A

i

tdt

sCT

a©

K

1

ia

cc4K

0d

Cell Calcium 43 (2008) 492–505

TRPC channels determine human keratinocyte differentiation:New insight into basal cell carcinoma

Benjamin Beck a,1, V’yacheslav Lehen’kyi a,1, Morad Roudbaraki a, Matthieu Flourakis a,Marie Charveron b, Pascal Bordat b, Renata Polakowska c,

Natalia Prevarskaya a,2, Roman Skryma a,∗,2

a Laboratoire de Physiologie Cellulaire, INSERM U800, USTL, Bat. SN3, 59655 Villeneuve d’Ascq Cedex, Franceb Centre de Recherche Pierre Fabre Dermo-Cosmetique, 31322 Castanet-Tolosan, Francec Jean-Pierre Aubert Research Centre, Inserm U 814, University of Lille II, Lille, France

Received 17 November 2006; received in revised form 19 July 2007; accepted 9 August 2007Available online 24 October 2007

bstract

Aberrant keratinocyte differentiation is considered to be a key mechanism in the onset of hyperproliferative dermatological diseases,ncluding basal cell carcinoma (BCC). It is, therefore, vital to understand what drives keratinocytes to develop such pathological phenotypes.

The role of calcium in keratinocyte differentiation is uncontested but the mechanisms controlling calcium-induced differentiation have yeto be completely elucidated. This study was designed to investigate the role of calcium-permeable TRPC channels in human keratinocyteifferentiation and BCC, using a combination of molecular and cell biology approaches, involving electrophysiology and Ca2+-imaging, onhe HaCaT cell line, primary cultures of normal human keratinocytes, and BCC cells.

We demonstrated that TRPC1/TRPC4 channel expression was important for keratinocyte differentiation, as knocking out these channels (byiRNA strategy) prevented the induction of Ca2+-induced differentiation. TRPC1/TRPC4-mediated calcium entry and endoplasmic reticuluma2+ content increased significantly in differentiated keratinocytes. However, the failure of BCC cells to differentiate was related to a lack of

RPC channel expression and calcium entry.In summary, our data demonstrate that TRPC1 and TRPC4 channels are key elements in keratinocyte Ca2+ homeostasis and differentiation

nd may therefore be responsible for skin pathologies.2007 Elsevier Ltd. All rights reserved.

ncer; B

tc

eywords: Human keratinocytes; TRPC1; TRPC4; Differentiation; Skin ca

. Introduction

The human epidermis is the largest barrier function tissuen the body. Keratinocytes undergo a defined proliferationnd differentiation program during normal stratification of

Abbreviations: TRPC, transient receptor potential canonical; BCC, basalell carcinoma; SOC, store-operated channels; SOCE, store-operated cal-ium entry; ER, endoplasmic reticulum; TG, thapsigargin; InsP3, inositol 1,,5-trisphosphate; SERCA, sarco–endoplasmic reticulum calcium ATPase;RT10, cytokeratin 10; TGM1, transglutaminase 1; IVL, involucrin.∗ Corresponding author. Tel.: +33 3 20 43 40 77; fax: +33 3 20 43 40 66.

E-mail address: roman.skryma@univ-lille1.fr (R. Skryma).1 Both authors contributed equally to this work.2 These authors shared the senior authorship.

epctwi

srml(

143-4160/$ – see front matter © 2007 Elsevier Ltd. All rights reserved.oi:10.1016/j.ceca.2007.08.005

asal cell carcinoma; Store-operated calcium entry; TRPC channels

he epidermis. However, anomalies in the signaling pathwaysontrolling this process probably contribute to the pathogen-sis of hyperproliferative dermatological diseases, includingsoriasis and basal cell carcinoma (BCC). Indeed, aberrantell differentiation is considered to be a key mechanism inhe onset of both diseases. It is, therefore, vital to understandhich mechanisms drive the development of keratinocytes

nto undifferentiated phenotypes.The role of calcium (Ca2+) in global growth-related cell

ignaling pathways is uncontested. In epidermal cells, a

ise in intracellular calcium concentration ([Ca2+]i) is aajor event triggering differentiation [1,2]. It is well estab-

ished that an increase in extracellular calcium concentration[Ca2+]o) above 0.1 mM, i.e. a “calcium switch”, induces

alcium

kic[sdgktiaepfttartaCcortecpCsmc

ccsTrpRst[ilss

kttcwcaw

2

2

pFmsS(ckLablgm(oaI

wp0cai

atc(fctDwmaoto

2

waP

B. Beck et al. / Cell C

eratinocyte differentiation by mechanisms related to thencrease in [Ca2+]i that are not fully understood. Identifi-ation of the molecular phenomena responsible for theseCa2+]i increases may help to determine the mechanisms ofeveral pathologies related to abnormal differentiation. Toate, among several putative candidates, it has been sug-ested that the Ca2+-Receptor (CaR) mediates Ca2+-inducederatinocyte differentiation [3,4]. This protein is a sevenransmembrane domain receptor coupled to the phospho-nositide pathway, which triggers Ca2+-store depletion andconsecutive Ca2+ influx, known as “store-operated calciumntry” (SOCE [5]). It has already been reported that endo-lasmic reticulum (ER) Ca2+ stores represent an importantactor in keratinocyte physiology and that modifications inhe expression of proteins involved in Ca2+ homeostasis ishe primary cause of epidermal diseases such as Darier’snd Hailey Hailey’s diseases [6]). However, it has also beeneported Ca2+-induced differentiation is impaired by lan-hanum, a well-known, effective inhibitor of Ca2+ channelsctivated downstream of ER Ca2+-release, suggesting thata2+ influxes from the extracellular medium are required forell differentiation [7]. Furthermore, an altered SOCE wasbserved in psoriatic keratinocytes, characterized by a lowate of differentiation compared to the rate of proliferation,hus strengthening the hypothesis that Ca2+ channels are keylements in keratinocyte differentiation [8]. Finally, in basalell carcinoma, the most common skin cancer, keratinocytesroliferate but fail to differentiate properly. Nevertheless,a2+ channels and their activity in BCC have not been

