 6148, 50 Sou!h D r., lic tlie sd a , M D 20892-,S003. r i io n c : (301) 594-3454. Fa.';: (301) 402-0890. Et-niail: c scanga(i;'n ia id .nih.gov.

T L R signaling is req u ired fo r resistance to acu te tuberculosis. Since M yD 88 is also req u ired for IL-1 re ce p to r ( IL -IR ) and IL -18R signaling, th e possible involvem ent o f these recep tors m ust also be taken in to account. M yD 88“ ''^ m ice have been .shown to be highly susceptib le to a n u m b er o f pathogens, including Listeria monocytogenes (8, 21), Staphylococcus aureus (27), and Toxoplasma gond ii (19), and in a recen t study, we d e m o n s tra ted th a t these anim als a re m o re suscep tib le to M ycobacterium avium infection than e ith e r T L R 2 - o r T LR 4-defi- c ien t m ice (9).

To tes t th e req u irem en t fo r M yD 88 in host resistance to aeroso l M. tuberculosis in fection , we in fected M y D S S m i c e (3) partially backcrossed on a C57BL/6 back g ro u n d w ith 20 to 50 C P U o f th e v iru len t H 37R v stra in o f M tuberculosis by using a nose-only exposure ch am b er (C H T echnolog ies, W estw 'ood, N .J.) and com p ared th e ir survival and im m une responses to those o f w'ild-type con tro l (W T) m ice (T aconic Farm s, G cr- m antow 'n, N .Y .). In th ree sep a ra te experim ents, M yD 88-defi- cien t m ice succum bed to M. tuberculosis in fection w ith in only 42 days o f in fection , while W T m ice survived fo r > 1 8 0 days (Fig. lA ) . T h is m orta lity was ind istingu ishab le from th a t o b served w'ith sim ilarly in fec ted m ice in a sep ara te experim en t (m ean survival tim e, 41 ± 1 days). L ungs of infected anim als w ere rem oved, hom ogenized in p h osphate-buffered saline w ith 0,5% T w een 80, and p la ted on 7H11 agar p lates to en u m era te th e num bers o f bacilli. T h e m ycobacterial b u rd en in th e lungs of M yD 88“ '’ m ice was consistently higher than th a t in the W T anim als a t each tim e p o in t exam ined, reach ing a > 3-Iog difference a t th e ir tim e of d ea th (Fig. IB ). This increase in bacteria] num bers was also ev iden t in acid-fast s ta ined sections o f the sam e tissue (Fig, 2A and B). His- to p ath o lo g ical exam ination a t 3 w eeks revealed exacerbated g ran u lo m ato u s in flam m ation and necrosis in the lungs o f M yD 88“ ' ” m ice relative to those o f com parab ly in fec ted W T anim als (Fig. 2C and D ), and this dift'erence becam e even m ore p ro n o u n ced a t 5 w'eeks postin fection (d a ta no t show n). Livers

24 0 0

F IG . 1. M yDSS m ice a re m o re su scep tib le th a n W T m ice to aerogen ic M. tuberculosis in fec tio n . (A ) M yDSS ''^' m icc (d iam onds) and C 57BL/6 X I29sv (F j) W T an im ais (sq u a re s), u sed to co n tro l for the possible in fluence o f c o n ta m in a tin g 129 genes, w ere infected in g roups o f 5 to 7 m ice w ith 20 to 50 C P U o f M . tuberculosis and m o n ito red fo r sur\'ival. D a ta a re re p re sen ta tiv e o f tw o s e p a ra te experim en ts. B acteria l burdens (m ean s ± s tan d a rd e rro rs ) in th e lungs (B ) o r livers (C ) w ere also m easu red in th re e m ice p e r g ro u p a t th e tim es ind ica ted . A sterislis ind icate s tatistica lly s ignificant (P s 0 .05) d ifferen ces d e te rm in e d by u n p a ired t te st a fte r log tran s fo rm a tio n b e tw ee n C F U values in M yD 8S^''“ and W T anim als. D a ta a re re p re sen ta tiv e o f th e re su lts from tw o experim ents.

from M yD 88 ' ' m ice also show ed h ig h er m ycobacteria l loads, particu larly a t 3 weeks postin fec tio n , a tim e w hen bacteria l C F U w ere still below th e lim it o f d e tec tio n in th e W T anim als (Fig. 1C). In liver tissue, sections fro m M y D 88 m ice show ed few er lesions (0.Ü3 ± Ü.Ü2 g ra n u lo m as /1 2 x field) com pared to those of W T an im als (0.33 ± 0.18 granulom as/12X field) at the sam e 3 w eek tim e p o in t (Fig. 2, c o m p are panels E and F), desp ite th e m arked e levation in b ac teria l load (Fig. 1C). H ow ever, by 5 w eeks, b o th g ran u lo m a n u m b ers and m or-

and restim u lated w ith pu rified p ro te in derivative (S tatens Se- rum institu t, C o p en h ag en , D en m ark ), and IL-12p40 and IF N -7 w ere q u an tita ted in su p e rn a ta n ts 3 daj's la te r by enzym e-linked im m unosorben t assay as desc rib ed previously (19). A t 2 and 4 w eeks p o stin fec tion , sp lenocy tes fro m M . tubercu los is -m ftc ltd MyDSB” ^" m ice m ad e significantly less IL-12p40 and IF N -7 than did spleen cells fro m in fec ted W T anim als (Fig. 3D and E ). N evertheless, it is im p o rta n t to no te that for each of the cytokines s tud ied in vivo and ex vivo, a significant level o f

phology ap p eared com p arab le in the W T an d M y D 88 an- cytokine expression w as ev iden t even in the M yD 88im als (da ta no t show n). T hese findings suggest th a t MyDSS"''*' m ice display b o th delayed initial g ran u lo m a fo rm atio n as well as im paired con tro l o f b ac te ria l g row th w ith in th e m atu re lesions th a t eventually develop.

W e next investigated th e im m unolog ic d e fec t(s ) responsib le fo r the striking susceptib ility to M. tuberculosis exhibited by M yD 88 '' anim ais. T o ta l R N A was iso la ted fro m th e lungs by using Trizol (Inv itrogcn , San D iego , C alif.), and cD N A was p rep ared by using S u perscrip t rev erse tran sc rip ta se (RT; In- v itrogen) and sub jected to q u an tita tiv e rea l-tim e R T -PC R analysis with previously desc rib ed p rim ers (9) and a 7900H T sequence detection system (A pp lied B iosystem s, F o ste r City, C a lif ) . lL-12 and IF N -7 , two cytokines re q u ire d fo r contro l of M. tuberculosis in mice ( 10 ) and im plica ted in m ycobacterial resistance in hum ans (.5), a re in d u ced by a n u m b er of p a th o gens in an M yD 88-d e p cn d e n t m an n e r (2, 9, 19, 21). W e obsen 'ed significantly less IL -12p40 and IPN -"/ n iR N A in the lungs o f M. tiihercu los is-in íccícd M yD 88 ‘ '' ' m ice than in sim- ilaily infected W T m ice a t bo th 2 and 3 w'eeks postinfection (Fig. 3A and B). T ran scrip ts for tu m o r n ecrosis facto r alpha (TNF-o:), a n o th e r p ro in flam m ato iy cy tok ine req u ired fo r re sistance to M. tuberculosis in fec tion (10), W’ere also reduced significantly in the lungs o f in fec ted M v D 88-defic ien t anim als (Fig. 3C).

T he defccts in the IL -12 and IF N -7 resp o n ses in the knocko u t (K O ) anim als as d e tec ted by rea l-tim e R T -P C R in vivo w ere investigated fu rth e r in ox vivo rc s tim u la tio n experim ents. Splenocytes w ere p la ted at .5 X 10''’ cells/w ell in 96-well p lates

m als, suggesting th e ex istence of a lte rna tive signaling pathways fo r g enera ting th ese responses.

IF N -7 plays a m ajo r ro le in th e up-regu lation o f nitric oxide .synthase 2 (N O S2) an d th e su b seq u en t production of N O , a m etabo lite w ith an tim ycobacteria l activity both in vivo and in v itro (10). W e assessed w h e th e r im paired NO synthesis m ight con tribu te to th e e n h an ced susceptib ility o f M yD 88 '' m ice to M. tuberculosis by m easu rin g N O S2 gene expression as w'ell as its p ro d u c tio n in situ in th e lungs of infected mice. M yD 88^^^' m ice show ed inarked ly re d u ce d N 0 S 2 n iR N A levels com pared to those of W T an im als by 3 w eeks postinfection (Fig. 3F). M oreover, im m u n oh istoehem ical staining fo r NO S2, p e rform ed as described p rev iously (20), was greatly diininished in the lungs o f th e K O m ice co m p ared to those of W T anim als at th e sam e tim e p o in t (Fig. 2 G and H ). T h erefo re , M. tuberculosis-induced N O S2 expression in vivo is largely d ep enden t on M yD 88, a finding w hich co n trasts w ith the conclusion of in vitro stud ies in which th e induction o f NOS2 expression by M. tuberculosis was ob se tv ed to be M yD 88-independent (16, 22), T his d iscrepancy m ay re flect ad d itio n al dow nstream effects o f M yD 88 deficiency on N O S2 gene induction by M tubeivulosis in vivo versus in vitro .

T hese findings estab lish th a t host resistance to infection with M. tuberculosis FI37Rv is d e p e n d e n t on M yD 88 and therefore strongly im plicate T L R a n d /o r IL -l/IL -1 8 recep tor signaling in this response. P revious s tud ies using mice deficient in IL-1(30), IL -IR (13), o r IL -18 (14, 24) have revealed m inor roles for these signaling e le m en ts in th e con tro l of M. tuberculosis

2402 N O TES I n f e c t . I m m u n .

''r* -•-• - V ,i r ' .... : i--'

FIG. 2. MyD88~'~ mice infected with M. tuberculosis exhibit more bacilli, exacerbated pathology, and reduced N 0S2 expression in lungs, as well as delayed granuloma formation in liver. Formalin-fixed, paraffin-embedded lung (A to D, G, and H) and liver (E and F) tissue sections from mice 3 weeks after infection with aerosol M. tuberculosis were stained by the Kinyoun acid-fast method to detect mycobacteria (red staining) (A and B) or with hematoxylin and eosin stain (C to F). Note the absence of granulomas in panel F. NOS2 was visualized immunohistochemically in serial sections o f these same tissues (G and H). Sections shown are representative of multiple fields from the organs of at least three animals per group. Original magnifications are x63 (A and B), x5 (C and D), XIO (E and F), and X20 (G and H).

relative to the role described here for MyD88. Therefore, our results argue for a major function of TLRs in host defense against this pathogen and are consistent with previous data demonstrating a requirement for MyD88 in resistance to M. avium infection (9).

Our findings are, however, in partial disagreement with a recently published study in which MyD88“ ''“ mice aerogenically infected with the Kurono strain of M. tuberculosis

showed no increase in mortality, despite developing higher bacterial loads than WT animals (26). Moreover, no significant reduction in proinflammatory or Thl cytokine production was observed in the infected MyD88“ '“ animals (26). Since a similar infection protocol was used in both this and the present study, it is likely that the disparate results relate to differences in the bacterial strains employed. An alternative possibility is that the discrepancy is due to differences in

V o l . 72. 2004 NOTES 2403

PIG . 3. E xpress ion o f lL -12 , and T N F -a . as w ell as N O S2,is im paired in !VIyD8 8 “ '’" m ice follow ing aero g cn ic M . luberculosis in fection . R ea l- tim e R T -P C R was used to q uan tiliJ te JL -12p40 (A ), ÍF N - 7 (B ), TNF-cx (C ), and N O S 2 (F ) n iR N A exp ression in th e lungs o f in fcc ied W T (gray ba rs) and M yD 8 8 “ “ (b lack b a rs ) m ice. In p a r allel ex p erim en ts, sp lenocy tes from in fec ted W T and M y D 8 8 “ ' “ m ice w ere iso la ted and re s tim u la ted w ith pu rified p ro te in deriva tive , an d th e s u p e rn a ta n ts w ere analyzed 3 days la te r fo r IL -12p40 (D ) and IF N -7

(E ) by enzym e-linked im m u n o so rb en t assay. E ach b a r is th e m ean ( ± s tan d a rd d ev ia tio n ) o f d a ta from th re e m ice. A sterisk s in d ica te a P value o f ^ 0 .0 5 d e te rm in e d by u n p a ire d t test. D a ta a re re p re sen ta tiv e o f resu lts from th re e ex p erim en ts.

th e g e n e tic b a ck g ro u n d o f th e K O m ice used in th e two stud ies .

W hile M yD 88 ap p ears to regu la te resistance to a t least somei M. tuberculosis strains, th e specific T L R s involved have yet to be defined. P revious s tu d ies investigating T L R 2 (18, 25), T L R 4 (1. 6 , 18. 23), o r T L R 6 (25) have revealed only a m inor influence of these T L R s in th e early con tro l o f M. tuberculosis. T h ere fo re , e ith e r a T L R no t yet tes ted o r a com bina tion o f different T L R s is likely to explain the M yD 88 d ep endency of host resistance to M. tuberculosis. Since M. luberculosis H 37R v- infected M y D 88 '“ ''' m ice show ed im paired IL -12, IF N -7 , T N F -a , and N O S2 responses, it is reaso n ab le to specu la te th a t the T L R signaling pathw ays involved d e te rm in e h o st con tro l o f infection by regu la ting the p ro d u c tio n o f th ese fo u r m ediators, known to be req u ired for resistance to M. tuberculosis in m ice (10). H ow ever, since M yD 88 deficiency did no t result in a com plete e lim ina tion o f IL-12, ÍF N -7 , T N F -a , o r N 0 S 2 expression, it is possible th a t o th e r as-yet-un iden tified , T L R - d ep en d en t im m une responses co n trib u te to co n tro l o f this im p o rtan t pa thogen .

We thank Shizuo Akira and tDouglas Golenbach for generously providing the original My0 8 8 ” '"" breeders. We are also grateful to Sandy White and Jacqucline Gonzales for technical assistance and Dragaiia Jankovic for crilical reading of this paper.

R E F E R E N C E S

1. A bel, 15., N. T h ie b le m o n t, V. J . F. Q u e s n ia u x , N . B ro w n , .1. M p ag i, K . M iyake, F. B ih l, a n d B. Ryffcl. 2Ü02. T o li-Iik c r e c e p to r 4 e x p re ss io n is re q u ired to co n tro l ch ro n ic M yc o h a a e r iu m ruberculosis in fe c tio n in m ice. .Í. h n m u n o l. 169 :3155-3162.

2. A d ach i, K ., H . T s u tsu i , S .-I. K a s h iw a m u ra , E . S ek i, I I . N a k a n o , O . T ak cu ch i. K. T a k e d a . K. O k u m u ra . L . V an K a e r , H . O k a m u ra , S. A k ira , an d K. N a k a n ish i. P la sm o d iu m bcrghci in fe c tio n in m ice in d u ce s liver injury by an IL -12 and T o ll- lik e re c e p to r/m y e lo id d i f f e re n tia t io n fa c to r 8S -d ep en d en t m ec h a n ism . J. Im m u n o l. 167 :5928-5934 .

3. A d ach i, O ., T. K aw ai, K . T a k e d a , M . M a ts u m o to , H. T s u tsu i , M . vSakagaini, K . N a k a n ish i . a n d S . A k ira . 1998. T a rg e te d d is ru p t io n o f th e M yD 8S g ene re su lts in loss o f IL -1 - a n d IL -1 8 -m e d ia te d fu n c tio n . Im m u n ity 9 :143-150.

4. B rig litb ill , H , D .. D. H . L ib ra tc y , S. R . K ru tz ik , R . B. Y an g , J . T. B clisie, S. R. B Ic h a rsk i, M . M a it la n d , M . V. N o rg a rd , S . E . P levy, S. T . Sm ale , P . .1. B re n n a n , B. R , B loom , P . J . G od o w sk i, a n d R . L . M o d lin . 1999. H o s i d e fen se m ec h a n ism s trig g e re d by m ic ro b ia l l ip o p ro te in s th ro u g h T o il- lik e rec e p to rs . S c ien ce 285:732-“-736.

5. C a sa n o v a , J . L., a n d L. A b el. 2002. G e n e t ic d isse c tio n o f im m u n iiy to m yco b a c te ria : th e h u m an m o d e l. A n n u . R e v . Im n n in o l. 2 0 :5 8 1 -6 2 0 .

6 . C h a c k e ria n , A. A., T . V. P e r e r a , a n d S . M . B e h a r . 2001. G a m m a in te rfe ro n - p ro d u c in g C D 4 '' T ly m p h o cy tes in th e lu n g c o r r e la te w ith res is tan ce to in fec tio n w ith M ycobacterium tuberculosis. In fe c t. Im m u n . 69:2666-2674 .

7. C o o p e r, A. M ., D . K . D a lto n , T . A. S te w a rt , J . P . G riffen , D . G. R ussel!, an d1. M . O rn ie . 1993. D is s e m in a te d tu b e rc u lo s is in IF N -7 g e n e -d is ru p te d m ice. .1. E xp. M ed . 178 :2243-2248.

8. E d e lso n , B. T ., a n d E . R . U n a n u e . 2002. M y D S S -d ep en d en L b u t T o ll-like r e c e p to r 2 - in d e p e n d e n t in n a te im m u n iiy to L isteria: n o ro le fo r e ith e r in m ac ro p h a g e iis te r ic id a l activ ity . J . Im m u n o l. 1 6 9 :3 8 6 9 -3 8 7 5 .

9. F en g , C . G ., C . A. S c a n g a , C. M . C o lia z o -C u s to d io , A . W . C h cev er, S. Ilien y . P . C a s p a r , a n d A. S h e r . 2003. M ice lack in g m y elo id d iffe re n tia tio n fac to r 88 d isp lay p ro fo u n d e fe c t s in h o s t r e s is ta n c e a n d im m u n e re sp o n se s to M yco- bacrerium a v iu m in fe c tio n n o t e x h ib ite d by T o ll- lik e re c e p to r 2 (T L R 2 )- and T L R 4 -d e tic ie n t an im a ls . .T. Im m u n o l. 1 7 1 :4 7 5 8 -4 7 6 4 .

10. F ly n n , J . L., a n d J . C h a n . 2001. Im m u n o lo g y o f tu b e rc u lo s is . A n n u . Rev.Im m u n o l. 19 :93-129 .

n . F ly n n , J . L ., J . C h a n , K . J . T r ie b o id , D . K . D a lto n , T . S te w a rt, a n d B. R. B loom . 1993. A n e s se n tia l r o le fo r i n le r fe r o n -7 in r e s is ta n c e to M yco b a a c- riu m tuberculosis in fec tio n . J. E xp . M ed . 1 7 8 :2 2 4 9 -2 2 5 4 .

12. .Jones, B . W ., T . K . M e a n s , K . A. H e ld w c in , M . A. K e e n , P . J . H ill, J . T . B elisle . a n d M . J . F e n io n . 2001. D ifT erent T o ll- lik e r e c e p to r ag o n is ts induce d is tin c t m ac ro p h a g e re s p o n s e s . J. L e u k o c . B io l. 69 :1 0 3 6 -1 0 4 4 .

13. Ju iF erm an.s, N . P ., S. F lo rq u in , L. C a m o g iio , A. V erb o n , A. l i . K o lk , P . S p e e lm a n , S. J . H . v a n D e v e n te r , a n d T . v a n d e r P o ll. 2000. In te r le u k in -1 sig n a lin g is e sse n tia l fo r h o s t d e fe n s e d u r in g m u rin e p u lm o n a ry tu b ercu lo sis . J. In fe c t, D is. 1 8 2 :902-908 .

14. K in jo , Y., K . K a w a k am i, K . l ie z u , S . Y a ra , K . M iy a g i, Y. K og u ch i, T. I lo s h in o , M . O k a m o to , Y. K a w a se , K . Y o k o ta , K . Y o sh in o , K . T a k e d a , S. . \k i r a , a n d A. S a ilo . 2002. C o n tr ib u tio n o f IL -1 8 to T h l re sp o n se and hose d e fe n se a g a in s t in fe c tio n by M yco b a c ter iu m tuberculosis: a c o m p a ra tiv e study w ith IL -12p40 . J . Im m u n o l. 1 6 9 :3 2 3 -3 2 9 .

15. K o p p , E ., a n d R . M e d zh ito v . 2003. R e c o g n itio n o f m ic ro b ia l in fec tio n by T o ll- lik e rec e p to rs . C u rr , O p in . Im m u n o l. 1 5 :3 9 6 -4 0 1 .

16. M e a n s , T . K ., B. W . J o n e s , A. B. S c h ro m m , B. A. ShurtlefF , J . A. S m ith , .1. K e a n e , 0 . T. G o len b o ck , S. N . V ogel, a n d M . J . F e n to n . 2001. D iffe ren tial e ffec ts o f a T o ll- lik e r e c e p to r a n ta g o n is t o n M yco b a cteriu m tuberculosis- in d u ced m ac ro p h a g e re sp o n se s . J . Im m u n o l. 166 :40 7 4 -4 0 8 2 .

17. M e a n s , T . K ., S . W an g , E . L ie n , A. Y o s h im u ra , D . T . G o len b o ck , a n d M . J . F e n to n . 1999. H u m a n T o ll- lik e re c e p to rs m e d ia te c e llu la r ac tiv a tio n by M. tuberculosis. J. Im m u n o l. 1 6 3 :3 9 2 0 -3 9 2 7 .

18. R e ilin g , N., C . H o lsc b e r , A. F e b re n b a c h , S. K ro g e r , C . J . K irsc h n in g , S. G o y ert, a n d S. E h le rs . 2Ü02. C u ttin g ed g e : T o ll- lik e r e c e p to r (T L R )2 - and T L R 4 -m e d ia te d p a th o g e n re c o g n itio n in r e s is ta n c e to a irb o rn e infection w ith M ycobacterium tuberculosis. J. Im m u n o l. 1 6 9 :3480-3484 .

19. S c a n g a , C . A., J . A lib e r ti, D . J a n k o v ic , F . T illo y , S. B c n n o u n a , E . Y. D enkers. R. M ed zh ito v , a n d A. S h e r . 2002. C u t tin g ed g e : M y D 88 is re q u ired fo r re s is ta n c e to T oxop lasm a g o n d ii in fe c tio n a n d r e g u la te s p a ra s ite -in d u c e d I L 4 2 p ro d u c tio n by d e n d r i t ic cells. J. Im m u n o l. 16'^8:5997-6001.

20. S c a n g a , C . A., V. P . M o h a n , K . Y u, H . J o s e p h , K . T a n a k a , J . C h a n , a n d J . L. F ly n n . 2000. D e p le tio n o f CL)4 ' T cells c a u se s re a c t iv a t io n o f m u rin e k tlcnl tu b e rc u lo s is de.spite c o n tin u e d e x p re s s io n o f IF N -7 a n d N 0 S 2 . J . Exp. M ed, 192:347-358,

21. S ckl, E ., H . T s u tsu i , N . M . T s u ji, N . H a y a s h i, K . A d ach i, H . N ak an o , S. F u ta ts u g i-Y u m ik u ra , O . T a k e u c h i, K . H o s h in o , S. A k ira , J . F u jim o to , a n d K. N a k a n ish i . 2002. C ritic a l ro le s o f m y elo id d i lfe re n tia t io n fa c to r 88-depen- d e n l p ro in lla m m a to ry c y to k in e re le a se in ea rly p h a se c le a ra n c e o f Listeria m onocytogenes. J. Im m u n o l. 1 6 9 :3 8 6 3 -3 8 6 8 .

