TSUD AnalysisReportGuide 3.2 1.PDF

Version 3.2

- Page 1 - Copyright © 2012 Life Technologies Corporation

For Research Use Only. Not intended for any animal or human therapeutic or diagnostic use.

Torrent Browser Analysis Report Guide

Version 3.2




Introduction

A Torrent Browser run report contains statistics and quality metrics for your run. From a run report you can do thefollowing:

Review pre-alignment metrics such as bead loading, Ion Sphere™ Particle (ISP) density, total number ofreads, percentage of reads at Q30 quality, and mean read lengthReview alignment metrics such as total aligned bases, average coverage, and mean raw accuracyDownload the result setManually run a plugin on the run resultsReview the planned run settingsReview the test fragments used with this run and test fragment quality metricsReview analysis information and Torrent Suite software versionsReview the analysis logGenerate a zip file for technical support

See to handle runs generated with version of Torrent Suite earlier than 3.0.Old report analysis

A run report is divided into the following main areas (see the example run report below):

Report header – A button to download the run report as a PDF, a button to review the planned run settingsfor the run, a menu to change to a different result set for the same sample, and a navigation bar, for instanceto jump to the Output Files section.Barcode Summary – For barcoded runs, a barcode summary table appears at the top of the run report.Unaligned – Metrics taken before alignment, including bead loading, ISP density and other metrics,sequencing quality metrics, and read lengthAligned Metrics on the aligned reads– Plugin Previews – Summary output of completed plugins (when supported by the plugin)Output Files – Download buttons for both pre-aligned reads and aligned reads filesPlugin Summary – Links to plugin reports and a button to select another plugin to run (on a completedanalysis)

– A button which displays information about the Test Fragments performance of each test fragment includedin the experimentAnalysis Details – A button which displays a set of information about the sequencing run environment (rundate, sample name, chip type, instrument name, barcode set, etc.)Support – A button which displays a link to the report log and a link to generate information for technicalsupport

– A button which displays the version of Torrent Suite software and its modules Software Version

Version 3.2



Version 3.2



Report header

The run report header contains the following:

A navigation bar to jump to other areas of the report, such as the Output Files sectionA button to download the run report as a PDF fileA Result Set menu to view the run report of a different result set for the same sampleA Review Run Plan button to view the planned run information for this run

Version 3.2



Old report analysis

The Torrent Browser cannot display run reports from earlier versions of the Torrent Suite software in the new runreport format.

To work with results generated with an earlier version of Torrent Suite software, you have these options:

Re-analyze the run to generate a new report – Opens the Data > Completed Runs & Reports >Reanalyze page. Typically you click button to re-analyze with the same settings. The Start Analysis Adv

page is also available to change the analysis settings. After you re-analyze the run, you then haveancedall 3.x features available in the new run report.View the pre-3.0 report – Open the run report in the old pre-3.0 style. Many 3.x features are notavailable in the old style run report.View this report log – Open the text log for this run.

Version 3.2



Contents


Run Report Metrics

Run Metrics Overview

Run Report Metrics Before Alignment

Run Report Metrics on Aligned Reads

Barcode Reports

Test Fragment Report

Report Information

Output Files

Plugin Summary

Run the Installed Plugins

Alignment Plugin

Coverage Analysis Plugin

ERCC Analysis Plugin

IonReporterUploader Plugin

Run RecognitION Plugin

sampleID Plugin

Torrent Variant Caller Plugin

Pre-3.0 Run Reports

Version 3.2



Run Report Metrics


Run Report Metrics

This section provides background information on run metrics and detailed descriptions of a run report. See Runfor explanations of quality metrics, read length calculations, and alignment.Metrics Overview

Run Metrics OverviewRun Report Metrics Before AlignmentRun Report Metrics on Aligned Reads

Contents


Run Report Metrics




Barcode Reports


Report Information

Output Files

Plugin Summary


Alignment Plugin





sampleID Plugin


Pre-3.0 Run Reports



Version 3.2



1. 2.

3.


This page provides background information on quality metrics, read lengths, and alignment. These concepts arerequired to understand your run report.

The Torrent Browser Analysis Report gives performance metrics for reads whose initial bases match the library key.

These reads are generated from the input library, not from the positive control Test Fragments.

Performance is measured based on either predicted quality or quality as measured following alignment. Q20 andAQ20 are explained as examples of predicted quality and quality following alignment.

Predicted Quality (Q20)Quality Following Alignment (AQ20)

Predicted Quality (Q20)

The number of called bases with a predicted quality of Q20 is reported. The predicted quality values are reported onthe Phred scale, defined as (error probability). Q20, therefore, corresponds to a predicted error rate of-10×log10

one percent.

Refer to for a more complete description ofhttp://en.wikipedia.org/wiki/Phred_quality_scorePhred values.

Quality Following Alignment (AQ20)

Alignment of reads can be a useful process to assess the quality of the sequencing reaction and the quality of theunderlying library where an accurate reference is available. Reads are aligned to a reference genome. Anydiscrepancy in alignment to a reference (whether biological or technical, meaning a real variant or a sequencingerror) is listed as a mismatch. Alignment performance metrics are reported depending on how many misalignedbases are permitted. Torrent Suite reports alignment performance at two quality levels:

AQ20Perfect

How Is Aligned Read Length Calculated?

The aligned length of a read at a given accuracy threshold is defined as the greatest position in the read at whichthe accuracy in the bases up to and including the position meets the accuracy threshold. So for example the AQ20length is the greatest length at which the error rate is 1% or less. The "perfect" length is simply the longest perfectlyaligned segment. For all of these calculations the alignment is constrained to start from position 1 in the read - inother words, no 5' clipping is permitted.

The underlying assumption is that the reference to which the read is aligned represents the true sequence thatshould have been seen. Suitable caution should be taken when interpreting AQ20 values in situations where thesample sequenced has substantial differences relative to the reference used, such as working with alignments to arough draft genome or with samples that are expected to have high mutation rates relative to the reference used. Inthese situations the AQ20 lengths might be short even when sequencing quality is excellent.

Specifically, the AQ20 length is computed as follows:

Every base in the read is classified as being correct or incorrect according to the alignment to the reference.At every position in the read the total error rate is computed up to and including that position.

http://en.wikipedia.org/wiki/Phred_quality_score

Version 3.2



3. The greatest position at which the error rate is one percent or less is identified and that position defines theAQ20 length.

For example, if a 100bp read consists of 80 perfect bases followed by 2 errors followed by 18 more perfect bases,the total error rate at position 80 is zero percent. At position 81 the total error rate is 1.2% (1/81), at position 82 theerror rate is 2.4%, continuing up to position 100 where it is two percent (2/100). The greatest length at which theerror rate is one percent or less is 80 and the greatest length at which the error rate is two percent or less is 100, sothe AQ20 lengths are 80 and 100 bases, respectively.

How Is Alignment Performed?

Within Torrent Browser, the objective is to provide you with a view on alignment that helps determine run and libraryquality.

There are many alignment algorithms available within the marketplace and you are encouraged toconsult with a bioinformatician for the most appropriate alignment algorithm for your downstream analysisneeds. Alignment algorithms are also embedded in many of the commercial software tools availablewithin the Ion Torrent Web store. You are also encouraged to experiment with these tools.

Alignment within Torrent Browser is performed using TMAP. TMAP is currently an unpublished alignment algorithm,created by the authors of the BFAST algorithm. Please, contact Ion Torrent Technical Support for more informationabout TMAP.

Technical Note - Analysis PipelineTechnical Note - TMAP Alignment

Although TMAP is unpublished and a reference is not currently available, the precursor to TMAP,BFAST, is based on the ideas in the following publications:

Homer N, Merriman B, Nelson SF.BFAST: An alignment tool for large scale genome resequencing.PMID: 19907642PLoS ONE. 2009 4(11): e7767. http://dx.doi.org/10.1371/journal.pone.0007767

Homer N, Merriman B, Nelson SF.Local alignment of two-base encoded DNA sequence.BMC Bioinformatics. 2009 Jun 9;10(1):175.PMID: 19508732 http://dx.doi.org/10.1186/1471-2105-10-175

Which Reads Are Used in the Alignment Process?

The alignment stage involves aligning reads produced by the pipeline to a reference genome and extracting metricsfrom those alignments. By default, Torrent Suite aligns all reads to the genome, however there may be situations,particularly with large genomes, where the alignment takes longer than the user is willing to wait. So for suchcircumstances the Torrent Suite also has the capability to define on a per-reference basis the maximum number ofreads that should be aligned from a run. For more detail on how to enable and specify this reference-specific limitsee the Adding a Reference Sequence section of .Working with Reference Sequences

When the number of reads in a run exceeds a genome-specific maximum, a random sample of reads is taken andresults are extrapolated to the full run. By sampling a quickly-aligned subset of reads and extrapolating the valuesto the full run, the software gives you enough information to be able to judge the quality of the sample, library andsequencing run for quality assessment purposes.

The outputs of the alignment process is a BAM file. The BAM file includes an alignment of all reads, including the

https://iontorrent.jira.com/wiki/display/TSUD/Technical+Note+-+Analysis+Pipeline

https://iontorrent.jira.com/wiki/display/TSUD/Technical+Note+-+TMAP+Alignment

http://dx.doi.org/10.1371/journal.pone.0007767

http://dx.doi.org/10.1186/1471-2105-10-175

https://iontorrent.jira.com/wiki/display/SDBX/Working+with+Reference+Sequences

Version 3.2



unmapped, with exactly one mapping per read. When a read maps to multiple locations, the mapping with the bestmapping score is used. If more than one such mapping exists, a random mapping is used and given a mappingquality of zero.

If sampling is in effect for a run and full read alignment is needed, the analysis can be manuallyre-run using the tab option and checking the chRuns Advanced Override alignment samplingeckbox.

Contents


Run Report Metrics




Barcode Reports


Report Information

Output Files

Plugin Summary


Alignment Plugin





sampleID Plugin


Pre-3.0 Run Reports




Version 3.2



The Unaligned area in the Run Summary section provides before-alignment metrics. There are four sections in theUnaligned area:

ISP DensityISP SummaryQualityMean Read Length

ISP Density

This table describes the I density metrics:on Sphere™ Particle (ISP)

Metric Description

Total Bases Number of filtered and trimmed million base pairsreported in the output BAM, SFF, and FASTQ files.

Note: The SFF file format is deprecated and will notappear in future releases.

Bead Loading Percentage of chip wells that contain a live ISP. (Thepercentage value considersonly potentially addressable wells.)

Version 3.2



The ISP Density image is is a pseudo-color image of the Ion Chip™ showing percent loading across the physicalsurface.

ISP Summary

This table describes the ISP summary metrics:

Metric Description Calculation

Total Reads Total number of filtered andtrimmed reads independent oflength reported in the output BAM,SFF, and FASTQ files.

Note: The SFF file format isdeprecated and may not appear infuture releases.

Usable Sequence

Loading Percentage of chip wells thatcontain a live ISP. (The percentagevalue considers only potentiallyaddressable wells.)

Version 3.2



Empty Wells Percentage of chip wells that do notcontain an ISP. (The percentagevalue considers only potentiallyaddressable wells.)

Enrichment Predicted number of Live ISPs that have a key signal identical to thelibrary key signal (the same valueas shown in the Well Informationtable).The Percent Enrichment valuereported is the number of loadedISPs that are Library ISPs, aftertaking out Test Fragment ISPs.

Library ISPs / (No. of Loaded ISPsminus TF ISPs)

No Template Percentage of chip wells that do notcontain a DNA template.

Clonal Percentage of clonal ISPs.

An ISP is clonal if all of its DNAfragments are cloned from a singleoriginal template. All the fragmentson such a bead are identical (andthey respond in unison as eachnucleotide is flowed in turn acrossthe chip).

Polyclonal Percentage of polyclonal ISPs (ISPs carrying clones from two or moretemplates).

Polyclonal ISPs / Library ISPs

Final Library Percentage of reads which pass allfilters and which are recorded in theoutput BAM, SFF, and FASTQ files.This value may be different from theTotal Reads due to technicalitiesassociated with read trimmingbeyond a minimal requirementresulting in Total Reads beingslightly less than Final Library.

Final Library / Library ISPs

% Test Fragments Percentage of Live ISPs with a keysignal that is identical to the testfragment key signal.

Test Fragment ISPs / Live ISPs

% Adapter Dimer Percentage of ISPs with an insertlength of less than 8 bp.

Primer dimer ISPs / Library ISPs

% Low Quality Percentage of ISPs with a low orunrecognizable signal.

Low quality ISPs / Library ISPs

Version 3.2



Quality

This table describes the quality metric:

Metric Description

Fraction of total bases >= Q30 Percentage of total bases with a predicted quality ofQ30 or better.

The quality histogram gives the percentage of bases that have a predicted quality level in each of seven bins.

The performance measurements in this section are based on predicted quality.

Read Length

Version 3.2



This table describes the read length metric:

Metric Description

Mean Read Length Average length, in base pairs, of all filtered andtrimmed library reads reported in the output BAM, SFF,and FASTQ files.

The read length histogram is a histogram of the trimmed lengths of all reads present in the output files.

For more information on filtering and trimming, please see Technical Note - Filtering and.Trimming

https://iontorrent.jira.com/wiki/display/TSUD/Technical+Note+-+Filtering+and+Trimming


Version 3.2



Contents


Run Report Metrics




Barcode Reports


Report Information

Output Files

Plugin Summary


Alignment Plugin





sampleID Plugin


Pre-3.0 Run Reports




This section of a run report provides metrics on aligned reads:

Version 3.2



The Total Aligned Bases

The following table describes metrics in the Total Aligned bases column.

Metric Description

Total Aligned Bases Number of filtered and trimmed million base pairsreported in the output BAM, SFF, and FASTQ files.

% Aligned Bases Percentage of Total Aligned Bases out of all reads.

Average Coverage Depth of Reference The average of the number of reads that cover eachreference position.


