Two-Exon Skipping Due to a Point Mutation in p67-phox-Deficient Chronic Granulomatous Disease

By M. Aoshima, H. Nunoi, M. Shimazu, S. Shimizu, 0. Tatsuzawa, R.T. Kenney, and S. Kanegasaki

The cytosolic 67-kD protein in phagocytes (p67-phoxl and B lymphocytes is one of essential components of the superox- ide-generating system in these cells, and its defect causes an autosomal recessive type of chronic granulomatous disease (CGD). We performed mutation analysis of p67-phox mRNA from a CGD patient who lacks the protein and found an in- frame deletion from nucleotide 694 to 879, which corre- sponds to the entire sequence of exons 8 and 9. This se- quence encodes one of two Src homology 3 domains and a part of proline-rich domain in p67-phox and lack of these domains seem t o have influenced stability of this protein. To know causative reason for the deletion, we analyzed ge- nomic DNA for p67-phox using two sets of primers that cov- ered exons 8 and 9 with adjacent introns. The DNA frag- ments from the patient were shown to be same in length as those from control. However, the single-strand conforma-

HRONIC GRANULOMATOUS disease (CGD) is a rare inherited disorder whereby phagocytes cannot

generate superoxide anion and its derivatives to other active oxygen species that may be used for killing infectious agents. Patients with this disease have recurrent, life-threatening in- fections with catalase-positive bacteria and fungi.’ The su- peroxide generating system in phagocytes and B lympho- cytes’ consists of a membrane-bound catalytic component, cytochrome bSs8, and cytosolic components that seem to be required for activation of the system. A functionally active enzyme complex is formed on stimulation of macrophages or neutrophils by assembly of the necessary components on the plasma membrane. This complex carries an electron from reduced form of nicotinamide-adenine dinucleotide phos- phate to molecular oxygen to form superoxide anion, which is then released to the outside of the cells or inside the phagosomes.3

The catalytic component, cytochrome bSs8, is composed of two subunits, gp91- and p22-phox (phagocyte oxidase). Cytosolic components include p47- and p67-phox and a small guanosine-triphosphate binding protein Ra~-p21.‘“~ These five proteins were shown to be sufficient to support superoxide-generation in a cell free ~ y s t e m . ~ . ~ Any defect in the four “phox” proteins causes CGD, which occurs either as an X-linked or an autosomal di~order.~ The gene responsi- ble for the former type of CGD codes for gp91-phox and genes responsible for the latter for p22-, p47-, and p67-phox. The mRNAs that code for allphox proteins have been cloned and sequenced and the genomic organizations r e p ~ r t e d . ~ ” ~ It is known that p67-phox deficiency is rare in the United States,” Europe,*’ and Japan (manuscript in preparation). Mutations that cause this type of CGD are heterogeneous,’ in contrast to the cases in p47-phox deficiency, the majority of which seem to be accounted for by a common dinucleotide d e l e t i ~ n , ’ ~ ~ ~ ~ although some patients were heterozygous for this deletion and had a second missense rnutaion in the other allelle.’33’5 We found a homozygous AG dinucleotide inser- tion in one patient with p67-phox deficiency, which would bring about a frame shift into mRNA resulting in an early stop codon.26 de Boer et alZ7 reported that a mutation re- sulting in a nonconservative amino acid change in p67-phox

C

Blood, Vol 88, No 5 (September l), 1996: pp 1841-1845

tion-polymorphism analysis of the fragments showed that a patient’s specimen that included the splice junction of exon 9 exhibited different m o b i l i from the control. By se- quencing of the fragment, a homozygous G to A replace- ment at position +l of intron 9 was found t o be a sole muta- tion, which reduced the matching score of the splicing sequence to the consensus calculated according to the for- mula proposed by Shapiro and Senapathy (Nucleic Acids Res 15:7155,1987). The reduced matching score at the splice doner site (5’ splice site] of intron 9 and the original low matching score at the acceptor site (3’ splice site) of intron 7 may explain the skipping of exon 8 and 9, and another predicted mechanism is discussed on the basis of Shapiro and Senapathy’s hypothesis. 0 1996 by The American Society of Hematology.