22. S h i, S ., C . N a th a n , D. S c h n a p p in g e r , J . D re n k o w , M . F u o r te s , E. Block. A. D ing , T . R . G rtn g c i a s , G . S c h o o ln ik , S. A k ira , K . T a k e d a , a n d S. IChrt. 2003. M y D 88 p r im e s m a c ro p h a g e s fo r fu ll-sc a le ac tiv a tio n by interfcron--Y yet

2404 NOTES Infect. Immun.

m ed ia te s few re sp o n se s {d M xco b a c ter iu n i tuberculosis. J. E xp. M ed. 198 :987- ‘97.23. S h im , T. S., 0 . C . T u r n e r . ; in d I. M . O rm e . 2003. T o ll- lik c re c e p to r 4 plays

no ro le in su sce p tib ility o f m ic e io M yco b a c ter iu m tuberculosis. T u b ercu lo sis (E d in b u rg h ) 8 3 :3 6 7 -3 7 1 .

24. vSu<>aN\ar:i, 1., H . Y am a(5a, I I. K a n c k o , S. M i/,iino , K . T akeda, a n d S. A k ira . 1999. R o le o f in le r!e u k in -1 8 ( IL - IS ) in m y co b actcriiil in fec tio n in IL -IS - g e n e -d is ru p le d m ice, in fe c t. Im m u n . 6 7 :2 5 8 5 -2 5 8 9 .

25. S u g aw ara , I., H . V a n ia d a , C . L i, S. M iz n n o , O . T a k e iic h i, a n d S. A k ira . 2003. M ycob iic teria l in fec tio n in 'l 'L R 2 a n d T I .R 6 k n o c k o u t m ice. M icrobio l. Im - m unu l, 47 :327-330 ,

26. S u g aw ara , I., II. Y a n ia d a , S. M iz iin n , K. T a k c d a , a n d S. A k ira . 2003. M yc o b ac te ria l in fe c tio n in M y D S 8-d e ñ c ie n t m ice. M ic ro b io l. Im m u n o l. 4 7 :8 4 1 - 847.

27. T a k c u c h i, O ., K . H o sh in o , a n d S. A k ira . 2000. C u ttin g ed g e : T L R 2 -d e f ic ie n t a n d M y D 88-d e f ic ie n t m ice a re highly su sce p tib le to S ia p h ylo co ccu s aureus in fe c tio n . J . Im m u n o l. 165 :5392-5396.

28. T h ü in a - l is z y n s k i, S., S. S le n g e r , O . T a k c u c h i, M . T. O c h o a , M . E n c e le , P . A. S ie lin g , P . F . B a rn e s , M . R o liinghoff, P . L. BoIc.skei, M . W a g n er , S. A k ira , M , V. N o rg a rd , J . T . l ie lis fe , P . J . G o dow sk i, !í. R . lilo o m , a n d R . L. M o d lin . 1999. In d u c tio n o f d irc c t a n tim ic ro b ia l activ ity th ro u g h m a m m a lia n T o ll- lik e re c e p to rs . S c ien ce 291 :1 5 4 4 -1 5 4 7 .

29. U n d e rh il l , D . M ., A. O z in sk y , K . D. S m ith , a n d A. A d erem . 1999. T o ll-lik e r e c e p lo r -2 m e d ia te s m y c o b a c te r ia - in d u ce d p ro in ila m m a to ry s ig n a lin g in m a c ro p h a g e s . P ro c . N a tl. A cad . Sci. U S A 96:14459-14465 .

30. Y a m a d a , H ., S. M iz u n o , R . H o ra i, Y. Iw a k u ra , a n d I. S u g a w a ra . 2000. P ro te c tiv e ro le o f in te rIeu k in -1 in m y co b ac teria l in fe c tio n in IL -U v 'P d o u b le k n o c k o u t m ice . L a b . In v estig . 80 :759-767 .

E d ito r J. F. U rban . Jr.

II

A R T I C L E

T L R 9 r e g u la t e s T h l r e s p o n s e s a n d c o o p e r a t e s

w i t h T L R 2 in m e d ia t in g o p t im a l r e s is t a n c e

t o M y c o b a c te r iu m tu b e rc u lo s is

Andre Bafica/-’ Charles A. Scanga,' Carl G. Feng/ Cynthia Leifer,- A llen Cheever/ and Alan Sher’

Mmmunobiologv Section, Labotatorv of Parasitic Diseases, and -Experimental Immunology Branch, National Cancer Institute, National institutes of Health, Bethesda, MD 20892’Laboratorio de Imunorregulacao e Microbiología, Centro de Pesquisas Goncaio Moniz, FIOCRUZ, Bahia 40296-710, Brazil Biomedical Research Institute, Rockville, MD 20852

To investigate the role of Toll-like receptor (TLR)9 in the immune response to mycobacteria as well as its cooperation with TLR2, a receptor known to be triggered by several major mycobacterial ligands, we analyzed the resistance of TLR9“ /" as well as TLR2/9 double knockout mice to aerosol infection with Mycobacterium tuberculosis. Infected TLR9” /’ but notTLR2 “ /“ mice displayed defective mycobacteria-induced interleukin (1L)-I2p40 and interferon (IFN) - 7 responses in vivo, but in common with TLR2“ “ animals, the TLR9“/“ mice exhibited only minor reductions in acute resistance to low dose pathogen challenge. When compared with either of the single TLR-deficient animals, TLR2/9“ ~ mice displayed markedly enhanced susceptibility to infection in association with combined defects in proinflammatory cytokine production in vitro, IFN- 7 recall responses ex vivo, and altered pulmonary pathology. Cooperation between TLR9 and TLR2 was also evident at the level of the in vitro response to live M. tuberculosis, where dendritic cells and macrophages from TLR2/9~/“ mice exhibited a greater defect in IL-12 response than the equivalent cell populations from single TLR9-deficient animals. These findings reveal a previously unappreciated role for TLR9 in the host response to M. tuberculosis and illustrate TLR collaboration in host resistance to a major human pathogen.

CORRESPONDENCE Andre Bafica: abafica(5)nÍ3Íd.nih.aov ORAlan Sher:[email protected]>rfviations iisc-d: BCG.

of Calniccu* and Guerin; BiMDCs, BM-df.-nvcd DCs- BMiM, BM-dt'iivcd inacrnphacs; DKO, double KO; MOl, nuiitiplicity (it'iiitcction; TLi , 'I'oll-likf

T o ll-lik e recep tors (TLRs) are th o u g h t to play a critical role in b o th innate resistance and the in itia tion o t adaptive im m unity to infectious agents (1, 2). T L R s are k n ow n to recognize d istinct m olecu lar structures on m icrobes, and in several cases (e.g., recognition o f viruses by T L R 3 , T L R 7 , T L R 8 , and T L R 9), different sets of T L R s have been associated w ith the response to d ifleren t classes o f m icroorganism s(1). A lthough the available evidence suggests th a t m u ltip le ra ther than single T L R s are req u ired fo r innate defense against m ost pa tho gens (for rev iew see reference 2), it is no t clear h ow signals fi'oui difierent T LR s are orchestrated in generating a protective response. In paiticular, th ere is con troversy as to w hether at the in vivo level m ultiple T L R interactions are required to trigger individual effector elements or w hether T L R c o o p era tio n stems from the u iteraction

A. B.ifioa and G..\. Scanga contrihiiied eqiuilly ro tliii woi'k. Tilt' online \’er.sion of chis ariick* conuins suppietneriLal niatfnal,

o f distinct effector m echanism s, each triggered by indiv idual T L R s.

T L R signahng has been postulated to have a m ajo r in v o lv em en t in the regulation o f host resistance to Mycobacterimn tuberculosis (3, 4), an im p o rtan t hu m an pathogen that infects over one third o f the w orld’s population (5). Im m unological co n tro l o f M . tiibeiriilosis infection has been show n to depend on T h l CD4'*‘ T cells as w ell as T N F , IF N -7 , and IL-12 (6-14). T h e latter cy tok ine, p roduced largely by APCs such as D C s and m acrophages, is th o ugh t to function in m ycobacterial im m unity by both indvicing and m ain tain ing the T h l-m ed ia ted IF N - 7 response (8, 9, 15). M . tuberculosis as well as o ther m ycobacteria contain well-characterized T L R ligands that are po ten t in vitro stimuli o f a n u m b er o f p ro inflam m atory cytokines, including T N F and IL -12 (16-19), A role for T L R signaling in host resistance to M, tuberculosis is fu rth er supported by the observation that mice deficient in M y D 88, a m ajor adaptor molecule

V=', 202, )•](., i:-, Dcccrnbc-r 19. 2005 17ir)-1724 wwwjerT;,org/cgi/doi,''lD.1084/jcm.20051732Supplemental Materia! can be found at; http;//www .jem.org/cgi/contenl/fuII/jem.20051782/DC1

mailto:[email protected]

required for signaling events by m ost T L R / I L - I R family m em bers, show greatly enhanced susceptibility to aerosol in fection w ith the pathogen, equivalent to that observed with lF N -7 -d e fic ien t m ice (20, 11). Infected M y D 88“ ''“ animals, in addition to their loss o f resistance, display im paired p ro in - flam m atory cytokine synthesis, w hich was found to correlate w kh decreased nitric oxide synthase 2 expression and d im in ished IF N -7 synthesis (20). In addition, M y D 88-deficient APC's display a m arked reduction in the synthesis o f lL -1 2 , T N F , and nitric oxide w h en exposed to M . tubcyailosis in vitro (2 1 , 22),

A lthough N4yD88 appears to play a m ajor role in resistance to M . tuberculosis, it has been difficult to attribu te this requ irem en t to the function o f a single T L R . Thus, m ice deticient in T L R 2 , T L R 4 , T L R 6 , IL-1. o r IL-18, although in som e cases displaying specific defects in antim ycobacterial responses, exhibit only m in o r increases in suscepitibility to low dose aerogem c challenge (23-28). For exam ple, M . tu- beirnlosis-mfcczed T L R 2 “ ''“ m ice, a lthough show ing defective granulom a form ation, display only a small elevation in pu lm onary bacterial loads late in infection and survive for at least 150 d (28). Interestingly, how ever, w h en infected w ith unconventionally high doses o f M . tuberculosis. T L R 2 “ '’“ b u t no t T L R 4 “ ''‘“ m ice exh ib it greatly enhanced susceptibility com pared w ith W T animals (23, 24). This loss in resistance is accom panied by alterations in proinflam m atory cytokine and nitric ox ide synthase 2 expression as well as the pu lm onary granulom atous response (28). T L R 2 also has been show'n to play an im portan t role in the regulation o f m y co bacteria l-induced cytokine p roduction by A PC s in v itro (23, 28 -30). N evertheless, it is difficult to reconcile this evidence for T L R 2 invo lvem en t w ith the m inim al loss in resistance consistently obsen 'ed in T L R 2 m i c e challenged w ith low level physiological doses o í M . tuberculosis.

O n e in te rp reta tion o f the above findings is that host resistance to M. tuberculosis depends on a previously unevaluated T L R -lig an d in teraction . T L R 9 is one such T L R /IL - IR family m em b e r w hose in v o lv em en t in co n tro l o f M, tuberculosis infection has never been fom ially addressed, T L R 9 was initially described as recognizing unm ethylated C pG motifs in bacterial and viral D N A (31, 32) and was show n to be responsible for the im m unostim ulatory efi'ects o f these nucleic acids. In this regard, it is o f interest that the original dem onstra tion o f the adjuvant properties o f D N A em erged from studies on Mycobaacrium bovis (bacillus o f C alm ette and G uerin |IiC G J) (33) and d iat D N A from M . tuberculosis as well as o th e r m ycobacteria has subsequently been show n to contain h ighly im m unostim ula to iy C pG m otifs (34-37). T L R 9 is k n o w n to be localized in endosom es as w ell as phagolysosom es, w here it could be triggered by m ycobacterial D N A after uptake o f d ie pathogen (38-41). For diese reasons w e considered T L R 9 to be an im po rtan t candidate pa tte rn -reco g n itio n recep to r that m igh t accoun t for the M y D 88 dependency o f host resistance to .M. tuberculosis.

In this study, we show that D N A from M, tuberculosis is indeed a p o ten t stim ulus o f T L R 9 -d ep en d cn t proinflam m a-

to iy cytokine production by bo th D C s and m acrophages and that the in v itro responses o f these cells to live m ycobacteria are also partially dependent on TLR.9. In addition , our data indicate that T L R 9 plays an im po rtan t role in the regulation o f the m ycobacteria-induced T h l responses du ring A'/, tuberculosis in fec tion in vivo. Finally, w'e dem o n stra te that m ice d oubly defic ien t in T L R 9 and T L R 2 sh o w enhanced suscep tib ility to M . tuberculosis n o t observed in m ice lacking e ith e r T L R 2 or T L R 9 alone. T aken to g e th e r, these data reveal a role fo r T L R 9 in th e im m u n e response to M . tuberculosis and pixivide an im portant example o f T L R collaboration in host resistance to infection.

RESULTS DNA from M. tuberculosis induces proinflammatory cytokine responses througli a TLR9-dependent pathwayT o assess w h e th e r T L R 9 plays a ro le in A'/, tuberculosis in fection , w e first asked i f the stim ulation o f p ro inflam m atory responses by m y co b acte ria l D N A d o c u m e n te d in p rev ious studies (3 3 -3 7 ) depends on th is T L R as w o u ld be p red ic ted . As show’n in Fig. SI A, available at h t tp ; / / w w w .je m .o rg /c g i/c o n te n t/fu ll/ je m .2 0 0 5 1 7 8 2 /D C 1, purified D N A from M . tuberculosis, B C G , o r Escherichia coli stim ulated IL -12p40 p ro d u c tio n by splenic C D l l c ^ DCs from W T m ice. Im portan tly , this response was found to be T L R 9 -d e p e n d e n t as was Ai. tuberculosis D N A —induced IL- 12p40, T N F , and I F N -a p ro d u c tio n by B M -d eriv ed D C s (B M D C s; Figs. S I, B and C , and S3) and T N F and IL-6

synthesis by B M -derived m acrophages (B M M ; Fig. S I, D and E). In keep in g w ith prev iously pub lished data d em o n strating a req u irem en t fo r endosom al acid ification in im m u n e stim ulation by C p G o lig onucleo tides (42), the response o f sp lenic D C s to m y co b acte ria l D N A was found to be in h ib ited by ch lo ro q u in e trea tm e n t (no t depicted). T ak en to g eth e r, these results ind icate th a t m ycobacterial D N A is a -po ten t stim ulus for T L R 9 -d e p e n d e n t cytokine p ro d u c tio n by m urine A PC s.

The in vitro IL-12 response of APCs to M. tuberculosis hacM is regulated by both TLR9 and TLR2, whereas TNF is controlled primarily by TLR2H aving dem onstrated T L R 9 -d ep en d en t proinflam m atory responses to m y cobacteria l D N A , w e n e x t asked w h e th er T L R 9 regulates cytokine p ro d u c tio n stim ulated by live I\4. tuberculosis in freslily isolated splenic DCs. In addition, we sim ultaneously assessed the invo lvem en t o f T L R 2 because this recep to r has previously been show n to influence proinflam m atory cytokine p roduction by B M -derived A P C populations in response to A-Í. tuberculosis in fec tion (23, 28, 43).

As show n in Fig. 1 A , live M . tuberculosis induced IL- 12p40 secretion by splenic D C s in a dose-dependen t m anner, and this response was m arkedly reduced in the absence o f M y D 88 . H eat-k illed m ycobacteria also induced IL-12p40 p roduction , indicating that this response is no t dependen t on D C in fec tio n . N ev erth e le ss , in a g re e m e n t w ith a previous study (44), A'/, Uiberculosis-induced lL -12 synthesis was

TLR9 COOPERATES WITH TLR2 IN RESISTANCE TO M. TUBERCULOSIS I BQfica ct al.

http://www.jem.org/cgi/content/full/jem.20051782/DC

AR

MBdln M.tb PamSCy» CpG LPS

Figure 1. Role for both TLR9 and TLR2 in the MyD88-dependent IL-12p40 response of splenic DCs to M. tuberculosis. (A) Purified CDl 1 c+ spieen cells from WT or MyD88“'“ mice were exposed to live (MOl = 1:1 [M. tL/berculasis 1] or 3:1 [M. tuberculosis 3]] or heat-killed (MOl = 1;1 H-K M. tuberculosis l]) M. tuberculosis for 24 h. (B) WT DCs were treated w'ith 5 |xg/ml cytochalasin'D or vehicle (DMSO) for 30 min and then incubated with live M. tuberculosis (MOl = 1:1) or 10 (ig/ml LPS for 24 h.(C) DCs from WT or TLR2“'“ mice were treated with 5 |xg/ml chloroqulne 01 vehicle (saline) for 30 rnin and then stimulated with live M. tuberculosis (MOl = 1:1) for 24 h. (D) DCs from WT, MyDSS"'-, TLR2-'“, TLR9“-', and TLR2/9 were exposed to live M. tuberculosis (MOl = 1:1) or TLR agonists as described in A. In all experiments, supernatants were harvested and IL-12p40 was determined by ELISA. Results are means ± SE of triplicate measurements. Experiments shown are representative of at least three performed. *, P < 0.05 between experimental and control groups in A. B, and C. **, P < 0.05 between TLR2‘ ■' versus TLR9 values in D.

greatly im paired in the presence o f cytochalasin D , suggesting at least a partial req u irem en t fo r bacterial phagocytosis (Fig. 1 B). hiterestingly, D C s from e ith e r T L R .2- o r T L R 9 - deficient inicc displayed significandy reduced IL -12p40 p ro duction in response to hve (Fig. 1 D ) o r h eat-k illed (not depicted) M . tuberculosis, w ith T L R 9 -d e fic ien t D C s show ing the greater detect. H o w ev er, D C s fro m m ice lacking these .single T L R s w ere clearly less im paired in th e ir IL -12 responsiveness than DCs from M y D S S ’'^ anim als (Fig. 1 D). C h lo ro q u in e partially inh ib ited bacteria l-induced IL-12 synthesis by W T D C s and com plete ly b locked the response o f T L Iv 2 “ ' ' DC's to this stim ulus (Fig. 1 C ), supporting a m ajor requ irem ent for endosom al acidification in M. tuberculosis- stim ulated IL-12 p roduction .

T o test w h e th er T L R 9 and T L R 2 have add itive effects on A'/, tubcrculosis-induccd cy to k in c f iro d u ctio n , w e generated T L R 2 /9 -d e f]c ie n t m ice and tested the response o f DC;s from these double K O (f.)K O) anim als. In ipo rtandy , ,\-l. tubcrculosis-cxposcd splenic D C s from T L R 2 /9 '“' “ m ice d isplayed a p ro fo u n d I’e d u c tio n in IL -1 2 p 4 () synthesis, greater than that seen w ith e ith e r o f th e single K O animals and com parable to that seen w ith DC's fro m M y D 88-def)- c ien t m ice (1-ig. 1 D). T L R 2 /T l.T v 9 co o p era tio n was also o b se rv ed in th e 1 L -I2 p 4 0 as w e ll as p 7 0 resp o n se o f BMDC^s to M . tuberculosis (Fig. S2, available at h t tp : / /

Media M.tD LPS

Figure 2. Role of TLR9 and TLR2 in proinflammatory cytokine production by M. tuberculosis-st'intu\ated macrophages. BMM from WT, MyD88-' , TLR2-' , TLR9 -, and TLR2/9-'" were stimulated with M. tuberculosis (MOl = 1:1), 15 p-g/ml CpG, 5 |xg/ml PGN, or 100 ng/ml LPS for 24 h. (A) IL-12p40, (B) TNF, and (C) IL-6 production was measured in the culture supernatants by ELISA. Results are means ± SE of triplicate measurements. Experiments shown are representative of two performed.*, P < 0.05 between WT versus KO values.

w w w .je m .o rg /c g i/c o n te n t/fu ll/ jc m .2 0 0 5 1 7 S 2 /D C 1 ), alth o u g h in ag reem en t w ith p rev iously published data in a sim ilar in v itro system (43), levels o f the IL-12 heterod im er w ere m u ch lo w er th an th e single p40 chain. Also consistent w ith previous findings (45), no in fluence o f T L R 2 , T L R 9, or M y D 88 on type I IF N p ro d u c tio n (IF N -a) by DC's stim ulated w ith live M . tuberculosis was detected in these experim ents (Fig. S2 D).

Because m acrophages play a m ajo r role in the response to m ycobacteria, w'e also investigated T L R 2 /T L R 9 involvem ent in p roinflam m atory cy tok ine p roduction by these cells. B M M from T L R 2 - o r T L R 9 -d e fic ien t m ice show ed significant reductions in bacteria-stim ulated IL-12 synthesis (Fig, 2 A). M oreover, D K O B M M show ed reduced cytokine responses com parable to those seen in M y D 88"“''“ APC" populations (Fig. 2), suggesting th a t T L R 2 and T L R 9 act in concert in signaling IL -12 responses by these cells. In conti'ast, T N F and lL -6 p ro d u c tio n by m acrophages appeared to be controlled prim arily b y T L R 2 and n o t T L R 9 (Fig. 2, B and C). T L R 2 also appeared to preferentially regulate the low level T N F response obsei-ved in B M D C s (Fig. S2 C) and splenic DC's (not depicted).

Jüivi V'OL, 202, Di'ccrribcr 19, 2005

http://www.jem.org/cgi/content/full/jcm.200517S2/DC1

days post'5nfecxion

Figure 3. Interaction of TLR9 and TLR2 in host resistance to aerosol M. tuberculosis infection. (A) WT, TLR2-, TLR9-, TLR2/9-, and MyDSB- deficient mice were aerogenically infected with 50-100 CFUs/mouse (n = 6 õnimals per group), and survival was monitored. The results shown are representative of two independent experiments. Statistical analysis revealed that the MyD88-, TLR9-, and TLR2/9-deficient mice were significantly more susceptible (P < 0.01) than WT animals and that the survival curve of the TLR2/9“''"' mice is significantly different from that of the TLR9 (P = 0.027), TLR2 (P = 0.0053), or MyD88 (P = 0.002] animal groups, (B) Lungs from infected animals were harvested at 21 and 42 d after infection, and mycobacterial loads were determined. Results are mean ± SE of measurements from four anima Is. The experiment shown is representative of two performed. *, differences in CPUs between the KO versus WT groups that are statistically significant (P < 0.05).

Figure 4. Increased susceptibility of TLR9" " mice to high dose M. tuberculosis Infection. (A) WT, MyD88-, and TLR9-deficient mice were aerogenically infected with 500 CPUs/mouse (n = 5 animals per group) instead of the usual 50-100 CPU challenge, and survival was monitored. The results shown are representative of two independent experiments. Statistical analysis revealed that the MyD88- and TLR9-deficient mice were significantly more susceptible [P < 0.001) than WT animals and that the survival curve of the TLR9 mice is significantly different (P = 0.0042) from that of the MyD88 animal group. (B) Lungs from infected animals were harvested at 14 and 21 d after infection, and mycobacterial loads were determined. Results are mean ± SE of measurements from four animals. *, a statistically significant difference (P < 0.05) in CPUs between TLR9 'f■■ versus WT mice.

TLR2 and TLR9 cooperate in host resistance to M. tuberculosis infectionTo assess and com pare the rc-spective roles o f T L R 2 and T l,R .9 in resistance to in fe c tio n in v iv o , w e inea.sured survival, bacterial loads, and histopatholog^-’ in T L R 2 '" ''“ , T L R 9 ' , T L R 2 / 9 ' ^ ^ M y D 88“ ''“‘, and W T control m ice infected by the aerosol ro u te w ith a low dose (50-100 C PU s) o f v iru le n t M . tuberculosis. A t this challenge level, all W 7’ animals survived for at least 200 d, whereas all ,\4yD88 animals succum bed w ith in 75 d as reported p re viously (20, 21). M o st single T L R 2 '''~ and T L R 9 “ ''" m ice survived for the full 200-d p e rio d o f the experim ent, w ith some attrition occu rrin g after day 100 (Fig. 3 A). In contrast, infected T L R 2 /9 ' ' m ice began to die m uch earlier, and all succum bed w ith in 120 d (Fig. 3 A).