The graph in the Total Aligned reads column plots number of aligned (in blue) and unaligned (in grey) bases by posit



Version 3.2



ion in an aligned sequence:

For each position in an aligned sequence, the height of the blue area shows the number of aligned bases at thatposition. The grey area shows the number of unaligned bases at that position. Unaligned bases are not shown bythe absolute height on the number of bases axis, but by the difference between the grey height and the blue height.

Raw Accuracy

The following table describes metrics in the Raw Accuracy column.

Metric Description

Mean Raw Accuracy 1x .

The graph in the Raw Accuracy column plots percent accuracy for each position in an aligned sequence:

Version 3.2



Contents


Run Report Metrics




Barcode Reports


Report Information

Output Files

Plugin Summary


Alignment Plugin





sampleID Plugin


Pre-3.0 Run Reports

Version 3.2



Barcode Reports


Barcode Reports

The barcode section of a run report displays the following information per barcode:

Column Description

Barcode Name The individual barcode in the barcode set.

The row labeled as No barcode reports on unclassifiedbarcodes, which are reads that could not be classifiedas matching one of the expected barcodes in thebarcode set.

Sample Name of the sample that was sequenced oninstrument.

Output Total number of reads.

% >= Q20 The percentage of reads that have a predicted qualityscore of Q20 or better.

A Q20 score is the predicted quality of a Phred-likescore of 20 or better, or one error in 100 bp.

Reads Total number of filtered and trimmed library reads(independent of length). This number is reported in thebarcode BAM file.

Mean Read Length The average read length, in bp, of all filtered andtrimmed library reads reported in the barcode BAM file.

Version 3.2



Read Length Histogram A thumbnail histogram of the read lengths for thisbarcode.

BAM Buttons to download the BAM and BAM index file (BAI)for this barcode. The BAM file contains aligned readssorted by reference location.

See also for a description ofRun Metrics Overviewalignment data.

The number of barcodes shown in the barcode section varies according to the barcode set used in your run and onthe barcodes actually present in the sample. Only data for barcodes present in the run are displayed in the runreport.

Contents


Run Report Metrics




Barcode Reports


Report Information

Output Files

Plugin Summary


Alignment Plugin





sampleID Plugin


Pre-3.0 Run Reports

Version 3.2



Output Files


Output Files

These links permit you to directly download the data and report files. Some files are compressed, using the for.zip

mat, to provide data integrity and to reduce download time.

Click on a file type button to save the file to your local computer. Most output files can be loaded into third-partyviewers (such as IGV) for visualization. The barcode row only appears for runs on barcoded data.

Files in the barcode row are zips of one file per active barcode. To download only BAM and BAI files for a singlebarcode, go to the barcode section at the top of the run report (see ).Barcode Reports

Column Description

Reads Files with unaligned reads (before alignment)

Aligned Reads Files with aligned reads

File type Reads Aligned reads

BAM Unaligned reads in BAM format.

In this release, the BAM filecontains some flow spaceinformation.

Aligned reads sorted by referencelocation.

See Run Metrics Overview for adescription of the alignment dataincluded in this BAM file.

BAI — BAM index file

Version 3.2



SFF Compressed (.zip) StandardFlowgram Format (SFF) -formattedfile that contains "flow space" data. The bases called in a run are storedin two formats: SFF and FASTQ.Both files contain the nucleotidecalls and associated quality values,the SFF files, additionally, containsignal values in flow space and amapping between sequence andflow spaces.

The data are organized on a perflow basis, and contain informationabout nucleotide flows that both didand did not result in baseincorporation. (See Technical Note -

.)Filtering and Trimming

Note: The SFF file format isdeprecated and may not appear infuture releases.

—

FASTQ Compressed(.zip) FASTQ-formatted filecontaining data organized in aper-base basis, including qualityscores. The reads contained in thefile are unaligned reads. (See Technical Note - Filtering and Trimming.)

—

Note: Large FASTQ files are zipped with a format that is not compatible with the native Windows unzip utility.

The BAM format

Binary Sequence Alignment/Map (BAM), is a compressed, binary form of the SAM format. BAM files can beindexed, using the BAM Index file, for quick access to sequence alignment data. See http://samtools.sourceforge.netfor more a more detailed description of the SAM/BAM file format. Many tools are available for working with SAMfiles.





http://samtools.sourceforge.net/

Version 3.2



Contents


Run Report Metrics




Barcode Reports


Report Information

Output Files

Plugin Summary


Alignment Plugin





sampleID Plugin


Pre-3.0 Run Reports

Version 3.2



Plugin Summary


Plugin Summary

The section lists the plugins associated with the analysis, and provides an interface for runningPlugin Summaryand monitoring your plugin(s).

Plugins can have one of the following behaviors:

Run without user input.Run with a user interface for getting plugin parameters.

Plugins without a user interface display a confirmation message that the plugin has been submitted to run. Pluginsrequiring input parameters display a user interface dialog and are launched after you click on the plugin userSubmit interface.

The Combine Alignment and IonReporterUploader functionality

In previous releases, Combine Alignment was a plugin available through the button. Select plugins to run CombineAlignment is now available in a project result set page, Data > Projects > , with the projectname Combine

button. The result sets to be combined must be members of the same project.Selected...

The IonReporterUploader plugin is available here to launch manually through the Select plugins to run button andcan also be specified in the template and planned run wizard, under the Export chevron, to run automatically (afterthe plugin is configured).

Version 3.2



1.

2.

3.

Run a pluginThe Plugin Summary listPlugin reportsPlugin log files

Run a plugin

The following plugins are pre-installed on Torrent Server. See for aRunning the Installed Pluginsdescription of these plugins.

AlignmentCoverage AnalysisERCC_AnalysisIonReporterUploaderRun RecognitIONsampleIDTorrent Variant Caller

To manually run a post-analysis plugin on the report data:

Click .Select Plugins To Run The Plugin List pops up and displays a list of available plugins:

Click the plugin you want to run. If the plugin does not require user input, it begins execution. This displays the user interface for your plugin. In this example, the plugin is selected, displayingAlignmentthe plugin dialog (see for more information about running pre-installedAlignment Run the Installed Pluginsplugins):

https://iontorrent.jira.com/display/TSUD/Running+the+Installed+Plugins

Version 3.2



3.

4.

5.

Select the desired plugin options and click . This runs your plugin, listing the run status in the Submit Plugin

panel.Summary For plugins that take a long time to run, click to update the plugin display status.Refresh Plugin Status

The Plugin Summary list

After a plugin runs, it is listed in the panel:Plugin Summary

Some plugins, such as Alignment, display a preview results window in the Plugin Summary list.

Plugin reports

Plugin results, results summaries, links to output files, and other information are available in the plugin reportpages. See for a description of report pages for the installed plugins.Run the Installed Plugins

Click the plugin html link in the Plugin Summary section to open that plugin's report page:

Version 3.2



1.

2.

Plugin log filesTo view the plugin log file, hover your mouse pointer over the log icon to the right of your plugin to display theplugin log file:

Click the icon to display the log:

Version 3.2



2.

3. Click to exit the display.Close

Contents


Run Report Metrics




Barcode Reports


Report Information

Output Files

Plugin Summary


Alignment Plugin





sampleID Plugin


Pre-3.0 Run Reports

Version 3.2






You customize your analysis by running one or more plugin applications at the end of eachTorrent Suite Softwarerun. Your Torrent Browser includes several of these plugins, such as for variant calling and realignment. The TorrentBrowser Plugin Store offers other plugins written by Ion Community members. The isTorrent Browser Plugin Storeon the Ion Community (registration required).

Available plugins Manually run a pluginAutomatically run plugins

Available plugins

This table lists the pre-installed and officially supported plugins.

Plugin Description

Alignment Plugin Performs a new alignment to the reference you specify.

Note: Plugins run after the Torrent Suite analysispipeline. This plugin does not affect the alignmentduring pipeline analysis.

Coverage Analysis Plugin Provides statistics and graphs describing the level ofsequence coverage produced for targeted genomicregions.

ERCC Analysis Plugin Helps with ERCC RNA Spike-in Controls: enables youto quickly determine whether or not the ERCC resultsindicate a problem with either the library preparation orthe sequencing instrument run.

IonReporterUploader Transfers run results files to your organization in IonReporter™ Software (available under a separatelicense).

Run RecognitION Plugin Considers candidate runs for inclusion in IonCommunity leaderboards. Within each chip type (Ion314™ chip, Ion 316™ chip, and Ion 318™ chip), topruns are ranked according the number of AQ20 basesmapped.

sampleID Plugin Uses sample fingerprinting to identify anycross-contamination between samples or betweenbarcodes in a run.

http://ioncommunity.lifetechnologies.com/community/products/torrent_browser_plugin_store

Version 3.2



1. 2.

3.

Torrent Variant Caller Plugin Calls SNP and InDel variants across a reference orwithin a targeted subset of that reference. Withlow-frequency variant options, the plugin can callvariants down to a 5% level of variant frequency. It canalso show which variants coincide with predefined“HotSpot” positions on the reference sequence.

This table lists plugin functionality that is available in other areas of the Torrent Browser.

Previous plugin Description and new location

IonReporterUploader Transfers run results files to Ion Reporter™ Software(access is available under a separate license).

The IonReporterUploader is now selected before a runin the > , > , and Plan Templates Plan Planned Run wiza

pages. After a run, if the results set is a member of ardproject, you invoke the pIonReporterUploader from theroject page (see ).Projects

combineAlignment Combines reads aligned to the specified reference frommultiple run reports. Intended for use when multipleruns analyze the same tissue sample, for examplewhen a tissue sample is run on more than one chip.

You invoke combineAlignment from the project page(see Projects). The runs you combined must bemembers of the same project.

Manually run a plugin

You manually run a plugin in the run report of a completed analysis run, with the button. OnlySelect plugins to runenabled plugins are listed. Follow these steps to manually run a plugin:

Go to the tab, then click the link for your completed analysis run.Data > Completed Runs & Reports In the run report, scroll down to Plugin Summary tab.

The Plugin Summary also lists any plugins that executed on your run (not shown in this example).

https://iontorrent.jira.com/wiki/display/TSUD/Plan+Tab

https://iontorrent.jira.com/wiki/display/TSUD/Templates


https://iontorrent.jira.com/wiki/display/TSUD/Planned+Runs

https://iontorrent.jira.com/wiki/display/TSUD/Template+and+Planned+Run+Wizard


https://iontorrent.jira.com/wiki/display/TSUD/Projects+Tab


Version 3.2



3.

4.

5.

Click to see the list of available on your Torrent Server. See fSelect plugins to run plugins Available Pluginsor the pre-installed plugins. Your server may have additional plugins or other versions installed.

Click the desired plugin name to run a plugin. If the plugin does not require user input, it starts immediately, without a confirmation screen. Click to close the Plugin List without running a plugin.Close

Automatically run plugins

When you design your sequencing protocol in the Plan > Template page, you specify which plugins to execute. Youcan select any plugin that is installed and configured on your Torrent Server. You are not limited to the pre-installedplugins.

See the following for more information on specifying plugins in your templates and planned runs:

Plan TabTemplatesPlanned RunsTemplate and Planned Run Wizard

The old method to autorun a plugin

Your Torrent Server administrator can set plugins to be executed automatically on every run; however, thepreinstalled plugins are not good candidates to be run automatically. For example, the Torrent Variant Caller pluginfails on runs that do not use both the hg19 reference and the Ion AmpliSeq™ Cancer Panel or custom product data.





Version 3.2



The Alignment and RunRecognitION plugins cannot be be executed automatically because theyrequire manual user input before every run.

For Ion Reporter users, enabling Autorun with the IonReporterUploader plugin could cause you™extra expense, by transferring unnecessary results to the Ion Reporter server. (The Plan tab™allows you to turn off the plugin for a template and for a planned run.)

Contents


Run Report Metrics




Barcode Reports


Report Information

Output Files

Plugin Summary


Alignment Plugin





sampleID Plugin


Pre-3.0 Run Reports

Alignment Plugin


Version 3.2



1.

2.

3.

4.

5.

Alignment Plugin

The Alignment plugin performs a new alignment to the user-selected reference file. Output files include SAM/BAMand FASTQ files of sampled reads. This plugin cannot be auto-run because it requires user input before execution.

The new alignment appears .in the context of the same run report

The recommend way to do a re-alignment is through the run report under Data > Completed Runs & Reports > run report > gear menu > Reanalyze > Advanced > Start reanalysis from:

. The method generates a new run report and you optionally can run otherAlignment Reanalyze plugins on the new result set.

Follow these steps to run the plugin and to review the plugin output report.

To run this plugin, in the report for your run, scroll down to the Plugin Summary section, and click Select.plugins to run

In , select . The plugin displays the plugin user interface:Select a plugin Alignment

From the drop-down list, select the desired library.Libraries

Select the desired option.Sampling

Click the checkbox for each of the desired plugin output formats: , , and ..sam .bam .fastq

Version 3.2



5.

6. Click to run the plugin with the specified parameters.Submit

The interface provides feedback that the plugin has started:

On completion, the displays a minimal output preview in the plugin list of the paAlignment Plugin Summarynel:

Click the link to display the full plugin output.Alignment.html

Plugins run after the Torrent Suite analysis pipeline. This plugin does not affect the alignment during pipelineNote:analysis.

Version 3.2



Contents


Run Report Metrics




Barcode Reports


Report Information

Output Files

Plugin Summary


Alignment Plugin





sampleID Plugin


Pre-3.0 Run Reports




The Coverage Analysis plugin provides statistics and graphs describing the level of sequence coverage producedfor targeted genomic regions.

You can run the Coverage Analysis plugin automatically or manually.

To run the Coverage Analysis plugin automatically, you select Coverage Analysis plugin during template setup.Refer to the and pages section of the for informationPlan Tab Templates Torrent Browser User Interface Guideabout how to set up a template and create a planned run.

To run the Coverage Analysis plugin manually, perform the following steps:



https://iontorrent.jira.com/wiki/display/TSUD/Torrent+Browser+User+Interface+Guide

Version 3.2



1. In the Torrent Browser, select a run report by clicking a run link, then clicking a report from the dropdown area.The run report opens.