(Gly-78 to Glu) was responsible for the protein deficiency in one CGD patient. Skipping of exon 3 due to T to C replacement in the splice donor site in intron 3 was also found recently.’8 In this study, we report a new type of p67-phon-deficient CGD, whose mRNA lacks the entire sequence of two exons, namely exons 8 and 9. A single nucleotide replacement found at position + l of intron 9 greatly reduces the matching score of the splicing sequence to the consensus29 and seems to be responsible for the dele- tion. Two exon skipping due to a point mutation at a splice site has rarely been reported, and this is the first case in CGD.

MATERIALS AND METHODS

Case. The patient is a 24-year-old man with a history of recur- rent skin abscess, pneumonia, and cervical lymphadenitis, whose parents were first cousins. His first episode of cervical lymphadenitis and gastroenteritis was at the age of 9. The patient’s neutrophils showed normal chemotaxis and phagocytosis, but failed to generate 02- (2.9% of control) on stimulation with FMLP.

Epstein-Barr virus transformation. B lymphoblast cell lines were established by immortalization with Epstein-Barr virus (EBV) as previously de~cribed.’~ Briefly, the collected mononuclear cells from the patient were exposed to EBV obtained from B95-8 culture medium for 2 hours, then cultured for 4 weeks.

From The Institute of Medical Science, the University of Tokyo, Mitsubishi Yuka Bio-Clinical Laboratories Inc, Tokyo, National Center of Pediatric Treatment, Setagaya-ku, Tokyo, Japan: and the National Institute of Allergy and Infectious Disease, National Insti- tutes of Health, Bethesda, MD.

Submitted December 27, 1995; accepted April 25, 1996. Supported in part by the grants in aid from the Ministry of Educa-

tion, Science and Culture of Japan. Address reprint requests to H . Nunoi, MD, The Institute of Medical

Science, the University of Tokyo, 4-6-1 Shiroganedai, Minatoku, Tokyo 108, Japan.

The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked “advedsement” in accordance with 18 U.S.C. section 1734 solely to indicate this fact. 0 1996 by The American Society of Hematology. 0006-4971/96/8805-0016$3.00/0

1841

For personal use only.on April 10, 2019. by guest www.bloodjournal.orgFrom

1842 AOSHIMA ET AL

Table 1. Oligonucleotide Primers Used for Reverse Transcriptase-PCR

~~ ~

No. Sequences Direction Position

1 AGGCCTCCTAGTITCTACCTAATC Sense 1-24 2 CCTCCTTCTTGGCATACATGAAAG Antisense 407-430 3 TTCGAGGGAACCAGCTGATAGACT Sense 326-349 4 TTGAACATGACCGTGGCCCAGTTA Antisense 856-879 5 GGGTGTGCCTGAGACAAAAGAA Sense 772-795 6 ATCCTTCATGCTGTCTTCTGAAAG Antisense 1237-1260 7 GCTGGAACACACTAAGCTGAGCTA Sense 1182-1205 8 TTTCTTCAGCTTTGTAGTGTGA Antisense 1612-1635 9 CTTAAAGAAGCCTTGATTCAGCTT Sense 304-327

10 CGCAACTCAACTGGTTCAAGGTAG Antisense 900-923

Set of primers 1 and 2,3 and 4,5 and 6,7 and 8, and 9 and 10 were used for amplification targeting nucleotide 1-430, 326-879, 772-1260, 1182-1635 and 304-923, respectively.