In several pix’vious stuclies, a m ore p rofound effect o f T L R 2 deficiency on host resistance to ¡VÍ. lubcrculosis was revealed at h igher challenge doses (23, 28). In analogous fashion, T L R 9-deÍK 'ient m ice w ere show n to be highly susceptible to challenge w ith 500 C F U s/m o u se , w ith all o f the animals no w succum bing by day 70 (Fig. 4 A).

'I he observed eflects of T L R deficiency on liost resistance coiTelated widi changes in pulm onary bacterial load measured at

days 21 and 42 after infection with a low dose inocula (Fig. 3 B). Thus, as reported previously (20, 21), MyDSB” '" mice showed greatly increased bacterial burdens' in compai-ison to W T aniinds, a difference that approached 2 logs by day 42 after infection. !n contrast, the single TLR 2~^“ and T L R 9 “ ^~ mice showed only m inor increase.s in mycobacterial loads at both time points (Fig. 3 B), and it was only at day 100 after infection that these differences in C FU s reached statistic;il significance (not depicted). Im poitandy, at day 21 after infection, T L R 2 / 9 ^ '^ animals displayed increases in pulm onaiy bacterial counts equivalent to those observed in the M y D 88' m i c e , and at day 42, the T L R 2 /9 ~ ' “ animals still m aintained significandy higher CFU s w hen com pared w ith W T or each o f the single T L R - deficient mice, albeit low er than the bacterial counts in the M yD 88 ' animals (Fig. 3 B). Similar alterations in C FU s were observed in the spleens fiôm the same animals (not depicted). Although single TLR9~^~ mice challenged with a low dose of M . tuhcnvlosis failed to display significantly higher pathogen loads than W T animals at days 21 and 42, they exhibited statistically significant increases in CFU s wlien challenged w ith the higher dose (500 CFUs) inocula (Fig. 4 B), and dtis loss in resistance co iT c la ted vi.-ith diminished ex vivo 1L-I2p40 production detected in lung hom ogenates (not depicted).

TLR9 COOPERATES W¡TH TLR2 RESISTANCE TO M, TUBERCULOSIS I Bifics et 5l.

Cooperative effects of TLR2 and TLR9 on the pulmonai^ histopathologic response to M. tuberculosisT o d e te rm in e v\'lie thcr th e in creased su scep tib ility o f T Lfi.9 and 7’L R 2 /9 ‘ mi ce is reflected in the tissue re sponse to iVI. itihcKiilosis, we exam ined the lungs o f the animals at day 42 after infection. As rep o rted previously (20), lungs Irom iVlyDSS^'’"' animals exh ib ited w idespread n ec ro sis w ith tew distinct granulom as (Fig. 5, B and G) and show ed m arked increases iii acid-fast-sta ined bacilli (Fig. 5 I.) w hen com pared w ith W T m ice (Fig. A, F. and K). .Mso m agi-eenient w ith previous studies (28), lungs from in fected TLii^2 “ m ice show ed increased inflam m ation w ith ex u b eran t po lym orphonuclear infiltrates, in terstitial p n eu - iiioiiitis, and genera! d isruption o f granulom a nioi-phology (Fig. 5. C , H , '’a n d M ).

In con trast, lungs from T L R 9 “ ' " m ice sh o w ed no m ajo r d ifference in overall h istopatho log)' (Fig. 5, D and !) or g ranu lom a num bers (not dep icted) w h en com p ared w ith lungs from sim ilar infected W T anim als. A nd like lungs fro m T L R 2 “ ''~ m ice, lungs from T L R 9 “ -'“ m ice show ed onJy m arg inal increases m ac id -fast-s tam ed bacteria (Fig. 5, K—N ). H o w ev e r, a strik ing d ifte rence was seen in the lungs

o f the day 42 in fec ted T L R 2 /9 ‘' '" anim als in com parison w ith e ith e r o f the single T L R -d e fic ie n t o r W T m ice. Sections from the fo rm er anim als displayed w idespread inflam m ation (Fig. 5, E and J), even m o re ex trem e than that seen in the T L R 2 “ ' ' m ice (Fig. 5, C and H ) and closely resem bling that observed in the M y D 88""'’“ anim als (Fig. 5, B

Figure 5. Lungs from TLR2/9” " mice display exacerbated pulmonary pathology and increased acid-fast bacilii. Formalin-fixed, paraffin- embeaded pulmonary tissue sections from day 42 infected mice were stained with l-iematoxylin and eosin (A-J), [\lote the Increased inflammation In TLR2 ' ■ and TLIÍ2/9 lungs (A and E), with rfie more extreme patiiology In the latter group. Acid-fast bacilli in lung tissue were stained with the Zlehl-I\leelsen method (K-O). Representative sections from Infected Wf (A, F, and l<), MyD88 ' - (B, G, and L), TLR2 (C, H, and M), fLR9-'' (D, I, and N), and TLR2/9"“' ' (E, J, and 0) mice are shown. Original magnification is 5 (A-E), 20 (1-J), and 10 (K-O).

Figure 6. Influence of TLR9 on the generation of IFN-7-producing CD4+ T cells and Thi-associated cytokines in M. tuberculosis-infected mice. (A) Lung cells isolated from day 30 infected mice were stimulated with anti-CD3 mAb, and intracellular IFN-7 production was determined by flow cytometry after gating lymphocyte populations by forward and side scatter parameters, fhe FACS profiles of anti-CD4~ and anti-CD8-stained lymphocytes in A are from pooled cells from two mice and are representative of results from four animals per group. The majority (85-95<>/o) of the IFN-7 plus CD4“ cells shown in the dot plots In the top panel were determined to be CD8+ T cells (unpublished data). Based on Its nonspecific staining with multiple antibodies, the CD4 dim IFN--y+ population in the lung preparations from infected MyD881(0 mice is likely to represent dead cells, consistent with their abundance in sections of the same tissue (Fig, 5, B and G). Percentage of CD4+ and CD8+ T cells that stain positively for IFN-7 calculated from the experiments shown in A. Relative expression of mRNAs for (C) and IL-12p40 (D) determined In lungs at 30 d after Infection. Results are mean ± 5E of measurements from three animals. (E) Purified splenic C04+ T cells from the same mice described in A were cocultured with BMDCs Infected with different MOIs for 72 h. IFN-7 was assayed by ELISA In culture supernatants. The means ± SE of measurements from triplicate wells are presented. The experiment shovn was performed twice with similar results. *, significantly different values (P < 0.05) between WÍ and KO ceils.

Ji:M VOL 202, Dtccniiici 19, .3005

and G). M o reover, lungs from the T L R 2 /9 animals exhibited focal necrosis, a proccss rarely seen ni W T or single T L R -d c fic ien t m ice b u t c o m m o n in M y D 88“ ' ~ mice. In addition, num erous acid -fast bacilli w ere clearly evident in lung tissue from the d o u b le T L R -d e fic ie n t hosts (Fig. 5 O ), consistent w ith the increased pu lm onary C PU s observed in these anim als (Fig. 3 B).

In contrast to TLR2, TLR9 controls IFN-y production by CD4+ T cells In M. tuberculos¡s-\nfe.cttd animalsBecause !L -1 2 -d ep en d en t IF N - 7 is a m ajo r m ediator o f resistance to M. liihciriilosis and o u r data indicated a major influence o f T L R 9 on b ac teria -induced lL -12 production in vitro (Fig. 1 D), w e asked w h e th e r defects in in vivo IF N -7 responses are also ev iden t in T L R 9 as well as in T L R 2 /9 ” ''^ mice. W hen m easured at 30 d after infection by intracellular cytokine staining after ex v ivo a n ti-C D 3 stim ulation, '^40% ot pulm onary C Y)4* cells from W T animals w ere found to secrete IF N -7 , and this response was dim inished by 60-70% in the equ iv a len t p o p u la tio n fro m M y D 88" ''“ m ice (Fig. 6 , A and B). Im portan tly , T L R 9 - '' " and T L R 2 /9 - ''- bu t no t T L R 2 -d efic ien t m ice sh o w ed significant reductions in IF N -7 ''' CD4'^ cells as w ell as in lung IF N - 7 and IL -!2p40 n iR N A expression, a lth o u g h the obsers'ed decreases w ere less than those seen in iV!yD8 8 ‘ ‘ m ice (Fig. 6 , B -D ). In contrast, n o n e o f th e K O m ice sh o w ed deficiencies in IFN-y"^ CDS'^cells (Fig. 6 B), and it is possible the retention o f this cell population in the T L R 9 a n d T L R 2 /9 ^ contributes to their partial resistance. iVleasurement o f changes in IL-12p70 p ro d u c tio n was n o t possible because the heterodim er is n o t present in suftlcient quantity in sera o r lung hoinogenates to allow d e tec tio n by ELISA.

To confirm that tliese differences reflect alterations in M . tuhcrailosisspecific T h l p rim ing , w'e tested the recall responses o f splenic C D 4 ^ T cells from day 30 infected mice u s in g ’B M D C s from W T m ice that had been infected in v itro w ith d iñeren t doses o f live m ycobacteria as APCs. As show n in Fig. 6 E, m ajo r defects in M . tuberculosisspedñc IF N -7 responses w ere observed in the T L R 9 “ ^~, M yD 88“ ''“ , and T L R 2 /9 “ ' ~ m ice b u t n o t in the T L R 2 " '^ animals.

DISCUSSIONT he gready enhanced susceptibility o f M y D 88"'"“ mice to M. tuhemilosis is perhaps the strongest evidence for a role o f T L R / IL - IR signaling in host resistance to this pathogen. N evertheless, in previous studies it has been difficult to assign this defect to the role o f any individual T L R / I L - I R family m em ber. Because mice deficient in each o f die know n T L R s have not yet been systematically screened, the possibility remains that one yet-to-be-m vestigated T L R accounts for M y D 88-dependent resistance. An alternative explanation proposed by others (2, 46) as a general concep t for T L R function is that multiple T L R s act 111 concert in d e te rm in ing pathogen control. In this study, we have identified a previously unrecognized T L R - ligand interaction that con tribu tes to the innate and adaptive im m une response to M . tuberculosis and provided clear-cut ev

idence for its cooperation w ith a second T L R sigmal in host resistance to this bacterium .

A lthough m ycobacterial D N A has long been linked to the adjuvant p roperties o f B C G as well as m ycobacteria! extracts (34-36), it is only w ith the recent discoveiy o f im m u- nostim ulatory C p G m otifs (31) and d ieir recognition by T L R 9 (47) d iat the basis o f this effect o f m ycobacteria on the im m une system has been properly appreciated. N ev ertheless, the role o f T L R 9 /D N A interaction on host resistance to AÍ. tuberculosis o r to o th er m edically im p o rtan t m ycobacteria has n ev er been systematically exanfined. T he findings presented here confirm that m ycobacterial D N A does indeed stim ulate proinflam m atoiy cytokine synthesis th ro u g h T L R 9 and fu rther establish a role for this T L R in the IL -12 and T h l responses to live M . tuberculosis in vitro as well as in vivo. A lthough these defects w ere associated w ith only m in o r increases in pu lm onar)' bacterial loads and decreases in host surv’ival at low dose challenge, T L R 9 “ ''“ m ice displayed m arkedly enhanced susceptibility w hen exposed to h igher dose bacterial inocula (Fig. 4) as described previously for T L R 2 ‘'''"' animals (23, 28), H ow ever, in d irect contrast to T L R 2 ^ ''“ m ice, infected T L R 9 ” ''“ animals did n o t show m ajo r alterations in granulom atous pathology or in v itro T N F p ro d u c tio n by APCs. T hus, although TLR 9^‘'' "' and T L R 2 "'''' m ice show' com parable changes in resistance to M . tuberculosis infection at bo th low and high dose infection , th ey exh ib it distinct im m une response defects to this pa thogen in vivo.

It is hkely th a t T L R 9 triggering by m ycobacteria requires bacterial uptake and phagolysosom al fusion, as drugs that in hibit these tw'o processes dam pened the T L R 9 -d ep en d en t IL -12 response o f A PC s. T herefore, we hypothesize that M. tuberculosis triggers T L R 9 by releasing D N A from either bacteria dying w 'ithin phagolysosom es or th rough the uptake o f dead bacilh. An alternative possibility that cannot be ruled o u t at present'is th a t m ycobacteria possess T L R 9 ligands distinct from g enom ic bacterial D N A . A recendy described p receden t is the stim ulation o f T L R 9 by hem ozom pigm ent from m alaria (48).

A lthough T L R 9 alone had distinct bu t partial effects on host resistance to M . tuberculosis, these w ere clearly enhanced in m ice doubly deficient in T L R 9 and T L R 2 as reflected in both increased bacterial load and reduced mean surviv'al. In addition, D ( 's from T L R 2 /9 D K O m ice shov\'ed greater im pairm ent in th e ir m ycobacteria-induced IL-12 responses than did the eq u iv a len t p o p u la tio n s from each o f the single T L R * ''“ animals. In each o f the above parameters, the observed effects o f the absence o f T L R 9 and T L R 2 appeared to be additive in the T L R 2 /9 D K O mice, although the p u lm onary' pathology and bacterial burden in these animals as m easured by borii C F U and acid-fast bacilli in situ staining show ed evidence o f synergy (Figs. 3 and 5, M -O ). N evertheless, in term s o f the o th er parameters analyzed, the phen o ty p e o f the TLr!^2/9 D K O animals is m ore com plex. For exam ple, redundancy was obsei*ved in the regulation o f IL-12p40 production by T L R 2 and T L R 9 in BM D Cs (Fig. S2

TLR9 COOPERATES WITH TLR2 IN RESISTANCE TO M. WBEPCUW5ISI Bafica et a

AR TICLE

A). M oreover, as discussed above, in several cases individual im m une deficiencies appeared to be linked to single TLR s. For exam ple, AÍ. niherai/ivis-induccd T N F p roduction appears to be con tro lled by TLR.2 and recall IFN -'y responses by T L R 9.

It has recently been proposed in several studies (46, 49) that T L R signals synergize in the triggering o f IL-12 and o th er T h l-p ro m o tin g m ediators by DCs. T his hypothesis, based largely on experim ents exam ining the interactions o f m ultiple T L R ligands on D C responses, argues that the in duction and m ain tenance o f an effective im m une response against m icrobes depends on the recognition o f a “ pathogen code” by a com bination o f d ifferent T LR s. O u r results partially support this concep t because som e bu t n o t all ot the M . tuhcrculosis-'mduced T L R effects w ere synergistic in vivo. .Nevertheless, it is likely that spiecitic com binations o f T L R s act in concert by instead stim ulating distinct responses that together are rec]uired for effective microbial control, a m echanism also requ iring a pathogen code. This m echanism also w ould depend on in d uction thresholds related to both the dose and kinetics o f infection .

A lthough o u r in vivo data reveal a m ajor cooperative in - teracrion b e tw een T L R 9 and T L R 2 in host resistance to m ycobacteria, this is clearly no t the case for o th er T L R com binations. T hus, T L R 2 /4 '''" m ice have been found to display un im paired resistance to M . Uibcrailosis as well as B C G infection (45, 50). M o reover, in a recen t experim ent, w e failed to observe increased susceptibility to M . lubcrculosis in animals deficient in T IR A P , an adaptor m olecule required for M yD S S -d ep en d en t signaling by bo th T L R 2 and T L R 4 , relative to m ice singly deficient in T L R 2 (unpublished data). It IS o f interest that bo th T L R 2 " ''" ' and T L R 9 ” ''" m ice display clearly enhanced susceptibility to h igh dose M . tuberculosis in fection , a p ro p e rty th a t does no t appear to be shared by T L R 4 “ ''" anim als (23). T his observation suggests that screening o f different T L R /lL -1 R ~defic ien t m ice by high dose challenge could be used as a strategy' for de tecting additional signaling receptors that cooperate w ith T L R 2 and T L R 9 in exp lain ing the M y D 88-d ep en d en t con tro l o f M, tuberculosis in fection . H av ing show n cooperation betw een tw o T L R /IL -1 R family m em bers in host resistance to this pathogen, the nex t obvious step is to de term ine w hether even greater eflects on control o f M. tuberculosis will be evident in mice w ith the appropria te triple recep tor deficiency.

T h e findings of this study in the m urine tuberculosis m odel have'several im plications for the investigation o f the role o f T L R / I L - I R in susceptibility o f hum ans to m ycobacterial infection and disease. T h e involvem ent o f these receptors has been suggested from genetic studies correlating single nucleo tide po lym orphism s w ith in the T L R 2 gene, w ith disease severity in patients infected with M . leprae (51) or susceptibility to infection in populations exposed to M. tuberculosis (52, 53). O u r observations that T L R 9 also contributes to host resistance to m ycobacterial infection suggests that polym orphism s in this gene (e.g., T LR 9 single nucleotide polym orphism s at —1,237 and —2,428; reference 54) should

also be exam ined in the same type o f genetic study and predicts that m ore extrem e disease susceptibility v,till be seen in patients w ith sim ultaneous m utations in b o th T L R 2 and T L R 9 . A t a m ore general level, the ev idence that different T L R s cooperate in de te rm in ing host resistance to infection in m urine experim ental m odels supports the n o tio n that co m p lex p o lygen ic analyses in v o lv in g th e in te rac tio n o f m ultiple ra ther than single T L R gene family alleles m igh t be required to reveal m ajor functions for the T L R /I L - IR system in innate im m unity to hum an infectious diseases.

MATERIALS AND METHODSE x p e r i m e n t a l a n im a ls . W T c o n tro l C 5 7 B L /6 m ic e w e r e p u rc h a se d

fro iii T a c o n ic F arm s. B re e d in g pairs o f M y D 88 ' , T L R 2 ' , an d

T ’LIi.9 '^ ■ m ic e w e re o b ta in e d fro m S. A k ira { O saka U n iv e rs i ty , O sak a .

Ja p a n ) v ia D . G o le n b o c k (U n iv e rs ity o f M a ssa c h u se tts M e d ic a l S c h o o l.

W o rc e s te r , M A ) a n d ÍÍ.. S e d e r (N a tio n a l In s t i tu te s o f H e a lth [ N IH ] , l ie -

rhe.sda, .M D ). T h e M y D S S ^ '^ an d T L R 9 " ' '“ m ic e h a d b e e n b ack cro ssed

to C .S 7 B L /6 io r 10 g e n e ra t io n s , a n d th e T L R 2 ' a n im a ls h a d b e e n b a c k -

c ro ssed fo r five g e n e ra t io n s . T L R 2 ,^y“ ''“ an im a ls w e r e g e n e ra te d b y m a t

in g T L R 2 ' ' ■ w i th T L R 9 -d e f ic ie n t a n im a ls . T h e s e F1 a n im a ls w e re th en

in te rc ro s s e d to d e r iv e h o m o z y g o u s T L R 2 /9 ~ ^ “ m ic e id e n t i f ie d b y P G R

o f tail sn ips (u n p u b lis h e d da ta ) . B e c a u se o f th e k n o w n in f lu e n c e o f 1 2 9 /

SvJ g e n e s in h o s t re s is ta n c e to in tr a v e n o u s M . lubcrculosis in fe c tio n (55)

a n d th e fm ite a lth o u g h r e m o te p o ss ib ility th a t th e re le v a n t g e n e s m ay h ave

b e e n re ta in e d in th e 'r i . ,R 2 ‘ p a re n ts o f th is c ross, w e c o m p a re d th e re

s is tan ce o f C 5 7 B L /6 an d B 5 /1 2 9 F 2 m ic e u n d e r th e c o n d it io n s o f lo w

d o se ae ro so l in fe c tio n u sed . In a g re e m e n t w i th s tu d ie s b y o th e r in v es tig a

to rs ( 5 6 -5 9 ) , w e obsei-ved n o s ig n if ic a n t d iffe re n c e s in su rv iv a l a n d b a c te

rial lo ad s b e tw e e n th e tw o m o u se g ro u p s { u n p u b lish e d d a ta ) . A n im als

w e re b re d an d m a in ta in e d at a n A m e ric a n A ss o c ia t io n o f L a b o ra to ry A n i

m al C a re -a c c re d i te d fac ility a t th e N a t io n a l In s t i tu te o f A lle rg y a n d In fe c

tio u s D iseases [N IA ID ] , N I H . M ic e o f b o th sex es b e tw e e n S - a n d 1 4 -w k

o ld w e re used in all e x p e r im e n ts .

T L R a g o n i s t s a n d o t h e r r e a g e n t s . T h e sy n th e tic l ip o p ro te in P am 3G ys

(S - [ 2 , .V b is { p a lm ito y lo x y ) - (2 -R S ) -p ro p y l] - iV -p a lm ito y l- (R ) -G y s - (S ) -S e r -

L y s4 "O H , trih y d ro c iilo r id e ) \^’as o b ta in e d f ro m E M C . M ic ro c o lle c tio n s . P e p -

tid eo g ly can (Staphyhcoccits mircus), u l tra -p u re LPS (E . coU 0 1 1 1 :6 4 ) , e n d o -

to x in - fre e E. coli D N A (K I2 ), an d G.pG o lig o D N A (1826) w e re p u rch ased

firoin In v iv o g e n . P u rif ied g e n o m ic D N A fro m M . lubcrculosis M 3 7 R v was

p ro v id e d b y J. Belisle (C o lo ra d o S tare U niversity ', F o r t CJollins. C O ) u n d e r

th e N I H , N IA ID c o n tra c t N O l A l-7 5 3 2 0 “ T u b e rcu lo s is R e s e a rc h M ateria ls

a n d V acc in e T e s tin g .” P u rif ied g e n o m ic D N .A fro m M ycobactm um sp (B C G )

w as p u rch a se d f ro m A n ie d c a n T y p e C u l tu r e C o lle c r io n (n o . 1 9 0 1 5D ).

C h lo ro q u in e an d cy tochalasin D w e re o b ta in e d fro m S ig m a-A ld rich .

A P C s a n d c e l l c u l t u r e s . S p le n ic C D I l c ^ cells w e re o b ta in e d b y in c u b a

tio n o f .splenic cell susp en sio n s w i th a n t i - C ! ) H c M ic ro B e a d s (M ilten y i l i io -

tec) fo r 15 m in a t 4 °C fo llow 'ed b y a w a sh in g s tep in P B S /b o v in e se ru m al

b u m in an d th e n so rte d in an A u to M A C S (iso latio n m o d e P O S S F L _ S ;

M ilte n y i B io te c ) . A nalysis o f th e so rte d cells s h o w e d p u r ity > 9 5 % .

B M D C s w e re g en e ra ted as o rig ina lly d e scrib ed e lsew h ere ( 6 0 / In b n e f

B.M cells w e re re m o v e d from th e fem u rs and tibias o f m ice an d c u ltu red in

R P M l 1640 ( G IB C O B R L ) s u p p le m e n te d w i th 2 n iM l-g lu ta m in e , h e a t-

in ac tiv a ted 10% F C S , lo t) i-tg /m l p e n ic ill in , 100 fJ.g/m i s tre p to m y c in , 5 X

l ( r 2 - m e r c a p t o e t h a n o l (co m p le te m ed ia ; all fro m S ig in a -A ld rich ). plus 20

n g /m l G M -C S r- (G IB C O B R I.) . C")n days 3 a n d 6 , c o m p le te m ed ia was added

c o n ta in in g 10 n g /m l G M -C S F . BM Li)Cs w e re used a t days 6 - 7 o f cu ltu re .

B M M w e re g e n e ra te d as d e scrib ed p rev io u s ly (61). In b r ie i, B M cells

w e re w ash ed and re su sp e n d e d in D M E M c o n ta in in g g lu co se , su p p le m e n te d

w ith 2 m M L -g lu ta m in e , 10% FC^S, 10 m M H e p e s , 100 |x g /m ! s tre p to m y

c in , 100 U / m l p en ic illin (all f ro m Sigm a-.-M drich). an d 20-30%-, 1.920 cell-

.:"M VOL 2-J2. Dccernlicr 10, 2005 1721

c o n d it io n t 'd n u :d iu m (;is ,i so u rc e o f M -C S F ) , a n d incub<itcd for 7 d ar

3 7 ‘ C. 5% CC )2.