2. On the run report page, scroll about halfway down the screen to the Plugin Summary area. Click Select plugins. The popup appears:to run Select a plugin

3. Select . The Coverage Analysis Plugin interface appears.coverageAnalysis

4. Select a library type.

5. If you have one and would like to use it, select a targeted regions file.

Version 3.2



6. If you would like to pad the target by a number of bases, enter the desired number. If you do not enter anumber, the default of 0 is used.

7. If you would like the option to examine unique starts, select the checkbox.

8. When you are satisfied with your selections, click .Submit

The analysis runs and a group of output reports is created.

The following sections of this document describe the output reports generated by the Coverage Analysis plugin.

Coverage Analysis Plugin Output

The Coverage Analysis Plugin output is a report called the Coverage Analysis Report. This report includes statisticsabout all reads, and the following information in graphical form:

Target CoverageBinned Target CoverageTarget Coverage by ChromosomeIndividual Target CoverageOn/Off Target Read AlignmentNormalized Target Coverage

In addition, from the bottom of the Coverage Analysis Report, you can download a BAM file or its related BAM indexfile.

All Reads

The All Reads section of the Coverage Analysis Report provides statistics about all reads. The items in this reportare described in the table below.

Version 3.2



Statistic Description

Number of mapped reads Total number of reads mapped to the reference.

Number of reads on target Total number of reads mapped to any targeted regionof the reference. A read is considered to be on target ifat least one aligned base overlaps a target region. Aread that overlaps a targeted region but where onlyflanking sequence is aligned, for example, due to poormatching of 5' bases of the read, is not counted.

Percent of reads on target The percentage of reads mapped to any targetedregion relative to all reads mapped to the reference.

Total aligned base reads The total number of bases covered by reads aligned tothe reference.

Total base reads on target The total number of target bases covered by anynumber of aligned reads.

Version 3.2



Percent base reads on target The percent of all bases covered by reads aligned tothe reference that covered bases in target regions.

Bases in targeted reference The total number of bases in all target regions of thereference.

Bases covered (at least 1x) The total number of target bases that had at least oneread aligned over the proximal sequence. Only thealigned parts of each read are considered. Forexample, unaligned (soft-cut) bases at the 5' ends ofmapped reads are not considered. Covered targetreference bases may include sample DNA read basemismatches, but does not include read base deletionsin the read, nor insertions between reference bases.

Average base coverage depth The average number of reads of all targeted referencebases...

Uniformity of coverage The percentage of all target bases covered by at least0.2x the average base coverage depth.

Maximum base read depth The maximum number of times any single target basewas read.

Average base read depth The average number of reads of all targeted referencebases that were read at least once.

Std.Dev base read depth The standard deviation (root variance) of the readdepts of all targeted reference bases that were read atleast once.

Target coverage at 1x The percentage of target bases covered by at least oneread.

Target coverage at 10x The percentage of target bases covered by at least tenreads.

Target coverage at 20x The percentage of target bases covered by at least 20reads.



Target Coverage Graph

In the Target Coverage graph, target base coverage is plotted against read depth, where read depth is the number

Version 3.2



of times a particular base is read and coverage is the number of counts of bases read at that read depth. This plotincludes the number of target bases that were not read (to 0x coverage). The right-hand y-axis shows thecumulative coverage as a percentage of the total number of targe base reads, corresponding to the blue line. Thismay be used to gauge the target number of bases read to a particular depth.

Binned Target Coverage Graph

In the Binned Target Coverage graph, as in the Target Coverage graph above, target base coverage is plottedagainst read depth, where read depth is the number of times a particular base is read and coverage is the number ofcounts of bases read at that read depth. However, in the Binned Target Coverage graph, the read depths are binnedto better represent coverage where the maximum read depth is high. The binning size is chosen accordingly. Forexample, an x-axis value of 20x indicates the sum of coverage for reads from 1 to 20, or 11 to 20 if the precedingbar was labeled 10x, etc. This plot does not include the coverage for non-covered target bases (0x coverage).

Version 3.2



Target Coverage by Chromosome Graph

In the Target Coverage by Chromosome graph, the number of reads that align to each chromosome of the referenceare plotted as a bar chart. The number of reads that have aligned sequence overlapping any part of the target regionare represented by the gray portion of the plot. Those aligned off-target are represented by the white region.

Version 3.2



Individual Target Coverage Graph

In the Individual Target Coverage graph, the number of aligned base reads are counted for individual target regionsof the reference and normalized by dividing by the length of the target. These valuea are plotted on a bar chart foreach chromosome of the reference to a common scale, set by the highest normalized count. Red areas of the barsshow the fraction of the target bases uncovered by any read. For example, 20:80 red:gray indicates only 80% of theoriginal target was read. Note that with large numbers of targets, details for individual target regions (bars) may notbe visible. Download the data file using the link provided to examine the individual target coverage in full detail.

Version 3.2



On/Off Target Read Alignment Graph

In the On/Off Target Read Alignment graph aligned read starts are counted for each 100 bases of the reference andplotted as a bar if the count as at least five. Hence zero- or low-coverage regions, including isolated read mappings,are not represented in these plots. Plot color is alternated to show continuous regions of coverage. Red and bluerepresent the reads starting in a 100 base region overlapping a target region. Black and gray represent readsstarting outside of a target region. Peaks are contiguous and aligned to 100 base counts along the reference but nodistance between any two peaks is depicted. Note that with large numbers of targets, peak shape and resolutionbetween on- and off-target peaks may not be discernible. Download the data file using the link provided to examinethe coverage in full detail.

Version 3.2



Normalized Target Coverage Graph

In the Normalized Target Coverage graph, the fraction of total target bases covered is plotted against normalizedcoverage, where normalized coverage is the number of times a particular base is read (read depth) divided by theread depth of all target bases. The y-axis is the cumulative read depth divided by the total number of target basereads.

Version 3.2



Version 3.2



Contents


Run Report Metrics




Barcode Reports


Report Information

Output Files

Plugin Summary


Alignment Plugin





sampleID Plugin


Pre-3.0 Run Reports




This section describes the ERCC Analysis plugin. This plugin helps with analyses that use ERCC RNA Spike-inControls. The plugin enables you to quickly determine whether or not the ERCC results indicate a problem witheither the library preparation or the sequencing instrument run.

Enable the ERCC Analysis pluginManually run the ERCC Analysis pluginConfigure a template to run the ERCC pluginPlugin run timesView analysis resultsInterpret the data View transcript detailsDefinitions( ) Configure the ERCC Optional Analysis pluginView plugin error information

Version 3.2



1.

2.

1.

2.

ERCC resources

Enable the ERCC Analysis plugin

A plugin must be enabled before it can run. Your Torrent Server administrator may have already enabled ERCCAnalysis plugin and then the plugin appears in the run report Plugin Summary Select Plugin to Run list.

Follow these steps if you need to enable the plugin:

Scroll to the top of the Torrent Browser and click in the gear menu on the right:Plugins

If the ERCC_Analysis plugin does not appear on your plugin page, click the column to sort by nameNameand scroll to the plugin. In the ERCC_Analysis row, click the Enable column checkbox:

Auto-run is not recommended for the ERCC_Analysis plugin unless most analyses on thisTorrent Server use ERCC controls.

Manually run the ERCC Analysis plugin

Follow these steps to manually launch the ERCC_Analysis plugin. You can use the default minimum R-squaredvalue or enter you own value.

Open the run report for the analysis. Scroll down to the Plugin Summary section.

Version 3.2



1.

2.

3.

4.

5.

Click to open the plugin list:Select plugin to run

Click . (The version number on your system might be different from the version shown here.)ERCC_Analysis

A popup window with a minimum acceptable R-squared value appears. You can use the default value orenter your own value. The value should be in the range from 0 to 1.

Click to start the plugin.Submit

Configure a template to run the ERCC plugin

If you configure a template or planned run to execute the ERCC Analysis plugin, your experiment uses the IonandTotal RNA-Seq Kit V2, then on the wizard Kits page, you must make a Barcode Set selection. Select either one ofthe following in the Barcode Set menu:

IonXpressRNA – Select this if your experiment uses this kit. RNA_Barcode_None – Select this if your experiment does not use a barcode kit. This selection is required

Version 3.2



for the correct trimming.

The following wizard image shows the two barcode kit selections. (Make only one selection per run.)

Plugin run times

For analysis runs with total reads under 1,000,000, the plugin normally takes 2-3 minutes to run (on supportedhardware). For larger runs, the plugin takes approximately an additional 1-2 minutes per million total reads. Forexample, a run with 5 million reads may take 10-15 minutes. These run times are offered only as a guideline. If yourTorrent Server is busy with other processing, plugin run times are longer.

After the ERCC analysis is completed, you can view the analysis results.

View analysis results

Plugin analysis results appear in the plguin summary area:

After the status of the ERCC plugin has changed to “Completed,” click the ERCC_Analysis.html link in the PluginSummary section to open the ERCC Report and view analysis results:

Version 3.2



Interpret the data

The ERCC Report screen (shown on page 5) displays the ERCC Dose Response plot. The points are color-coded,based on mapping quality. There is also a trendline, based on the parameters shown in tabular form to the right ofthe graph.

The y-axis of the plot is the log (base 2) of the raw counts found for the transcript in question. The x-axis is alsologarithmic, but represents the known relative concentration of the ERCC transcripts. Ideally, the points all fall on astraight line.

More realistically, in the good case, the raw counts and relative concentration should at least correlate with a highR-squared (for example, 0.9 or higher). The table to the right of the plot (shown on page 5) shows the R-squaredvalue found for this plot, as well as the Slope, Y-intercept, and N (number of transcripts found) values. Althoughthere are 92 transcripts in the ERCC mix, it is not expected that all 92 will be detected. The number of transcriptsdetected depends on the sequencing depth.

Version 3.2



View transcript details

If you want to look at the details regarding a particular transcript, there are two methods you can use:

Hover your mouse-cursor over a point on the ERCC Dose Response plot to display a popup window thatshows details about that transcript (the name, reads, and coverage plots).

If several points are very close together on the plot and it is difficult to hover over the point you are interestedin, you can zoom in on the plot to more easily distinguish points:

Use your mouse to draw a box around the point of interest and magnify it.To zoom out to the full view of the ERCC Dose Response plot, either doubleclick the plot, or click the

button.Reset Zoom

Scroll to the particular transcript, and click the [+] next to the transcript name.

This method shows the same information, plus a few additional pieces. See Definitions if the meaning of anyof these pieces is unclear.

Definitions

This section defines terms used in the plugin output.

Coverage Depth – The minimum and maximum number of reads covering bases in the transcript. Ifcoverage is 100%, the minimum value will be > 0.

Coverage – The number of base positions covered by at least one read.

Start Sites – The number of base positions that are the start site for a read.

Unique Start Sites – The number of start sites that have only one read starting at the site.

Coverage CV – Coefficient of Variation for coverage = average coverage / stddev coverage for the entiretranscript.

( ) Configure the ERCC Analysis pluginOptional

You can optionally change the R-squared value to set a default value for the summary report screen:

1. If the window showing the minimum acceptable R-squared value is open, close it. Then scroll to the top ofthe Torrent Browser and click in the gear menu on the right:Plugins

Version 3.2



2. If the ERCC_Analysis plugin does not appear on your plugin page, click the column to sort by nameNameand scroll to the plugin. In the row, click the Manage column gear menu, then select ERCC_Analysis Configur

.e

3. The ERCC Plugin Configuration screen opens:

Enter a value between 0 and 1 as your minimum acceptable R-squared value (a lower value is indicatedby a red light in the summary report). Then click .Submit

The value you enter on the is used when the plugin is auto-run andERCC Plugin Configuration screen when a user Users canmanually launches the plugin without entering a value. override this value on aper-run basis when they manually launch the plugin.

Version 3.2



1.

2.

View plugin error information

If the ERCC_Analysis plugin status changes to “Error” after you click the ERCC_Analysis.html link, then somethingwent wrong during the running of the plugin. In this case, look at the error log:

Return to the Plugin Summary, then click the log file icon to see the error log:

Scroll to the bottom of the log to see error messages:

An Error status for the ERCC_Analysis plugin should be a rare event and indicates that the ERCC_Analysis pluginitself failed to run. A plugin error does not indicate that the ERCC_Analysis results are bad.

ERCC resources

The External RNA Controls Consortium (ERCC) is hosted by the U.S. National Institute of Standards andTechnology. The plugin is for experiments that use ERCC Analysis ERCC RNA Spike-In Control Mixes, set of RNAcontrols derived from the ERCC plasmid reference library.

For information on ERCC RNA Spike-In Control Mixes, please refer to the ERCC RNA Spike-In Control Mixes User

http://tools.invitrogen.com/content/sfs/manuals/4455352C.pdf

Version 3.2



(Pub no. 4455352).Guide

For more information on ERCC analysis, refer to the following resources:• Figure 2, Analysis of ERCC read counts, in Sensitivity of RNA-Seq using Ion semiconductor sequencing acomparison to microarrays and qPCR• The Ion Torrent white paper Methods, tools, and pipelines for analysis of Ion PGM™ Sequencer miRNA and geneexpression data• The information on the product page.ERCC ExFold RNA Spike-In Mix

Contents


Run Report Metrics




Barcode Reports


Report Information

Output Files

Plugin Summary


Alignment Plugin





sampleID Plugin


Pre-3.0 Run Reports




The Run RecognitION plugin allows you to submit your best runs to the Ion Community leaderboards. The

http://tools.invitrogen.com/content/sfs/manuals/4455352C.pdf

http://ioncommunity.lifetechnologies.com/docs/DOC-2840

http://ioncommunity.lifetechnologies.com/docs/DOC-2840

http://tools.invitrogen.com/content/sfs/manuals/CO25176_0512.pdf

http://tools.invitrogen.com/content/sfs/manuals/CO25176_0512.pdf

http://products.invitrogen.com/ivgn/product/4456739

Version 3.2



1.

2.

leaderboards are available on the Ion Community, and are organized in leagues according to chip type:

Your Torrent Suite software must be at least version 1.5.1 to use this plugin.