I t n r n ~ o ~ M o t ar~al~sis. Cytosolic fractions from the B-cell lines were subjected to sodium dodecyl sulfate-polyacrylamide gel elec- trophoresis (SDS-PAGE). Proteins were blotted to polyvinylidine difluoride (PVDF) membrane and detected with specific antibodies against p67-p11o.r and p47-pho.r, as previously described.’

lsolntion of RNA nrld r w t l w s i s of cDNA. Total RNA was iso- lated from B-cell lines with an acid guanidinium thiocyanate-phenol- chloroform method as described previously.” The first strand of cDNA was synthesized from 20 ng total RNA using Moloney murine leukemia virus reverse transcriptase primed with 30 pmoles of ran- dom hexamer mixture. Subsequently, cDNA for p67-pho.~ was am- plified by polymerase chain reaction (PCR) with the oligonucleotide primers shown in Table I. The PCR was performed for 30 cycles using the following conditions: denaturation at 94°C for 1 minute, annealing at 52°C for 1 minute. and extension at 72°C for 30 seconds. PCR products of p67-phox cDNA were run on l 9 low melting agarose gel, excised from the gel, and purified using a glass powder- based procedure (Gene Clean 11 Kit: Bio 101, Inc, La Jolla, CA). Subsequently the PCR products of p67-phr~x cDNA were sequenced directly.

Grnonlic DNA. Genomic DNA was isolated from the EBV B- cell lines. PCR was performed with the specific primers designed for exon 8 and adjacent intron sequence (5’-TCCGATCAGTCA- GAAATGCGG-3’ as sense primer, and S’-GTGTCAGCCCCA- CCACAGTC-3’ as antisense primer). and for exon 9 and adjacent intron sequence (S’-TTGCAGTTAGATGTGGAGTT-3’ as sense primer, and S’-AACTCAACTGGTTCAAGGTAGTTG-3‘ antisense primer). The PCR products were purified with 2 9 low melting aga- rose gel and subcloned directly into a TA cloning vector (pCR 11: Invitrogen. San Diego, CA). The recombinant plasmids were pre- pared from transformant Esrhrrichia coli strains with an alkaline- SDS method.

Singlr-srrrmd con!fonrlcrrion polymorphirrn. About 100 ng each of PCR products in 12 pL of Tris-borate buffer (TBE) containing l 9 Ficoll 400. 0 .259 Bromophenol Blue. 0.25% Xylene cyano1 were denatured at 80°C for 5 minutes, cooled on ice and run on a cooled 10% polyacrylamide gel at 4°C as described by Hongyo et al.”’ Subsequently, the gel was stained with the silver (2D-Silver Stain 11; Daiichi Pure Chemicals, Inc. Tokyo, Japan).

DNA sequencing. Cycle sequencing reactions were performed using Taq Dye Deoxy Terminator Cycle Sequencing Kit (Perkin- Elmer, Chiba, Japan). Sequencing was performed using an auto- mated sequencer (AB1 model 373A: Perkin-Elmer). A total of 1 p g of the cloned plasmid or 80 ng of the PCR products were used as template.

RESULTS

The patient was diagnosed with CCD by the lack of super- oxide dismutase sensitive cytochrome c reducing activity of his neutrophils on stimulation. In contrast to the cytosol of the EBV-transformed B-cell lines from normal volunteers, which supported the superoxide generating activity of neu- trophil membrane in vitro, that from the patient did not sup- port activity. Normal levels of the large and small subunits of cytochrome bSsR were found in the patient’s neutrophils by Western blots. Cytosol of the patient’s neutrophils and EBV-transformed B-cell line contained a significant amount of p47-phox, but no detectable p67-phox protein (Fig I ) .