M e ie r m e th o d , nnd th e s ig n if ican ce o f d ifie re n c e s w as ca lcu lated by the lo g -

ran k test. V alues o f P < 0 .0 5 w e re c o n s id e re d statistically significant.

M . {¡ibcrculosis i n f e c t io n s . F o r in v itro e x p o su re o f A P C s to M . lubcmilosis,

the v iru le n t strain I1 3 7 R v w as p rep a re d from fro zen s tocks as dcscribcd p rev i

ously (62). In som e e x p e rim en ts , m y co b a c te ria w e re k illed b y h ea tin g a t 60 °C

fo r 1 h. D C s and B M M w e re ex p o sed to d if íe re n t m u ltip lic itie s o f in fec tio n

(V lO Is) o f m y co b a c ie iii o r 'I ' l . R agonists in c o m p le te m ed ia fo r 1 8 -2 4 h . In

o n e set of e x p e rim en ts , sp len ic D C s w e re first p re in c u b a te d \\ ’ith 5 |x g /in l

c h lo ro q u in e o i‘ cv tochalasin 1) fo r 3 0 m in a t 3 7 °C . C ells w e re th en ex p o sed

to m y co b ac te ria (M O I = 1) o r 10 pLg/ml LPS as a c o n tro l. S u p e rn atan ts w ere

th en h a rv ested , and ELISAs fo r IL -1 2 p 4 0 , T N F , an d IL-G (R & D System s) as

w ell as to r IF N -ü : (PB L B io m e d ic a l L ab o rato ries) w e re p e rfo rm e d .

F o r in v iv o m y co b a c te ria l in fe c tio n , m ic e w e re in fe c te d as d escrib ed

p rev io u s ly (5<S). In b rie i, an iiiia ls w e re p la c e d in a c lo se d , n o s e -o n ly a e ro -

so li:ia tion system ( C I l T e c h n o lo g ie s ) a n d e x p o s e d fo r 15 n i in to n e b u liz e d

.'VI iitbnriilosis to d e liv e r 50--100 b a c te r ia /m o u s e ( lo w d o se in o cu la ). In a

d iite re n t set o t e x p e rim e n ts , m ic e w e re in fe c te d w i th ^ 5 0 0 b a c te r ia /m o u s e

(h igh d o se in o cu la ). T o assess m y co b a c te r ia l lo ad , lu n g s a n d sp leens w e re

h a rv e s ted at several tim es ai'ter m ie c tio n , an d tissue h o rn o g e n a te s w e re d i

lu te d in P B S /T w e e n - 2 i ' a iid c u ltu re d o n 7 H 1 1 ag a r p la tes as d e sc r ib ed

p rev io u s ly (63). C o lo n y c o u n ts w e re d e te rm in e d 21 d la te r.

F lo w c y t o n i c t r y . S in g le ceil su sp en s io n s f ro m in d iv id u a l m ic e w e re im -

m u n o s ta in e d as d escrib ed p rev io u s ly (15). In b r ie f , fo r in tra ce llu la r d e te c

tio n o f IFN -'Y , to ta l lu n g cells w e re s tim u la te d w i th 10 |x g /m l o f p la te -

b o u n d a n t i - C D 3 at 3 7 ‘'C fo r 6 h . an d b re fe ld in A w as a d d e d d u r in g th e last

2 h. C ells w e re th e n surface s ta in e d w ith n iA b to CJ.M (c lo n e R M 4 -5 ) o r

C D 8 (c lo n e 5 3 -6 .7 ) , fix ed , an d p e rn ie a b il iz e d . In tra c e llu la r I F N - 7 w as d e

te c te d w ith a n t i - I F N - 7 m A b (c lo n e X M G 1 .2 ) . D a ta w e re c o lle c te d u s in g a

F A C S C a lib u r (B D Im m u iio c y ro m e try Sy.stems) w ith C E L L Q u e s t (B D B io

sc ien ces) a n d a n a ly zed w i th F lo w jo so ftw a re (T re e S ta r) , A ll m A bs w e re

o b ta in e d f ro m B D B io sc ien ces.

M e a s u r e m e n t o f c y t o k i n e g e n e e x p r e s s i o n i n l u n g t i s s u e . T o ta l

R N A w as iso la ted f ro m lu n g s, a n d r e a l - t im e R T - P C R w as p e rfo rm e d o n

an A B I P rism 7 9 0 0 s e q u e n c e d e te c t io n system (A p p lie d B iosystem s) usin g

S Y B R G re e n P C R M a ste r M ix (A p p lie d B io sy s ten is ) a fte r R T o f 1 |xg

R N A u s in g S u p e rsc rip t II rev e rse rran .scrip tase ( In v i tro g e n ) . T h e re la tiv e

level ol g e n e ex p ressio n w as d e te rm in e d b y th e c o m p a ra tiv e th re sh o ld cycle

m e th o d as d e scrib ed by th e m a n u fa c tu re r , w h e re b y e a ch sam p le w as n o r

m alized to h p r t and ex p ressed as a fo ld c h a n g e c o m p a re d w ith u n tre a te d

c o n tro ls . T in ; to llo w in g p r im e r pairs w e re u sed ; fo r hprl: G T T G G T T A -

C A G G C C A C A C T T T G T T G (fo rw ard ) a n d G A G G G T A G G C T G G C -

C T A 'l 'A G G C T (reverse); i!-12p40: C T C A C A T C T G C T G C T C C A -

C A A G (fo rw ard ) an d A A T T T C G T G C T r C A C A C 'T T C A G G (reverse);

ijn~y: A G A G C C A G A T T A T C T C T T T C T A C C T C A G (fo rw ard ) and

C r r y r v - i 'C X ^ C C l T G C T G C r G ( rev erse).

C D 4'*’ T c e l l r e c a l l r e s p o n s e a s s a y . S p le en colls f ro m .'VI mhciriilosis-

in fec ted \V T , M y D S H '-''" , T L R 2 - , T L R 9 " a n d T L R 2 / 9 - ' - m ice w ere

n ic u b a tc d w ith a n ti -C D 4 M ic ro B e a d s (M ilte n y i B io tc c ) t o r 15 m in a t 4 “C ,

\^•ashed, an d th e n so rte d in th e A u to M A C S (M ilte n y i B io te c ) . T h e p u r if ie d

C D 4 * ' T ce lls {]()'' c e l l /m l) w e r e t h e n c o c u l t u r e d \ \ 'i th AÍ. ttihcra ilosis-

in fe c te d B M D C s (5 X U)^ c e lls /m l) fo r 7 2 h . !n p a ra lle l, 10 p -g /m l o f p la te -

b o u n d a n ti-C M )3 - (c lo n e 1 4 5 -2 C 1 3 ; B D B io sc ie n c e s) s tim u la te d C D 4 ' T

cc lk w e re c u ltu re d foi' 7 2 h as a p o s it iv e c o n tro l . I F N - 'y (iv&’D System s)

levels in c u ltu re su p e rn a tan ts w e re th e n d c - te n n in e d b y E L IS A .

H i s to p a t h o l o g y . L ungs w e re fix ed b y in fla tin g th e tissues w ith n eu tra l

b u tie i 'e d fo i'in ah n , s e c tio n e d , an d th e n s ta in e d w ith h e m a to x y lin and eosin

o r by th e Z ie h l-N e e ls e n m e th o d to d e te c t a c id -fa s t m y c o b a c te r ia .

S t a t i s t i c s . S tu d e n t’s t test w as u sed to d e te rm in e iIk- s ig n if ic a n c e o f d iffe r

ences b e tw e e n grou]>s. S u rv iv a l c u rv e s w e re g e n e ra te d u.sing the K ap lan -

O n l in e s u p p l e m e n t a l m a t e r i a L F ig. S I d e m o n s tra te s the T L R 9 d e p e n

d en ce o f p ro in f la m m a to ry c y to k in e resp o n ses b y A P C s s tim u la te d w ith m y

cobacte ria l D N A . Fig. S2 d e m o n s tra te s a m a rk e d d ec rease in M . lubcrciilosis—

s tim u la ted IL -1 2 b u t n o t T N F p r o d u c t io n b y T L R 2 /9 B M D C s w h en

c o m p a re d w i th th e e q u iv a le n t cell p o p u la t io n s f ro m single T L R o r W T

anim als. Fig. S3 sh o w s th a t M . lubcrcu lo sis-a tim u h ied type I IF N ( IF N -a )

p ro d u c tio n b y D C s d o es n o t re q u ir e TLV ^2, 'F L R 9 , o r M Y i.)8S in con trast

w ith th e T L R 9 /M y D 8 8 d e p e n d e n c e o f th e sam e c y to k in e resp o n se s tim u

lated b y m y co b a c te r ia l D N A . Figs. S 1 -S 3 a re availab le at h t t p : / / w w w .

je m ,o r g /c g i / c o n te n t / f u l l / j e m .2 0 0 5 1 7 8 2 /D C 1 .

Vi/e are grateful to Sara Hieny, Patricia Casper, and Sandy White for their invaluable

technical assistance and Drs. Ulrike W ille-Recce and Robert Seder for generously providing the TLR9"- ' mice breeders used in this study, We also thank Drs. Giorgio Trinchieri, Ricardo T. Gazzinelli, David Segal, and Karen L Elkins for their cfiticai

reading of this rrianuscript.The au thors have no conflicting financial interests.

S ubm itted : 2 S ep tem b er 2 0 0 5

A ccepted: 14 N ovem ber 2 0 0 5

REFERENCES1. T a k e d a , K ., T . K a ish o , a n d S. A k ira . 2 0 0 3 . T o ll- l ik e recep to rs . A im u .

Rev. hm unnol. 2 1 :3 3 5 -3 7 6 .2. Iw asak i, A ., an d R . M e d z h ito v . 2 0 0 4 . T o l l- l ik e r e c e p to r c o n tro l o f the

ad ap tiv e im m u n e re sp o n ses . N n i. Im m unol. 5 :9 8 7 -9 9 5 .3. K ru tz ik , S .R . , a n d R .l.„ M o d lin . 2 0 0 4 . 7 'h e ro le o f T o ll- I ik e recep to rs

in c o m b a tin g m y c o b a c te r ia . Scniin . Im m unol. 1 6 :3 5 —41.4. Q u e s n ia u x , V ., C . F re m o n d , M . J a co b s , S. P arida . D . N ic o lle , V . V er

e m e e v , F. B ih l, F. E ra rd , T . B o th a , M . D re n n a n , e t al. 2 0 0 4 . T o ll-I ik e r e c e p to r p a th w a y s in th e im m u n e resp o n ses to m y co b ac te ria . Microbes Infecí. 6 :9 4 6 -9 5 9 .

5. W o rld F le a lth O rg a n iz a t io n . T h e W o r ld H e a lth R e p o r t 2 0 0 4 . G en ev a . 32 pp.

6 . C a ru so , A .M ., N . S e rb in a , E . K le in , K . T r ie b o ld . B .R . B lo o m , a n d J .L . F ly n n . 1 9 9 9 . M ic e d e f ic ie n t in C D 4 T cells h av e on ly tran.siendy d im in ish e d levels o f I F N -g a m m a , y e t s u c c u m b to tu b ercu lo sis . J . bm nu-

nol. 1 6 2 :5 4 0 7 -5 4 1 6 .7. S canga, C .A ., V .P . M o h a n , K . Y u , H .J o .s e p h , K, T an ak a , j . C h a n , and

J .L . F ly n n . 2 0 0 0 . D e p le t io n o f C D 4'* ' T ceils causes rea c tiv a d o n o f m u r in e p e rs is te n t tu b e rc u lo s is d e sp ite c o n tin u e d exp ress io n o f intert*eron 7

an d n itr ic o x id e sy n th ase 2 .J . E x p . M ed . 1 9 2 :3 4 7 -3 5 8 .8. C o o p e r , A .M ., A .D . R o b e r ts , E .R . R h o a d e s , J .E . C allahan , D .M .

G etzy , an d I .M . O rm e . 1995. T h e ro le o f in te r le u k in -1 2 in acq u ired im m u n ity to Mycobacteriuiu tuberculosis in fe c tio n . Immimolooy. 8 4 :4 2 3 -4 3 2 .

9. F ly n n , |.L ., M .M . G o ld s te in , K .J. T r ie b o ld , J . S y p ek , S, W o lfa n d , and B .R . B lo o m . 1 9 9 5 . IL -1 2 in creases res is tan ce o f B A L B /c m ic e to M y cobacterium iubcirulosis i n f e c t io n .J . ¡mmuno!. 1 5 5 :2 5 1 5 —2524.

10. F ly n n , J .L . , M .M . G o ld s te in , J . C h a n , K .J. T r ie b o ld , K . PfetTer, C .J. L o w en s te in , R.. S c h re ib e r, T .W '. M ak , a n d R .R . B lo o m . 1995. T u m o r necrosi.s fac to r-a lp h a is r e q u ir e d in th e p ro te c tiv e im m u n e response against Mycohúcicrium tuberculosis in m ic e . Im m u n ity . 2 :5 6 1 -5 7 2 .

11. B ean , A .G ., D .R . R o a c h , I I . B r isc o e , M .P . F ran ce , H . K o rn e r , j .D . S e d g w ic k , an d W .J . B r i t to n . 1 9 9 9 . S tru c tu ra l d efic ien c ies in g ran u lo m a fo rm a tio n in T N F g e n e - ta rg e te d m ic e tm d e r lie th e h e ig h te n e d suscep tib ility to ae ro so l M ycobactcrium tuberculosis in fe c tio n , w h ic h is n o t c o m

p en sa ted fo r by ly m p h o to x in . /. Im m unol. 1 6 2 :3 5 0 4 -3 5 1 1 .12. C o o p e r , A .M .. D .K . D a l to n , T..A.. S te w a rt, J .P . CrifTm, D .G . R ussell,

an d I .M . O r m e . 1993 . D is se m in a te d tu b e rc u lo s is in in te rfe ro n 7 g en e - d is ru p te d m ic e . J . E x p . A icd. 1 7 8 :2 2 4 3 -2 2 4 7 .

13. F ly n n , J .L . , J . C h a n , K J . T r ie b o ld , D .K.. D a lto n , T .A . S tew art, andB .R . B lo o m . 1993 . A n essen tia l ro le fo r in te r le ro n 7 in resistance to

Mycolnicttriuin iuberculosis u 'ifcc tio n . /. E x p . M ed. 1 7 8 :2 2 4 9 -2 2 5 4 .14. C asan o v a . J .L . , a n d L. A b e l. 2 0 0 2 . G e iie d c d issection o f u n iiu in ity to

TLR9 COOPERATES WITH TLR2 IN RESISTANCE TO M. TUBERCULOSIS [ Bafico c;

http://www

JI.T IC L E

niy co b ac tcri.i: th e h u m a n m o d e l . A iu iu . Rcu. ¡inmuno!. 2 0 :5 8 1 -6 2 0 .

15. Ft-ng. C .G ., D . J a n k o v ic . M . K u llb e rg . A . C h e e v e r , C .A . Scanga, S. 1-iicny, 1’. C asp a r, G .S , Y .ip , a iu l A . ShtT . 2 0 0 5 . M ain te n an c e o f p u l- m o n a n ' I 'h l e f ie c io r f im c tio n in c h ro n ic tu b ercu lo sis req u ires p ersiste n t [1 -1 2 pTodticU Dn. J . Ininiiinoí. 1 7 4 :4 1 8 5 -4 1 9 2 .

IC). T Jionia-U s;!yn.sl:i, S ., S. S te n g e r , O . I 'a k e u c h i , M .T . O c iio a . M . E n télele, P .A . S ieiin j:. i> .r. B .irnt-s. M . R o iiin g lio ff . P .L . B o lcskei, M . W a g n er, e t al. 2 0 0 1 . I n d u c t io n o f d ire c t a n tim ic ro b ia l ac tiv ity tlH'CUgh m am in ah a n to ll- l ik c r c c e p to rs . Sciaicc. 2 ')1 -.1544 --1 5 47 .

17. Jo n es, B .W ., T .K . N4ean.s, K .A . H e id w e in , M .A . K e e n , P .j. H ill, J .T . B elisle, and M .J . F e n to n . 2 0 0 1 . D i i fe r e n t T o l l- l ik e rec e p to r agoinsts n id u ce d is tin c t m a c ro p h a g e resp o n ses . /. ¡..cnhoc. Biol. 69:1 ()36—l 044.

18. A bel, B.. N . T h ie b le r n o n t, V J .I - , Q u e s n ia u x , N . B ro w n , J . M p ag i, K . M iy ak e . F. B ih l, a n d B . i<.yfl^'l. 2 0 0 2 . 'f o l l - h k e re c e p to r 4 expression is req u ired to c o n tro l c h ro n ic M ycolxiacnKni lubcrailosis in fe c tio n in m ice .

J- hvujuiiol. 1 6 9 :3 1 5 5 -3 1 6 2 .

19. Feng, C .C . , C .A . S can g a , C .M . C o l la z o -C u s to d io . A .W . C h e e v e r, S. F lieny . P. C a sp a r, a n d A. S lie r . 2 0 0 3 , M ic e lac k in g m y e lo id d iffe ren tia tio n fac to r 88 d isp lay p r o fo u n d d e fec ts in h o s t res is tan ce and im m u n e response.s to MyLohacicriiim auim n in fe c tio n n o t e x h ib ite d by T o ll- lik e r e c e p to r 2 ( 'rL R .2 ) - a n d T L R 4 -d e f ic ie n t an im als. J . Imm unol. 171: 4 7 5 8 -4 7 6 4 .

20. Scanga. C .A ., A . B afica , C .G . F e n g , A .W . C h e e v e r. S. M ieny, and A. Sher. 2004 . M y D H S -d e f ic ie n t m ic e di.sp]ay a p ro fo u n d los.s in re.si.stance to Mycohiiacriwn mhcrculosh a ssoc ia ted w itli partially im p aired ’T'h1 c y to - kuie an d n itr ic o x id e i;ynthase 2 e x p ress io ii. Iitfcci. Inuvun. 7 2 :2 4 0 0 -2 4 0 4 .

21. F re m o n d , C .M ., V. Y e re m c e v , D .M . N ic o lle , M . Jaco b s, V .F.

Q u e sn ia u x , a n d B . RyfTel. 2 0 0 4 . F a ta l MyLohncicriiun tuberculosis in fe c - n o n d e sp ite a d a p tiv e im m u n e re sp o n se in th e ab sen ce o f M y D 88 . J. Clin. Inues!. 1 1 4 :1 7 9 0 -1 7 9 9 .

22 . Shi, S .. C . N a th a n . 1). S c h n a p p in g e r , J . D re n k o w , M . F u e rte s . F'. B lo ck . A . ].)ing , T .R . G in g e ra s , G . S c h o o ln ik , S, A k ira , et al. 2003 . M y f^88 p rim es m acro p h ag e .s fo r full-.scale a c tiv a tio n by in te r fe ro n - 7

\’et m ed ia te s few resp o n ses to M ytobiicicriuui iuhcnulosis. }. E xp. M ed. 1 9 8 :9 8 7 -9 9 7 .

23 . R .eiling , N . , C . H o ls c h e r , A . F e h re n b a c h . S. K ro g e r , C .j, K irsch n in g ,S. G o y e r t, an d S. IZhlers. 2 0 0 2 . C u t t in g e d g e : T o ll- l ik e r e c e p to r (T L R )2 - an d T L R 4 -m e d ia te d p a th o g e n re c o g n i tio n in resistance to

a irb o rn e in fe c tio n w it li M ycobiuierium ruberculosis. J . Imm unol. 169;3 4 8 0 -3 4 8 4 .

24 . K am ath , A .B .. J . A ir, I I . D e b b a b i , a n d S .M . B e h a r . 2 0 0 3 . T o lM ik e re c e p to r 4 -d e fe c tiv e C 3 H /f d e J m ic e a re n o t m o re su sce p tib le than o th e r C 3 I I su b stra iu s to iiv fec tio n w i th A4ycobadcriuni lubcrcuhsis. Infecí, hn - mun. 7 1 :4 1 1 2 -4 1 1 8 .

25. Sugaw ara , I., M. Y a m a d a , C . Li, S. M iz u n o , O . T a k e u c h i, an d S. A kira. 2 0 0 3 . M y c o b a c te ria ! in fe c tio n in T I .R 2 an d T L R 6 k n o c k o u t m ice . Microbiol. Iinniunol. 4 7 :3 2 7 —3 3 6 .

26 . Sugaw 'ara, I.. FI. Y a m a d a , S. F lu a , a n d S. M iz u n o . 2 0 0 1 . R o ie o f in t e r - leuk iii (IL )- l ty p e 1 r e c e p to r in m y c o b a c te r ia ] in fe c tio n , A-Iicrobiol. Im munol. 4 5 :7 4 3 -7 5 0 .

27. K in jo , Y .. K . K a w a k a m i, K . U e z u , S. Y ara . K . M iy a g i, Y . K o g u ch i, T . F lo sh in o , M . O k a m o to , Y . K a w a se , K. Y o k o ta , e t al. 2 0 0 2 . C o n t i ib u - ti(Mi of 1F.-I8 to T h 1 re sp o n se a n d h o s t d e fen se against in fe c tio n b y MyLobaciviium lubcrculosiy. a c o m p a ra t iv e s tu d y w i th 1 L -I2 p 4 0 , /, Im nui- nol. 1 6 9 :3 2 3 -3 2 9 .

28 . D re n n a n , M .B ., 1). N ic o lle . V .J . Q u e s n ia u x , M , Ja co b s , N , A llie, J. M p ag i, F 'rem o n d , H . W a g iu -r , K irsc h m n g . an d B. R yfrel, 2004 . T o ll-h k e re c e p to r 2 -d e f ic ie n t m ic e su c c u m b to Mycob,Kicriinn lubcrailo-

in fe c tio n , .iiii. /. IîUiiol. 1 6 4 :4 9 -5 7 .2 9 . iVU-.ans. 'i '.K . . U .W . Jo iie :;. A .B . S c h r o m m , \ i .A . Shin 'lleii', J .A . S m ith ,] ,

K ean t', U ,4 ', ( io le n b o c k , S .N . V o g e l , a iu i M .J . F e n to n . 2001 , D if ie r- enrial e lfec ts o t a T o ll-4 ik e r e c e p to r a n ta g o n is t o n Mycobr.cieiium nibcrai- /I’.Nj.s-induced m a[:ro p h a g e iv sp o n se s . J , luim iinol. 1 ()6 :4074“ 4082.

30 . U n d e rh ill , D .M ,, A . O z in s k y , K .O . S m ith , and A . A d e re m . 1999. 'lo l l - l ik e i e c e p to r -2 m e d ia te s m y c o b a c te r ia - in d u c e d p ro in f la n im a to ry signaliiig in m ac ro p h a g e s . /Vor. h 'a tl. .dead. Sci. U S A . 9 6 :1 4 4 5 9 -1 4 4 6 3 .

31 . K rieg , A .M ., A ,K . Y i, S, M at.son , T ,J , W .ild sc h m id t, G .A . B ishop , R .

fea sd a lc . G .A , K o r e t /k y , a n d l .) .M . K lin m a n . 1995, C iiG m otifs in

32 .

b ac teria ] I..)NA tr ig g e r d ire c t .B-cell ac tiv a tio n , \ ’aturc. 3 7 4 :5 4 ò -5 4 9 . L u n d ,J . , A . Sa to , S. A k ira , R . M e d z h ito v , and A . h vasak i. 20(¡3. T o ll- like re c e p to r 9—m e d ia te d rec o g n itio n o f H e ip e s s im p lex v iru s -2 by p la sm a cy to id d e n d r i t ic cells. _/. E xp . M ed. 1 9 8 :5 1 3 -5 2 0 .

3 3 . T o k iin a g a , T . . H . Y a m a m o to , S. S h im ad a , H . A b e , T . P u k u d a . Y .