Running the RunRecognitION Plugin

Follow these steps to run to the RunRecognitION plugin:

Go to the report page for your run. Scroll down to the Plugin Summary section, and click Select plugins to.run

In , click :Select a plugin RunRecognitION

Version 3.2



2.

1.

The leaderboard for your chip type is shown, with a message indicating where your ranks among theleaderboard runs.

How Do I Submit My Run to the RunRecognitION leaderboard?

Follow these steps to submit a candidate run to the leaderboard:

Go to the report page for your run. Run the RunRecognitION plugin, as described in #Running the.RunRecognitION Plugin

The Run RecognitION leaderboard is displayed for your chip type.

Version 3.2



1.

2.

3.

1.

2.

Scroll to the Ion Community Login section below the leaderboard. If you do not have an Ion Communityaccount, click to register. Enter your community user name and password.create an account Optionally enter the any of this information about your run:

Your site nameThe reference genome used in this runThe application type for this run

Below the information fields, click and carefully read that information. Click theTerms and Conditionscheckbox " ".I agree to the Terms and Conditions Click at the bottom of the page. If your run qualifies, it is added to the leaderboard:Submit

Version 3.2



2.

What Information About Me Does RunRecognitION Make Public?

If your run is published to the leaderboard, your Ion Community user name and avatar are visible to other membersof the community.

Version 3.2



Contents


Run Report Metrics




Barcode Reports


Report Information

Output Files

Plugin Summary


Alignment Plugin





sampleID Plugin


Pre-3.0 Run Reports

The IonReporterUploader Plugin



The IonReporterUploader plugin transfer results files directly from a Torrent Server analysis to your Ion Reporter™Software organization (available under a separate license).

You can run the plugin on a completed analysis, in the Report tab, or create a run plan that launches the pluginautomatically when the PGM sequencer analysis completes.™

When you run the plugin, you have these options:

Transfer and analyze — Select the Ion Reporter™ workflow to analyze the newly-transferred files. The IonReporter™ analysis begins automatically when file transfer completes. In this release, only single-sampleworkflows are supported.

Transfer but do not analyze automatically — Select to have the files transferred to theNo Workflow

server and imported into Ion Reporter™ application. An analysis is not automatically launched, but thetransferred files appear in the Search Sample page, and an analysis can be launched from the Ion

Version 3.2



1.

2.

3.

4.

5.

Reporter™ UI.Software

Do not transfer — Select to turn off the pluginDo not upload or launch Ion Reporter Analysis

in a run plan. This feature prevents the unnecessary transfer of results when Auto-Run is set for the plugin.This option does not appear in the Select Plugin to Run submission page.

There is a one-time configuration of the plugin in both the Ion Reporter™ UI and the Torrent Browser,Software before the plugin can be used.

Role Requirements

An Ion Reporter™ administrator role must generate an authentication token in the Ion Reporter™ Software SoftwareUI. This token is used to configure the IonReporterUploader plugin in the Torrent Browser (as described below).

Either a regular user or an can configure the plugin in the Torrent Browser.ionadmin

Transfer Limitations

The following limitations apply to the Uploader plugin:

The Uploader plugin transfers results files for a completed run that executed on the Torrent Server where theplugin is configured.You cannot copy results file from a different Torrent Server and have the plugin transfer those files.Only files appearing in the File Links section of a run report are transferred.You cannot add supplemental files to the results files of a run, in order to have the plugin transfer those files.

Run the IonReporterUploader Plugin from a Run Report

Follow these instructions to run the plugin on a completed PGM analysis.™

Log into your Torrent Browser, and go to the Reports tab.

Open the run report for the PGM™ sequencing data to be transferred, and scroll down to the PluginSummary section.

Check that the VariantCaller plugin is not in progress.

Click the button.Select Plugins to Run

Double-click the IonReporterUploader entry. The Ion Reporter Uploader submission screen opens:

Version 3.2



5.

6.

7.

8.

Do not change the pre-configured fields.

If you select an Ion Reporter™ workflow, the uploader plugin launches an analysis on the transferred resultsfiles.

In the Launch Ion Reporter analysis section, select one of the following in the Ion Reporter workflow menu:

No Workflow — The plugin transfers your files to the Ion Reporter™ system, but does notautomatically launch an analysis.

A specific workflow — After the plugin transfers your files to the Ion Reporter™ system, itnamelaunches an analysis using the workflow you select with this menu.

Note: The list of workflow names is read from your Ion Reporter™ department. Please allow a moment forthe menu to be populated.

Click . Submit

Because of the large size of sequencing results files, file transfer typically takes some time. The IonReporter™ analysis cannot be started until file transfer is complete.

Check the progress of the analysis on the import role tab or in the tab pHome Analysis > Analysis Trackerage.

Add the IonReporterUploader Plugin to a Run Plan

To set a run plan to automatically transfer files (after the completion of the PGM analysis), use the ™ Ion Reporter™menu on the Edit Plan page.

The plugin supports the following options:

Transfer and analyze — Select the Ion Reporter™ workflow to analyze the newly-transferred files. The IonReporter™ analysis begins automatically when file transfer completes. In this release, only single-sampleworkflows are supported.

Version 3.2



Transfer but do not analyze automatically — Select to have the files transferred to theNo Workflow

server and imported into Ion Reporter™ application. An analysis is not automatically launched, but thetransferred files appear in the Search Sample page, and an analysis can be launched from the IonReporter™ UI.

Do not transfer — Select to turn off the pluginDo not upload or launch Ion Reporter Analysis

in a run plan. This feature prevents the unnecessary transfer of results when Auto-Run is set for the plugin.This option does not appear in the Select Plugin to Run submission page.

The menu by default is set to not transfer:

The plugin supports automatic launch of an analysis on the transferred files. In this release,Ion Reporter™single-sample analyses are supported (related samples are not supported). For t a workflow:automatic launch, selec

To transfer files without analysis launch, select in the menu.No Workflow

Plugin Not Configured or Not Enabled

If the Uploader plugin is not enabled for Auto-Run, the Ion Reporter menu does not appear in in the Edit Plan™page.

If the Uploader plugin is not configured with the authentication token, the plan page provides a link toIon Reporter™

the Config tab:

Configure Ion Reporter™ for the Plugin

An generates an authentication token.Ion Reporter™ administrator

Version 3.2



1.

2.

3.

4.

5.

If a second authentication token is generated, the previous token becomes invalid immediately.

Configuration Limitation

You cannot configure the plugin to support more than one Ion Reporter™ organization on the Ion Reporter™ server.

Configure the IonReporterUploader Plugin

You configure the plugin in the Torrent Browser with the authentication token that an Ion Reporter™ administratorgenerated in the Ion Reporter™ UI. The plugin is configured once, and then is available for all users on your TorrentServer.

Follow these steps to configure your IonReporterUploader plugin:

Log into the Torrent Browser as either an or a regular user.ionadmin

Go to the tab and scroll down to the plugin section. Find the entry for IonReporterUploader.Config

Click the link for IonReporterUploader, and select : Manage Configure IonReporterUploader

The Ion Reporter™ Uploader Configuration page opens:

If the configuration page already contains an different authentication token, thatconfiguration might now be invalid.

Enter the authentication token from the Ion Reporter™ administrator in the authentication token field, and

Version 3.2



5.

6.

7.

8.

9.

click .Save

If the IonReporterUploader is not enabled, click that checkbox to enable it:

Torrent Browser plugins optionally support an Auto-Run feature. If Auto-Run is enabled forIonReporterUploader, the plugin attempts to transfer all results files from all completed runs on this TorrentServer. In most situations, this behavior is not appropriate and could be expensive. The run plan pagesupports a plugin option to not transfer the results of run being planned.

If you enable Auto-Run for the plugin, select the plugin option in the TorrentDo not upload or launch

Browser Planning tab to avoid transferring files you do not want.

This configuration of the plugin makes all files transferred by the plugin available to the Ion Reporter™organization that generated the authentication key.

Contents


Run Report Metrics




Barcode Reports


Report Information

Output Files

Plugin Summary


Alignment Plugin





sampleID Plugin


Pre-3.0 Run Reports

Version 3.2



The SampleID Plugin


The SampleID Plugin

Ion AmpliSeq™ Sample ID Panel is a human SNP genotyping panel enabling accurate sample verification forincreased confidence in sample data management. The plugin is comprised of nine primer pairs that can becombined with any Ion AmpliSeq Ready-to-Use or Custom Panel for the generation of a unique ID duringpost-sequencing analysis of research samples.

The Ion AmpliSeq™ Sample ID Panel can be used in combination with any Ion AmpliSeq™ Ready-to-Use orCustom Panel using the Ion AmpliSeq™ Designer 1.2 or greater. This plugin is compatible with the Ion Xpress™barcodes set.

Plugin outputRun the SampleID plugin automaticallyRun the SampleID plugin manuallyOn-target metrics

Plugin output

Example plugin output is shown below:

Use the Sample ID column to verify sample fingerprints.

Click on a barcode ID to open the detail report:

With the detail report, you can review the IUPAC SNP calls and click a link in the TaqMan Assay ID column to®

order the corresponding TaqMan Assay.®

Version 3.2



1.

2.

Run the SampleID plugin automatically

You set up the plugin to run automatically when you configure your template. In the Plugin chevron of the templatewizard, you select which plugins run automatically on planned runs created from that template. See the pTemplatesage in the .Torrent Browser User Interface Guide

Run the SampleID plugin manually

You can launch the plugin manually from a completed run report.

Follow these steps to run the plugin manually:

Open the run report and scroll down to the Plugin Summary button. Click . Select plugins to run

In the list, click . The sampleID plugin does not take user input. The plugin Select a plugin sampleIDexecutes immediately (depending on server load) when you click it in the list.Select a plugin

On-target metrics

When you use the SampleID Panel, lower-than-expected number of on-target reads may occur. To recover thecorrect on-target reads metrics, add back the On-Target reads from the Sample ID Panel into the Ion AmpliSeq™Ready-to-Use or Custom Panel Coverage Analysis plugin data.



Version 3.2



Contents


Run Report Metrics




Barcode Reports


Report Information

Output Files

Plugin Summary


Alignment Plugin





sampleID Plugin


Pre-3.0 Run Reports


Torrent Browser Analysis Report Guide (v3.x)

Introduction

The Torrent Variant Caller (TVC) plugin calls SNP and indel variants in a sample across a reference or within atargeted subset of that reference.

Using the Torrent Variant Caller plugin, you can perform six possible analysis types by selecting one of three librarytypes (Whole Genome, Ion AmpliSeq, Ion TargetSeq) and one of two variant frequencies (Germ-line or Somatic). In addition, if you have Target Region and/or HotSpot Region files in BED format, you can upload them and selectthem from the dropdown menu, and they will be applied to your analysis.

If you do not select a Target Regions file or a HotSpot Regions file, the Torrent Variant Callerplugin assumes there are no targeted regions when it runs the analysis.

Version 3.2



1.

2.

3.

4.

1.

2.

Run the Torrent Variant Caller plugin

There are two ways to run the Torrent Variant Caller plugin: automatically, by preconfiguring the plugin to run assoon as primary analysis has completed, or manually, allowing you to run the plugin at any time from a completedrun report.

The Torrent Variant Caller takes a significant amount of time to complete. Setting it up to runautomatically saves time compared to running it manually.

Run Torrent Variant Caller automatically

To run the Torrent Variant Caller plugin automatically, perform the following steps on the Torrent Browser beforerunning the chip on the PGM instrument:™

If you have not previously uploaded BED files for your intended reference library, click the optionReferencesin the Admin gear menu. Click the name of your reference (or " " for a new reference) and upload yourAddBED files. (Skip this step if you have already uploaded BED files for your reference. For information aboutworking with BED files, see the section in .)Work with BED Files Torrent Suite User Documentation

Click the tab in the Torrent Browser. In your template, Plan your run and select Run Type, VariantPlanFrequency, and Reference. For information about templates and planning a run, see the and Plan Tab Templ

pages in the .ates Torrent Browser User Interface Guide

If the application type is AmpliSeq or TargetSeq, select the proper target and HotSpot region files. The menuselections will depend on your selected reference.

Run the plan on the PGM™ or Proton™ instrument (either by selecting the planned run or entering the plan's For information about running a plan, see the "Work with Completed Runs" section in short code). the Torrent

. The Torrent Variant Caller runs automatically after primary analysis hasBrowser User Interface Guidecompleted.

The Torrent Variant Caller plugin is not run if you select Generic Sequencing as the sequencingrun type.

Run Torrent Variant Caller Manually

To run the Torrent Variant Caller plugin manually, perform the following steps:

In the Torrent Browser, select a run report on the page or on a Data > Completed Runs & Reports Data >page.Projects > projectname

On the run report page, scroll about halfway down the screen to the Plugin Summary area. Click Selectplugins to run. In the list of plugins, click on variantCaller.

https://iontorrent.jira.com/wiki/display/TSUD/Work+with+BED+files

http://lifetech-it.hosted.jivesoftware.com/docs/DOC-2941







Version 3.2



2.

3. The Torrent Variant Caller Plugin interface appears.

The first item, Reference Genome, displays the reference used for mapping. The same reference is usedfor the variant caller run. The reference cannot be changed from within the Torrent Variant Caller Plugininterface.

The TVC plugin supports multiple run analysis. The plugin can analyze a BAM file generated fromCombine Alignment on multiple reports in a project. Combine Alignment creates a new run report (in the

ou can open the new combined run report and use the button tosame project). Y Select plugins to runlaunch the TVC plugin.

Version 3.2



4. Select a Library Type for your analysis from the dropdown menu. Options include , Whole Genome Ion, and .AmpliSeq Ion TargetSeq

The TVC plugin supports the various panels in the Ion AmpliSeq family of sequencing kits:™

Ion AmpliSeq Cancer Panel™Ion AmpliSeq™ Comprehensive Cancer PanelIon AmpliSeq™ Inherited Disease PanelIon AmpliSeq™ Custom Panels

The TVC plugin can also analyze data generated from the Ion TargetSeq Exome kit.™

When an is selected, a Trim Reads checkbox appears, for which the defaultIon AmpliSeq™ product setting is checked. This setting trims reads to amplicon targets, primarily to avoid variant sites beingcovered by residual primers from overlapping amplicons.