tudied in detail. These data suggest that Ca2+ channelsay play a major role in the altered differentiation of BCC

ells.One transient receptor potential (TRP) superfamily of

ation channels, which includes a remarkable spectrum ofhannels mediating a variety of sensory and receptor-inducedignals, is of particular interest [9,10]. Among these, theRPC subfamily has been suggested to participate in SOC-

elated Ca2+ entry [11], as well as playing a key role inrocesses like cell differentiation in some cell models [12].ecent studies have demonstrated TRPC channel expres-

ion in human keratinocytes from the epidermis [13] andhe involvement of TRPC1 in gingival keratinocyte growth14]. Moreover, it has recently been proposed that TRPC1 isnvolved in Darier’s disease, that modifies keratinocyte pro-iferation and differentiation. Taken together, all these datauggest that Ca2+ influxes mediated by TRPC may contributeignificantly to epidermal keratinocyte pathophysiology.

However, the Ca2+ homeostasis modulations induced byeratinocyte differentiation had not been studied in detail andhe identity of the calcium-permeable channels controllinghe keratinocytes’ response to the “calcium switch”, espe-ially in BCC cells, remained elusive. This study, therefore,

as designed to investigate the role of TRPC channels in

apacitative calcium entry in human epidermal keratinocytesnd assess their involvement in Ca2+-induced differentiation,ith a specific focus on non-melanoma skin cancer.

(pit

43 (2008) 492–505 493

. Material and methods

.1. Cell culture

The HaCaT human keratinocyte cell line was kindlyrovided by Prof. B. Dufy, CNRS UNR 5543, Bordeaux,rance, cultured in Ca2+-free Dulbecco’s modified Eagle’sedium (DMEM) (Gibco-BRL, CergyPontoise, France),

upplemented with 2% fetal calf serum (Seromed, Poly-labo,trasbourg, France), containing 0.07 mM Ca2+, kanamycin100 �g/ml), and l-glutamine (2 mM). The basal cell car-inoma and human Primary Keratinocyte (hPK) cells wereindly provided by Dr. R. Polakowska, INSERM U814,ille, France. BCC were grown under the same conditionss hPK. hPK were obtained from adult skin discarded afterreast reduction surgery and used according to the Dec-aration of Helsinki Principles and the ethical committeeuidelines of CHRU Lille Medical Center, prepared in agree-ent with French law. After overnight incubation in dispase

1 U/ml) and digestion at 4 ◦C, followed by trypsinizationf the separated epidermis, cells were plated and grown inkeratinocyte-defined SFM-supplemented medium (Gibco

nvitrogen Corp., Cergy Pontoise, France) [15].Cells were cultured at 37 ◦C in a humidified atmosphere

ith 5% CO2 in air. The medium was changed three timeser week and cultures were split by treating the cells with.25% trypsin (in PBS) at 37 ◦C for 5 min before reachingonfluency. Cells were seeded in six-well plates for PCRnd Western blotting and mounted on glass coverslips formmunocytochemistry and calcium imaging.

The terms “undifferentiated” and “differentiated” ker-tinocytes were used throughout the article. These indicatehat the cells were cultured in a complete DMEM mediumontaining 0.07 mM Ca2+ (undifferentiated) or 1.8 mM Ca2+

differentiated), which corresponds to a differentiation stateor these cells. Generally, for differentiated phenotypes, theells were allowed to grow for 24 h after trypsinization,hen the 0.07 mM Ca2+ DMEM medium was replaced byMEM with 1.8 mM Ca2+ (or Defined-Keratinocyte SFMith 1.8 mM Ca2+). After 1–4 days’ incubation in the latteredium, cells were considered as early differentiated (ED)

nd their status was confirmed by PCR and Western blottingf corresponding markers. Indeed, this delay is necessary forhe cells to pass from the basal layer to the early spinous layerf the skin [16].

.2. Electrophysiology and solutions

Macroscopic currents in HaCaT cells were recorded in thehole-cell configuration of the patch-clamp technique, usingcomputer-controlled EPC-9 amplifier (HEKA Electronics).atch pipettes were made from borosilicate glass capillaries

Hirschmann laborgerate) on a P-97 (Sutter instrument co.)ipette puller. The resistance of the pipette filled with thentracellular solution (see composition below) varied from 3o 5 M�.

4 alcium

cMwmpCtcDKip

rMaawgawfiama

2

4c0Htsacb3eecDe

2

wNdciEp

iwsrZ

2

c1iT2TgfSbmb2aaac(Fugar

2

oBfpt0sgaaPwn6p

94 B. Beck et al. / Cell C

The composition of the extracellular solution for patch-lamp recordings was 120 mM NaCl, 10 mM CaCl2, 2 mMgCl2, 5 mM glucose, and 10 mM HEPES, pH 7.3 adjustedith TEA-OH, osmolarity 310 mOsm/kg adjusted with d-annitol. For divalent cation selectivity the cells were

erfused with a solution containing: 120 mM NMDG, 10 mMaCl2, 2 mM MgCl2, 10 HEPES, 5 glucose. Depending of

he experiment, we substituted 10 mM Ca2+ for the same con-entration of Ba2+, Sr2+ or Mn2+. The divalent-free solutionVF had the following composition: 130 mM NaCl, 5 mMCl, 0.5 EDTA, 10 mM HEPES, 5 glucose. The permeabil-

ty of TRPC channels was determined as described in ourrevious study [17].

The composition of the intracellular solution for SOC cur-ent recording was: 120 mM CsMet, 10 mM CsCl, 6 mM

gCl2, 10 mM HEPES, and 10 mM BAPTA (1.2-bis(2-monophenoxy)ethane N,N,N′,N′tetraacetic acid). pH 7.2djusted with CsOH and osmolarity 295 mOsm/kg adjustedith d-mannitol. Necessary supplements (InsP3, thapsigar-in) were added directly to the respective solutions fromppropriate stock solutions. All the reagents dissolved inater, ethanol, or dimethylsulfoxyde were diluted to theirnal concentration in the respective solutions and applied byperfusion system. Data were accumulated from the experi-ents at least three times under each condition. All reagents

nd chemicals were provided by Sigma.