Fujt.saw'a, Y . F u ru ta n i , O . Y a n o , T . K a tao k a , T . S u d o , e t al. 1984. A n t i tu m o r activity-' o f d e o x y rib o n u c le ic ac id tra c tio n fro m MycobiKlerinni boi'ii B C G . L Iso la tio n , p h y .sico ch en n cal c h a ra c te r iza tio n , and a n ti tu -

m o r a c d v ity , J . N a tl. Cancer Inst. 7 2 :9 5 5 -9 6 2 .34 . R o n a g h y , A .. B . |. P ra k k e n , K . T ak ab ay ash i, G .S . F ire s te in , D . B o y ie ,

N ,J . Z v a illle r . S .T . R o o r d , S. A lb an i, D .A . C a rso n , a n d E . R a z . 2 0 0 2 .

Im m u n o .s tim u h to rv ' D N A seq u en ces in flu e n ce th e co u rse o f a d ju v a n t

a rth ritis . 7 . Im m unol. 1 6 8 :5 1 -5 6 .3 5 . K rieg , .A.M . 2 0 0 1 . C p G m o tifs in b ac teria l l .)N A an d th e ir im m u n e ef

fects^ 2 0 0 2 . A n n a . R ev . Im m unol. 2 0 :7 0 9 -7 6 0 .3 6 . 7 'o k u n a g a , T . Y a m a m o ro , and S, Y a m a m o to , 1999. H o w BC Cí led

to th e d iscovery o f iin m u n o stiin u la to r> ’ D N A .J p n . J . Infecí. Dis. 5 2 :1 -1 1 ,3 7 . Y a m a m o to , S., T . Y a m a m o to , S. S h im ad a , E, K u ra m o to , O . Y a n o , T .

K a ta o k a , an d T . T o k u n a g a . 1992 . D N A fro m b ac te ria , b u t n o r f ro m v e rte b ra te s , in d u ce s in te rfe ron .s, ac tivates n a tu ra l k ille r cells an d in h ib its r u m o r g ro w tii . Microbiol. Im m unol. 3 6 :9 8 3 -9 9 7 .

38 . A h m a d -N e ja d , P ., H . H a c k e r , M . l \u r z , S. B a u e r , R .M . V ab u las, andH . W a g n e r . 2 0 0 2 . B ac te ria l C p G - D N A a n d l ip o p o ly sacch a rid es a c tiv a te T o l l- l ik e re c e p to rs a t d is tin c t ce llu la r c o m p a r tm e n ts . E u r .J . hn m u - 110!. 3 2 :1 9 5 8 -1 9 6 8 .L atz, £ . . A . S c h o e n e m e y e r , A . V is in tin . K .A . F itzg e ra ld . B .C . M o n k s .C .F . K n e tre r , E. L ien , N .J . N ilse n , T . E sp ev ik . and I.J).T. G o le n b o c k . 2 0 0 4 . T L R 9 signals a fte r tra n s lo c a tin g fi-om th e E R to C p G D N A in

th e ly so so m e . N n t. linn innol. 5 :1 9 0 —198.L eife r, C .A ., M .N . K e n n e d y , A . M a zz o n i, C , L ee , M .J. K ru h lak , an dI.X M . Segal. 2 0 0 4 . r i , .R 9 is lo ca lized in th e e n d o p la sm ic re ticu lu m p r io r to s t i m u l a t i o n . Im m unol. 1 7 3 :1 1 7 9 —1183.K alis, C ., M . G u m e n s c h e im e r , N . F re u d e n b e rg , S. T c h a p tc h e t , G . F e- je r , A . Heir,, S. A k ira , C . G alan o s, an d M .A . F re u d en b e rg , 2 0 0 5 , R e q u ire m e n t fo r T L R 9 in th e im m u n o m o d u la to ry ac tiv ity o f Propionibac- tcriuin aeries. {. h iim unol. 1 7 4 :4 2 9 5 —4 3 0 0 .R u tz , M . , J . M e tz g e r , T . G e lle r t, P . L u p p a , G .B . L ip fo rd , FL W a g n e r ,

an d S. B a u e r . 2 0 0 4 . T o l l- l ik e re c e p to r 9 b in d s s in g le -s tra n d e d C p G - D N A in a s e q u e n c e - a n d p H - d e p e n d e n t m a n n e r . E u r .J . Im m u n o l 34: 2 5 4 1 -2 5 5 0 .

4 3 . J a n g , S., S. U e m a ts u , S. A k ira , an d P . S algam e. 2 0 0 4 . IL -6 and IL -IO in d u c t io n rro m d e n d ri t ic cells in re sp o n se to MyrobiKtcriuiii lubcrculo.us is p re d o m in a n tly d e p e n d e n t o n T L R 2 -m e d ia te d re c o g n itio n . J . Im m nnoí. 1 7 3 :3 3 9 2 -3 3 9 7 .

44. F u k o n , S.A ., J .M . J o h n s e n , S .F . W o lf , D .S . S ieb u rth , and W .H . B o o m . 1996. In te r le u k in -12 p ro d u c tio n by h u m an m o n o cy te s in fec ted w ith M y cobacterium tuberculosis: ro le o f phagocy tosis. Infect, hm nun . 6 4 :2 5 2 3 -2 5 3 1 .

45 . Sh i, S ., A . B lu m e n th a l, C .M . H ic k e y , S. G a n d o tra , D . L ev y , a n d S. E h r t, 2 0 0 5 . E x p re ss io n o f m a n y im m u n o lo g ic a lly im p o r ta n t g en es in Mycobacicriuni tnbcrculosis-m fcctcd m ac ro p h a g es is in d e p e n d e n t o f b o th T L R 2 an d T L R 4 b u t d e p e n d e n t o n I F N - { a l p h a { b e ta } re c e p to r and S T A T 1 .J . Im m unol. 1 7 5 :3 3 1 8 -3 3 2 8 .N a p o lita n i, G ., A . R in a ld i . F. B e r to n i, F. S allusto , and A. L an zav ec - ch ia , 2 0 0 5 . S e lec te d T o lM ik e re c e p to r ag o n is t c o m b in a tio n s synerg isri- cally trig g e r a T h e lp e r ty p e 1-p o la r iz in g p ro g ra m in d e n d ri t ic cells. N a t. hnm unpl. 6 :7 6 9 -7 7 6 .H e m m i, H ., O . T a k e u c h i , T . K aw ai, T'. Kai.sho, S. Sato , H . S an jo , M . M a ts u m o to , K . F lo sh in o , IL W a g n e r , K . T a k e d a , and S. A kira. 2000 , A "J'o ll-like re c e p to r rec o g n iz es b ac te ria l DN.A., Nature. 4 0 8 :7 4 0 -7 4 5 . C o b a n , C . , K .J, Ish ii. T , K a w a i, H , H e m m i, S, S a to , S. U e m a ts u . M . Y 'a m am o to , O . T a k e u c h i, S. i tag ak i, N . K u m a r, et al. 2 0 0 5 . T o ll- l ik e

re c e p to r 9 m ed ia te s in n a te in in u in e ac tiv a tio n b y the m alaria p ig m e n t h e m o z o in . /. E x p . M ed. 2 0 1 :1 9 -2 5 .

G a u tie r , G ., M , H u m b e r t , F. D e a u v ie a u . M . S cu ille r, J . F lisco tt, H..E, B ates, G . T r in c h ie r i , C . C a u x , an d P . G a r ro n e . 2 0 0 5 . A ty p e I in te r fe ro n a u to c r in e - p a r a c r in e l o o p is in v o lv e d in T o l l - l ik e r e c e p t o r - in d u c e d in te r le u k in -1 2 p 7 0 se c re tio n b y d e n d ritic cells, f. E xp . M ed. 2 0 1 :1 4 3 5 -1 4 4 6 .

39

40

41

42

46

48

49

JEfv; VOL. 202, Oct:criibcr 19, 200S

5-},

56.

N ic o lle , IX . C . í -rc n io n d . X . l^ ichon , A. l io u c h o t . I. M nille t. B. R y ffel, and V J . Q u e s n ia u x . 2 0 0 4 . L o n g - te rm c o n tro l o f Mycohíií-rcriuni boui'y BCXí inicL 'tion in th e nb sen ce o f ’I 'o l l- l ik e re c e p to rs (T L R s) : in v es tig a tio n o t T L R 2 - , T L Ií,6 - , o r ^ 'L R 2 - T L R 4 - d e r ic ie n t m ice , ¡tifec!. lai-

7 2 - .6 9 9 4 -7 0 0 4 .K ang , T .J ., .nid CÍ.T. C h a e , 2 0 0 1 . D e te c t io n o f T o i l- l ik e re c e p to r 2 (7 'L R 2 ) n iu ta n o n in th e ic p ro in a to u s lep rosv p a tie n ts , FEA'IS Iinuintio!.M ed. M in-ohwl. 3 1 :5 3 -5 8 .C')gu,s. A .C . , b . Y o ldas, V. O z d e m ir , A, U g u z , S. O le e n , L tCcscv, M . C 'o sk u n . A . C illi, and O . Y e g in . 2 0 0 4 . T h e A rg 7 5 3 G L n p o ly m o rp h ism o l th e h u m a n to ll- lik e rec e j) to r 2 g en e in tuberculosi.'s d isease. Eitr.Rr.^pir. J . 2 3 :2 1 9 -2 2 3 .

B e ii-A li, M .. M .R , D a rb o u c h e . S, B o u sn in a , A . C h a b b o u . and K . D e l- lagi. 2 0 0 4 . '1 o ll- lik e re c e p to r 2 A rg 6 7 7 Trp p o ly m o rp h is m uñ a ssoc ia ted

w ith su sce p tib ility to tubercn io .sis in T u n is ia n p a tie n ts , Clin. D ia^n . Li/i. ¡niintitio!. 11 :G 25-'õ26 .

L azarus. R . . W .T . K iim e c k i, B .A . R a b y . D . V e rc e lh , L.J. P a lm er, D .j. K w iatkow '.sk i, E .K . .S ilverm an, F\ M a rt in e z , a n d S .'F . Wcis.s. 2 0 0 3 .

S in g ie -n u c le o tid e p o ly m o rp h ism s in th e T o l l- l ik e r e c e p to r 9 g en e (T L R 9 ) : frcciuencies, p a irw ise lin k a i;c d ise q u ilib r iu m , a n d h ap lo ry p es in th re e U .S . e th n ic g ro u p s and ex p lo ra to ry ' c a se -c o n rro l d isease as.soci- aticMi s tu d ies . G í7U''h;íí'.';. 8 1 :8 5 -9 1 ,

M e d in a , E .. an d R .J . N o r t l i . 1998. R e s is ta n c e ra n k in g o f so m e c o m m o n in b re d m o u se stra ins to M ycohiutciiutu lubcrculosis a n d re la tio n sh ip to m a jo r h is to c o m p a tib ility c o m p le x h a p lo ty p e a n d N r a m p i genor> 'pe.

9 3 :2 7 0 —2 74 .M a cM ic k in g , J . l ) . , R .J . N o r th , R . LaCoui-se, j .S . M u d g e tt, S.K . Shah,

and C .F . N a th a n , 1997. Id en tificatio n o f n itric o x id e synthase as a p ro te c tive locus against tuberculosis. Pioc. Natl. Acad. Sci. V S .A . 9 4 :5 2 4 3 -5 2 4 8 .

57 . F ly n n , J .L ,, M .M , G o ld s te in , K .J. T r ie b o id , B . K o lle r , an d 13.R . B lo o m , 1992. M a jo r h is to c o m p a tib ilirs ’ c o m p le x class 1 -restricted T cells are re q u ired fcTr resi.stance to MycolHKicrium tuhi‘railo.<;is in fec tio n .

Proc. N oll. Acad. Sci. L 'M . 8 9 :1 2 0 1 3 -1 2 0 1 7 .58 . B e h a r , S .M ., C .C , D a sc h e r, M .j . G ru sb y , C ,R , W a n g , and M .B . B re n

ne r. 1999. S u scep tib ility o f m ic e d e fic ie n t in C D l l . ) o r T A P I to in fec

t io n w ith Mycobacterium tiibcrculosis. J . E x p . M ed . 1 8 9 :1 9 7 3 -1 9 8 0 .59 . D 'S o u z a , C .D ., A .M . C o o p e r , A .A . F ra n k , S, F h le rs , J, T u rn e r . A.

B en d e lac , arid L M , O n n e . 2 0 0 0 . A n o v e l u o n c lass ic b e ta 2 -m ic ro g lo b - u h n - re s tr ic te d m e c h a n ism in f lu e n c in g early ly m p h o c y te a c cu m u la tio n

and s u b seq u e n t re.sistance to tu b e rc u lo s is in th e lu n g . A m . j . Respii. Cell M ol. Biol. 2 3 :1 8 8 -1 9 3 .

60 . L u tz , M .B .. N , K u k u tsc h , A .L , O g ilv ie , S. R o s s n e r , F. K o c h . N , R o m an i, an d G . S ch u ler . 1999. A n a d v a n c e d c u ltu re m e th o d fo r g e n e ra t

in g large q u a n n tie s o f h ig h ly p u re d e n d r i t ic cells fro m m o u se b o n e m a rro w . / . Inin tu iio i M ethods. 2 2 3 :7 7 —9 2 .

61 . Pvo th fuchs, A .G ., D . G ig lio t ti , K . P a lm b la d . U . A n d e rs so n , H . W igzell. and M .E . R o t te n b e r g . 2 0 0 1 . IF N - a lp h a /b e ta -d e p e n d e n t , IF N -g a m m a s e c re tio n b y b o n e m a r ro w -d e r iv e d m a c ro p h a g e s c o n tro ls an in trace llu lar b ac te ria l in fe c tio n . J , InimunoJ. 1 6 7 :6 4 5 3 —6 4 6 1 .

62 . B afica . A., C .A . S canga. M ,L . S c h ito , S. H ie n y , an d A. Sher, 2003.

C u t t in g edge: in v iv o in d u c t io n o f in te g ra te d H ÍV -1 expres.sion by m y co b a c teria is c ritica lly d e p e n d e n t o n T o l l- l ik e re c e p to r 2. /, humu- nol. 1 7 1 ;1 1 2 3 -1 1 2 7 .

63 . Dafica, A „ C .A . S canga, C . S e rh an , F. M a c h a d o . S. W h ite , A. Sher, a r \ d j . A lib erti. 2 0 0 5 . H o s t c o n tro l o f MycoòdCferinHi fubcrcuíosíí is reg u la te d b y 5 - l ip o x y g e n a s e -d e p e n d e n t iip o x in p r o d u c t io n . /. Cliu. Iin'cst. 1 1 5 :1 6 0 1 -1 6 0 6 .

TLR9 COOPlRATES WITH TLR2 IN RESISTANCE TO M. JUBERCULGSiS \ Bsiica ct al.

Related Commentary, page 1473 1 ^ cl I Q rt I f ' iD Cl I 11V/1W

H o s t c o n t r o l o f M y c o b a c t e r iu m t u b e r c u lo s is i s r e g u l a t e d b y 5 - l i p o x y g e n a s e - d e p e n d e n t

l i p o x in p r o d u c t i o nA n d r e B a f ic a , ^ - ^ C h a r l e s A . S c a n g a , ' ' C h a r l e s S e r h a n , ^ F a b i a n a M a c h a d o , S a n d y W h i t e , ' '

A l a n S h e r ,^ a n d J u l i o A l ib e r t i " *

Mmmuiiobiology Section, Laboratory of Parasitic Diseases, National Institute of Allergy and Infectious Diseases (NIAID), NIH, Bethesda, Maryland, USA. Laboratorio de Imunorregulacao e Microbiología, Centro de Pesquisas Goncalo Moniz, Fundação Oswaldo Cruz, Salvador, Bahia, Brazil.

Center for Experimental Therapeutics and Reperfusion Injury, Department of Anesthesiology, Perioperative and Pain Medicine,Brigham and Women’s Hospital, Harvard Medical School, Boston, Massachusetts, USA. ''Department of Immunology,

Duke University Medical School, Durham, North Carolina, USA.

Thl type cytokine responses are critical in the control of Mycobacterium tuberculosis infection. Recent findings indicate that 5-lipoxygenase-dependent (S-LO-dependent) lipoxins regulate host IL-12 production in vivo. Here, we establish lipoxins as key chemical mediators in resistance to M. tuberculosis infection. High levels of lipoxin A4 (LXA4) were detected in sera from infected WT but not infected 5-LO-deficient mice. Moreover, lungs fromM tuberculosis-infected S-lo"/ animals showed increased IL-12, IFN-y, and NO synthase 2 (NOS2) mRNA levels compared with the same tissues in WT mice. Similarly, splenoc)T:e recall responses were enhanced in mycobacteria-infected S-lo~/ versus WT mice. Importantly, bacterial burdens in lungs were significantlylower than those from WT mice, and this enhancement in the resistance of the animals to M. tuberculosiswas completely prevented by administration of a stable LXA4 analog. Together our results demonstrate that lipoxins negatively regulate protective Thl responses against mycobacterial infection in vivo and suggest that the inhibition of lipoxin biosynthesis could serve as a strategy for enhancing host resistance to M. tuberculosis.

IntroductionT h l-m e d ia ce d im m u n ity p lays a c ru c ia l ro le in h o s t defense against Mycobactcrium tuberculosis. C ytokines such as IL-12, IFN-y, and TN F are essential for p ro tec tio n ag a in st th is pa thogen in the m ouse m odel (1-3). A d d itio n a l evidence suggests th a t the sam e cytokines are im p o rta n t resistance factors in the h u m an im m une response against m ycobacterial in fec tio n (4-7). In add ition to the

' T h l type response m o u n te d over the course o f infection, downreg u la to ry m ed ia to rs m ay be im p o r ta n t players in co n tro llin g e.xcessive synthesis o f p ro in fla m m a to ry cytokines an d subsequent tissue dam age and c o u ld c o n tr ib u te to th e p ro m o tio n o f b acterial survaval. N evertheless, T h 2 cy tok ines su ch as IL-4 and IL-13 have been described as p laying no o r on ly a lim ited role in in vivo M. tuberculosis in fection (8-10). S im ilarly , a lth o u g h in vitro IL-10 p ro d u c tio n is a ssoc iated w ith reduced h u m a n disease (1 1 ), mice deficient in this im p o rta n t dovvnregulacory cytokine show neatiy norm al con tro l o f M. tuberculosis in fec tion (9, 10).

There is a gj'owing body o f evidence indicating th a t a class o f lipoxygenase-derived eicosanoids knovv'n as lipoxins plays an im portan t role m the im m u n o reg u la tio n o f in flam m ation-associated disease(12). We have previously show n d ia t lipoxin A.i (LXA-i), a lipid m ediator deriw d locally from 5-lipoxygenase (.S-LO) bios)'nthetic pathways, ijcts in virro as a negative rc g u la to ro f DC IL-12 p roduction criggevcd by the intracellular p ro to zo an parasite Toxoplasma gondii (13). An in ■eivo role for this pathw ay in h o s t resistance to the same pathogen

N o n s ta n d a r d a b b rc v i ii i io n s u s e d : leu k o tr ie n o B.;; 5-LO, 5-lipoxy^cnasii; LXyV4,iip(.'xin A.,; N0S2, NO synthase 2.C o n i l ic r o f im c r c s t : T h e a iu l io rs iâve cicchircd t h a t lU’ co n flic t o f lULcrc.' t exists.

C i ta r io n fo r rlii.s a r tic le : j. C//?;. /jirr.vf, 115:16!.) I - iòOíj (2005),Jo::10.]r;2/|C12. 9-19.

was suggested by the observation th a t T. gpndii-mfected 5-LO-defi- c ient m ice su ccu m b as a resu lt o f exacerbated p ro in flam m ato ry responses despite d im inished parasite num bers (14),

In the p resen t report, we asked w hether 5 -L O -dependent m echan ism s, a n d in p a rticu la r th o se m ed ia ted by lipoxins, also play a role in re g u la tin g h o st resistance to M. tuberculosis. To do so, we exam ined th e course o f in fec tion - a n d p a th o g en -in d u ced cellular im m u n e responses in 5 -L O -defic ien t m ice exposed to m ycobac teria liy aeroso l exposure. C~>ur resu lts reveal a m ajo r role for 5-LO --dependent lipoxin synthesis in the im m une m o d u la tio n o f M. tuberculosis in fection in vivo an d suggest th a t this pathw ay may be a p o ten tia l targ e t for th erapeu tic in te rven tion in tuberculosis.

ResultsM. tuberculosis-infected mice produce LXA4 in a 5-LO-dependent manner. To assess w hether 5-LO plays a t:ole in M. tuberculosis infection in vivo, we f irs t m easu red its p ro d u c ts leukotriene B,i (LTB4) and LXA4 in sera fro m B6 , 129S F2/J mice a t d ifferent tim e p o in ts after aerosol in fec tio n (3ÜÜ C FU /anim al). As show n in Figure 1, these eicosano ids were d e tec ted a t h ig h levels as early as 1 week after M. tuberculosis in fection . LXA4, b u t n o t LTB.», synthesis was m ain ta ined d u rin g ch ro n ic in fection . Im portan tly , n e ith e r eicosanoid was d e tec ted above b ack g ro u n d levels in M. tuberculosis -¡nfected 5 -k r '' anim als, w hich confirm ed the dependence o f LTB., and LXA,i on 5-LO in vivo (Figure 1, A an d B). To address the issue o f which cell p o p u la t io n is re sp o n sib le fo r 5-LO activity, we pe rfo rm ed im m u n o sta in in g fo r the enzym e in lung sections o f M. tuberculosis- infected W T mice, 5-L O -positive s ta in ing was fo u rd to colocalize w ith en d o th e liu m (Figure 1C) and F4/80* cells (Figure ID ),Taken together, these resid ts ind ica te th a t LTB4 and LX,A,j are strongly in d u ced d u rin g M. tuberculosis in fection in vivo and suggest chat

endo the lia l cells a n d m acrophages provide the source o f the 5-LO required for th e synthesis o f these eicosanoids,

S -LO -dc ficm t mice display enhanced control o fM . tuberculosis infection. To in v estig a te the role o f 5-LO in M. tuberculosis in fec tion in vivo, we assessed b acteria l b u rd e n s an d tissue h is to p a th o lo g ) ' in S-lo'/' an d c o n tro l anim als. Lungs from S-lo^'^ m ice displayed sign if ic an t re d u c tio n s in m ycobacterial load a t b o th 21 and 42 days a fte r in fec tion w hen com pared w ith sim ilarly in fected W T co n tro l an im als (F igure 2, A a n d B). S im ilar reductions in bacteria l co u n ts were observed in spleens from the sam e anim als (d a ta n o t show'n). Acid-fast s ta in in g co n firm ed th a t fewer m ycobacteria were p resen t in the lungs o f 5 -L O -defic ien t m ice com pared w ith B6 , 129S F2/J c o n tro l m ice (F igure 2, C an d D, respectively). In ad d itio n , lungs fro m 5 -L O -d efic ien t m ice in fec ted for SO days w ith A4. tuberculosis show ed d ram a tica lly red u ced tissue in f la m m a tio n com pared w ith lungs from in fected W T anim als. C o nsisten t w ith their h igh m ycobacterial b u rd en 50 days after infection, lungs from W T m ice exhibited severe, w idespread alveolitis and in terstitia l p n eum onitis as well as a reas o f necrosis (Figure 3, A an d B). In co n tra st, lungs from sim ilarly infected S-to^l' m ice displayed m uch less in flam m ation and little evicience o f tissue necrosis (Figure 3, C and D).