Total RNA was isolated from the patient’s EBV-trans- formed B-cell lines and used to obtain first-strand cDNA by reverse transcription, then amplified with a set of four overlapping sense and antisense primers designed to cover the entire coding sequence of p67-phox (Table 1). As shown in Fig 2, PCR products using two sets of primers, 112 and 7/8, were detected, but not the product of primers 314 (lane F ) and 5/6 (lane G). The result suggests there was a deletion in the region between nucleotides 326 and 1260. Subse- quently, another set of primers (9/10) that span nucleotides 304 to 923 were synthesized and the cDNA amplified to find the deletion in the p67-phox cDNA. The fragment obtained from the patient’s RNA was single and shorter than that from control RNA by about 200 bp (lanes I and J). By direct sequence of the fragment, the deleted part was determined

l 2 PMN

Fig 1. lmmunoblot analysis of transformed B-cell lines, cytosolic fraction, with antibodies against p67-phox and p47-phOX. Lane l, X- linked CGD; lane 2, this case; PMN, normal neutrophil.

For personal use only.on April 10, 2019. by guest www.bloodjournal.orgFrom

TWO EXON SKIPPING IN p67-ph0x-DEFlClENT CGD

M A B C D E F G H

1843

\ I I .I

Fig 2. Reverse transcriptase-PCR for p67-phox cDNA. PCR products amplified with the five sets of primers (1/2, 3/4, 5/6, 7/8, and 9/10] shown in Table 1. Lanes A and E, PCR product obtained with primer 1/2; lanes B and F, PCR product obtained with primer 3/4; lanes C and G, PCR product obtained with primer 5/6; lanes D and H, PCR product obtained with primer 7/8; lanes I and J, PCR product obtained with primer 9/10, Lanes A,B,C,D, and I, PCR products from RNA prepared from control EBV B cells; lanes E, F, G, H, and J, PCR products from RNA prepared from patient's EBV B cells. Lane M, DNA size marker &X174/Hae 111 digest. PCR products were run on 1.5% gel (the left panel) and 3% gel (the right panel).

to be nucleotides 694 to 879, which correspond to the entire sequence of exons 8 and 9 (Fig 3).

To investigate the cause of the deletion, genomic DNA fragments of exons 8 and 9 and adjacent introns were ampli- fied from the patient's cell line and compared with those of a normal control. The PCR products from the patient and control were found to be the same length. However, the PCR product from the patient's specimen that includes the splice junctions of exon 9 exhibited different mobility when single- strand conformational polymorphism analysis was per- formed (data not shown). The results suggested the mutation was located in the splice junction of exon 9. The fragment including exon 8 or 9 was subcloned into TA cloning vector.

a Patient

b Control .. CTCTGCAACCACAG,GCAGCTGAGCCTC ..... TGlTCAACGGGCAG,AAGGGCCTTGlTC..

exon 7 1 exon 8 exon C) I cxnn In

Patient v eson 7 I exon In ... GCCCCTCTGCAACCACAGAAGGGGClTGlTCCCT...

Fig 3. Sequence analysis of the p67-phox cDNA. (a) This patient; (b) alignment of the sequence of cDNA from control (upper) and this case (lower).

Each six clones were sequenced in full-length. As shown in Fig 4, there is a G to A replacement at position + 1 of intron 9, the first base of the splice consensus sequence in the splice doner site (5' splice site), which was found to be the sole mutation in the fragment. Matching of splice donor and ac- ceptor sequences to the consensus can be quantified using a scoring system described by Shapiro and Senapathy.'" Ac- cording to the formula they proposed, we calculated the scores for the splice donor and acceptor sites of the p67- phox gene to see if the point mutation found in the splice donor site of intron 9 affected the matching score. As shown in Table 2, the score of the donor site (5' splice site) of intron 9 in normal p67-plrm is 82.7, whereas the G to A mutation at + l i n the CGD gene was 64.6. The acceptor

a Control c w n Y I m m n Y

A C G G G C A G G T A T G C A G

b Patient A C G G G C A G [ A ] T A T G C A G

exnny I lnmnY

e3'

Fig 4. Sequence analysis of genomic DNA. (a) Control sequence around the exon 9, intron 9 boundary; (b) sequence around the exon 9, intron 9 boundary from patient.