.3. Calcium imaging

Cells were plated onto glass coverslips and loaded with�M Fura-2 AM at room temperature for 45 min in HBSSontaining (in mM): 140 NaCl, 5 KCl, 2 MgCl2, 2 CaCl2,.3 Na2HPO3, 0.4 KH2PO4, 4 NaHCO3, 5 glucose, and 10EPES, adjusted to pH 7.4 with NaOH. The coverslips were

hen placed in a perfusion chamber on the stage of the micro-cope. Fluorescence images of the cells were recorded usingvideo image analysis system (Quanticell). Fura-2 fluores-

ence, at an emission wavelength of 510 nm, was recordedy exciting the probe alternately at 340 and 380 nm. The40 nm/380 nm signal ratios were converted into [Ca2+]i lev-ls using an in vitro calibration. All reagents soluble in water,thanol, or dimethyl sulfoxide were diluted to their final con-entration in HBSS and applied using a perfusion system.ata were accumulated from at least three measurements for

ach type of experiment.

.4. Calcium imaging within the ER

HaCaT cells were grown on glass coverslips and loadedith 5 �M Mag-Fluo 4 AM (Molecular Probes, Leiden, Theetherlands) at 37 ◦C for 45 min. After incubation with theye, the plasma membrane was selectively permeabilized:

ells were rinsed briefly in a high K+ solution with the follow-ng composition (in mM): 125 KCl; 25 NaCl; 10 HEPES; 1GTA; 0.5 CaCl2; 0.1 MgCl2 (free Ca2+ clamped to 170 nM,H 7.2), and exposed for 1 min to the same solution at 37 ◦C

2

p

43 (2008) 492–505

n the presence of digitonin (0.5 mg/ml). Permeabilized cellsere then continuously perfused with the high K+ solution

upplemented with 0.2 mM Mg-ATP. Mag-Fluo 4 imagingatios were measured using a confocal microscope (LSM 510,eiss, Le Pecq, France).

.5. Western blotting

Subconfluent HaCaT cells were treated with an ice-old lysis buffer containing: 10 mM Tris–HCl, pH 7.4,50 mM NaCl, 10 mM MgCl, 1 mM PMSF, 1% Non-det P-40, and a protease inhibitor cocktail from Sigma.he lysates were centrifuged at 15,000 × g and 4 ◦C for0 min, mixed with a sample buffer containing: 125 mMris–HCl pH 6.8, 4% SDS, 5% �-mercaptoethanol, 20%lycerol, 0.01% bromophenol blue, and boiled at 95 ◦Cor 5 min. Total protein samples were subjected to 8–10%DS-PAGE and transferred to a nitrocellulose membraney semi-dry Western blotting (Bio-Rad Laboratories). Theembrane was blocked in a 5% milk containing TNT

uffer (Tris–HCl, pH 7.5, 140 mM NaCl, and 0.05% Tween0) overnight then probed using specific rabbit polyclonalnti-Serca 2b (generously provided by Dr. F Wuytack),nti-calreticulin (Stressgen Biotechnologies), anti-TRPC1nd anti-TRPC4 (Alomone Labs Ltd.), and mouse mono-lonal anti-KRT10 (Chemicon International) and anti-�-actinLab Vision Co.) antibodies (see the antibody controls inig. 4A). The bands on the membrane were visualizedsing by enhanced chemiluminiscence (Pierce Biotechnolo-ies Inc.). Densitometric analysis was performed usingBio-Rad image acquisition system (Bio-Rad Laborato-

ies).

.6. Immunocytochemistry

The cells grown on the glass coverslips were washednce with PBS and incubated with Cholera toxin subunitAlexa Fluor® 488 conjugate (Molecular Probes, 1/2000)

or 15 min, then washed once with PBS and fixed in 3.5%araformaldehyde in PBS. PBS-glycine (30 mM) was usedo quench the reaction, followed by permeabilization with.1% Triton X-100. The cells were washed again in PBS andubjected to conventional immunostaining. Alexa Fluor® 546oat anti-rabbit IgG (Molecular Probes, 1/4000) was useds a secondary antibody for TRPC1 and TRPC4 staining,nd Alexa Fluor® 488 donkey anti-mouse IgG (Molecularrobes, 1/4000) for KRT10 staining. Fluorescence analysisas carried out using a Carl Zeiss LSM 510 Laser Scan-ing Systems connected to a Zeiss Axiovert 200 M with3X1.4 numerical aperture oil-immersion lens at room tem-erature.

.7. RT-PCR

Total RNA was isolated using the guanidium thiocyanate–henol–chloroform extraction procedure. After DNase I (Life

B. Beck et al. / Cell Calcium 43 (2008) 492–505 495

Table 1Primers, siRNA, and oligonucleotides

No. Name (Accession No.) Forward (5′-. . .-3′) Backward (5′-. . .-3′) Expected size (bp)

1 TRPC1 (NM 003304) TTCCTCTCCATCCTCTTCCTCG GCTCTCAGAATTGGATCCTCCTC 5482 TRPC4 (NM 016179) CTGAGTTTGTTGGTGCCACCATG GTAATCCCAGGACTTCAAAGCGG 4823 KRT10 (NM 000421) TAACAACTGATAATGCCAACAT AGTGGACACATTTCGAAGGT 2604 IVL (NM 005547) TCTAAGATGTCCCAGCAACACA TCATGCTGTTCCCAGTGCTGTT 2925 TGM1 (NM 000359) GATCGCATCACCCTTGAGTTAC TCCTCATGGTCCACGTACACAAT 3046 �-Actin (NM 001101) CAGAGCAAGAGAGGCATCCT GTTGAAGGTCTCAAACATGATC 2097 TRPC1 siRNA 5′-GGGUGACUAUUAUAUGGUUdTdT-3′8 TRPC4 siRNA-1 5′-UUUACUGAGUUUGUUGGUGdTdT-3′9 TRPC1 sens 5′-ATGGGCCGCGATGATGGC-3′