The Ion TargetSeq allows you to specify Target Padding and whether to Use Unique Starts.™ optionTarget Padding allows for calling variants the specified number of bases adjacent to a target region.Checking Unique Starts will perform the variant calling using just one read starting at each referenceposition for both read orientations. This removes bias due to non-uniform library enrichment but producesa most conservative representation of target coverage. Checking this option can increase specificity andreduce sensitivity.

5. Select a Variant Frequency for your analysis from the dropdown menu. Options include or Germ-line Somatic. Select Germ Line unless you are looking for low frequency variants (<20%); in that case, select Somatic.

6. If they are needed for your analysis, select Targeted Regions or HotSpot Regions BED files by doing one ofthe following:

If the Target Regions file and/or HotSpot regions files you want to use already appear in the dropdownmenu, select them.If you want to use a Target Regions or HotSpot Regions file that is not already included as an option inthe dropdown menu, use the BED file uploader on a reference page to upload the BED file. Once youhave uploaded a new BED file, it appears in the dropdown menu, and you can select it for use in youranalysis.

If you do not select a Target Regions file or a HotSpot Regions file, the TorrentVariant Caller plugin assumes there are no targeted regions when it runs theanalysis.

BED files provided by Life Technologies can be downloaded from the Ion Community. Use the BED fileuploader to include these files as options in the dropdown menu.

For more information about BED files, see .Work with BED Files

7. When you are satisfied with your selections, click . The analysis runs and a group of output reports isSubmitcreated.

Torrent Variant Caller plugin output

The Torrent Variant Caller plugin output includes the following details reports:

Barcode Coverage and Variants ReportVariant Caller Report

https://iontorrent.jira.com/wiki/display/TSUD/Work+with+BED+files

Version 3.2



Variant Calls SummaryVariant CallsAllele Coverage for All Bases in HotSpot Regions

In addition, there is a File Links section, which is a list of output files generated by the Torrent Variant Caller Plugin.The plugin output files can be loaded into the Broad Institute's IGV or other third-party tools for further visualizationor analysis.

Variant Caller results for analyses with a very large number of variants (such as exome or genome analyses) arebest viewed in Chrome or Firefox rather than Internet Explorer, because Internet Explorer runs Javascript moreslowly than other browsers, especially on large datasets. The workaround for using Internet Explorer is to confirmcontinuing to run the scripts as many times as prompted until the results load.

You can hide report sections by clicking the collapse icon for a section, in hts header bar:

Barcode Coverage and Variants Report

The Barcode Coverage and Variants Report is a table that provides a summary list of reports per barcode. For eachbarcode, various types of data are displayed that can help you evaluate the quality of your run.

Barcoded samples are represented by different colors. A successful barcode is shown with a clickable hyperlink, afailed barcode is shown with a red term, and non-existent barcode is represented with a gray term.The followingtable provides descriptions of the Barcode Coverage and Variants Report columns.

Column Description

Variant Caller Reports Individual reports for each barcode. For anon-barcoded run, this report is not generated.

Mapped Reads Number of reads that map to the reference genome.

Reads On-Target Number of reads that overlap the target region.

Bases On-Target Number of bases that overlap the target region.

Read Depth Average coverage in all targeted regions. (The numberof bases in reads that overlap the targeted region,divided by total length of the region.)

Version 3.2



1x Coverage Percentage of the targeted region that has at least 1xcoverage.

20x Coverage Percentage of the targeted region that has at least 20xcoverage.

100x Coverage Percentage of the targeted region that has at least100x coverage.

Variants Detected Number of variants detected in the targeted region.

Variant Caller Report

Variant Caller Reports are individual reports (per barcode) which can be selected from the Barcode Coverage andVariants Report shown above.

While the Barcode Coverage and Variants Report provides a summary of all available barcode reports, the VariantCaller Report provides additional data, such as variant categories and information in HotSpot regions.

The following tables provide descriptions of the Variant Caller report columns.

Report Header

Column Description

Number of mapped reads Total number of reads mapped to the reference.

Version 3.2



Percent reads on target The percentage of reads mapped to any targetedregion relative to all reads mapped to the reference.

Number of mapped bases The total number of target bases covered by anynumber of aligned reads.

Percent bases on target The percent of all bases covered by reads aligned tothe reference that covered bases in target regions.

Report Tables - Target Regions / HotSpot Regions

Column Description

Bases in target regions The total number of bases in all target regions of thereference.

Average base coverage depth The average number of reads of all targeted referencebases. This is the total number of base reads on targetdivided by the number of targeted bases, and thereforeincludes any bases that had no coverage.

Uniformity of coverage The percentage of target bases covered by at least0.2x the average base coverage depth.

Coverage at 1x The percentage of target bases covered by at least 1read.

Coverage at 20x The percentage of target bases covered by at least 20reads.

Coverage at 100x The percentage of target bases covered by at least 100reads.

Heterozygous SNPs Number of called heterozygous SNPs in target regionsor loci.

Homozygous SNPs Number of called homozygous SNPs in target regionsor loci.

Heterozygous INDELs Number of called heterozygous INDELs in targetregions or loci.

Homozygous INDELs Number of called homozygous INDELs in targetregions or loci.

Heterozygous SNPs and INDELs differ from the reference in only one copy of the chromosome,while homozygous SNPs and INDELs differ from the reference in both copies of thechromosome.

Version 3.2



Variant Calls Summary

The Variant Calls Summary table shows the number of variants per chromosome. In this table, you can select thenumber of entries to display, filter the table based on search terms, or export the table for use with other third-partydata analysis tools.

You can use this report monitor the quality of your run on a per-chromosome basis. For example, if onechromosome has an unexpected number of variants, this might indicate an issue with the run.

The following table provides descriptions of the Variant Calls Summary Report columns.

Column Description

Chromosome The chromosome (or contig) name in the referencegenome.

Variants The total number of variants called (in the targetregions of) the reference.

Het SNPs The total number of heterozygous SNPs called (in thetarget regions of) the reference.

Hom SNPs The total number of homozygous SNPs called (in thetarget regions of) the reference.

Het INDELs The total number of heterozygous INDELs called (in thetarget regions of) the reference.

Hom INDELs The total number of homozygous INDELs called (in thetarget regions of) the reference.

HotSpots The total number of variants identified with one or moreHotSpots.

Variant Calls

The Variant Calls table has several interactive features, including the following:

Version 3.2



Multi-column sortingTable search and filterPaging and re-sizingColumn hiding, re-sizing and movingLinking to IGV (Integrative Genomic Viewer)Displaying up to 5 million recordsRow selection for exporting data

The following table provides descriptions of the Variant Calls report columns.

Column Description

View Click to open the variant in the Broad Institute'sIGVIntegrative Genomics Viewer to see all reads coveringthe variant.

The IGV is hosted by the BroadInstitute, so internet connectivity isrequired from the machine runningyour web browser. Use of the IGValso requires a Java RuntimeEnvironment installed on thedesktop.

Version 3.2




Position The one-based position in the reference genome.

Gene Sym Gene Symbol for the gene where the variant is located.This value is not available (N/A) if no target regionswere defined (full genome was used).

Target ID Name of the target region where the variant is located.This value is not available (N/A) if no target regionswere defined (full genome was used).

Var Type Type of variation detected: SNP (single nucleotidepolymorphism), MNP (multinucleotide polymorphism),IN (insertion), or DEL (deletion).

Zygosity Assigned zygosity of the variation: HOM (homozygous),HET (heterozygous), or NC (no call).

Ref The reference base(s).

Variant Variant allele base(s).

Var Freq Frequency of the variant allele.

P-value Estimated probability that the variant could beproduced by chance. (The smaller the p-value, thehigher the confidence in the variant call.)

Coverage The total reads covering the position.

Ref Cov The number of reads covering the reference allele.

Var Cov The number of reads covering the variant allele.

HotSpot ID The HotSpot ID for one or more starting locationsmatching the identified variant. (Examples: cosmic ID,dbSNP ID.)

Allele Coverage for all Bases in HotSpot Regions

The Allele Coverage for all Bases in HotSpot Regions report provides allele- and strand-specific coverageinformation for each location of interest, as defined in a HotSpot BED file. The purpose of this table is to provideinvestigators with additional information about locations of interest, in the event that a variant wasn't called at thelocation of interest and wasn't shown in the Variant calls table.

The Allele Coverage for all bases in HotSpot regions report has been updated for the Torrent Suite 2.0 release. Newcolumns include: HotSpot ID, Cov (+), and Cov (-).

Version 3.2



The following table provides descriptions of the Allele Coverage for All Bases in HotSpot Regions report columns.

Column Description


Position The one-based position in the reference genome.

Target ID Name of the target region containing the HotSpotvariation site.

HotSpot ID Name of the HotSpot variant site(s) s overlapping. (Examples: cosmic ID, dbSNP ID.) current position

Name(s) marked with a '*' have multiple start positionsor start position changed after LeftAlignment.

Ref The reference base(s).

Coverage The total reads covering the position.

A Number of reads calling A.

C Number of reads calling C.

G Number of reads calling G.

T Number of reads calling T.

INDEL Number of reads calling either an insertion or deletionat this base location.

Cov (+) Number of forward reads aligned over the referencebase.

Version 3.2



Cov (-) Number of reverse reads aligned over the referencebase.

File Links

The File Links section contains links to the plugin results files. The variant calls files (VCF files) are in VCF 4.1format. The plugin output files can be loaded into the Broad Institute's IGV or other third-party tools for furthervisualization or analysis. If your run includes barcoded data, barcode file links also appear in this section.

The following table provides descriptions of the files available in the File Links section.

Link Description

Open internal IGV to import genome Opens the genome in the IGV browser.

Variant calls file Variant calls generated by this plugin, in table format: textfile.xls

Allele counts file Coverage and allele information, in table format: textfile.xls

SNP calls file SNP calls generated by this plugin, in VCF format: binaryfile.vcf.gz

SNP calls VCF index file Index of the SNP calls file, generated from the SNPcalls file. Format: binaryfile.vcf.gz.tbi

INDEL calls file INDEL calls generated by this plugin, in VCF format: binaryfile.vcf.gz

Version 3.2



INDEL calls VCF index file Index of the INDEL calls file, generated from the INDELcalls file. Format: binaryfile.vcf.gz.tbi

Target regions file Target regions file generated by this plugin, in BEDformat: textfile.bed

Target hotspots file Target HotSpots file generated by this plugin, in BEDformat: textfile.bed

Mapped reads file Mapped reads file generated by this plugin, in BAMformat: binaryfile.bam

Mapped reads index file Index of the mapped reads file, generated from themapped reads file. Format: binaryfile.bai

TaqMan Assay Search®

After running the TVC plugin, you can select variants from a report table and submit a search against the TaqMan ®

Assay Search webpage. When the search is submitted, you can choose which Assay database to search.TaqMan®

A new browser window appears with the search results. If assays are available for the selected variant,TaqMan®

you can immediately order the assay directly from the landing page. You must be connected to the internet toaccess this feature.

To initiate a search, simply select variants from the TVC plugin report and click on the tool icon. A pop-up window

allows you to submit variants for TaqMan assay design.®

Version 3.2



You are then presented with a list of validation assays that you can order from Life Technologies.

© 2012 Life Technologies Corporation. All rights reserved.The trademarks mentioned herein are the property of Life Technologies Corporation or their respective owners.Taqman is a registered trademark of Roche Molecular Systems, Inc.


http://www.iontorrent.com/

Version 3.2



Contents


Run Report Metrics




Barcode Reports


Report Information

Output Files

Plugin Summary


Alignment Plugin





sampleID Plugin


Pre-3.0 Run Reports

Version 3.2






The section of the Analysis Report provides information about the performance of eachTest Fragment SummaryTest Fragment included in the experiment.

Test Fragments are used during analysis to predict the CF/IE/DR values for each Test Fragment,regionally. Analysis results for a Test Fragment are displayed when there are at least 1000 high-quality TestFragments, where there is an 85% match against the appropriate template in the Test Fragment list. This includesCF/IE/DR estimates and performance calculations.

The number of TFs reported includes lower quality TFs, down to 70% match, to better representthe run quality from all TF's.

Open the test fragment report

Open the test fragments report with the Test Fragments button, near the bottom of the run report:

Test fragment metrics

The Test Fragments report displays the following information:

Parameter Description

Test Fragment Test fragment name (defined in the Admin >References tab of Torrent Browser).

Reads Number of filtered & trimmed reads identified for thistest fragment.

Version 3.2



Percentage 50AQ17 The percentage of reads for this with atest fragmentminimum of 50 base pairs in length and an error rate of1 in 50, Phred-like 17, or better. Quality is based onalignment, not predicted quality.

The test fragment sequence is also shown in the read length histogram.

Read length histogram

This is a histogram of read lengths, in units, that have a Phred-like score of 17 or better, or one error in 50 bpbp(the ends only are shown because of width considerations):

Distributions skewed to the right are ideal, showing longer read lengths (test fragments are a discrete length). It islikely that the sequence can extend all the way through the , if enough flows are run, so the histogramtest fragmentonly displays a maximum size based on the length of the .test fragment

Version 3.2



Contents


Run Report Metrics




Barcode Reports


Report Information

Output Files

Plugin Summary


Alignment Plugin





sampleID Plugin


Pre-3.0 Run Reports

Version 3.2



Report Information


Report Information

This section describes the following run report buttons:

Analysis DetailsSoftware VersionSupport

Analysis Details

The report displays the following information:Analysis Details


Run Name Name of the run.

Version 3.2



Run Date Date and time the PGM™ run was started.or Proton™

Run Cycles Number of PGM™ cycles analyzed for thisor Proton™ report. Note that this number can differ from the totalnumber of cycles run on the sequencer.

Run Flows Number of PGM™ nucleotide flowsor Proton™ analyzed for this report. Note that this number candiffer from the total number of flows occurring on thesequencer.

Project Names of the projects the result set is a member of.