For personal use only.on April 10, 2019. by guest www.bloodjournal.orgFrom

1844 AOSHIMA ET AL

Table 2. Scores for Splice Site Sequence for the p67-phox Gene

Donor Site Acceptor Site

Intron 1 Intron 2 Intron 3 Intron 4 Intron 5 Intron 6 Intron 7 Intron 8 Intron 9 Intron 10 Intron 11 Intron 12 Intron 13 Intron 14 Intron 15

81.4 96.7 87.6 95.4 86.3 86.3 95.4 100.0

82.7 (64.6) 81 .o 96.7 80.1 90.9 88.9 92.2

88.1 95.0 78.2 85.9 87.4 81.4 71.2 96.9 81.6 93.0 98.6 91.6 87.7 97.0 84.4

The scores for splice acceptor site were calculated from nucleotide sequences at the position from -14 to +l, and donor sites were from the sequence at the position from -2 to +6. The formula was proposed by Shapiro and Senapathy.”The score for a G to A mutation at +l in intron 9 is given in parentheses.

site (3’ splice site) of intron 7 has a score of 71.2, the lowest score among all donor and acceptor sites in p67-phox.

DISCUSSION

Sequence analysis of cDNA from a CGD patient with p67-phox deficiency has shown that the patient’s mRNA for this protein lacks a region between nucleotides 694 and 879. The deleted nucleotides correspond to the entire sequence of exons 8 and 9 in the gene and to amino acid residues 231 to 293. Nevertheless, even though the deletion was in-frame, no protein was found in the patient’s neutrophils or in EBV- transformed B-cell lines from the patient. The residues in- clude one of two Src homology sequence 3 consensus regions (SH3; residues 245 to 295) and a part of the proline- rich sequence (residues 227 to 234) present in wild-type p67-phox. It is known that the SH3 domain binds to the proline-rich sequence and the mutant protein may have lost its stability due to a loss of these sequences. The sequences, therefore, contribute to protein stability through intra- or intermolecular association of p67-phox with itself or with other proteins such as p47-phox or p40-phox that contain similar sequences.”-”

When sequence in the vicinity of exons 8 and 9 in p67- phox genomic DNA was analyzed, a homozygous substitu- tion of G to A at position + l of intron 9 was found as the sole mutation. The results suggest that the mutated splice donor site of intron 9 influenced site recognition and caused skipping of the upstream exon(s). Point mutations affecting splice donor sites often cause the loss of an entire upstream exon.34 In the case of CGD, mutations located in the genes for gp91-phox, p22-phox. and p67-phox that include nucleo- tide changes at positions + 1 or +2 of the splice donor sites of introns have been reported to cause the skipping of the immediate upstream Decreased interaction of a ribonucleoprotein particle involved in splicing with the splice donor site of an intron may influence its binding to

the splice acceptor site of the preceding intron, resulting in a skip of the intervening exon.”’

In the present case, both exons 8 and 9 were skipped due to a point mutation at the splice donor site of intron 9. Such a mutation has been reported in only a limited number of cases. A point mutation caused by ultraviolet irradiation at the acceptor site of intron 1 in the hypoxanthine-guanine phophoribosyltransferase gene resulted in a loss of exons 2 and 3, or exon 2 alone.34 In maple syrup urine disease, the E1P subunit of the branched-chain a-keto acid dehydroge- nase (BCKDH) was reported to have a point mutation at the donor site of intron 5 that is responsible for the loss of exons 5 and 6.” Most of the mRNA for BCKDH in this disease lacked exon 5, but some normally spliced and two exon- skipped mRNA were also found.

Although the mechanism of two exon skipping is not known, the low matching scores of the splicing sequences to the consensus at the acceptor site of intron 7 and the mutated splice donor site of intron 9 in the present case seem to affect site recognition. Shapiro and Senapathy” proposed that such matching scores are a useful way to predict recogni- tion of the splice site. In the BCKDH case, matching scores to the consensus at the mutated donor and the acceptor sites of intron 5 were 70.4 and 78.1, respectively. In p67-phox deficiency, the low scores of the acceptor site of intron 7 (71.2) and the mutated donor site of intron 9 (64.6) are as low as that of the mutated site in the BCKDH case. The splicing machinery may not be able to recognize sequences with these low scores quite as well, resulting in the deletion of one or more exons.