10 TRPC1 antisens 5′-GCCATCATCGCGGCCCAT-3′1 ′ GGCT ′1 AATAG

TtrtltIPGT1tMsfiavo7tuU

2

cwTuotfitiasDT

rttc

2

wuc

3

3e

fhceCe1facrl

fitu

1 TRPC4 sens 5 -AT2 TRPC4 antisens 5′-GT

echnologies) treatment to eliminate genomic DNA, 2 �gotal RNA was reverse transcribed into cDNA at 42 ◦C usingandom hexamer primers (Perkin Elmer) and MuLV reverseranscriptase (Perkin Elmer) in a 20 �l final volume, fol-owed by PCR as described below. The PCR primers usedo amplify TRPC1 and TRPC4 cDNAs as well as those forNV, TGM1, KRT10, and �-actin are specified in Table 1.CR was performed on the RT-generated cDNA using aeneAmp PCR System 2400 thermal cycler (Perkin Elmer).o detect different cDNAs, PCR was performed by adding�l of the RT template to a mixture of (final concen-

rations): 50 mM KCl, 10 mM Tris–HCl (pH 8.3), 2.5 mMgCl2, 200 �M of each dNTP, 600 nM of sense and anti-

ense primers, and 1 U AmpliTaq Gold (Perkin Elmer) in anal volume of 25 �l. DNA amplification conditions includedn initial 5 min denaturation step at 95 ◦C (which also acti-ated the Gold variant of Taq Polymrase), and 33 cyclesf 30 s at 95 ◦C, 30 s at 59 ◦C, 30 s at 72 ◦C, and finallymin at 72 ◦C. Density was then measured using “Quan-

ity one” software (Biorad) and the data were analyzedsing Origin 7.0 (Microcal Software Inc., Northampton, MA,SA).

.8. ODN and siRNA cell transfections

For antisense assays, the sense and antisense oligonu-leotides (Eurogentec) targeted against TRPC1 and TRPC4ere designed at the initiating ATG codon level (seeable 1 for sequences). The HaCaT cells were treated forp to 48 h with either 0.5 �M phosphorothioate antisenseligodeoxynucleotides (ODNs) or sense ODNs by addinghem directly to the culture medium. The ODNs were trans-ected using “Gene porter 2” (Gene Therapy Systems, Inc.)n 2 ml serum-free DMEM-HG. Human keratinocytes wereransfected overnight with 200 nM siRNA-TRPV6 per welln a six-well plate using “Gene porter 2” (Gene Ther-

py Systems, Inc.) in a final volume of 1 ml. Ready-to-useiRNA-TRPV6 (processing option:A4) was synthesized byharmacon Research Inc. (Lafayette, USA) (see Table 1).o monitor the efficiency of transfection we used the fluo-

aa(m

CAGTTCTATTAC-3AACTGAGCCAT-3′

escein tagged siRNA/oligonucleotides. It allowed to see theransfection rate, to estimate the time course, etc. To moni-or the specificity of siRNA/oligonucleotides we performedorresponding Western blots (see Figs. 4A,B; 6A).

.9. Data analysis

Each experiment was repeated at least three times. Dataere expressed as mean ± S.D. Statistics were analyzedsing Student’s unpaired t-tests (two-tailed). P < 0.05 indi-ates statistical significance.

. Results

.1. “Calcium switch” increases store-operated calciumntry

We selected the HaCaT cell line as it is closely similar inunctional competence to normal keratinocytes. These cellsave been used in many studies as a paradigm for epidermalells and are a suitable cell model for investigating the differ-ntiation and proliferation of human keratinocytes [18–20].ells kept in medium containing 0.07 mM Ca2+ were consid-red undifferentiated (U) and cells kept in medium containing.8 mM Ca2+ were considered differentiated (D) [1,2]. Weocused our study on the early events in differentiation, i.e.fter 1–4 days of incubation in the high-Ca2+ medium. Theseells were considered to be early differentiated as they cor-esponded to keratinocytes from the basal and early spinousayers [16].

In view of the major role of [Ca2+]o in keratinocyte dif-erentiation and its link to intracellular Ca2+ homeostasis, wenvestigated the consequences of Ca2+-induced differentia-ion on ER Ca2+ stores and SOC entry. Ca2+-imaging wassed to quantify the amount of Ca2+ depleted from the ER

nd the magnitude of SOCE. Perfusion of undifferentiatednd differentiated FURA-2 loaded cells with thapsigarginTG, 1 �M), a well-known inhibitor of SERCA (sarcoplas-ic and endoplasmic reticulum calcium ATPase), proteins,

496 B. Beck et al. / Cell Calcium 43 (2008) 492–505

Fig. 1. Variation in calcium store depletion and SOCE depending on dif-ferentiation. (A) In two representative cells, perfusion of 1 �M TG-inducedCa2+-store depletion in a Ca2+-free solution and SOCE occurred immedi-ately on addition of Ca2+ to the bath solution. The cell grown in low-Ca2+

medium ([Ca2+]o = 0.07 mM) is represented by black upward-triangles andthe early differentiated (ED) cell grown in a standard solution for 3 days([Ca2+]o = 1.8 mM) by open circles. (B) Histogram summarizing the mag-ncc

ittEbr

3k

sEmMtdm(s

Fig. 2. ER calcium homeostasis. (A) Measurement of the ER-free Ca2+

concentration with Mag-fluo 4 in two representative permeabilized ker-atinocytes. Application of 1 �M TG and 1 �M ionomycin, as well as 10 mMEGTA, are indicated by corresponding sticks. Undifferentiated cell is shownby black upward-triangles and ED cell by open circles. (B) A histogramsummarizing the magnitude of ER Ca2+ depletion induced by 1 �M TG inundifferentiated (black columns) and differentiated (white columns) cells.Values are normalized by the values in undifferentiated cells. (C) The effectsof Ca2+-induced differentiation on expression of Ca2+-signaling involv-ing ER proteins, SERCA 2b and calreticulin. HaCaT cells were grownto subconfluence in either 0.07 mM (U) or 1.8 mM (D) Ca2+-containingDMEM medium, lysed, analyzed by SDS-PAGE, blotted to a nitrocellulosemembrane, and probed with specific rabbit polyclonal anti-SERCA 2b andanti-calreticulin antibodies. Mouse monoclonal anti-�-actin was used as aloading control.