Sample Name of the sample assigned to the run used togenerate this analysis. This is assigned on the PGM™

sequencer.or Proton™

Library Name of the library assigned to the run used togenerate this analysis. This library name is used tospecify the reference genome used for alignment.

PGM Name of the PGM™ or Proton™ sequencer on whichthe run was performed. This value is typically enteredon the sequencer.

Flow Order Flow order selected on PGM™ sequencer: or Proton™ Samba = TACGTACGTCTGAGCATCGATCGATGTACAGC [Default] Regular = TACG The "regular" flow order adds bases most rapidly tosequenced molecules but is vulnerable to phase errors.The Samba flow order consists of a 32-base sequence,repeated. This flow order resists phase errors byproviding opportunities for out-of-phase molecules tocatch up and is designed to sample all dimer(nucleotide pair) sequences, efficiently. Samba is thedefault flow order because it improve sequencingaccuracy for longer reads by resisting phase errors.

Library Key A short known sequence of bases used to distinguishthe library fragment from the test fragment. Example:"TCAG"

TF Key A short known sequence of bases used to distinguishthe test fragment.

Chip Check A series of tests on reference wells (about 10% of thechip in non-addressable areas) is performed to ensurethat the chip is functioning at a basic level. The value ofthis field is either or .Passed Failed

Version 3.2



Chip Type Type of chip used on the PGM . Usually,™ sequencer314, 316, or 318 (for the Ion 314™ chip, Ion 316™chip, and Ion 318™ chip.) A letter follows the numbers,indicating the chip version.

Chip Data In this release, the value is , for a forward run.single

Notes A space for text notes entered during the PGM™ or Prsequencer run.oton™

Barcode Set The name of the barcode set assigned to the run. Blank for non-barcode libraries.

Analysis Name Name of the analysis provided in Torrent Browser whenthe analysis was initiated. If the analysis was scheduledto auto-start, this is the default analysis name.

Analysis Date Date the analysis was performed.

Analysis Flows Number of PGM™ nucleotide flows or Proton™analyzed for this report. Note that this number candiffer from the total number of flows occurring on thePGM™ sequencer. or Proton™

runID The run code that the Torrent Browser assigned to theplanned run for this analysis.

Software Version

The report display includes version information for the Torrent Suite Software and its modulesSoftware Versioninstalled on your Torrent Server.

The version numbers shown in the example may be different from your current version of thesoftware depending on the age of the analysis. See the About tab in the Torrent Browser for acomplete list of modules and version on your server. See the Torrent Suite Release Notes forthe package versions in a specific release.

Version 3.2




Torrent Suite Version of Torrent Suite software used to generate theanalysis.

Datacollect Version of the Datacollect package.

Graphics Version of the Graphics package

LiveView Version of the LiveView package.

Script Version of the Script package.

host Host name where the Torrent Server is installed.

ion-alignment Version of the Torrent Suite alignment module used forthis analysis.

ion-analysis Version of the Analysis Pipeline used to generate theanalysis.

ion-gpu Version of the NVIDIA Tesla GPU driver.

ion-pipeline Version of the analysis pipeline.

Support

The Support button opens links to the following:

Download the Customer Support Archive – Download a ZIP archive containing the PDF and HTML

Version 3.2



version of the run report as well as useful logs in case troubleshooting is required.Download the New Customer Support Archive – Generate a new customer support archive and downloadit.View the Report Log – View the error log for this run report.

An example report log is shown below (chopped for width considerations):

Version 3.2



Contents


Run Report Metrics




Barcode Reports


Report Information

Output Files

Plugin Summary


Alignment Plugin





sampleID Plugin


Pre-3.0 Run Reports

Version 3.2



CSV Metric File Format

A Comma-Separated Value (CSV) file is a universal text file format for storing data. You can download an analysismetrics CSV file that contains analysis-level information for each Torrent Server analysis run, using the TorrentBrowser list view.Data > Completed Runs & Reports

In the CSV file, each line represents a Torrent Server analysis run, and within each line information fields areseparated by a comma. These files are easily opened using spreadsheet software, such as Microsoft Office Excel orOpen Office Calc, where each comma-separated field is listed in a separate column. The Torrent Browser CSV filehas 82 CSV fields per entry, as described in the following table:

Field Description

Report Name of the analysis run report

Status Status of the analysis (e.g., Started, Complete)

Cycles Number of flow cycles from the actual sequencing run

Plugin Data JSON string of plugin data

TF Name* Test Fragment Name

Q10 Mean* Average Q10 read length.

Q17 Mean* Average Q17 read length

Q10 Mode* Mode Q10 read length

Q17 Mode* Mode Q17 read length

System SNR* System Signal-to-Noise Ratio

50Q10* Number of TF Ion Sphere™ Particles (ISP) at 50+ bp atQ10

50Q17* Number of TF Ion Sphere™ Particles (ISP) at 50+ bp atQ17

Keypass Reads* Number of reads that have test fragment keys

CF* CAFIE metric: Carry forward

IE* CAFIE metric: Incomplete extension

DR* CAFIE metric: Signal/polymerase loss (droop)

TF Key Peak Counts* Signal strength of the first three bases of the TF key

Version 3.2



Total_Num_Reads Total number of reads

Library_50Q10_Reads Reads of length at least 50bp with 90% or greateraccuracy



Library_Mean_Q10_Length Average length of reads with 90% or greater accuracy

Library_Q10_Coverage Average per base coverage considering reads with90% or greater accuracy

Library_Q10_Longest_Alignment Longest read length amongst reads with 90% orgreater accuracy

Library_Q10_Mapped Bases Total bases from reads with 90% or greater accuracy

Library_Q10_Alignments Number of alignments from reads with 90% or greateraccuracy







Library_Q17_Mapped Bases Total bases from reads with 98% or greater accuracy



Version 3.2








Library_Q20_Mapped_Bases Total bases from reads with 99% or greater accuracy


Library_Key_Peak_Counts Signal strength of the first three bases of the library key

Library_50Q47_Reads Number of perfect reads of length at least 50bp



Library_Mean_Q47_Length Average length of perfect reads

Library_Q47_Coverage Average per base coverage considering only perfectreads

Library_Q47_Longest_Alignment Longest reads length amongst perfect reads

Library_Q47_Mapped_Bases Total bases from perfect reads

Library_Q47_Alignments Number of alignments from perfect reads

Library_CF CAFIE metric: Carry forward

Library_IE CAFIE metric: Incomplete extension

Library_DR CAFIE metric: Signal/polymerase loss (droop)

Library_SNR System Signal-to-Noise Ratio

Sample Name of the sample

Version 3.2



Project Name of the project to which the sample belongs

Library Name of the reference genome

Notes Any additional user-provided notes

Run Name Long name of the analysis run

PGM Name Name of the PGM where the sample was sequenced

Run Date Date the sample was sequenced

Run Directory Location of the raw DAT files on the Torrent Server

Num_Washouts NA

Num_Dud_Washouts NA

Num_Washout_Ambigous NA

Num_Washout_Live NA

Num_Washout_Test_Fragment NA

Num_Washout_Library NA

Library_Pass_Basecalling NA

Library_pass_Cafie NA

Number_Ambiguous NA

Number_Live Number of wells producing a signal

Number_Dud Number of wells with ISPs but no signal

Number_TF Number of wells containing test fragment

Number_Lib Number of wells containing library

Number_Bead Number of wells containing beads

Library_Live Number of wells containing library ISP with signal

Library_Keypass Number of wells containing library ISP with signal andmatch key

Version 3.2



TF_Live Number of wells containing test fragment ISP withsignal

TF_Keypass Number of wells containing test fragment ISP withsignal and match key

Keypass_All_Beads Number of wells containing ISP with signal and matchkey

* Columns 5-17 contain test fragment metric. There is one row of metrics for each test fragment: A through D. Theother columns contain library read metrics.

Version 3.2



Pre-3.0 Run Reports


Pre-3.0 Run Reports

This section describes the old style run reports used before release 3.0. The old style run report use an older layoutand do not offer 3.x features.

To view analysis runs generated with earlier version of the Torrent Suite software, you must either re-analyze therun to create a 3.x-style run report or use the older report format.

Some features that previously were available in run reports are moved in 3.x releases. For example, in 3.x, tocombine alignments you create a project, use a template that creates run results in that project, and use the Data >

button. This button replaces the combinAlignments plugin that wasProjects > > Combine Selected...projectnameavailable in previous releases.

Contents

(3.x)Torrent Browser Analysis Report Guide

Pre-3.0 Run Reports

Pre-3.0 Library Summary Overview

Pre-3.0 Library Summary Report

Pre-3.0 Barcode Reports

Pre-3.0 Test Fragment Report

Pre-3.0 Ion Sphere Particle Summary

Pre-3.0 Report Information

Pre-3.0 File Links

Pre-3.0 Plugin Summary

Pre-3.0 Running the Installed Plugins

(3.x) Alignment Plugin

(3.x) Coverage Analysis Plugin

(3.x)ERCC Analysis Plugin

(3.x)Run RecognitION Plugin

(3.x)sampleID Plugin

(3.x)Torrent Variant Caller Plugin

Pre-3.0 Library Summary


Version 3.2



Pre-3.0 Library Summary

This section provides background information and a detailed description of the report.Library Summary

Library Summary OverviewLibrary Summary Report

Contents


Run Report Metrics




Barcode Reports


Report Information

Output Files

Plugin Summary


Alignment Plugin





sampleID Plugin


Pre-3.0 Run Reports




This section of the Torrent Browser Analysis Report gives performance metrics for reads whoseLibrary Summaryinitial bases match the library key.

These reads are generated from the input library, not from the positive control Test Fragments.

Performance is measured based on either predicted quality or quality as measured following alignment.

Version 3.2



1. 2. 3.

Using Predicted Quality (Q17/Q20)Using Quality Following Alignment (AQ17/AQ20)

Using Predicted Quality (Q17/Q20)

The number of called bases with a predicted quality of Q17 or Q20 is reported. The predicted quality values arereported on the Phred scale, defined as (error probability). Q20, therefore, corresponds to a predicted-10×log10

error rate of one percent and Q17 corresponds to a predicted error rate of two percent.

Refer to for a more complete description ofhttp://en.wikipedia.org/wiki/Phred_quality_scorePhred values.

Using Quality Following Alignment (AQ17/AQ20)

Alignment of reads can be a useful process to assess the quality of the sequencing reaction and the quality of theunderlying library where an accurate reference is available. Reads are aligned to a reference genome. Anydiscrepancy in alignment to a reference (whether biological or technical, meaning a real variant or a sequencingerror) is listed as a mismatch. Alignment performance metrics are reported depending on how many misalignedbases are permitted. Torrent Suite reports alignment performance at three quality levels:

AQ17AQ20Perfect

How Is Aligned Read Length Calculated?

The aligned length of a read at a given accuracy threshold is defined as the greatest position in the read at whichthe accuracy in the bases up to and including the position meets the accuracy threshold. So for example the AQ17length of a read is the greatest length at which the read error rate is 2% or less, and the AQ20 length is the greatestlength at which the error rate is 1% or less. The "perfect" length is simply the longest perfectly aligned segment. For all of these calculations the alignment is constrained to start from position 1 in the read - in other words, no 5'clipping is permitted.

The underlying assumption is that the reference to which the read is aligned represents the true sequence thatshould have been seen. Suitable caution should be taken when interpreting AQ17 values in situations where thesample sequenced has substantial differences relative to the reference used, such as working with alignments to arough draft genome or with samples that are expected to have high mutation rates relative to the reference used. Inthese situations the AQ17 lengths might be short even when sequencing quality is excellent.

Specifically, the AQ20 length is computed as follows:

Every base in the read is classified as being correct or incorrect according to the alignment to the reference.At every position in the read the total error rate is computed up to and including that position.The greatest position at which the error rate is one percent or less is identified and that position defines theAQ20 length.

For example, if a 100bp read consists of 80 perfect bases followed by 2 errors followed by 18 more perfect bases,the total error rate at position 80 is zero percent. At position 81 the total error rate is 1.2% (1/81), at position 82 theerror rate is 2.4%, continuing up to position 100 where it is two percent (2/100). The greatest length at which theerror rate is one percent or less is 80 and the greatest length at which the error rate is two percent or less is 100, sothe AQ20 and AQ17 lengths are 80 and 100 bases, respectively.

How Is Alignment Performed?

http://en.wikipedia.org/wiki/Phred_quality_score

Version 3.2



Within Torrent Browser, the objective is to provide you with a view on alignment that helps determine run and libraryquality.

There are many alignment algorithms available within the marketplace and you are encouraged toconsult with a bioinformatician for the most appropriate alignment algorithm for your downstream analysisneeds. Alignment algorithms are also embedded in many of the commercial software tools availablewithin the Ion Torrent Web store. You are also encouraged to experiment with these tools.

Alignment within Torrent Browser is performed using TMAP. TMAP is currently an unpublished alignment algorithm,created by the authors of the BFAST algorithm. Please, contact Ion Torrent Technical Support for more informationabout TMAP.

Technical Note - Analysis PipelineTechnical Note - TMAP Alignment

Although TMAP is unpublished and a reference is not currently available, the precursor to TMAP,BFAST, is based on the ideas in the following publications:

Homer N, Merriman B, Nelson SF.BFAST: An alignment tool for large scale genome resequencing.PMID: 19907642PLoS ONE. 2009 4(11): e7767. http://dx.doi.org/10.1371/journal.pone.0007767

Homer N, Merriman B, Nelson SF.Local alignment of two-base encoded DNA sequence.BMC Bioinformatics. 2009 Jun 9;10(1):175.PMID: 19508732 http://dx.doi.org/10.1186/1471-2105-10-175

Which Reads Are Used in the Alignment Process?