If actual splice sites have a low score, other sequence signals have been proposed that direct splicing in addition to the splice junction sequence signal^.^' These regulatory elements, termed splicing enhancers, are located downstream and stimulate splicing efficiency for binding of the splicing machinery. Since the acceptor site of intron 7 has a very low score in the present case, it is possible that such an enhancer element is present downstream, but is affected by the mutation at the splice donor site of intron 9 or by exon 9 skipping. In addition to the splice site sequences and possible enhancer sequence, the size of an exon seems to influence exon skipping.” Exon 8 of the p67-phox gene has only 44 bases, and this small size may also contribute to the skipping of this exon. Further studies may help clarify the unusual two exon skipping mechanism that led to CGD in this patient.

REFERENCES

1. Smith M, Cumutte T: Molecular basis of chronic granuloma- tous disease. Blood 77:673, 1991

2. Kobayashi S, Imajoh-Ohmi S, Kuribayashi F, Nunoi H, Naka- mura M, Kanegasaki S: Characterization of the superoxide-generat- ing system in human peripheral lymphocytes and lymphoid lines. J Biochem 117:758, 1995

3. Makino R, Tanaka T, lizuka T, Ishirnura Y, Kanegasaki S: Stoichiometric conversion of oxygen to superoxide anion during the respiratory burst in neutrophile. J Biol Chem 261:11444, 1986 4. Nunoi H, Rotrosen D, Gallin JI, Malech HL: Two forms of

autosomal chronic granulomatous disease lack distinct neutrophil cytosol factors. Science 242:1298, 1988

S . Rotrosen D, Yeung CL, Katkin JP: Production of recombinant

For personal use only.on April 10, 2019. by guest www.bloodjournal.orgFrom

TWO EXON SKIPPING IN PB~-~~OX-DEFICIENT CGD 1845

cytochrome bSss allows reconstitution of the phagocyte NADPH oxi- dase solely from recombinant proteins. J Biol Chem 268:14256, 1993

6. Segal AW, West I, Wientjes F, Nugent JH, Chavan AJ, Haley B, Garcia RC, Rosen H, Scrace G: Cytochrome b-245 is a flavocy- tochrome containing FAD and the NADPH-binding site of the micro- bicidal oxidase of phagocytes. Biochem J 284:781, 1992

7. Roos D: The genetic basis of chronic granulomatous disease. Immunol Rev 138:121, 1994

8. Royer PB, Kunkel LM, Monaco AP, Goff SC, Newburger PE, Baehner RL, Cole FS, Curnutte JT, Orkin SH: Cloning the gene for an inherited human disorder-chronic granulomatous disease-on the basis of its chromosomal location. Nature 322:32, 1986

9. Teahan C, Rowe P, Parker P, Totty N, Segal AW: The X- linked chronic granulomatous disease gene codes for the beta-chain of cytochrome b-245. Nature 327:720, 1987

IO. Rotrosen D, Yeung CL, Let0 TL, Malech HL, Kwong CH: Cytochrome b5s8: The flavin-binding component of the phagocyte NADPH oxidase. Science 256:1459, 1992

11. Parkos CA, Allen RA, Cochrane CC, Jesaitis AJ: Purified cytochrome b from human granulocyte plasma membrane is com- prised of two polypeptides with relative molecular weights of 91 ,OOO and 22,000. J Clin Invest 80:732, 1987

12. Parkos CA, Dinauer MC, Walker LE, Allen RA, Jesaitis AJ, Orkin SH: Primary structure and unique expression of the 22-kilodal- ton light chain of human neutrophil cytochrome b. Roc Natl Acad Sci USA 85:3319, 1988