itude of ER Ca2+-store depletion and SOCE in undifferentiated (blackolumn) and ED (white column) cells. Values are normalized; maximumytoplasmic Ca2+ increase in undifferentiated cells is shown as reference.

nduced a rise in [Ca2+]i. This passive Ca2+-store deple-ion was followed by SOCE, measured by the responseo the addition of 2 mM Ca2+ in the bath (Fig. 1A). InD cells, both Ca2+-store depletion and SOCE increased,y 51.44 ± 5.60 and 54.55 ± 8.50% (n = 350 conditions−1),espectively (Fig. 1B).

.2. ER calcium content increased in differentiatederatinocytes

In order to determine the cause for the increase in Ca2+-tore depletion, we investigated the amount of Ca2+ in theR. We measured ER Ca2+-store depletion directly in per-eabilized keratinocytes using confocal microscopy andag-Fluo 4, a specific ER-Ca2+ dye. Under these condi-

ions, we observed an increase in the TG-evoked Ca2+-store

epletion in differentiated cells (Fig. 2A and B). Further-ore, the depletion induced by ionomycin (1 �M) and EGTA

10 mM) perfusion, which is directly proportional to Ca2+

tores, was about 35% more marked in cells grown in a high-

alcium

Ctw

oasdKbtSupto

3d

mpmeS(pIioapsrw0s(rrcrv

d1tdc((sfia

aeDir∼(rfiiiC

salnaaS[Ci1fbst

3d

iscoooTotTaoWa5t(f

B. Beck et al. / Cell C

a2+ medium than in undifferentiated cells (Fig. 2A). Takenogether, these results confirmed that ER Ca2+ homeostasisas modified by Ca2+-induced differentiation.Expression of the proteins involved in ER Ca2+ home-

stasis, e.g. SERCA proteins, which pump Ca2+ into the ER,nd calreticulin, which harbor Ca2+ in this organelle, wastudied to determine the cause of the enhanced Ca2+-storeepletion characterizing early differentiated keratinocytes.eratinocytes grown in a low-Ca2+ environment expressedoth proteins. However, in the 4 days after Ca2+ was addedo the medium, when the cells had begun to differentiate,ERCA-2b expression increased up to 10-fold and calretic-lin approximately 3-fold (Fig. 2C). Overexpression of theseroteins may enhance the ER’s capacity to harbor Ca2+ and,herefore, to increase its capacity to release larger quantitiesf this ion.

.3. Store-operated current depending on theifferentiation state

We further studied the biophysical properties and phar-acology of SOC current (ISOC) in HaCaT cells and their

otential modulation depending on differentiation. Trans-embrane ISOC was activated by stimulations inducing the

mptying of ER Ca2+ stores [5]. Two ways of activatingOC current were therefore used: cell dialysis of (i) InsP3100 �M) or (ii) TG (1 �M), via the patch pipette. Bothroducts induced the emptying of ER stores either due tonsP3 activating the InsP3-receptor on ER membrane or TGnhibiting Ca2+ reuptake by SERCA proteins in the ER. Inrder to facilitate those mechanisms, 10 mM BAPTA waslso added to the intracellular solution. Following theserotocols, HaCaT cells responded to InsP3 or TG dialy-is by generating inwardly rectifying membrane currents,ecorded at very negative potentials (−100 mV). Dialysisith InsP3 (100 �M) in undifferentiated cells activated a.82 ± 0.08 pA/pF current (at −100 mV, n = 18, Fig. 3A),ignificantly lower than the current activated in ED cells1.92 ± 0.28 pA/pF, n = 21). The I/V relationship of both cur-ents showed a strong inward rectification and had a positiveeversal potential, at 15.30 ± 3.34 mV for undifferentiatedells and +17.44 ± 4.72 mV for ED cells (n = 21 and 18,espectively, Fig. 3B). TG-induced ISOC showed the sameariations (not illustrated).

In order to measure the selectivity of SOC channels toivalent cations, we substituted 10 mM Ca2+ for 10 mM Ba2+,0 mM Sr2+, or 10 mM Mn2+ in the bath solution. Quan-ification of the InsP3 induced ISOC carried by these fourivalent cations yielded the following sequence of relativeonductance: Ca2+ (1) > Sr2+ (0.54) ∼ Ba2+ (0.48) � Mn2+

0.02) in undifferentiated keratinocytes and Ca2+ (1) > Sr2+

0.65) ∼ Ba2+ (0.52) � Mn2+ (0.01) in ED cells. These

equences, summarized in Fig. 3C, are analogous to thoseound for native ISOC in other cell types. We have also stud-ed SOC current permeability to monovalent cation by usingdivalent-free solution (DVF, see methods). Application of

w7(I

43 (2008) 492–505 497

DVF solution on fully developed ISOC evoked a transientnhancement of the latter (Fig. 3D). The current observed inVF solution had a more negative reversal potential value

ndicating a shift of permeability. Analysis of this shift of theeversal potential value indicated a permeability to Ca2+/Na+

16.8 in ED cells and ∼16 in undifferentiated keratinocytesFig. 3E). This order of magnitude is higher than the oneeported for TRPC channels in the literature [21], we there-ore assume that in the HaCaT endogenous cell model, otheron channel highly permeant to calcium as ORAIs might benvolved in the SOC current. Taken together, these resultsndicate that ISOC activity is at least partially mediated bya2+ and Na+ permeable ion channels like TRPC channels.