C o n sisten t w ith th e ir reduced bacterial load, 5-/o“''" m ice infected w ith 300 C F U /m o u se d isplayed enhanced survival com pared w ith sim ilarly in fec ted B6 , 129S F2/J mice (Figure 2F). In these experim en ts, W T m ice su ccu m b ed to aerogenicM . tuberculosis in fec tion m ore rap id ly th a n has been re p o rte d previously in m ice o f th is

F ig u re 15-LO -dependen t LXA4 and LTB4 production and 5-LO expression during M. tub e rcu lo s is infection. W T (B6, 129J F2; filled squares) and 5-LO -defic ien t (B6, 129J Alox-5; open circles) an im als were infected by aerosol exposure with an average of 300 C FU /m ouse of M. tubercu losis H37Rv and LXA4 (A) and LTB4 (B) assessed by ELISA in serum at 8, 21 and 42 days after infection. Results are m ean ± SE of m easurements from 5 anim als. *P < 0.05 betvi'een experim ental groups. Results shown are representative o f 2 independent experim ents. (C and D) WT lung sections were stained with an ti-5 -LO (red) and costa ined with anti- F4/80 (green), followed by counterstaining w ith DAPI (blue). (C) 5-LO" endothelium. (D) Several F4/80+5-LO+ cells infiltra ting pu lm onary tissue during M. tubercu losis infection. Original m agnification, ><63.

genetic stra in . We reasoned th a t th is w'as likel)' a resu lt o f the fact chat the ino cu lu m (300 CFU) was larger th a n th a t (50 CFU) used in p rio r stud ies (15). A lthough the ex tended survival o f 5-/o'''“ mice infected a t h igh dose argues for their en h an ced resistance, we also exam ined m ortalit}’ a t the m ore conven tional low' in fectious dose (50 C FU /m ouse). In this setting, b o th 5-L O ~deficient an d con tro l m ice survived a t sim ilar rates u n til 300 daj's a fte r in fec tion (Figure 2E). Nevertheless, a h ighly sign ifican t re d u c tio n in bacteria l b u rden s im ila r to th a t observed a t th e h ig h er dose o f in fec tio n was evident in the lungs o f these anim als a t days 21 an d 42 (Figure 2D). T aken tog e th e r, these resu lts d e m o n s tra te th a t 5-LO p ro m o tes b o th m ycobacterial grow th and h o st suscep tib ility to infection.

5-LO-deficient mice infected with M. tuberculosis show increased expression ofproinflammatory mediators. To de term ine w 'hether the absence o f 5-LO affects the p ro in flam m ato ry responses in duced by m ycobacteria , we stu d ied the tim e course o f expression o f the genes

F ig u re 2Increased res is tance of 5 -LO -d e fic ien t m ice to M. tubercu los is infection. Lungs from \N J (b lack bars) and 5-lo-'- (gray ba is) m ice were harvested at several tim e po in ts after infection with an average of 300 (A) or 50 (B) C FU /m ouse and m ycobacterial burdens determ ined. Results are mean ± SE of m easurem ents from 4 animals. *P < 0.05. Representative ac id-fast b a c iiii-s ta in e d sections from lungs of 50 -day-in fec ted \NJ (C) and 5-/o-^'- (D) m ice (300 CFU/anim ai) illustrate the reduction in acid-fast bacilli (red stain ing) in the KO animals. O rig inal m agnification, xS3. (E) W T 86 , 128S F2/J (filled sym bols) and 5 -LO -de fic ien t (open sym bols) an im a ls w ere aerogenica liy infected with an average of 300 C FU /m ouse (higiT dose [H iD ]; squares) or w ith 50 C FU /m ouse (low dose [LoD]; c irc les) (n = 10 an irnais per group) and survival monitored. The resu lts shown are representative of 2 independen t experim ents perform ed at each dose.

en co d in g IL-12, IFN-y, TN F, a n d N O sy n th ase 2 (N O S2; in the lungs o f M. tubcrculosis-miecteà an im als. Levels o f b o th IL-12p40 and IFN-y m RNA were found to be significantly elevated in infected 5-hr/- mice com pared u 'ith their W T co u n te rp arts (Figure 4, A and D), consistent with their dim inished m ycobacterial burdens. Despite the m arked differences in p u lm o n ary h is to p ath o lo g y (Figure 3, A and B versus C an d D), the levels o f T N F expression in lungs d id no r differ significantly between infected S-/o“/" an d \XrT mice (Figure 4E). Im portan tly , expression o f the gene encoding N O S2, an enz)'me required for h o s t resistance to M. tuberculosis in m ice (Í 6), was found to he dram atically elevated in the absence o f 5-LO a t b o th 21 an d 42 days after infection (Figure 4B). Nevertheless, no differences in IL-10 expression were observed in the lungs o f 5-/o ' ‘ versus co n tro l an im als a t the tim e in tervals exam ined (d a ta n o t shown). To confirm this gene expression da ta , we assayed IL -12p40 and T N F pro tein levels in lu n g hon iogenates fro m th e sam e m fec ted an im a ls a t day 21

after infection. As show n in Figure 4, C a n d F,5-lo-i- m ice displayed significantly increased levels o fIL -1 2 p 4 0 b u t no t TNF. In add ition , im m im o s ta in in g o f lu n g sec tions was pe rform ed in an a tte m p t to identify the cellular sou rce o f th e increased p ro in f la m m a to ry cytokm e. Few C D l Ic* cells were fo u n d to coexpress IL-12p40 in lungs o fW T an im als (Figure 5A a n d Table 1), while a h ig h er fre-

F ig u re 3Decreased inflam m ation in lungs of M. tu b e rcu lo s is -tn ie c ie á 5 -L O - de fic ient m ice. R epresen tative H & E -s ta ined sections o f lungs from 50-day-infected (300 CFU inocu lum ) B5, 129S F2/J control (A and B) and 5-LO -defic ient (C and D) an im als. Note the reduction in inflam matory infiltration and greatly increased a lveo la r space in 5-lo~'- animals (C and D). O rig inal m agnification, x5 (A and C) and x40 (B and D).

quency o f C D l lcTL-12p40" cells was fo u n d in filtrating the lungs o f 5-LO -deficient m ice (Figure 5D a n d Table 1). However, no t all o f IL-12p40 sta in ing was associated w ith C D l Ic* cells (green), which suggests th a t 5-LO regu la tes IL-12 expression in b o th DCs and o ther leukoc)'tes in the tissue infiltrates. In contrast, the expression o f TN F and N O S2 was fo u n d to be restricted to the F4/80" (m acrophage) cell population , and a lth o u g h T N F expression was sim ilar in the 2 anim al groups (Figures 5, B a n d E and Table 1), the frequency o fN O S 2 'F 4 /8 0 ' cells was drarnatically enhanced in the lungs o f the infected 5-LO -deficient mice (Figures 5, C a n d F and Table 1). These find ings bo th agree a n d c o n tra s t w ith o u r previous observations on cell-associated cj'tok ine a n d N O S2 expression du rin g T. gondii in fection in 5 -L O -defic ien t m ice (14). In chat study, we observed enhanced IL-12 p ro d u c tio n by b o th C D l Ic* and C D l lc “ ceils in b ra in tissue o f infected 5-LO -deficienc m ice b u t failed to detect sign ificant changes in N O S2 as rep o rted here.

Treatment with an LXA4 analog reverses resistance in M tuberculosis- infected 5-L0~deficient mice. 5-LO is involved in the biosynthesis o f several eicosanoids, including LXA4, chat are knowTi to m ediate local control o f infiam m acion. Therefore, it w’as critical to formally establish w 'hether the enhanced p ro tec tio n against M. tuberculosis infection, elevated level o f t)’pe 1 cytokines, an d lower mycobacterial bur-

F ig u re 45 -L O -d e fic ie n t m ice in fected w ith M. tu b e rc u lo s is d is p la y in c re a s e d e x p re s s io n of p ro in fla m m a to ry m e d ia to rs . W T and 5-/o"'''- m ice w ere a e ro g e n ica lly in fec ted (300 CFU inocu lum ), and relative expression o f m R N As for IL-12p40 (A), N 0 S 2 (B), IFN -y(D ), an dT N F (E) was de term ined in the lungs at 8, 21 and 42 days after M. tuborcu los is in fection. To fu rthe r confirm these observations, we prepared lung ho m oge na tes from the sam e an im a l groups shovvin above and de te rm in ed IL-12 (C) and Ti\!F (F) levels by ELISA. ‘ P < 0.05. The results shovvin are re p rese n ta tive o f 2 in d e pen den t experim ents. Uninf., uninfected.

research article

den in S-LO-K O m ice are indeed re la ted to th e absence o f lipoxin genera tion d u rin g infection. T o address th is issue, we adm inistered a stable lipoxin analog, ATLa2, to b o th W T con tro ls an d S-LO-defi- c ien t m ice d u rin g th e first 21 days a fte r in fection . T h is eicosanoid analog, created by design m o d ifica tio n o f the co en d o f LXA4, was show n to have increased half-life in vivo a n d to in h ib it in flam m atio n in several disease m odels (17-19). As show n in Figure 6, A and B, ATLa2 trea tm e n t ab ro g a ted th e e n h an ced co n tro l o f bacterial grow th in b o th lungs an d spleens o f 5-L O -deficient mice. N o alteratio n o f in vivo resistance was n o te d in M. tuberculosis-inítcte.á W T con tro ls trea ted w ith th e LXA4 an alo g a t th is dose. These find ings suggest th a t the levels o f endo g en o u s lipoxin p resen t in the infected 5-L O -com petent mice are already o p tim a l an d th a t additional lipoxin does n o t a lter the h o st response to M. tuberculosis infection. W hen exam in ed a t 21 days a fte r in fec tio n , th e M. tuberculosis-íníscltá

m ice treated vwth the LXA4 an alo g displayed a weakened T h l response, as evidenced by reduced IFN-y p ro d u c tio n by splenocytes re s tim u la ted ex vivo w ith M. tuberculosis an tig e n (Figure 6C) b u t una lte red T N F levels (Figure 6D). Im portan tly , ATLa2 had no direct effects on m ycobacterial p ro life ra tion in vitro , w hich argues against the possibility th a t the in vivo activity o f th is e icosanoid is due to a d irect an tib io tic effect (d a ta n o t showTi).

DiscussionP ro in flam m ato iy cytokines such as IL -12 p lay c r it ic a l ro les in th e in d u c t io n o f h o s t re sistan ce to M. tuberculosis as well as o th e r in tra ce llu la r p a th o g en s . T hese re sp o n se s m u s t be c a re fu lly r e g u la t ed to av o id h o s t tis su e d am ag e . T h e a n ti in f la m m a to ry cy to k in es IL-10 a n d T G F -P hav e b een im p l ic a te d as key p ro te in m e d ia to rs th a t p re v en t excess IL-12, T N F -a , an d IF N -7 p ro d u c tio n in in tra c e l lu la r in fec tio n s . N ev erth e le ss , these d o w n reg u la to iy cy tok ines a p p ea r

Figure 5Lung-in filtra ting D Cs and m acrophages express high levels of IL-12 and N 0 S 2 in 5 -LO -d e fic ien t hosts Infected w ith M . tubercu los is . Frozen sections o f lungs from infected (300 CPU inocu lum ) W T (A , B, and C) and 5-lo->- (D, E, and F) m ice were doub le sta ined w ith an ti- C D IIc (A and D) o r anti-F4/80 (B, C, E, and F) (green) and with a n t i- IL-12p40 (A and D), anti-TN F (B and E), o ran ti-N O S 2 (C and F) (red), then countersta ined w ith DARI (blue). Note the presence of m any more CD11c+IL-12p40+ ce lls and F4/80*-NOS2+ cells in the tissue sections from 5-/0- '- an im als. The aste risk in A indicates the presence of m u ltinuc leated ce lls a t the cen ter o f a granulom a. R epresentative m icrographs (m agnifica tion, x63) from 4 anim als per group are shown.

to have only lim ited effects in con tro lling M. tuberculosis rep lication d u rin g in fec tion in an im al m odels (8, 20). In th e p resen t study, we re p o rt evidence fo r th e role o f a novel pathw’ay involved in d a m p en in g M. tuberculosis-diiven p ro in flam m ato ry im m u n e responses an d regu la ting bacteria l g row th th a t involves the 5 -L O -dependen t p ro d u c tio n o f lipoxins.

Lipoxins such as LXA4 are b io sra th esized by d ifferen t ceU types, including leukocytes, endothelial cells, and platelets by m eans o f tran- scellular pathw ays (21). Recently, LXA4 was show n to have downreg- u lato ry actions on several pro inflam m atory m echanism s including NK cell cytotoxicity (22), leukoqT:e responses to p ro in flam m ato r) ' cytokines (23), a n d m icrobial stim u la tio n (14) as well as m ig ra tion o fb o th n eu tro p h ils (18) an d eosinophils (24). Interestingly, s tim u la tio n o f m ucosal ep ithelial cells w'ith lipoxin analogs induced the expression o f a bactericidal/perm eability-increasing p ro tein , w hich exhibits antim icrobial activities an d enables epithelial cells to engage in active m icrobial h o s t defense (25,26).

LXA4 d ra m a tic a lly red u ces T. g o n d ii-induced IL -12 p ro d u c tio n by D C s in v itro a n d by D C s as well as o th e r cells in vivo (13, 14), w hich in d ica te s a ro le fo r LXA4 in p reven ting u n c o n tro lled p ro in fla m m a to ry responses, T. gondii triggered h igh levels o f LXA4

( -1 0 0 n g /m l) in sera o f W T m ice, w hile in fec ted 5 -L O -d efic ien t m ice p ro d u ced elevated a m o u n ts ofIL -12p40. Interestingly, it was recently show n th a t T. gondii synthesizes its own LO th a t m ay play a role in increasing local co n cen tra tio n s o f LXA4 (27). In th e p rese n t rep o rt, u s in g a n aeroso l m odel o f in fection w ith M. tuberculosis, we also d e tec ted th e in d u c tio n o f h igh levels o f LXA4 as well as th e leu k o trien e LTB4 in th e se ra o f W T mice. However, LXA4 a n d LTB4 w ere in d u c e d w ith d iffe re n t k inetics, a n d o n ly LXA4 persisted a t h igh levels d u rin g ch ron ic infection. F u rth e rm o re , we observed h igh levels o f expression o f 5-LO in lu n g e n d o th e liu m an d m acrophages d u rin g infection. T he latter results suggest th a t these cell p o p u la t io n s p a rtic ip a te in lipoxin g e n e ra tio n in vivo an d m ay be specifically involved in regu lating local in flam m ato ry responses d u rin g ch ro n ic experim ental tuberculosis.

Table 1Higher frequency of CD11c+IL-12p40+ and F4/80*NOS2* cells in lung sections from M. tuber-

cü/os/s-infected 5-LO -defic ient versus W T anim als''

Group CD11C*IL-12p40+ CD11C-|L-12p40* N0S2* F4/80*TIF+ F4/80-TNF*WT 39 ±6.11 28.66 ±6.4 101 ± 19.05 16.33 ±4.8 157 ±15.77S-Zcr'- 100.16 ±6.63“ 39.5 ±4,81 182,66 ± 13,96^ 15,33 ±1,01 135,66 ±16,44

Microscopic quantitation of fluorochrome-positive cells was performed on the lung sections described in Figure 5, Results are expressed as the number of positive cells per field ± SEM determined from 10 observation fields per slide and 3 slides per mouse (3 animals/group), < 0,05 vs, WT,

researcn aríiae

Figure 6In vivo adm in is tra tion o f a stab le ana log of LXA4 in M. tu b e rcu lo s is - infected m ice. W T or 5-/o~'” m ice w ere infected by aerosol exposure w ith M. tubercu los is (300 CFU Inoculum ) and treated 3 times a week by gavage from days 2 to 20 w ith veh ic le o r ATLa2 at 100 ng /an i- m al/treatm ent. Mice were sacrificed, and mycobacterial burdens were assessed in lungs (A) and spleens (B ), 21 days after infection. Spleen cell cu ltu res from the sam e an im a ls w ere restim ulated with purified protein derivative, and 72 hours later, IFN-y (C) and TN F (D) levels vêre m easured in superna tan ts by ELISA. Results are the mean ± SD from 5 anim als per group. *P < 0.05 between groups.

W hereas T. gondii-cxposed 5-lo~'~ m ice su ccum bed rapid ly to infection , the reduced lipox in g en era tio n in mice infectedw ith M. tuberculosis was associated w ith enhanced survival a t high- dose aerosol challenge, a lth o u g h there were no ap p aren t differences in m orta lity a t the lower in o cu lu m infections. These con trasting outcom es o f the 2 in fection m odels m ay stem from differences in the in trinsic virulence a n d im m u n e-stim u la to ry properties o f the p a thogens in q u estio n . T. gondii is a h ighly v iru len t and fast-replicating m ic ro o rg an ism th a t requ ires the in d u c tio n o f a p o ten t im m u n e response to p ro te c t th e h o s t a n d p roduce chron ic pers is te n t in fec tio n s n ecessa ry fo r p ro m o tin g its tran sm iss io n . M. tuheradosis, while also in ducing la ten t infections, replicates slowly and, a t least in the m ouse m odel, induces a weaker T h l response th an does T. gondii. M enee, in the absence o f lipox 'in-m ediated co u n te rreg u la tio n , th e en su in g cellu la r responses are enhanced, triggering im m u n o p a th o lo g } ' a n d m ortality ' in T, gondii infection, w hereas in M. tuberculosis in fec tio n , th is en h an cem en t results in increased con tro l o f bacterial replication . The observed restriction in m ycol)acterial g row th docs n o t ap p ear to be com plete, however, since h igh-dose M. tetcrtW rMM-infected S-lo^'^ m ice eventually began to succum b a t LSO days a fte r infection, and this m orta lin / is associated w ith an ap p ro x im ate log increase in m ycobacterial load com pared w ith earlier rim e p o in ts (e.g., day 42) (da ta no t shown). W hether the late d ea th o f the in fec ted 5-LO defic ien t anim als is due solely lo increased bacierial b u rd en rem ains unclear.

Since 5-LO is req u ired for bt>ih leuko triene and lipoxin Iiiosyn- ihesis, reconstitu tion experim ents were perform ed to m ore direclly nsses;. the role of ilie la tte r g ro u p o f eicosanoids in the regu lation o f nij’cobacterial g ro w th in vivo. Ir.ipo rtan tl) ', a d m in is tra tio n o f

the stab le lipoxm analog ATLa2 to M. tuhcrculosis-m itcKd S-lo-'- m ice, re s to red b o th p u lm o n ary m ycobacteria l loads a n d IFN-v p ro d u c tio n by p u rified p rotein derivative-stim ulated splenocyres to levels com parab le to those observed in in fec ted W T anim als. A lthough th is observation does n o t rule o u t the possible partic ip a tio n o f o th e r 5 -L O -dependen t m ediators, it d em onstra tes th a t a deficiency in lipoxins is sufficient to explain the effects on bacterial grow th and h o st response seen in the infected 5-L O -deficient anim als. ATLa2 tre a tm e n t has previously been show n to reduce in f la m m a to ry cell in f il tra tio n in a n u m b er o f d iffe re n t disease m odels (17-19). A lthough this subject is n o t directly addressed in the p resen t article, it is probable th a t the observed effects o f ATLa2 reco n stitu tio n in o u r experim ents resu lt from decreased effector cell recru itm en t in to infected lung.

In sum m ary, o u r find ings dem o n stra te the existence o f a novel pathw ay involved in c o n tro llin g p ro in fiam m ato iy an d T h l im m une responses against M. tuberculosis infection in vivo via the generation o f ,S-LO -d ep enden t lipo.xin form ation . These observations suggest th a t the reg u la tio n o f lipox in b iosynthesis m erits fu r th e r investig a tio n as a p o ten tia l im m u n o p h a rm aco lo g ic in te rv en tio n for enhancing the con tro l o f m ycobacterial replication in tuberculosis patients. In this regard, it shou ld be no ted th a t 5-LO inhib itors are already in clinical trial for asthm a, an d therefore it m ay be possible to rapidly design and im plem ent a study testing the efficacy o f this strateg)' for in te rven tion in tuberculosis (28-30).

MethodsMice. W T c o n tro ls (B6, 129S F2/J) a n d S-LO ■deficient (B6, 129S Alo.x-S,

F2/J) m ice were o b ta in e d from T he Jackson L abo ra to ry a n d were bred and

m a in ta in ed in an N IA ID A ssociation fo r th e A ssessm ent a n d A ccreditation

o f L ab o ra to ry A nim al C are-accred ited an im a l facility. Fem ale aniinal.s 5 -8 weeks o ld were used in all experim ents. All experim ents were approved by

th e N IA ID In s ti tu tio n a l A nim al Care an d Use C om m ittee .M. tuberculosis infection. T he M. tubcrcnlasis H 37Rv s tra in was passaged

th ro u g h mice, grow n in cu ltu re once, and frozen in a liquots. P rio r to in itc-

tion , an a liq u o t was thaw ed, d ilu ted in PBS, and briefly son ica ted in a cup-

h o rn sonicator. Mice were placed in a closed, nose-only aerosolization system (Cl I Technologies) a n d exposed for 15 m inu tes to nebu lized M. tuberculosis

Two d ifferen t bacterial doses were em ploj'ed: 50 and 300 CFU per m ouse. To

assess inycobacteríal load, we harvested lungs and spleens a t d ifferent times a fter infection , an d tissue hom ogenates were d ilu ted in buffered saline and

cu ltu red on 71111 agar plates. C olony coun ts were d eterm ined 2] days later.H istopatholo^. L u n g an d sp leen tissues were ha rv ested , fixed w ith n eu

tra l buffered fo rm alin , an d pa ra ffin em bedded . Serial sections were stained

w ith M&F. fo r h is to p a th o lo g ic analysis o r w ith K inyoun’s acid fast stain for

in s itu d e tec tio n o f m ycobacteria.Eicosanoid and cytokine determinations. S e ru m levels o f e icosano ids and

cy tok ines w ere m e a su re d u s in g c o m m erc ia l LLISA k its o b ta in e d from N eogen C orp . (LXA4), C a}'m an C hem ica l Co. (LTB4), an d R&D Systems.

(IL -12p40,T N F, IFN-v). For cy tokine detection in lungs, tissue was hom og

enized an d cen trifu g ed a t 3 0 0 ^ for 7 m in u tes . S upei'n ;itan ts a liquo ts were

frozen a t - 8 0 “C for la te r analysis by ELISA. .Measurement o f gene expression in lung.Totî RNAw'as isolated from lungs and

real-tim e RT-PCR was perfo rm ed o n an ABI Prism 7900 sequence detecrion

system (Applied Biosystem s) u sing SYBR C.ireen PCR M aster Mix (Applied B iosystenis) al'ter reverse tra n sc r ip tio n o f 1 |-ig RNA u sin g S uperscrip t II

reverse transcrip tase (Invitrogen Corp.). The relative level of gene expression

was de te rm in ed by the com parative C t m e th o d as described by d ie nw nii-

fac tu re t, w liereb)' d a ta ixir each sam ple were norm alized to hypoxanthiiie phospIio-ribosN 'kiransferase (hp tt) and e.Kpressed as a fold cliange com pared

researcíi artiCie

wich u n trea red con tro ls . I'lie follow ing p rim er pa irs w ere used: i’o r hp rr,

c r r rC i t iT T A C A C 'jC iC C A C iA C T r rG T T C ', (forw ard) a n d G A C iG G T A G G C T -

GGCCTATAGGCT (reverse); il-12p40. CTCACATCTGCTGCTCCACAAG

(rbrward) and A /\'lT rG G T G C T TC A CA C TT CA G G (reverse); ifn-y, AGAGC-

CA CSAlTATCrC'nTCTACCTCAG (forward) and C n T m rC C iC C T T G C .'T - GCTG (reverse); noi2, TGCCCCTTCAATGGTTGGTA (for\s'ard) and ACTG-

GAGC;tjAC:CACiC:CAAAT{reverse);t!)/;AAAAlTCC'iAGTGACAAGCCI'GTAG (forward) and CCCnXÍAACiAGAACCTCKXjACiTAG (reverse).