13. Lomax KJ, Leto TL, Nunoi H, Gallin JI, Malech H L Recom- binant 47-kilodalton cytosol factor restores NADPH oxidase in chronic granulomatous disease [published erratum appears in Sci- ence 246:987, 19891. Science 245:409, 1989

14. Let0 TL, Lomax U, Volpp BD, Nunoi H, Sechler JM, Nauseef WM, Clark RA, Gallin JI, Malech HL: Cloning of a 67- kD neutrophil oxidase factor with similarity to a noncatalytic region of p6Oc-src. Science 248:727, 1990

15. Kenney RT, Malech HL, Epstein ND, Roberts RL, Let0 TL: Characterization of the p67-phox gene: Genomic organization and restriction fragment length polymorphism analysis for prenatal diag- nosis in chronic granulomatous disease. Blood 82:3739, 1993

16. Abo A, Pick E, Hall A, Totty N. Teahan CC, Segal AW: Activation of the NADPH oxidase involves the small GTP-binding protein p2lracl. Nature 353:668, 1991

17. Knaus UG, Heyworth PG, Evans T, Curnutte JT, Bokoch GM: Regulation of phagocyte oxygen radical production by the . GTP-binding protein Rac 2. Science 254:1512, 1991

18. Didsbury J, Weber RF, Bokoch GM, Evans T, Snyderman R: rac, a novel ras related family of proteins that are botulinum toxin substrates. J Biol Chem 264:16378, 1989

19. Volpp BD, Nauseef WM, Donelson JE, Moser DR, Clark RA: Cloning of the cDNA and functional expression of the 47- kilodalton cytosolic component of human neutrophil respiratory burst oxidase. Proc Natl Acad Sci USA 86:7195, 1989

20. Clark R, Malech H, Gallin J, Nunoi H, Volp B, Pearson D, Nauseef W, Curnutte J: Genetic variants of chronic granulomatous disease: Prevalence of deficiencies of two cytosolic components of NADPH oxidase system. N Engl J Med 321547, 1989

21. Casimir CM, Chetty M, Bohler MC, Garcia R, Fischer A, Griscelli C, Johnson B, Segal AW: Identification of the defective NADPH-oxidase component in chronic granulomatous disease: A study of 57 European families. Eur J Clin Invest 22:403, 1992

22. Casimir CM, Bu-Ghanim HN, Rodaway AR, Bentley DL, Rowe P, Segal AW: Autosomal recessive chronic granulomatous disease caused by deletion at a dinucleotide repeat. Proc Natl Acad Sci USA 88:2753, 1991

23. Volpp BD, Lin Y: In vitro molecular reconstitution of the respiratory burst in B lymphoblasts from p47-phox-deficient chronic granulomatous disease. J Clin Invest 91:201, 1993

24. Iwata M, Nunoi H, Yamazaki H, Nakano T, Niwa H, Tsuruta S, Ohga S, Ohmi S, Kanegasaki S , Matsuda I: Homologous dinucleo- tide (GT or TG) deletion in Japanese patients with choronic granulo- matous disease with p47-phox deficiency. Biochem Biophys Res Commun 199:1372, 1994

25. Chanock SJ, Barrett DM, Curnutte JC, Orkin SH: Gene struc- ture of the cytosolic component, phox-47 and mutations in autosomal recessive chronic granulomatous disease. Blood 78:165a, 1991 (abstr, suppl 1)

26. Nunoi H, Iwata M, Tatsuzawa S, Onoe Y, Shimizu S, Kanega- saki S, Matsuda I: AG dinucleotide insertion in a patient with chronic granulomatous disease lacking cytosolic 67-kD protein. Blood 86:329, 1995

27. de Boer M, Hilarius SP, Hossle JP, Verhoeven AJ, Graf N, Kenney RT, Seger R, Roos D:,Autosomal recessive chronic granulo- matous disease with absence of the 67-kD cytosolic NADPH oxidase component: Identification of mutation and detection of carriers. Blood 83531, 1994