Pharmacological modulation of ISOC in HaCaT cells wastudied by analyzing currents activated by intracellular InsP3pplication. We studied the sensitivity of ISOC to the polyva-ent cation Lanthanum (La3+), which has been found to blockative CRAC and inhibit Ca2+-induced differentiation of ker-tinocytes [7,22]. A 10 �M concentration of La3+ blockedlmost all the ISOC current (Fig. 3F). We checked 2-APB andK&F 96365, compounds previously shown to inhibit ICRAC23] and, in different cell models, SOC and TRP mediateda2+ entry [24]. Perfusion with 100 �M 2-APB almost totally

nhibited ISOC (Fig. 3F). However, in ED cells, application of0 �M SK&F 96365 induced a 51.65 ± 3.74% inhibition ofully developed ISOC (Fig. 3D). The results were analogousetween ISOC in undifferentiated and ED cells. In conclu-ion, the ISOC characteristics in HaCaT cells were analogouso those in other cell types.

.4. TRPC channels are differentially involved in SOCepending on differentiation status

Recent studies have shown TRPC channel expressionn primary cultured epidermal keratinocytes and demon-trated the involvement of these channels in capacitativealcium entry [13]. In order to determine the involvementf TRP channels in SOC in HaCaT cells, we used antisenseligonucleotides against TRPC channels. We first validatedur commercial antibodies using recombinant TRPC1 andRPC4 proteins (Fig. 4A). We then checked that antisenseligonucleotide treatments selectively down-expressed theargeted proteins (Fig. 4B), and studied the consequence ofRPC channel down-expression on ISOC. Fig. 4 compares theverages of the ISOC time course from antisense and senseligonucleotide-treated cells and is summarized in Fig. 4E.e observed that, in ED keratinocytes, TRPC1 or TRPC4

ntisense oligonucleotides inhibited InsP3-activated ISOC by7.91 ± 12.27% (n = 8) and 38.25 ± 13.25% (n = 8), respec-ively (Fig. 4C). The same experiment performed with TG1 �M) to activate ISOC produced analogous results. In undif-erentiated cells, analogous experiments proved that TRPC1

as involved in both InsP3- and TG-activated ISOC, with4.41 ± 12.27 and 81.02 ± 11.83% inhibition, respectivelyFig. 4F). However, TRPC4 down-expression did not affectSOC in undifferentiated cells (Fig. 4F). We also checked

498 B. Beck et al. / Cell Calcium 43 (2008) 492–505

Fig. 3. Whole-cell endogenous SOC current in HaCaT cells. (A) Time course of the development of ISOC measured at −100 mV holding potential in response todialysis of 100 �M InsP3 in undifferentiated (black circles) and differentiated (open circles) cells. Dialysis started at the arrow as soon as the plasma membranewas ruptured. (B) IV relationship of InsP3-activated ISOC from two representative cells. Current was measured between −100 and 100 mV at maximum ISOC

amplitude. Cells were grown in either 0.07 mM (U) or 1.8 mM (D) Ca2+-containing medium. (C) Comparison of the InsP3-activated ISOC in cells exposedto 10 mM divalent cations (Ca2+, Ba2+, Sr2+ and Mn2+). Black column represents undifferentiated and white columns differentiated keratinocytes. (D) Timecourse of ISOC measured at −100 mV holding potential in response to dialysis of 100 �M InsP3 in ED keratinocytes. Application of divalent-free solution(DVF) is indicated by the upper bars. (E) IV relationship of InsP3-activated ISOC in a representative cell. Current was measured between −100 and 100 mVeither in DVF or in a control extracellular solution (10 mM Ca2+). (F) A histogram summarizing the effect of 50 �M SKF, 100 �M 2-APB, and 10 �M La3+

o olumnsc

tTsi

eutdetueo

wHdscc

3c

n normalized maximum SOC current induced by InsP3 in control (black current in undifferentiated cells acts as a reference.

he potential involvement of TRPC5 and TRPC7 in ISOC:RPC5 and TRPC7 antisense treatments did not induce anyignificant inhibition of SOC current in HaCaT cells (notllustrated).

In order to determine the potential variations of SOCxpression, we studied the expression of TRPC proteinsnder our specific growth conditions. Intriguingly, two ofhe proteins were differentially expressed depending on theifferentiation state. As illustrated in Fig. 5A, ED cellsxpressed both TRPC1 and TRPC4 proteins. On the con-

rary, cells grown in a low-Ca2+ medium (0.07 mM), i.e.ndifferentiated, expressed TRPC1 at a lower level and neverxpressed TRPC4. This result was confirmed by immunoflu-rescence experiments, which showed that both channels

n

i

) or differentiated (white columns) cells. Values are normalized; maximum

ere expressed in the plasma membrane of differentiatedaCaT cells, while only TRPC1 was detectable in non-ifferentiated cells (Fig. 5B–D). These experiments alsohowed that HaCaT differentiation was characterized by ahange in the general cell morphology, particularly cell toell adhesion.

.5. Down-expression of TRPC channels inhibitsalcium-induced differentiation

We further investigated whether TRPC1 and TRPC4 chan-els were involved in Ca2+-induced differentiation.