The alignment stage involves aligning reads produced by the pipeline to a reference genome and extracting metricsfrom those alignments. By default, Torrent Suite aligns all reads to the genome, however there may be situations,particularly with large genomes, where the alignment takes longer than the user is willing to wait. So for suchcircumstances the Torrent Suite also has the capability to define on a per-reference basis the maximum number ofreads that should be aligned from a run. For more detail on how to enable and specify this reference-specific limitsee the Adding a Reference Sequence section of .Working with Reference Sequences

When the number of reads in a run exceeds a genome-specific maximum, a random sample of reads is taken andresults are extrapolated to the full run. By sampling a quickly-aligned subset of reads and extrapolating the valuesto the full run, the software gives you enough information to be able to judge the quality of the sample, library andsequencing run for quality assessment purposes.

The outputs of the alignment process is a BAM file. The BAM file includes an alignment of all reads, including theunmapped, with exactly one mapping per read. When a read maps to multiple locations, the mapping with the bestmapping score is used. If more than one such mapping exists, a random mapping is used and given a mappingquality of zero.

If sampling is in effect for a run and full read alignment is needed, the analysis can be manuallyre-run using the tab option and checking the chRuns Advanced Override alignment samplingeckbox.

https://iontorrent.jira.com/wiki/display/TSUD/Technical+Note+-+Analysis+Pipeline

https://iontorrent.jira.com/wiki/display/TSUD/Technical+Note+-+TMAP+Alignment

http://dx.doi.org/10.1371/journal.pone.0007767

http://dx.doi.org/10.1186/1471-2105-10-175

https://iontorrent.jira.com/wiki/display/SDBX/Working+with+Reference+Sequences

Version 3.2



Contents


Pre-3.0 Run Reports







Pre-3.0 File Links












Performance, based on either predicted quality or quality as measured following alignment, is provided in the Librar section of the Detailed Report. This section of the report contains the following information:y Summary

Based on Predicted Per-Base Quality Scores - Independent of Alignment

The section gives performanceBased on Predicted Per-Base Quality Scores - Independent of Alignmentmeasurements based on predicted quality:

Version 3.2




Total Number of Bases [Mbp] Number of filtered and trimmed million base pairsreported in the SFF and FASTQ files.

Number of Q20 Bases [Mbp] Number of bases with predicted quality of Q20 orgreater.

Total Number of Reads Total number of filtered and trimmed readsindependent of length reported in the SFF and FASTQfiles.

Mean Length [bp] Average length, in base pairs, of all filtered andtrimmed library reads reported in the SFF and FASTQfiles.

Longest Read [bp] Maximum length, in base pairs, of all filtered andtrimmed library reads reported in the file.


Read Length Histogram

The is a histogram of the trimmed lengths of all a reads present in the SFF file. TheRead Length Histogramfollowing figure illustrates an example graph:

Consensus Key 1-Mer

The graph shows the strength of the signal from the first three one-mer bases of the libraryConsensus Key 1-Merkey. This graph represents the consensus signal measurement of release of H+ during nucleotide incorporation.



Version 3.2



The y-axis shows signal strength, measured in , which is an arbitrary but consistent unit of measure. TheCountsx-axis shows time as nucleotide over the chip.Flows There is a known key at the beginning of every library read. Typically, three bases are shown of the 4-mer key. Notethat the graph is displayed in "flow order" rather than "base order." For example, the four-base library key is typicallyTCAG for nucleotides one through four and is graphed as TCA, representing the nucleotide flow order. Negativeflows are not displayed.

Q: If the library key is 4 bases, why are only three bases displayed in the key one-mer graph?A: The next base after the last key base is the first library base. This base varies depending on the libraryfragment. If the last key base is a G and the first library base is a G, both of these are incorporated in thesame flow resulting in a signal roughly 2X of a one-mer. Thus, the last base of the library read is notinformative for quality purposes because that flow can contain library information in addition to keyinformation. The one-mer key pass graph only contains n-1 flows for an n-mer library key.

Reference Genome Information

The includes the :Library Summary Reference Genome Information


Genome Name Name of reference genome.

Genome Size Number of bases in the reference genome.

Genome Version Version information for the genome used.

Index Version Version information for the genome index used.

If an alignment error occurred, a message prompts you to view the report log for information about the error.

Based on Full Library Alignment to Provided Reference

Version 3.2



This section of the report shows performance as measured following alignment.Library Summary


Total Number of Bases [Mbp] Number of million of base pairs that have been alignedto the genome at the specified quality level.

Mean Length [bp] Average length, in base pairs, of all library reads thataligned to the genome at and (the longestQ20 Perfectperfectly aligned segment).

Longest Alignment [bp] Maximum length, in base pairs, of all library reads thataligned to the genome at a specific quality level.

Mean Coverage Depth Average number of times that a base wasindependently sequenced and aligned to the referencegenome. 1X means that every base was sequencedand aligned, on average, once. 2X means that everybase was sequenced and aligned, on average, twice.

Percentage of Library Covered [bp] Percentage of the reference genome that is covered ata minimum of 1X by filtered library reads at a specificquality.

Using the TMAP Alignment Algorithm

When the reference genome is a large genome, alignment is performed on a random subset of the reads in the SFFand FASTQ files. You can specify sampling and the number of reads to sample on a per-genome basis. Samplingonly occurs if this number is set during reference upload. Otherwise, complete alignment is performed. The values inthis table are extrapolated to the full number of reads.

Refer to the section of the forWork with Completed Runs Torrent Browser User Interface Guidea description of how to use the flag to force all reads to be usedOverride alignment samplingfor alignment.

Read Alignment Distribution

Summarizing the alignments produces the following report format:

https://iontorrent.jira.com/wiki/display/TSUD/Work+with+Completed+Runs

Version 3.2



The number of rows displayed varies depending on the read length.

Each column shows data based on alignment of the sample.

Column Description

Read Length [bp] The number of bases in each read considered for therow in the table.

Reads Number of reads with at least bases.Read Length

Unmapped Number of reads that TMAP could not map.

Excluded Number of reads mapped but not having 90% accuracyin first 50 bases.

Clipped Number of reads mapped and with accuracy of greaterthan 90% in first 50 bases, but with align length lessthan the threshold.Read Length

Perfect Number of aligned reads with zero mismatches in thefirst bases.Read Length

1 mismatch Number of aligned reads with one mismatch in the first bases.Read Length

2 mismatches Number of aligned reads with two or more mismatchesin the first bases.Read Length

SAM/BAM files for reports with sampled data only include alignment information for the sampledsubset.

Version 3.2



Contents


Pre-3.0 Run Reports







Pre-3.0 File Links












The Barcode Reports section displays histograms for the following metrics per barcode:

Chart Description

Total number of reads Total number of filtered and trimmed readsindependent of length. This number is reported in thebarcode SFF and FASTQ files.

AQ20 Bases Number of base pairs of sequence from reads withaligned quality score of AQ20 or better.

Mean AQ20 read length An AQ20 read length is the length, in units, that afterbpalignment has a Phred-like score of 20 or better, or oneerror in 100 bp. This histogram charts the mean ofthese AQ20 read lengths per barcode.

Version 3.2



AQ20 Reads The number of reads with an aligned quality score ofAQ20 or better.

The number of barcodes shown in the reports varies according to the barcode set used in your run and on the

Version 3.2



barcodes actually present in the sample. Only data for barcodes present in the run are displayed in the chart.

Each bar is labeled with the barcode ID. Data labeled as barcode ID X reports the number of unclassified barcodes:reads which could not be classified as matching one of the expected barcodes in the barcode set.

Contents


Pre-3.0 Run Reports







Pre-3.0 File Links












The section of the Analysis Report provides information about the performance of eachTest Fragment SummaryTest Fragment included in the experiment.

The report has a heading for each Test Fragment, in the form .Test Fragment - <TestFragmentName>

Test Fragments are used during analysis to predict the CF/IE/DR values for each Test Fragment,regionally. Analysis results for a Test Fragment are displayed when there are at least 1000 high-quality TestFragments, where there is an 85% match against the appropriate template in the Test Fragment list. This includesCF/IE/DR estimates and performance calculations.

Version 3.2



The number of TFs reported includes lower quality TFs, down to 70% match, to better representthe run quality from all TF's.

Test Fragment Summary

The part of the displays the following information:Test Fragment Summary Test Fragment Report

Test Fragment List

Consensus Key 1-Mer

The Consensus Key 1-Mer graph shows the strength of the signal from the first three one-mer bases of the TestFragment key. This graph represents the consensus signal measurement of release of H+ during nucleotideincorporation.

The y-axis shows signal strength, measured in Counts, which is an arbitrary but consistent unit of measure. Thex-axis shows time as nucleotide Flows over the chip.

There is a known key at the beginning of every read. Typically, three bases are shown of the 4-mer key. Note thatthe graph is displayed in "flow order" rather than "base order." For example, the four-base Test Fragment key istypically ATCG for nucleotides one through four and is graphed as ATC, representing the nucleotide flow order.Negative flows are not displayed.

Quality Metrics

Version 3.2



The part of the displays the following information:Quality Metrics Test Fragment Report


TF Name Test Fragment name, as defined in the tabTemplatesof Torrent Browser.

TF Seq Test Fragment sequence.

Num Number of filtered & trimmed reads identified for thisTest Fragment.

Avg Q17 read length Average read length with Q17, or better, for this TestFragment.

50AQ17 Number of reads for this Test Fragment with aminimum of 50 base pairs in length and an error rate of1 in 50, Phred-like 17, or better. Quality is based onalignment, not predicted quality.

Graphs

The part of the displays the following information:Graphs Test Fragment Report

AQ17 Read Lengths

The graph is a histogram of read lengths, in units, that have a Phred-like score of 17 orAQ17 Read Lengths bpbetter, or one error in 50 bp.

Distributions skewed to the right are ideal, showing longer read lengths (remembering that Test Fragments are adiscrete length). It is likely that the sequence can extend all the way through the Test Fragment, if enough flows arerun, so the histogram only displays a maximum size based on the length of the Test Fragment.

Version 3.2



Average Corrected Ionogram

In the graph, the x-axis is in flow space and the y-axis shows the signal intensity.Average Corrected Ionogram

A unit of one indicates that there is only one base. A unit of two indicates that there are two bases of that specificnucleotide incorporated during the single flow event.

Version 3.2



Contents


Pre-3.0 Run Reports







Pre-3.0 File Links











Pre-3.0 Ion Sphere™ Particle (ISP) Summary

The section of the Analysis Report gives summary statisticsIon Sphere™ Particle (ISP) Identification Summaryof Ion Sphere™ Particle performance:

Version 3.2



This section of the report is available before the or sections, providingLibrary Summary Test Fragment Summarya quick determination of whether or not the analysis should be permitted to continue.The report displays:

Well Information

The data generated in this section are created "early" in the analysis process, before basecalling, and are intended to be a coarse, initial assessment of run performance. The well data aresubject to more stringent filtering in later stages of the analysis.

Parameter Description Percentage

Total Addressable Wells Total number of addressable wells. Not calculated

Version 3.2



Wells with ISPs Number (and percentage ofaddressable wells) of wells thatwere determined to be "positive" forthe presence of an ISP within thewell. "Positive" is determined bymeasuring the diffusion rate of aflow with a different pH. Wellscontaining ISPs have a delayed pHchange due to the presence of anISP slowing the detection of the pHchange from the solution.

Wells with ISPs / Total AddressableWells

Live ISPs Number (and percentage of wellswith ISPs) of wells that containedan ISP with a signal of sufficientstrength and composition to beassociated with the library or TestFragment key. This value is thesum of the following categories:

Test FragmentLibrary

Live ISPs / Wells with ISPs

Test Fragment ISPs Number (and percentage of LiveISPs) of Live ISPs with a key signalthat was identical to the TestFragment key signal.

Test Fragment ISPs / Live ISPs

Library ISPs Number (and percentage of LiveISPs) of Live ISPs that have a keysignal identical to the library keysignal. These reads are input intothe Library filtering process.

Library ISPs / Live ISPs

Library ISP Details

The Library ISP Details table is available after basecalling and read filtering are complete. This table providesinformation on a collection of read filters, which are applied after basecalling to ensure only high-quality reads arewritten to the final results.

The Polyclonal filter removes ISPs carrying clones from two or more templates.

The Primer dimer filter removes reads carrying an insert of fewer than 8 bp.

The Low quality filter removes reads that fail to attain a high level of accuracy.

Version 3.2



Parameter Description Percentage

Library ISPs/Percent Enrichment Predicted number of Live ISPs thathave a key signal identical to thelibrary key signal (the same valueas shown in the Well Informationtable).

The valuePercent Enrichmentreported is the number of loadedISPs that are Library ISPs, aftertaking out Test Fragment ISPs.

Library ISPs / (No. of Loaded ISPsminus TF ISPs)

Filtered: Polyclonal ISPs carrying clones from two ormore templates.

Polyclonal ISPs / Library ISPs

Filtered: Primer dimer Insert length of less than 8 bp. Primer dimer ISPs / Library ISPs

Filtered: Low quality Low or unrecognizable signal. Low quality ISPs / Library ISPs

Final Library Reads Number (and percentage of LibraryISPs) of reads passing all filters,which are recorded in the SFF andFASTQ files.

This value may be different from the located inTotal number of reads

the Library Summary Section due totechnicalities associated with readtrimming beyond a minimalrequirement resulting in Total

being slightly lessnumber of readsthan .Final Library Reads

Final Library / Library ISPs

Chip Loading Image

The section includes a Chip Loading Image, similar to the imageIon Sphere™ Particle Identification Summaryshown in the following figure:

Version 3.2



This is a pseudo-color image of the Ion CHIP™ showing percent loading across the physical surface.The percentage is displayed above the image, with the percentage value that considersLoading Densityonly potentially addressable wells.

Contents


Pre-3.0 Run Reports







Pre-3.0 File Links










Version 3.2





Analysis Info

The report displays the following information:Analysis Info


Run Name Name of the PGM™ sequencer run entered. This valueis typically entered on the PGM™ sequencer.

Run Date Date and time the PGM™ run was started.

Version 3.2



Analysis Name Name of the analysis provided in Torrent Browser whenthe analysis was initiated. If the analysis was scheduledto auto-start, this is the default analysis name.

Analysis Date Date the analysis was performed.

Analysis Cycles Number of PGM™ cycles analyzed for this report. Notethat this number can differ from the total number ofcycles run on the PGM™ sequencer.