28. Tanugi-Cholley LC, Issartel J, Lunardi J, Freycon F, Morel F, Vignais PV: A mutation located at the 5’ splice junction sequence of intron 3 in the p67-phox gene causes the lack of p67-phox mRNA in a patient with chronic granulomatous disease. Blood 85:242, 1995

29. Shapiro MB, Senapathy P: RNA splice junctions of different classes of eukaryotes: Sequence statistics and functional implications in gene expression. Nucleic Acids Res 15:7155, 1987

30. Hongyo T, Buzard GS, Calvert RJ, Weghorst M: ‘Cold SSCP’: A simple, rapid and non-radioactive method for optimized single-strand conformation polymorphism. Nucleic Acids Res 21:3637, 1993

31. Uhlinger DJ, Tyagi SR, Inge U, Lambeth JD: p67-phox enhances the binding of p47-phox to the human neutrophil respira- tory burst oxidase complex. J Biol Chem 269:22095, 1994

32. Sumimoto H, Kage Y, Nunoi H, Sasaki H, Nose T, Fukumaki Y, Ohno M, Minakami S, Takeshige K: Role of Src homology 3 domains in assembly and activation of the phagocyte NADPH oxi- dase. Proc Natl Acad Sci USA 915345, 1994

33. de Mendez I, Garrett M, Adams A, Let0 T: Role of p67-phox SH3 domains in assembly of the NADPH oxidase system. J Biol Chem 269:16326, 1994

34. Steingrimsdottir H, Rowley G, Dorado G, Cole J, Kehmann A: Mutations which alter splicing in the human hypoxanthine-gua- nine phosphoribosyltransferase gene. Nucleic Acids Res 20: 1201, 1992

35. de Boer M, Bolscher BC, Dinauer MC, Orkin SH, Smith CI, Ahlin A, Weening RS, Roos D: Splice site mutations are a common cause of X-linked chronic granulomatous disease. Blood 801553, 1992

36. de Boer M, de KA, Hossle JP, Seger R, Corbeel L, Weening RS, Roos D: Cytochrome bSs8-negative, autosomal recessive chronic granulomatous disease: Two new mutations in the cytochrome bSss light chain of the NADPH oxidase (p22-phox). Am J Hum Genet 51:1127, 1992

37. Hayashida Y, Mitsubuchi H, lndo Y, Ohta K, Endo F, Wada Y, Matsuda I: Deficiency of the E10 subunit in the branched-chain cy-keto acid dehydrogenase complex due to a single base substitution of the intron 5 , resulting in two alternatively spliced mRNAs in a patient with maple syrup urine disease. Biochim Biophys Acta 1225:317, 1995

38. Watanabe A, Tanaka K, Shimura Y: The role of exon se- quences in splice site selection. Genes Dev 7:407, 1992

For personal use only.on April 10, 2019. by guest www.bloodjournal.orgFrom

1996 88: 1841-1845  

M Aoshima, H Nunoi, M Shimazu, S Shimizu, O Tatsuzawa, RT Kenney and S Kanegasaki chronic granulomatous diseaseTwo-exon skipping due to a point mutation in p67-phox--deficient 

http://www.bloodjournal.org/content/88/5/1841.full.htmlUpdated information and services can be found at:

Articles on similar topics can be found in the following Blood collections

http://www.bloodjournal.org/site/misc/rights.xhtml#repub_requestsInformation about reproducing this article in parts or in its entirety may be found online at:

http://www.bloodjournal.org/site/misc/rights.xhtml#reprintsInformation about ordering reprints may be found online at:

http://www.bloodjournal.org/site/subscriptions/index.xhtmlInformation about subscriptions and ASH membership may be found online at:

  Copyright 2011 by The American Society of Hematology; all rights reserved.Society of Hematology, 2021 L St, NW, Suite 900, Washington DC 20036.Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published weekly by the American

For personal use only.on April 10, 2019. by guest www.bloodjournal.orgFrom