The effects of TRPC1 and TRPC4 knockdown on Ca2+-nduced differentiation of human keratinocytes were studied

B. Beck et al. / Cell Calcium 43 (2008) 492–505 499

Fig. 4. The effects of TRPC antisense oligonucleotides on SOC current. (A) HEK 293 cells were nucleofected (Amaxa Inc., Germany) with the pcDNA3-hTRPC1 and -hTRPC4 plasmids and the corresponding Western blots were performed using commercially available anti-TRPC1/TRPC4 antibodies (AlomoneLabs LTD.). In addition, to prove the specificity of antibodies, the nucleofected HEK 293-TRPC1/TRPC4 cells were treated with the corresponding anti-TRPC1/TRPC4 siRNAs. Please note that HEK 293 ATCC contain low levels of both TRPC1 and TRPC4 what is visible in the blots. Black arrow indicatesthe size of the expected full length TRPC4 protein cloned in pcDNA3 vector. (B) HaCaT cells were transfected with sense and antisense ODNs to TRPC1and TRPC4. Cells were lysed, analyzed by SDS-PAGE, blotted to a nitrocellulose membrane, and probed with specific rabbit polyclonal anti-TRPC1 andanti-TRPC4 antibodies. Mouse monoclonal anti-�-actin was used as a loading control. (C) In differentiated cells, time course of the InsP3-induced current at−100 mV. Cells were treated with TRPC1 sense (black upward-triangles), TRPC4 sense (black circles), TRPC1 antisense (open upward-triangles), and TRPC4antisense oligonucleotides (open circles). (D) Time course of the TG-induced current at −100 mV in differentiated cells. Cells were treated with TRPC1 sense(black upward-triangles), TRPC4 sense (black circles), TRPC1 antisense (open upward-triangles), and TRPC4 antisense oligonucleotides (open circles). (E)Histogram summarizing the action of TRPC1 and TRPC4 sense and antisense oligonucleotide treatment on InsP3- and TG-evoked current in differentiatedcells. Values are normalized; the current in sense oligonucleotide-treated cells acts as the reference in each condition. Asterisks denote significance (>0.95). (F)Histogram summarizing the action of TRPC1 and TRPC4 sense and antisense oligonucleotide treatment on InsP3- and TG-evoked current in undifferentiatedcells. Values are normalized; the current in sense oligonucleotide-treated cells acts as the reference in each conditions.

500 B. Beck et al. / Cell Calcium 43 (2008) 492–505

Fig. 5. Variation in TRPC channels depending on differentiation. (A) Expression of TRPC1, TRPC4, and KRT10 proteins revealed by Western blotting in cellsgrown in low-Ca2+ concentration ([Ca2+]o = 0.07 mM) for 4 days, i.e. undifferentiated cells (U) and in cells grown in high-Ca2+ medium ([Ca2+]o = 1.8 mM)for 4 days, i.e. differentiated cells (D). Immunocytochemistry of TRPC1 (Fig. 1C), TRPC4 (Fig. 1D), and KRT10 (Fig. 1B) proteins in undifferentiated (U)and differentiated cells (D). Cells were plated onto glass coverslips, treated with Cholera toxin subunit B Alexa Fluor® 488 conjugate (green), fixed withp olyclonF

uHsfkaansfaweT

tkTHQamasc

araformaldehyde, and incubated with the anti-TRPC1 and TRPC4 rabbit pluor® 546 goat anti-rabbit or goat anti-mouse IgG.

sing IVL, TGM1, and KRT10 differentiation markers.aCaT cells grown in 0.07 mM Ca2+ were transfected with

iRNA-TRPC1 or TRPC4 and subjected to a Ca2+-switchor 24 h, 3 days later. The impact of TRPC1 and TRPC4nockdown on Ca2+-induced differentiation of human ker-tinocytes, i.e. expression of differentiation-specific markers,re shown in Fig. 6B and D, respectively. It should beoted that though there are some differences betweeniRNA vs. oligonucleotides strategies, i.e. time of trans-er, mode of action, cell toxicity, etc., oligonucleotides

re also effective and were used at the beginning of thisork consecutively substituted thereafter by siRNA. The

ffectiveness of transfection was verified by monitoringRPC1 and TRPC4 silencing at shown and quantified pro-

edmk

al antibody or anti-KRT10 mouse monoclonal antibody followed by Alexa

ein levels (Fig. 6A). In HaCaT cells, TRPC1 and TRPC4nockdown significantly depressed mRNA levels of IVL,GM1, and KRT10, compared to untransfected intact EDaCaT cells treated with Ca2+ under the same conditions.uantitative histograms depicting the effects of TRPC1

nd TRPC4 knockdown on expression of differentiationarkers normalized to their levels in undifferentiated ker-

tinocytes are shown in Fig. 6C and E. These resultsuggest that TRPC1 and TRPC4 represent an essentialomponent of Ca2+-induced human keratinocyte differ-

ntiation. The expression of differentiation markers alsoepended on TRPC1 and TRPC4 expression levels, whichay constitute an important component of Ca2+ uptake by

eratinocytes.

B. Beck et al. / Cell Calcium 43 (2008) 492–505 501

Fig. 6. TRPC1 and TRPC4 were involved in calcium-induced differentiation. TRPC1 and TRPC4 are important differentiation components in human ker-atinocytes. HaCaT cells were transfected with siRNA-TRPC1 or -TRPC4 (A, control of transfection) and subjected to calcium switch for 24 h (dHaCaT-TRPC1or dHaCaT-TRPC4) after 3 days. Total mRNA was isolated, reverse transcribed, and PCR was performed. (B and D) The expression of differentiation markersi 1 or dHd uHaCao

3d

CecIltt

twHctps

n undifferentiated (uHaCaT), differentiated (dHaCaT), and dHaCaT-TRPCifferentiation markers as compared to their normalized expression levels inr dHaCaT-TRPC4 cells, P < 0.05, n = 3.