In sitii In sirn iin n m n o sra in in g o t'C D 11c, F 4 /8 0 , 5-LO, IL-12p40,and N Ü S2 was perfo rm ed as previously described (14). In brief, ace-

rone-iixed , frozen sec tions were in c u b a ted w'irh b io tin -co n ju g a re d anri- Iiodies ag a in st C'D 11 c o r 1-4/80 (BD). A fter w ashing , sec tions were exposed

to s trep rav id in -co n ju g a red ,Alexa F luo r 486 (In v itro g en C orp .). Sections

were s in u iltan eo u s ly d oub le s ta ined w ith ra b b it an ti-lL ~ 12p40 , anti-T N F, an ti- 5-LC), o r anti-NC),S2 pAb, a n d the reac tio n u 'as de \'e lopcd v,'ith an ti- r a b b a IgG Alexa F inor 594 (Invirrogen. C’orp,), foUowe.d by co u n rc rs ta in in g

w ith D.API (Invirrogen Cicirp,), A fter w ash ing , th e sec tions were exam ined m icroscopicaU y, and the im ages were recorded u s in g th e A poT oine system

(Carl Zeiss iM icroim aging, Inc.).

It-i vivo hpoxin iinalvg Ireatment. ATLa2, 1 5 -ep i-1 6 -p h en o x y -p araflu o ro -

LXAi-mc'thy) e ste r (a generous g ift from J. P a rk in so n , Berlex Biosciences, R-ichm ond, C alifo rn ia , USA), was used in vivo as a s tab le lipox in analog as

p rev iously re p o rte d (18). I t was ad m in is te red by gavage 3 tim es a w eek at a dose of 0.2 m l (100 n g /a n im a l/tre a rm e n t) as p rev io u sly described (19).

T rea tm e n t was s ta r te d 2 days a fte r in fec tio n a n d c o n tin u e d u n til day 20.

S im ilarly inf:ecteci c o n tro l mice were likewise tre a te d w ith vehicle alone.

Spleen ceil cultures. S p leen s fro m M. tuherctilosis- in íecíG d m ice were

d isag g reg a ted th ro u g h 40-ü.m cell s tra in e rs , a n d red b lo o d cells were lysed osinotically . S p lenocy tes (5 x 10 '’ c e lls /m l) in RPM I 1640 m edium

(Inv itrogen C orp .) s u p p le m e n te d w ith 10% fe ta l c a lf se ru m (HyClone),

10 m M HEPES (In v itro g en C orp .), 2 m M g lu ta m in e (Inv itrogen Corp.), 100 U /m l p e n ic illin , 100 g /m l s tre p to m y c in (In v itro g e n C orp .), and

5.5 X 10 ^ M 2 -m e rc a p to e th an o l (In v itro g e n C o rp .) were d is tr ib u te d in

96-well plates and s tim u la te d w'ith 10 H-g/ml o f p u rif ied p ro te in derivative (S tatens S e ru m ln s tk u t) . A fter 72 h o u rs a t 3 7 ”C w ith 5% C O 2 a tm osphere,

su p ern a ta n ts were co llected for d e te rm in a tio n o f IFN-y levels.

Statistical analysts. S ta tis tic a l s ign ificance was assessed by unpaired S tu d e n t’s t te st (param etric ) o r M ann-W 'h itney U re s t (n o n p aram etric ), and

P ^ 0.05 was considered sign ifican t.

AcknowledgmentsWe are graceful co Jose R ibeiro and W arwick í5ricton for their help ful discussions an d criticism .

Received fo r p u b lic a tio n N o v em b er 11, 2004, an d accepted in revised form M arch 29 ,2005 .

Address correspondence to: Ju lio Aliberti, D e p a rtm en t o f Im m u- nolog)’, D uke University M edical School, 136 Jones Building, Box 3010, Duke U niversity M edical C enter, D u rh am , N o rth C arolina 27710, USA. Phone: (919) 613-7833; Fax: (919) 684-8982; E-mail: julio.aliberti@ duke.edu.

IS

16

1. C ooper, A.M> ccal. 1995. T h e role o f in te rk ’u k m -1 2 in a c q u ire d in im u n ity co M ycobactcrium tuberculosb wúcczxon. b n rn im o lo ^ . 84:420-432 . 13.

2. F iyiin, J.L., ec al. 1995. T u m o r necrosis f iic to r-a lp h a i.s r e q u ir tid in rh c p ro te c tiv e im m u n e respon.-ê a g a in s t M ycobjctcriam tubcn'uloiii in m ice, ¡m m u- mry. 2;.S6 1 -572.

3. F ly n n , J.L ., er al. 1 995. IL-12 ¡n creases re s is ra n c e 14, o f BALR/c m ice ro M vco b jc tm u m tuberculosis in iec- rion.y. b tm u n o l 155;25 15-2524,

4. d e jo n g , R., ec al. 1998. Severe m y co b acreria ! a n d S^dmoneila in fe c tio n s in in re r le u k in -1 2 rccepcor- d c h c ie n t p a tie n ts , Sch'ncc. 2 8 0 :1 4 3 5 -1 4 3 8 ,

5. A ltare , F., et ai. 1998. Im p a irm e n t o f n iy co h ac teria l n n m u n it ) ’ in h u m a n in te r le u k in - 12 rec e p to r d e ficiency. Saencc. 2 8 0 :1 4 3 2 - 1435.

ò . jo u a n g u y . E., er a l. 1996. in te r f e r o n -g a m m a - recepEcn- d e fic ie n c y in an in fa n t w ith fa ta l bac- ille C a im e tre -G u c r in in fe c tio n . /V. / . Med. 3 3 5 ::9 5 6 1961,

7. Keane, j ., er al. 2001. T u b e rcu lo s is a-ssociared w ith 1 7 in flix im a b , a ru m o r n ecro sis fac to r a lp h a -n eu cra l-izm g agen t- N. EngI.J. Med. 3 45 :10 9 S - 1104.

8.J u n g , V.J., R yan, L., L aC o u rsc , R., a n d N o r th , R.J.2 003 . In c re a se d in te r le u k in - 10 e x p re s s io n is n o r resp o n sil.'ie lo r fa ilu re o f T h e lp e r 1 im m u n ity co 18 resolve n irb o rn e M ycobjctm iinv n/hcrrulosis u ife c tio nin m ice, 109:295 299,

9. R o ach , F).R., er al. 2001 . l-jid c 'g en o u s in h ib i r io no f c in tim y co b ac re i'ia l im m u n iiy by I I . - 10 v a rie s 19. berw 'cen m}’cobacuM uil specie.«;. Scand. j. hnr/iiinol.SA:]G^ J7 ti

HJ. J iin g , V.j., L aC u u rse , R.. R yan, I... a n d N o r th , R.j.2002. F v id en ce m c o n s isu 'in w ith a n eg a tiv e in flu - 20 , ence o f T hcljH’.r 2 cells on p ro recritu i a flo rd e d by a i.lo inm anr T h e lp e r 1 respc.Mi.se a'.jain.sr M ycobadcri- tnii tiilcrcidosis lunj-; in fec tio n in m ice. Ininuiu.70:f>136-Cvl43. ' 21.

i 1, t'joidfeid, A.F. 200‘i. Cieneric su.scepiibility to pub nu)n;i;\’ ti.il.'erculosis in C'ambodia 'luhcrcidosis (rd i^b .). S4:76- 81,

1 2. A libei'n , j , 2005, 1-Iosr per.-ii.^tence: c x p lo tra r io n o f 22.

a n c i- in í la m m a to ry p a th w ay s by T o x o p la sm a g o n d ii. Nat. Ret’. Imrniinol. 5; 162-170.-Aliberti, J ., H icny, S., Reis e Sousa , C., S e rh an . C.N., a n d S h er. A. 2 0 0 2 . L ip o x in -m e d ia te d in h ib i t io n o f IL -12 p r o d u c t io n by D C s: a m e c h a n ism fo r r e g u la tio n o f m ic ro b ia l im m u n ity . Nat. Im m unol. 3 :7 6 -8 2 .A l ib e r r i , ] . , S e rh a n , C ., a n d S h e r , A. 2 0 0 2 . P ara- s ire - in d u c e d lip o x in A4 is an e n d o g e n o u s re g u la to r o f IL -12 p r o d u c t io n a n d in im u n o p a c h o lo g y in T o xo p la sn iii g o n d ii i n f e c t i o n . J. E xp. M ed. 1 9 6 :1 2 5 3 -1 2 6 2 .S can g a , C.A., et: at. 2004. M yD 88-de.ficíen.i: m ice d isp lay a p ro fo u n d loss in res is tan ce to Mycobacterium tuberculosis a s so c ia te d w ith p a rria ll)’ in ip au 'ed T h 1 c y to k in e a n d n i tr ic o x id e s y n th a s e 2 e x p ress io n , Infect, ¡mm iin. 7 2 :2 4 0 0 -2 4 0 4 . M acM ick ing ,J,D .,ecaJ. 1997. Id en tificatio n o f n itric o x id e sy n th a se as a p rorective lo cu s ag a in s t tu b e r cu losis . Proc. Natl. Acad Sci. U. S. 94 :5243-5248 . D e v c h a n d , R R ., ec al. 2005. A sy n th e ric e ico san o id L X -m im etic u n rav e ls h o s r -d o n o r in te ra c tio n s in a llo g e n e ic B M T -in d u ce d GvM D ro reveal an early p r o te c t iv e r o le f o r h o s t n e u tr o p h i ls , FASEB J. 1 9 :2 0 3 -2 1 0 .Ch.sh, C.B., e t al. 1999. Local a n d system ic delivery o f a s ta b le a sp ir in - tr ig g e re d lip o x in p rev en ts n e u t r o p h i l r e c r u i tm e n t in vivo. Proc. Natl. Acad. Sci. a s . A 9 6 :8 2 4 7 -8 2 5 3 .B a n n e n b e rg , G ., e t al. 2 0 0 4 . L ip o x m s a n d novel 15 -cp i-lip o x in an a lo g s d isp la \' p o te n t an ti-infki.m - m a ro ry a c t io n s a f te r o ra l a d m in is t r a t io n . Br. J. Pham ucoL 143:43-52 .D a i, G ., a n d M c M u rr.iy , D .N . 1999. E ffec ts o f m o d ii la r in g T G P -b e ra 1 on im m u n e re.sponses to m )’C obacteria! in fe c tio n in g u in ea pii^s. Tuber. Lung DÍS.79-.207-21A.S e riia n , C.N. 2002. L ipox ins a n d a sp ir in -trig g e red 1 5 -ep i-lip o x in 1,'io.synthesis: an u p d a te a n d role in

a n t i - in r ia in m a t io n a n d p ro -r e s o iu t io n [revieu-j, Pras¡aâf¡dins Other l.ipul Med:at. 6 8 -6 9 :4 3 3 -4 5 5 . R am sred r, LJ-, N g ,J ., W ig/.cil, H., Serh .m , C.N., .and

S a m u e ls so n , B. 19S5. A c tio n o f novel c icosano ids l ip o x in A a n d B o n h u m a n n a tu r a l k ille r cell cy to to x icity : e ffec ts o n in tra ce llu la r cAM P an d ta rge t ce ll b in d in g .,/ , ¡m m m o l. 135 :3 4 3 4 -3 4 3 8 .

23. H a c h ic h a , M ., P o u lio t , M ., P e tas is , N .A., and Ser- h a n , C .N . 1999. L ip o x in (LX)A4 a n d a sp in n - tn g - g e re d 15-epi-LX A 4 in h ib i t t u m o r n e c ro sis fac to r la ip h a - in i tia r e d n e u tro p h il responses a n d tra ffick ing: re g u la to rs o f a c y to k in e -c h e m o k in e a x is ,/ Exp. Med. 1 8 9 :1 9 2 3 -1 9 3 0 .

24. B an d e ira -M eio , C., e t al. 2000. C u ttin g edge: lipoxin (LX) A4 a n d a sp ir in -trig g e re d 15-epi-LX^^4 block a lle rg e n - in d u c e d e o s in o p h il tra ffick in g , j . ¡mmuno!. 1 6 4 :2 2 6 7 -2 2 7 1 .

25. C a n n y , G ., e t a l. 2 0 0 2 L ip id m e d ia to r - in d u c e d e x p re s s io n o f b a c te r ic id a l / p e rm eab ilicy - 'n creas- in g p ro te in (BPI) in h u m a n m u co sa l epithelia. Proc. Natl. Acad. Sci. U. S. A. 99 :3 9 0 2 -3 9 0 7 .

26- Levy, O ., C an n y , G ., Serhar^, C .N ., a n d Coiga.n, S,P,2003. E xpression o fB P i (bacteric idal/perm eab ility - in c re a s in g p ro te in ) in h u m a n m u co sa l ep ithe lia . Biocbem- Soc. Tram. 3 1 :7 9 5 -8 0 0 ,

27. B a n n e n b e rg , G.L,, A lib e r ti, J ,, H o n g , S., Sher, A., a n d S e rh a n , C. 2 0 0 4 . E x o g e n o u s p a th o g e n an d p lant: I5 -Iip o x y g en ase in it ia te en d o g e n o u s lipoxin A4 bios}’n tiiesis ../. Exp. Med. 199 :515-523 .

28. Israe l, 0., C o h n J . , D u b e , L., a n d D razen ,J.M . 1996. E ffec t o f t re a tm e n t w itii z ileucon . a 5-lipoxygena.se in h ib i to r , in p a t ie n ts w ith a s th m a . A ran d o m ized c o n tr o l le d t r ia l. Z i le u to n C lin ic a l T ria l Ciroup. JAM A. 2 7 5 :9 3 1 -9 3 6 .

29. D u B u sk e , L.M., G ro ssm an , J., D ube, LM ,, Swan.son, L .J .,an d L a n c a ste r. J.F. 1997. R a n d o m iz e d trial o f z ile u to n in p a tie n ts w ith m o d e ra te a s th m a : effect of red u c e d d o s in g freq u en cy a n d a m o u n ts on p u lm o n a ry fu n c t io n a n d ¿Lsthrna sy m p to m s, Z ileu ton S tu d y G ro u p . Am . J. Manag. Care. 3 :633-640 .

30. S c h w a r tz , II.J ., P e tty , T„" D u b e , L.M ., S w an so n . L.J., a n d L a n c a ste r , J.F. 1998, .A ra n d o m ize d c o n tro l le d tria l c o m p a r in g z ile u to n w ith th eophy lhne in m o d e ra te a s th m a . T h e Z ile u to n S tu d y G rouu. Arch. Intern. Med. 158:141 1 <18,

mailto:[email protected]

I V

I D l R E C T «

A va ila b le o n lin e a t w w w .s c ie n c e d ire c t.c o m

= n c e (^>

P ro stag lan d in s , Leukotrienes and Essential F a tty Acids 73 (2005) 283-288

Prostaglandins Leukotrienes § Essential Fatty Adds

w w w .elsevier.com /lociite/plera

A n t i- in f la m m a to r y p a th w a y s as a h o s t e v a s io n m e c h a n is m fo r p a th o g e n s

Julio Aliberti^^’*, Andre Bafica'^’'‘'Depcirlinent o f Im m im ology, Duke Univcrsily M edical Center, Durham, N C, 27705, USA

Itnm unohiology Section , Labora tory o f Parasitic Diseases, N IA ID , N ational Institu tes o f H ealth, Bethesda, M D 20892. USACentro de Pesquisas Goncalo M oniz, F IO C R U Z , Bahia, B razil

Abstract

Lipoxins play a key role in contro lling p o ten t p ro-inflam m atory responses triggered by infection with pathogens, such as Toxoplasma gondii and M ycobacterium tuberculosis. In o rder to con ta in m icrobial d issem ination, infected hosts m ust m oun t a powerful im m une response to p revent m ortality . The onset o f the chronic phase o f infection is characterized by con tinuous cell- m ediated im m unity. Such p o ten t responses are kept under tight con tro l by a class o f anti-inflam m atory eicosanoids, the lipoxins. Here, we review such im m une-con tainm en t strategies from the h o st’s perspective, to keep pro-in flam m atory responses under control during chronic disease, as well as from the perspective o f the pa thogen , which p irates the h o st’s lipoxygenase m achinery to its own advantage as a p robab le im m une-cscape m echanism .(Ç) 2005 Published by Elsevier L td.

1. Introduction

Toxoplasma gondii, a protozoan parasite, can invade and replicate within virtually any nucleated host cell. Infection occurs by ingestion of parasite cyst-contami- nated food or water; cysts rupture within the host and ' the released parasites actively enter host cells [1], including resident macrophages and dendritic cells (DCs), Once intracellular, the parasites (tachyzoites) quickly replicate. Although definitive evidence is still required, it is proposed that circulating infected host cells (probably macrophages or DCs) might mediate spread of the parasite to several organs, including the liver. One current hypothesis proposes that the acute phase of infection resolves when the remaining fast- replicating parasites sw'itch, probably as a response to immune attack, to a slow replicating form known as bradyzoiles and seclude themselves in cysts in certain tissues, such as tlie central nervous system (CNS) and the retina (known as chronic or persistent infection) [2],

C orrespond ing au th o r.E-maU address; ju lio .a!iberti(i/)d iike.edu (J. AHberti).

The main pathology during T. gondii infection occurs during |:hronic disease, when immune suppression caused 5y drugs or other infections, such as HIV, can lead to reversion from bradyzoites back to the fast replicating tachyzoites, which rupture cysts causing local tissue necrosis. When such a reaction occurs in the CNS, it is often lethal. Furthermore, during the early years of the AIDS epidemic, T. gondii infection was one of the main illnesses affecting immunocompromised patients [3],

From an evolutionary perspective, the ultimate goal of an intracellular parasite is to achieve successful transmission to a new host; in the case of T. gondii, this means to proliferate while promoting host survival. As its main route of transmission is through predation (i,e,, cats preying on mice), T. gondii needs to ensure that the host carries as many parasites as possible but is still a viable prey. To achieve this, the parasite has evolved several mechanisms to induce a powerful immune response by the host, which prevents host death. However, the pathogen also has mechanisms to subvert the immune response and enable it to persist through the chronic phase of the disease, which can last for many

0952-.327X/,$-.sce fro n t m a tte r (c) 2005 P ub lished hy Elsevier Lid. doi: 10.1016/j.plel'a.2005.05.018

http://www.sciencedirect.com

http://www.elsevier.com/lociite/plera

284 J. Aliberti, A. Bajica / Prostaglandins, Leukotriencs and Essential Fatty Acids 73 (2005) 283-288

years [4], Here, we discuss the immune response triggered by T. gondii and how hosts and pathogens make use of immune-regulatory pathways to promote host survival, which increases the probability of parasite transmission. We also suggest that this concept of the evolutionary advantage of favoring host survival can be extended to other infectious diseases, such as Mycobacterium luberculosis and Pseudomonas aeruginosa.

2. Preventing iinmunopathology due to uncontrolled immune responses

The effects of IFN-y-dependent immunity and related pro-inflammatory responses are potentially extremely toxic to the host. For example, during inflammatory diseases such as arthritis or Crohns’ disease, sustained or uncontrolled type 1 cytokine responses can cause serious damage. To prevent such damage, several host factors and receptors have evolved to contain potentially host- damaging responses. The presence of such control mechanisms is absolutely essential for the homeostasis of the immune response. This complex network of antiinflammatory mechanisms, given its effectiveness, has been seized by pathogens and used to their own benefit to prevent parasite eradication.

IL-10 is a good example of how a soluble factor is used by pathogens to inhibit immune responses. Some viruses, such as EBV, encode a viral homologue of IL-10 that can trigger the same signaling cascade as the mammalian cytokine [5], The resulting effects are mainly immune modulatory, with inactivation of IFN-]'-triggered microbicidal pathways, inhibition of antigen processing and presentation by antigen-presenting cells, and inhibition of T-cell cytokine production and cytotoxic activity [6]. Other viruses, with Poxviruses being the most thoroughly investigated so far, carry genes that encode IL-10 receptor homologues; therefore, cells expressing such receptors become refractory to signals through the IFN-y receptor that induce cytotoxicity or any other anti-viral effect [7]. IL-10 gene transfer has been shown to have anti-inflammatory actions in various pathologies associated with increased IFN-y, IL-1 or TNF production [8,9]. In accordance, it has been shown that neutralization of IL-10 during chronic toxoplasmic encephalitis leads to increased leukocyte infiltration in the CNS, indicating a role for this cytokine in controlling CNS inflammation [10]. IL- 10-deficient micc have no control over inflammatory responses and succumb to T. gondii infection early in the acute phase, with severe leukocyte infiltration and tissue necrosis in the liver and small intestines, mostly due to uncontrolled IFN-y and 7’NF production [11,12]. Given its immune modulatory activities, it was hypothesized that IL-10 induction by the pathogen could be used to escape from host immune responses during 7'. gondii

infection, therefore contributing to virulence of this parasite. One line of thought argues that IL-10 is not directly related to the factors that contribute to T. gondii virulence, and that IL-10 over-production has no role in the mechanisms that drive T. gondii persistence [9]. Regardless, other mechanisms of modulation of immune responses by the parasite are essential to allow survival of the host long enough for transmission and, ultimately for parasite survival as a species.

Given the potential damage if immune responses are left uncontrolled, it is likely that more than one modulatory pathway will have evolved. Evidence for another anti-inflammatory mechanism operating during T. gondii infection has been provided by a phenomenon known as “DC paralysis” , in which protection against T. gondii infection was conferred to IL-10-deficient mice by injection with STAg 24 h before T. gondii challenge, which downregulated IL-12 production and CCR5 expression by DCs [13]. STAg injection triggered endogenous production of an eicosanoid known as lipoxin A4 (LXA4), which was found to inhibit STAg- induced DC migration and IL-12 production in vivo and in vitro [14]. Lipoxins have been show to have potent anti-inflammatory properties in a grow'ing list of models, including periodontitis, arthritis, nephritis and inflammatory bowel disease [15-18], To mediate their actions, these agents bind to two main receptors—a seven- transmembrane G-protein coupled receptor, LXAR/ FPRL-1 [19], and a nuclear receptor, AhR [20]. Mice over-expressing human LXAR have shorter and less severe inflammatory responses, indicating that this receptor is mediating some, if not all, of the antiinflammatory actions of lipoxins in vivo [21], However, despite intense investigation, the contribution given by each receptor (membrane vs nuclear) involved in the triggering of lipoxin-derived anti-inflammatory responses is unclear. There is growing evidence of a role for suppressors of cytokine signaling (SOCS) molecules in the induction of the anti-inflammatory effects seen after hpoxin exposure [22]. The SOCS-family proteins, (e.g.SOCS-1, -2 and -3) are thought to mediate their actions by docking to the intracellular domains of cytokine or hormone receptors, thereby preventing binding and activation of downstream signaling elements [23]. Alternatively, these proteins might facilitate proteasome-dependent degradation of transcription factors through the induction of ubiquitylation [23,24]. So far, little is known about the molecular basis for lipoxin-induced SOCS expression and the control of pro-inflammatory responses, and this requires further study.