Analysis Flows Number of PGM™ nucleotide flows analyzed for thisreport. Note that this number can differ from the totalnumber of flows occurring on the PGM™ sequencer.

Project Name of the project assigned to the run. This istypically assigned on the PGM™ sequencer.

Sample Name of the sample assigned to the run used togenerate this analysis. This is assigned on the PGM™sequencer.

Library Name of the library assigned to the run used togenerate this analysis. This library name is used tospecify the reference genome used for alignment.

PGM Name of the PGM™ sequencer where the run wasperformed.

Chip Check A series of tests on reference wells (about 10% of thechip in non-addressable areas) is performed to ensurethat the chip is functioning at a basic level. The value ofthis field is either or .Passed Failed

Chip Type Type of chip used on the PGM. Usually, 314, 316, or318 (for the Ion 314™ chip, Ion 316™ chip, and Ion318™ chip.) A letter follows the numbers, indicating thechip version.

Barcode Set The name of the barcode set assigned to the run. Blank for non-barcode libraries.

Notes A space for text notes entered during the PGM™sequencer run.

Version 3.2



Flow Order Flow order selected on PGM™ sequencer: Samba = [TACGTACGTCTGAGCATCGATCGATGTACAGC

Default] Regular = TACG

The "regular" flow order adds bases most rapidly tosequenced molecules but is vulnerable to phase errors.The Samba flow order consists of a 32-base sequence,repeated. This flow order resists phase errors byproviding opportunities for out-of-phase molecules tocatch up and is designed to sample all dimer(nucleotide pair) sequences, efficiently. Samba is thedefault flow order because it improve sequencingaccuracy for longer reads by resisting phase errors.

Library Key A short known sequence of bases used to distinguishthe library fragment from the Test Fragment. Example:"TCAG"

Software Version

The report display includes version information for the modules installed on your Torrent Server.Software Version

The version numbers shown in the example may be different from your current version of thesoftware depending on the age of the analysis. See the About tab in the Torrent Browser for acomplete list of modules and version on your server. See the Torrent Suite Release Notes forthe package versions in a specific release.

Version 3.2




Torrent Suite Version of Torrent Suite software used to generate theanalysis.

Datacollect Version of the Datacollect package.

LiveView Version of the LiveView package.

Script Version of the Script package.

ion-alignment Version of the Torrent Suite alignment module used forthis analysis.

ion-analysis Version of the Analysis Pipeline used to generate theanalysis.

ion-dbreports Version of the ion-dbreports package.

ion-gpu Version of the NVIDIA Tesla GPU driver.

ion-plugins Version of the pre-installed plugins.

ion-torrentR Version of the TorrentR stats package.

tmap Version of the TMAP alignment package.

Version 3.2



Contents


Pre-3.0 Run Reports







Pre-3.0 File Links









Pre-3.0 File Links


Pre-3.0 File Links

These links permit you to directly download the data and report files. Some files are compressed, using the for.zip

mat, to provide data integrity and to reduce download time.

Right-click the wanted file type and follow the dialog to save the file to your local computer. MostSave link asoutput files can be loaded into third-party viewers (such as IGV) for visualization. The barcode links only appear forruns on barcoded data.

Version 3.2



File Type Description

Library Sequence (SFF) Compressed (.zip) Standard Flowgram Format (SFF)-formatted file that contains "flow space" data. The bases called in a run are stored in two formats:SFF and FASTQ. Both files contain the nucleotidecalls and associated quality values, the SFF files,additionally, contain signal values in flow space and amapping between sequence and flow spaces. The data are organized on a per flow basis, andcontain information about nucleotide flows that both didand did not result in base incorporation. (See Technical

.)Note - Filtering and Trimming

Library Sequence (FASTQ) Compressed (.zip) FASTQ-formatted file containingdata organized in a per-base basis, including qualityscores. The reads contained in the file are unalignedreads. (See .)Technical Note - Filtering and Trimming

Library Alignments (BAM) Binary Sequence Alignment/Map (BAM), is acompressed, binary form of the SAM file. BAM files canbe indexed, using the BAM Index file, for quick accessto sequence alignment data. See http://samtools.sourc

for more a more detailed description of theeforge.netSAM/BAM file format. Many tools are available forworking with SAM files.

See for aPre-3.0 Library Summary Overviewdescription of the alignment data included in the BAMfile. The reads in the file are sorted by referencelocation.




http://samtools.sourceforge.net

http://samtools.sourceforge.net

Version 3.2



Library Alignments (BAM Index) Binary Sequence Alignment/Map Index (BAI)-formatted file. A BAM index file speeds up the accesstime for a coordinate-sorted BAM file, enabling softwareto more quickly access random parts of the genomicinformation in a BAM file. Each BAM index file isassociated with a BAM file so be careful not to confusethem. They share the same file name but the BAMindex file has a .bai extension. To access information ina BAM file, a BAM index file is not required but doesimprove time-to-access.

Barcode Alignments Summary A summary file of alignment metrics for barcodes. Themetrics include the quality and read lengths at whicheach barcode aligns to reference. This link appears on barcode runs only.

Barcode-specific Library Alignments (BAM andBAM Index)

The same format and purpose as the LibraryAlignments (BAM) and Library Alignments (BAM Index)files, with content for specific barcodes. The BAM andBAM Index files for each barcode are zipped together. This link appears on barcode runs only.

Barcode-specific Library Sequence (FASTQ) The same format and purpose as the Library Sequence(FASTQ) file, with content for specific barcodes. TheFASTQ files for each barcode are zipped together. This link appears on barcode runs only.

Barcode-specific Library Sequence (SFF) The same format as the Library Sequence (SSF) file,with content for specific barcodes. The SFF files foreach barcode are zipped together. This link appears on barcode runs only.

Test Fragments (SFF) Test Fragment data are provided as a compressed,binary Standard Flowgram Format (SFF) file. See http://www.ncbi.nlm.nih.gov/Traces/trace.cgi?cmd=show&f=f

for a detailed descriptionormats&m=doc&s=format#sffof the file format.

PDF of this Report Complete detailed in PDF format.Analysis Report

Customer Support Archive ZIP archive containing the PDF and HTML version ofthe run report as well as useful logs in casetroubleshooting is required.

http://www.ncbi.nlm.nih.gov/Traces/trace.cgi?cmd=show&f=formats&m=doc&s=format#sff



Version 3.2



Contents


Pre-3.0 Run Reports







Pre-3.0 File Links












The lists the plugins associated with the analysis, and provides an interface for running andPlugin Summarymonitoring your plugin(s).

Plugins can have one of the following behaviors:

Run without user input.Run with a user interface for getting plugin parameters.

Version 3.2



1.

2.

3.

Plugins without a user interface display a confirmation message that the plugin has been submitted to run. Pluginsrequiring input parameters display a user interface dialog and are launched after you click .Submit

Running Plugins

The following plugins are pre-installed on Torrent Server. See Pre-3.0 Running the Installed for a description of these plugins.Plugins

AlignmentCoverage AnalysisERCC AnalysisIonReporterUploaderRun RecognitIONSampleIDTorrent Variant Caller

To manually run a post-analysis plugin on the report data:

Click .Select Plugins To Run The Plugin List pops up and displays a list of available plugins:

Click the plugin you want to run. If the plugin does not require user input, it begins execution. This displays the user interface for your plugin. In this example, the plugin is selected, displayingAlignmentthe plugin dialog (See for more information about runningAlignment Pre-3.0 Running the Installed Pluginspre-installed plugins.):

Version 3.2



3.

4.

5.

1.

2.

Select the desired plugin options and click . This runs your plugin, listing the run status in the Submit Plugin

panel.Summary For plugins that take a long time to run, click to update the plugin display status.Refresh Plugin StatusWhen your plugin completes, the status is updated to Started.

The Plugin Summary List

After a plugin runs, it is listed in the panel:Plugin Summary

Some plugins, such as Alignment, display a preview results window in the Plugin Summary list.

Plugin Reports

Plugin results, results summaries, links to output files, and other information are available in the plugin reportpages. See for a description of report pages for the installed plugins.Pre-3.0 Running the Installed Plugins

Click the plugin html link in the Plugin Summary section to open that plugin's report page.

Plugin Log Files

To view the plugin log file, hover your mouse pointer over the log icon to the right of your plugin to display theplugin log file:

Click the icon to display the log:

Version 3.2



2.

3. Click to exit the display.Close

Contents


Pre-3.0 Run Reports







Pre-3.0 File Links










Version 3.2



Torrent Browser Analysis Report GuidePre-3.0 Run the Installed Plugins

Available PluginsManually Run a PluginAutomatically Run Plugins

Available Plugins

This table lists the pre-installed and officially supported plugins.

Plugin Description

Alignment Plugin Performs a new alignment to the reference you specify.

Note: Plugins run after the Torrent Suite analysispipeline. This plugin does not affect the alignmentduring pipeline analysis.

Coverage Analysis Plugin Provides statistics and graphs describing the level ofsequence coverage produced for targeted genomicregions.

ERCC Analysis Plugin Helps with ERCC RNA Spike-in Controls: enables youto quickly determine whether or not the ERCC resultsindicate a problem with either the library preparation orthe sequencing instrument run.

Run RecognitION Plugin Considers candidate runs for inclusion in IonCommunity leaderboards. Within each chip type (Ion314™ chip, Ion 316™ chip, and Ion 318™ chip), topruns are ranked according the number of AQ20 basesmapped.

sampleIDPlugin Uses sample fingerprinting to identify anycross-contamination between samples or betweenbarcodes in a run.

Torrent Variant Caller Plugin Calls SNP and InDel variants across a reference orwithin a targeted subset of that reference. Withlow-frequency variant options, the plugin can callvariants down to a 5% level of variant frequency. It canalso show which variants coincide with predefined“HotSpot” positions on the reference sequence.

This table lists functionality that was available as plugins in previous releases. These are now available in otherareas of the Torrent Browser.

Previous plugin Description and new location

Version 3.2



1. 2.

3.

IonReporterUploader Transfers run results files to the Ion Reporter™Software (access is available under a separatelicense).

The IonReporterUploader is now selected before a runin the > , > , and Plan Templates Plan Planned Run wiza

pages. After a run, if the results set is a member of ardproject, you invoke the IonReporterUploader fromthe project page (see ).Projects

combineAlignment Combines reads aligned to the specified reference frommultiple run reports. Intended for use when multipleruns analyze the same tissue sample, for examplewhen a tissue sample is run on more than one chip.

You invoke combineAlignment from the project page(see ). The runs you combined must beProjectsmembers of the same project.

Manually run a plugin

The is the mechanism to manually run plugins. The Plugin List is accessed in the run report ofPlugin Listcompleted analysis runs. Only enabled plugins are listed. Follow these steps to manually run a plugin:

Click the tab, then click the link for your completed analysis run.ReportsIn the run report, scroll down to Plugin Summary section.

The Plugin Summary also lists any plugins that executed on your run (not shown in this example). Click to see the list of available plugins. See for the pre-installedSelect Plugins To Run Available Pluginsplugins. Your server may have additional plugins installed.









Version 3.2



3.

4.

5.

Click the desired plugin name to run a plugin. If the plugin does not require user input, it starts immediately, without a confirmation screen. Click to close the Plugin List without running a plugin.Close

Automatically run plugins

When you design your sequencing protocol in the Plan > Template page, you specify which plugins to execute. Youcan select any plugin that is installed and configured on your Torrent Server. You are not limited to the pre-installedplugins.

See the following for more information on specifying plugins in your templates and planned runs:

Plan TabTemplatesPlanned RunsTemplate and Planned Run Wizard

The old method to autorun a plugin

Your Torrent Server administrator can set plugins to be executed automatically on every run; however, thepreinstalled plugins are not good candidates to be run automatically. For example, the Torrent Variant Caller pluginfails on runs that do not use both the hg19 reference and the Ion AmpliSeq™ Cancer Panel or custom product data.

The Alignment and RunRecognitION plugins cannot be be executed automatically because theyrequire manual user input before every run.

For Ion Reporter users, enabling AutoRun with the IonReporterUploader plugin could cause™you extra expense, by transferring unnecessary results to the Ion Reporter server. (The Plan™tab allows you to turn off the plugin for a template or a planned run.)





Version 3.2



Contents


Pre-3.0 Run Reports







Pre-3.0 File Links









Pre-3.0 combineAlignments Plugin


Pre-3.0 combineAlignments Plugin

The c Alignment plugin combines reports from multiple runs that analyze the same tissue sample. The pluginombineis used, for example, when you run a tissue sample on more than one chip. The plugin combines the reports fromthose runs into one report. You run the plugin from any one of the related reports.

All runs must use the same reference.

Analyses using barcoded libraries are not supported in this release.

Run the Plugin

You run the plugin from the Report tab run report of one of the runs to be combined:

Version 3.2



That report appears in the selected reports section. Click search to find related reports:

Related reports appear in the search section. Your original report has the Add button grayed out:

Click for each run to be combined. Additional search results can be seen by clicking the button on theAdd Morelower right.

When you have all runs selected and appearing in the selected report section (the lower table), select a name forthe combined alignments report, and click .Submit

Plugin Notes

the plugin includes these notes in the submission page:

This plugin combines reads aligned to the specified reference from multiple run reports. The resulting combined

Version 3.2



alignment files may be downloaded from the plugin report page or used as input for other Torrent Browser pluginsthat support the use of these files, such as the Torrent Variant Caller.

Use the filters in the Report Locater to find reports then click the Add button to add them to the Selected Reportstable. Initially the list of selected reports will contain the current report name. This report, or any selected report, maybe removed from the list by clicking the Remove button. The alignment file from selected reports is combined by thisplugin after clicking the Submit button. You may also modify the default name for the combined alignment filesgenerated.

Note that the Report Locator will only include reports that are completed and does not support barcoded runs. Also,the Report Locator only lists reports for runs associated with the selected reference.

Contents


Pre-3.0 Run Reports







Pre-3.0 File Links









Documents

TSUD AnalysisReportGuide 3.2 1.PDF