Lipoxin biosynthesis can occur through several complex trans-cellular pathways and there is unlikely to be only one cellular source. Other classes of antiinflammatory mediators, such as those derived from DHA, also seem to depend on 5-LO-like activity [25] or

Alihcrii, A. Bafica / Prostaglandins, Leukotriencs and Essential Fatty Acids 73 (2005) 2S3-28S 285

aspirin-induced acetylated COX-2 activities [26], Like lipoxins, resolvins iiad been found to possess several anti-inflammatory actions [26,27]. LXA4 production seen after S'l'Ag injection was completely abolished in the abscnce of 5-lipoxygcnase, indicating that the biosynthetic pathways involving this enzyme were crucial in this experimental setting for the production of LXA4 [28], 5-lipoxygenase is produced as a propeptide that is activated by cleavage, Low levels of active 5-lipoxygenase are found in different cell types, including macrophages, platelets, DCs, and neutrophils [29]. The expression of a 5-lipoxygenase-activating protein (FL.AP) seems to be the key signal for induction of 5-lipoxygenase activity. Although, it is not completely clear which cells are the source of lipoxygenase activity in vivo during T. gondii infection, it is evident that 5- lipoxygenase is required for biosynthesis of LXA4. During infection with T. gondii, serum levels of LXA4 increase steadily over the course of the acute phase, and remain at high levels during chronic disease [28]. Such high levels found in the serum of chronically infected animals indicate that this mediator might exert relevant biological functions during this stage of the disease. Consistent with this, 5-lipoxygenase-deficient animals succumbed to T. gondii infection at the early onset of chronic disease (approximately 27 days post-infection). Furthermore, it became clear that immunity against the parasite was actually increased in the absence of 5- lipoxygenase, with significantly less brain cyst formation than in control animals, indicating that this was not the cause of mortality. By contrast, excessive pro-inflammatory cytokine production and massive cerebral infiltration was found, including atypical meningitis. The conclusion was that the excessive pro-inflammatory response in the brain ultimately caused the death of the 5-lipoxygenase-deficient hosts [28]. T. gondii infection in 5-lipoxygenase-deficient mice resulted in more extensive tissue pathology, mainly due to lack of LXA4 production, as treatment of 5-lipoxygenase-deficient mice with lipoxin analogs restored the resistance to tissue pathology with no mortality associated with uncontrolled pro-inflammatory responses, in a similar manner as for wild-type animals [28]. This indicates that 5-lipoxygenase-derived anti-inflammatory mediators (lipoxins) may inhibit the onset of tissue infiltration [30].

lL-10 and lipoxins share several biological functions in terms of controlling inflammation that indicate they might be redundant; however, the treatment of T. gondii-'mítci<zà 5-lipoxygenase-deficient mice with IL-10 failed to rescue animals from mortality [28]. Although less inflammation was seen in these animals, reactivation of parasite proliferation was observed. This observation w'as later found to be consistent with an apparent difference between the actions of IL-IO and LXA4, in which the former, but not the latter, effectively inhibited the microbicidal activity of macrophagcs [14].

Another interesting discrepancy between IL-10 and LXA4 comes from the pathological findings seen during T. gondii infections of IL-10- versus 5-lipoxygenase- deñcient mice. In the absence of IL-10, infection caused earlier mortality with generalized lymphocytic infiltration and massive hepatic necrosis, with little to no inflammation seen in the CNS. Strikingly, the opposite findings, in terms of both liver and CNS infiltration, were observed during infection of 5-lipoxygenase- deficient mice, indicating that these two anti-inflammatory mediators use related but independent intracellular inhibitory mechanisms. So, although the actions of IL- 10 and LXA4 are partially overlapping, their different effects in vivo and in vitro show that these two antiinflammatory mediators follow independent strategies for controlling pro-inflammatory activity. Furthermore, the kinectics as well as the molecular basis of the biosynthesis and biological activities of the compounds are quite different, indicating that the organ and the timing of action are critical for achieving appropriate control of the immune response.

3. Lipoxins as a mechanism for pathogen evasion

There is a growing body of evidence indicating an immune-modulatory role for lipoxins during infections. Furthermore, it is possible to speculate that pathogens may take advantage of this regulatory pathway to promote host survival, or even to allow a less toxic environment in which replication can occur. Emerging evidence indicates that the immune-modulatory actions of several lipid mediators are exploited by pathogens, including fungi and helminths. In such cases, it seems that modulation of immunity by suppressing host pro- inflammatory responses is the aim.'Despite the fact that DCs are one of the main targets for the immune modulatory actions of LXA4 during T. gondii infection, this cell population does not produce detectable levels of the eicosanoid [28,31]. Instead, resident splenic macrophages up-regulate 5-lipoxygenase expression after in vivo stimulation with parasite extract [14] indicating the participation of macrophages in the generation of lipoxins. The action of 5-lipoxygenase on arachidonic acid results in the formation of leukotriene A4, which can be rapidly converted to LXA4 through the actions of a second enzyme, called 15-lipoxygenase. Although the 5-lipoxygenase activity after T. gondii infection was known to be associated with splenic macrophages [28], the 15-lipoxygenase-expressing cell population was not known. In an effort to identify the sources of 15- lipoxygenase activity after T. gondii infection, Bannen- berg et al. [31] identified an enzymatic activity in tachyzoite forms exposed to calcium ionophore in the presence of arachidonic acid in vitro. Moreover, pro- tcomics analysis of tachyzoite-dcrived lysates revealed

286 J. AUbcrti, Á. Bufica / Prostaglandins, Leukotrienes and Essential Fatty Acids 73 (2005 ) 2S3-2SS

the presence of peptides homologous to plant-derived type 1 lipoxygenases [31], It therefore seems probable that the induction of lipoxin biosynthesis by T. gondii has been selected through the carrying of a plant-like lipoxygenase gene, which together with the actions of host-derived 5-lipoxygenase results in the high-level production of lipoxins. The presence of high levels of lipoxin, in turn, dampens ongoing immune responses so that hosts can control parasite proliferation without succumbing to the damaging consequences of excessive inflammation or tissue destruction.

Although the genes responsible for the 15-lipoxygenase acti ’ity in T. gondii have not been formally identified, the fact that enzymatic activity is induced after ionophore activation in vitro indicates a putative regulatory mechanism for 15-LO expression/activation[31] in which it can be speculated that invasion of host cells, or even immune attack of infected cells may trigger 15-LO activity in intracellular parasites. On the host side, the expression of 5-lipoxygenase is increased after stimulation with parasite extracts or after infection [14], Although the molecular basis for 5-lipoxygenase induction after parasite stimulation has not been clarified, it is known that this enzyme can be induced after leukocyte exposure to a variety of stimuli, including PGE2 [32]. The interplay between these mediators, the induction of 5-lipoxygenase and the control of immune responses in vivo await further investigation. Another intriguing point that contributes to the argument for a role of T. gondii 15-lipoxygenase in immune evasion is the presence of such enzymatic activity in an organism that does not have lipids that could serve as substrates for lipoxygenases. Therefore, the substrate has to come from infected host cells. Consistent with this, is the recent cloning of a 15-lipoxygenase-like enzyme from the bacterial pathogen, P. aeruginosa [33]. Although the production of lipoxins was not formally shown in this report, injection of exogenous 15-lipoxygenase into naive mice, as shown by Bannenberg et al [31], was sufficient to induce the production of LXA4 and have biological effects, such as inhibition of inflammatory infiltration and IL-12 production. P. aeruginosa is most commonly associated with chronic lung infections in patients with cystic fibrosis. It is possible that the bacteria may use the 15-lipoxygenase pathway leading to lipoxin biosynthesis to promote suppression of inflammation and persistence, possibly not activating innate or adaptive immune mechanisms in immune-- competent indi\'iduals. However, patients w'ith cystic fibrosis fail to generate lipoxins in the lungs and the continuing proliferation of bacteria results in uncontrolled accumulation of activated neutrophils that ultimately lead to serious tissue damage with organ failure [34], This constitutes the major pathology for the lung form of cystic fibrosis. The relevance of pathogen- derived 15-lipoxygenase given the lack of lipoxin

generation in the lungs of patients with cystic fibrosis and the severity of disease still remains to be elucidated.

Another lung pathogen that causes a chronic disease with enormous pubhc health relevance is M. tuberculosis. In spite of the fact that it is estimated that one- third of the world’s population is infected with M. tuberculosis, only 5-10% of this group develop active disease. The emergence of multi-drug resistance strains of M. tuberculosis and HIV epidemics has aggravated the situation [35]. On the other hand, for most individuals, infection is asymptomatic with granuloma formation preventing the spread of the bacteria, and potent cell-mediated immunity is typically found in exposed individuals [36]. The critical anti-mycobacterial response observed in animal models and probably in humans is characterized by induction of Thl mediated cytokines such as IL-12 and IFN-7 [37-40], Nevertheless, it has been hypothesized that breakdown of host resistance leads to reactivation of latent infection by unclear mechanisms involving failure of tissue granulomas to contain the mycobacteria proliferation [41], particularly in lungs, its major target organ. One example of resistance breakdown is the heightened susceptibility to M. tuberculosis infection observed in HIV-infected patients with defects on cellular -mediated immunity [42].

In addition to the Thl-type response mounted over the course of infection, down-regulatory mediators may be important players in controlling excessive synthesis of pro-inflammatory cytokines and subsequent tissue damage and could contribute to promoting bacterial survival. Nevertheless, Th2 cytokines such as IL-4, and IL-13 have been described to play no or only a limited role in in vivo M. tuberculosis infection [43]. Similarly, although in vitro IL-10 production is associated with reduced human disease [44], mice deficient in this important down-regulatory cytokine show nearly normal control of M. tuberculosis infection [43,45]. M. tuberculosis invasion of the lungs is typically a latent process wdth very little reaction occurring in the organ. It seems that the pathogen “slips” into the organ and establishes itself there with a tight balance between host inflammatory response and mycobacteria replication. Several factors may be involved in the “ immune silencing” phenomenon seen during M. tuberculosis infection [41]. Interestingly, Bafica and colleagues have shown that in the absence of endogenously generated LXA4, mice become more resistant to infection, with longer survival rates, lower bacterial counts and higher type 1 cell-mediated immunity against the bacilli [46]. Taking into account the effects of endogenously generated lipoxins during M. tuberculosis infection, it is possible to conjecture that in the previously mentioned model—P. aeruginosa infection in patients with cystic fibrosis—the resulting lung pathology due to the lack of lipoxin generation suggests that the cystic

J. Alibcrti, A. Bajica / Prostaglandins, Lcukotricnes and Essential Fatty Acids 73 (2005) 283-2S8 287

fibrosis gene defect may affect lipoxygenase activity directly, even in the presence of a pathogen-derived 15- lipoxygenase. This needs to be tested directly.

Taking the two infection models studied {T. gondii and M. tuberculosis) one notices an apparent discrepancy in the outcome of infection of 5-lipoxygenase- deficient animals, indicating a protective versus a host detrimental role for endogenously produced lipoxins, respectively. From the perspective of T. gondii, which is a fast-replicating pathogen, the host must be kept alive so that transmission can occur through predation. Thus, the host needs well-balanced immunity against the parasite, the number of which is kept low but not completely eliminated. To accomplish this, lipoxins are induced to keep immunity present, but not intensified. By contrast, M. tuberculosis is a slow growing, silent pathogen, that may require high proliferation rates in lungs of infected hosts for transmission to occur. To achieve this, lipoxins may be generated and could inhibit ongoing immune responses allowing enough bacilli to expand. Thus, both cases suggest that lipoxins-dependent inhibition of pro-inflammatory type 1 responses could provide a favorable environment for transmission and propagation of the pathogen.

In summary, the emerging role for lipoxins as immune-modulatory mediators, and the potential use of their inhibitory effects for pathogen survival and replication, is still a new and poorly understood field. Important questions such as the nature of the pathogen- derived signal that contributes to lipoxin generation, or whether the anti-inflammatory effects of LXA4 have a critical role in the balance between type 1, type 2 and regulatory T cell responses await to be answered. Furthermore, another important key element is whether the “piracy” of lipoxygenases by pathogens constitutes a general trend for immune escape and induction of persistence in vivo. Finally, the molecular basis for LXA4-mediated inhibition of DC function and IL-12 production in response to microbial stimuli requires further study. The elucidation of some of those issues may provide support for the development of therapeutic intervention in the 5-lipoxygenase/LXA4 axis.

References

[1] J.H . N4orisaki, .I.E. H euser, L..D. Sibley, Invasion o f Toxoplasm a fiorulil occurs by active p en etra tio n o f the host cell, ,1. Cell Sci. 108 (Pt 6) (1995) 2457-2464.

[2] M .W . B lack, J .C . B oo th ro y d , Lytic cyclc o f Toxoplasm a gondii, M icrobiol. M ol. Biol. Rev. 64 (2000) 607 -623.

[3] A..I. M artiitez . M . Sell, T . M itrov ics, c t al., T h e n eu ropa tho logy and epidem iology o f A ID S . A Berlin experience. A review o f 200 cases, P a tho l. Res. P rac t. 191 (1995) 427-443.

[4J J. b!ay, W .M . H u tch ison , T oxoplasm a goiulii~ -dn env ironm enta l co n tam in an t, F.C0 I. f3is. 2 (1983) 33 -43.

[5] S. S a lek -A rdakan i, .I.R. A rran d , M . M ackett, E p ste in -B a rr virus cncoded in tcrleuk in-lO inh ib its H LA -class I, IC A M -i, and B7

expression on h um an m onocytes: im plica tions for im m une evasion by EBV, V irology 304 (2002) 342-351.

[6] D .F . F lo ren tino , A. Z lo tn ik , P . V ieira, e t al., IL -10 acts on the antigen-presen ting cell to inh ib it cy tok ine p ro d u c tio n by T h l cells, J. Im m unol. 146 (1991) 3444-3451.

[7] D .M . H aig , P oxvirus in terference w ith the h o s t cy tok ine response, Vet. Im m uno l. Im m u n o p ath o l. 63 (1998) 149-156.

[8] F .A . van de Loo, W .B. van den Berg, G ene therapy for rh eu m ato id arth ritis. Lessons from an im al m odels, including studies on in terleukin-4, in te rle u k in -10, an d in te rleu k in -1 receptor an tag o n ist as po ten tia l disease m o d u la to rs . R heum . Dis. Clin. N o rth A m . 28 (2002) 127-149.

[9] U . W ille, E .N . Villegas, B. S triepen, D .S . R oos, C .A . H unter, In te rleu k in -10 does no t co n trib u te to th e pathogenesis o f a viru lent s tra in o f Toxoplasm a gondii, P a ra s ite Im m unol. 23 (2001) 291-296.

[10] M . D eckert-Schlu ter, C. B uck, D . W einer, et al., Interleukin-10 dow nregu la tes the in tracereb ra l im m une respon.se in chronic Toxoplasm a encephalitis, J. N eu ro im m u n o l. 76 (1997) 167-176.

[11] Y. Suzuki, A. Sher, G . Y ap , et al., IL -10 is requ ired fo r prevention o f necrosis in the small in testine an d m o rta lity in b o th genetically resistan t B A LB /c and susceptible C 57B L /6 m ice following peroral in fection w ith Toxoplasm a gondii, J. Im m uno l. 164 (2000) 5375-5382.

[12] R .T . G azzinelli, M . W ysocka, S. H ieny, e t al.. In the absence o f endogenous IL -10, mice acu tely infected w ith Toxoplasm a gondii succum b to a lethal im m une response dep en d en t on C D 4 -f T cells an d accom panied by overp ro d u c tio n o f IL -12, IF N -g am m a and T N F -a lp h a , J. Im m unol. 157 (1996) 798-805.

[13] C. Reis e Sousa, G , Y ap , O . Schulz, e t al.. Paralysis o f dendritic cell IL -12 p ro d u c tio n by m icrob ia l p ro d u c ts p reven ts infection- induced im m unopatho logy , Im m u n ity 11 (1999) 637-647.

[14] J. A liberti, S. H ieny, C. R eis e S ousa , C .N . S erhan , A. Sher, L ipox in-m edia ted inh ib ition o f IL -12 p ro d u c tio n by DCs: a m echan ism fo r regu la tion o f m icrob ia l im m unity , N at. Im m uno l. 3 (2002) 76-82.

[15] N .E . K ieran , P. M aderna , C. G o d so n , Lipoxins: po ten tia l an tiin flam m atory , p ro reso lu tion , a n d an tiiib ro tic m ed ia to rs in renal disease. K idney In t. 65 (2004) 1145-1154.

[16] B. Sam uelsson, A rach idon ie acid m etabo lism : role in inflam m ation , Z. R heum ato l. 50 (Suppl 1) (1991) 3 -6 .

[17] J. G oh , C. G odson , H .R . B rady, P. M ac m a th u n a , L ipoxins: p ro reso lu tion lipid m ed ia to rs in in testinal in flam m ation . G astro en tero logy 124 (2003) 1043-1054.

[18] T .E . V an D yke, C .N . Serhan, R eso lu tion o f inflam m ation: a new p a rad ig m fo r the pa thogenesis o f p e rio d o n ta l diseases, J. Dent. Res. 82 (2003) 82-90.

[19] J .F . M ad d o x , M . H ach icha , T. T ak an o , N .A . Petasis, V.V. Fokin,C .N . S erhan , L ipoxin A 4 stab le analogs a re p o ten t m im etics that s tim u la te h um an m onocytes an d T H P-1 cells via a G -protein- linked lipoxin A 4 recep tor, J. Biol. C hem . 272 (1997) 6972-6978.

[20] C .M . Schaldach, J. R iby, L .F . B jeldanes, L ipoxin A4: a new' class o f ligand fo r the ah recep tor, B iochem istry 38 (1999) 7594-7600.

[21] P .R . D evehand , M . A rita , S. H ong , et al.. H u m a n A L X receptor regu lates n eu troph il recru itm en t in transgen ic mice: roles in in flam m ation and host defense, F aseb J. 17 (2003) 652-659.

[22] M .O . L eonard , K . H annan , M .J. B urne, e t al., 15-Epi-16-(para- tluo rophenoxy)-lipox in A (4)-m ethyl ester, a synthetic analogue of 15-epi-lipoxin .^(4), is p ro tective in experim ental ischem ic acute renal failure, J. A m . Soc. N ep h ro l. 13 (2002) 1657-1662.

[23] W .S. A lexander, D .J. H ilton , T h e ro le o f suppressors o f cytokine signaling (SO C S) p ro te in s in regu la tion o f the im m une response, A nnu . Rev. Im m unol. 22 (2004) 503-529.

[24] B.T. K ile, B.A. Schulm an, W .S. A lexander, N .A . N icola, H.M . M artin , D..I. H ilton , T he SO C S box: a ta le o f destruction and de:_:radation. T rends B iochera. Sci. 27 (2002) 235-241.

288 J. Alihcrli, A. Bafica / Prostaglandins, Leukoíiienes and Essentia! Fatty Acids 73 (2005) 283-2SS

[-5] S. H ong , K. G ro n ert, P .R . D cvchand , R .L . M oussignac, C .N . [36]Serhan. N ovel docosatriencs an d 17S-resoIvins generated from docosahexaenoic acid in m urine b ra in , h u m an b lood , and glial [37] cells. A utaco ids in an ti-in flam m ation , .1. Biol. C hem . 278 (2003) 14677-14687.

[25] C .N . S erhan , S. H ong , K. G ro n e rt, et al., R esolvins: a family o fbioactive p roducts o f om ega-3 fa tty acid tra n s fo rm a tio n circuits [38] initiated by aspirin trea tm en t th a t co u n te r p ro in flam m ation signals, J. E.xp. M ed. 196 (2002) 1025-1037.

[27] M. .^r¡ta , F. Bianchini, J A liberti, e t a l.. S tereochem ical [39] assignm ent, an tiin flam m ato ry p ro p erties , an d recep to r for the om ega-3 lipid m edia to r resolvin E l , .1. Exp. M ed. 201 (2005)713-722.

[28] J. A liberti, C. Serhan, A , Sher, P a ra s ite -in d u ced lipoxin .A4 is an [40] endogenous regu lato r o f IL -12 p ro d u c tio n an d im m unopatho logyin Toxoplasm a gondii in fection , .1. Exp. M ed . 196 (2002)1253-1262.

[29] C .D . F unk . X.S. C hen, E .N . .Johnson, L. Z h a o , L ipoxygenase [41] genes and their ta rge ted d is ru p tio n . P ro stag . O th e r L ip id M ediat.68-69 (2002) 303-312.

[30] J.L . G ou le t, R .C . G riffiths, P. R uiz, e t al.. D eficiency o f 5- [42] lipoxygenase abolishes sex-related surv ival d ifferences in M R L -Ipr/lpr m ice, J. Im m unol. 163 (1999) 359-366.

[31] G .L . B annenberg , J. A liberti, S. H o n g , A . Sher, C. Serhan, [43] Exogenous pathogen and p lan t 15-lipoxygenase in itia te endogenous lipoxin A4 biosynthesis, J. Exp. M ed . 199 (2004) 515-523.

[32] B.D. Levy, C.B. Clish, B. Schm id t, K . G ro n e rt, C .N . Serhan,Lipid mediator class switching during acute inflammation: signalsin reso lu tion , N at. Im m unol. 2 (2001) 612-619 . [44]

[33] R.E. V ance, S. H ong, K. G ro n e rt, C .N . S e rh an , J .J . M ekalanos,T he o p p o rtu n istic pa thogen P seudom onas aeruginosa carries a [45] secretable a rach id o n ate 15-lipoxygenase, P roc. N a tl. A cad. Sci.USA 101 (2004) 2135-2139.

[34] C.L. K a rp , L .M . Flick, K .W . P a rk , et al., D efective lipoxin- m ediated an ti-in flam m ato ry activ ity in the cystic fibrosis airw ay, [46] N at. Im m unol. 5 (2004) 388-392.

[35] A. K ochi, T uberculosis: d is trib u tio n , risk fac to rs , m ortality , Im m unobio logy 191 (1994) 325-336.

J. C han, ,1. F lynn , T he im m unolog ical aspects o f latency in tuberculosis, C lin. Im m uno l. 110 (2004) 2 -12 .R. de .Tong, .A..A. Jan so n , W .R . F ab er, B. N aafs, T .H . O ttenhoff, IL-2 and IL -12 act in synergy to overcom e antigen-specific T cell unresponsiveness in m ycobacte ria l disease, J. Im m unol. 159 (1997) 786-793.F. A ltare , A. D u ra n d y , D . L am m as, et al.. Im pairm ent of m ycobacterial im m un ity in h u m an in te rleu k in -12 receptor deficiency, Science 280 (1998) 1432-1435.J.L . F lynn, M .M . G o ld ste in , K .J . T rieb o ld , J. Sypek, S. W olf, B .R. B loom , IL -12 increases resistance o f BA LB/c mice to M ycobacterium tuberculosis in fection , J. Im m unol. 155 (1995) 2515-2524.A .M . C ooper, A .D . R oberts , B .R . R hoades , J.E . C allahan, D .M . G etzy, I.M . O rm e, T h e ro le o f in te rleu k in -12 in acquired im m unity to M ycobacterium tuberculosis infection. Im m unology 84 (1995) 423-432.•I.L. F lynn, J. C h an , Im m u n e evasion by M ycobacterium tuberculosis: living w ith the enem y, C u rr. O pin. Im m unol. 15 (2003) 450-455.Z. Toossi, V iro iog ical an d im m uno log ica l im pact o f tuberculosis on hum an im m unodefic iency v irus type 1 disease, J. Infect. Dis. 188 (2003) 1146-1155.Y .J. Jung, R. L aC o u rse , L. R yan , R .J . N o rth , Evidence inconsistent w ith a negative influence o f T helper 2 cells on p ro tec tion a ffo rded by a d o m in a n t T helper 1 response against M ycobacterium tuberculosis lung in fection in mice. Infect. Im m un. 70 (2002) 6436-6443.A.E, G oldfeld (E d .), G en etic suscep tib ility to pu lm onary tuberculosis in C am bod ia , T ubercu losis (E d inb ) 84 (2004) 76-81.D .R . R oach , E. M ar tin , A .G . B ean, D .M . R ennick, H . Briscoe, W .J. B ritton , E n d ogenous in h ib itio n o f an tim ycobacterial im m unity by IL -10 varies betw een m ycobacteria l species, Scand. J. Im m unol. 54 (2001) 163-170.A. Bafica, C. Scanga, C. S erhan , F. M ach ad o , S. W hite, A. Sher, J. A liberti, H o st co n tro l o f M ycobacterium tuberculosis is regulated by 5 -lipoxygenase-dependen t lipoxin production , J. Clin. Invest. 1 15 (2005) 1601-1606.

Documents

UNIVERSIDADE FEDERAL DA BAHIA FACULDADE DE … Luiz Barbosa Báfica...mediators of IL-12 regulation and resistance/susceptibility to the pathogen. An experimental mouse model of aerosol