.6. Failure of BCC to differentiate correlated with theown-regulation of SOCE and TRPC channels

As TRPC channels seem to play a major role ina2+-induced keratinocyte differentiation, we studied thexpression and functions of these proteins in carcinomaells, where differentiation is known to be impaired [25,26].

ndeed, basal cell carcinoma is characterized by a basal cell-ike phenotype [27] and an altered response to stimulationriggering differentiation in normal keratinocytes. As illus-rated in Fig. 7A, these cells did not differentiate in response

cwA(

aCaT-TRPC4. (C and E) Histograms showing relative expression levels ofT. Asterisks denote statistical significance as compared to dHaCaT-TRPC1

o the Ca2+-switch. Moreover, TRPC1 or TRPC4 expressionas not detectable at mRNA level in these cancer cells. UnlikeaCaT cells, the TRPC channel expression pattern did not

hange depending on the Ca2+ growth conditions. InsP3 washen used to stimulate Ca2+-store depletion and activate SOCroteins. However, no SOC was recorded in BCC cell, irre-pective of the growth conditions (Fig. 7B). As the BCC

ells are derived from surgically removed tumor, we checkedhether normal cells from patients expressed TRPC proteins.s in HaCaT cells, both TRPC1 and TRPC4 were expressed

Fig. 7C). This expression correlated with the triggering of

502 B. Beck et al. / Cell Calcium 43 (2008) 492–505

Fig. 7. Absence of TRPC1 and TRPC4 correlated with differentiation failure in BCC cells. There was no TRPC-related SOCE in BCC cells. (A) RT-PCRessay designed to determine TRPC1, TRPC4, transglutaminase 1 (TGM1), and cytokeratin 10 (KRT10) mRNA in BCC cells grown either in a low- (0.07 mM)or high-calcium (dHaCaT) medium (1.8 mM), and in HaCaT cells grown in a high-calcium medium that allowed cells to differentiate (1.8 mM). (B) Dialysiso 3 min.p nt in hPw

aidd

4

ca(idc

4c

aMlmk

kktdimpawok

4k

ibtte

f InsP3 (100 �M) in BCC cells fail to induce any SOC current even afterroteins in hPK. (D) InsP3 dialysis activated a large inward-rectifying curreas followed at −100 mV.

n inwardly rectifying ISOC by InsP3 dialysis (Fig. 7D). Thisndicated that BCC cells failed to differentiate, at least in part,ue to a lack of TRPC-mediated SOC entry (see schematiciagram in Fig. 8).

. Discussion

This study presents three major findings: (i) both ERalcium content and SOCE increased in early differenti-ted human keratinocytes compared to undifferentiated cells;ii) down-regulation of TRPC1 and TRPC4 prevented Ca2+-nduced differentiation; and (iii) the failure of BCC toifferentiate correlated with the down-regulation of TRPChannel expression and SOCE.

.1. Human keratinocyte cell growth is regulated byalcium

It is already well established that Ca2+-store depletion isn important phenomenon for keratinocyte physiopathology.

oreover, altered ER Ca2+ homeostasis has been shown to

ead to pathology of the epidermis. Indeed, SERCA pumputation is the cause of Darier’s disease, characterized by

eratinization disorders [6]. Ca2+-induced differentiation in

tima

(C) Immunoblotting assay showing the expression of TRPC1 and TRPC4K grown under the same calcium conditions as the BCC cells. The current

eratinocytes is also blocked by lanthanum (La3+), a well-nown SOC inhibitor [7]. SOC-related Ca2+ entry may,herefore, be an important component of keratinocyte growthownstream from ER Ca2+ homeostasis. This hypothesiss strengthened by the data reporting that altered SOC-

ediated Ca2+ influxes in keratinocytes are characteristic ofsoriasis, a disease involving an abnormal rate of prolifer-tion compared to differentiation [8]. In view of these data,e hypothesized that the proteins involved in Ca2+ home-stasis, especially SOC, were the major factors regulatingeratinocyte differentiation.

.2. ER calcium stores increase in early differentiatederatinocytes

Our results clearly showed that the ER Ca2+ contentncreased significantly in differentiated keratinocytes. Theasal filling status of intracellular Ca2+ stores depends onhe balance between Ca2+ efflux via leak channels and reup-ake by SERCA pumps. Our results showed that SERCAxpression was affected by differentiation. We also checked

he expression of calreticulin, which plays a significant rolen determining intraluminal ER Ca2+ concentrations [28]. It

ay act as a Ca2+ sensor for SERCA in the ER lumen [29]nd play a role in Ca2+ storage [30]. Our results demonstrated

B. Beck et al. / Cell Calcium 43 (2008) 492–505 503

Fig. 8. Speculative model for the role of TRPC proteins in calcium-induced differentiation and Basal cell carcinoma disease. In normal undifferentiatedkeratinocytes, TRPC1 is involved in a weak capacitative calcium entry. Increasing the Ca2+ concentration in the medium, known as a “Ca2+-switch”, triggersTRPC1 upregulation and TRPC4 calcium channel expression. This upregulation of TRPC calcium channels leads to an increase in Ca2+ entry that inducesc tokeratio tiationT

t(ieCe

4d

IeIkiTcsvFpathT

Pci

4h

ssiT[d

wnwEee(

ell differentiation (characterized by the expression of markers such as cyf TRPC channel expression. The Ca2+-switch is unable to trigger differenRPC4 channels, as well as the resulting lack of capacitative Ca2+ entry.

hat differentiation increased calreticulin protein expressionFig. 2). These high levels of calreticulin and Ca2+ ER may,n turn, be responsible for the enhancement of SERCA2bxpression. Taken together, the increased expression of ERa2+ homeostasis-related proteins was consistent with thenhancement of ER Ca2+ concentration in ED cells.

.3. Store-operated calcium entry increased in earlyifferentiated keratinocytes

As previously mentioned, we observed that SOCE andSOC increased in ED keratinocytes compared to undiffer-ntiated cells. Indeed, our study is the first to characterizeSOC in human keratinocytes. Biophysical characteristics oferatinocyte ISOC, including pharmacology and ion selectiv-ty, were similar to those described in other models (Fig. 3).he marked increase in this current in ED keratinocytes wasonsistent with the enhancement of SOCE. Recent studiesuggest that the ER calcium sensor responsible for SOC acti-ation is the stromal-interacting molecule (STIM1) [31,32].urthermore, it has been demonstrated that STIM1 interactshysically with TRPC1 and TRPC4, suggesting that it may

ctivate these channels in response to ER Ca2+-store deple-ion [33]. This study hints at a relationship between ER Ca2+

omeostasis and Ca2+ entry mediated by TRPC channels.his potential relationship was confirmed by the findings of

suTi

n 10 or involucrin). Basal cell carcinoma cells are characterized by a lossin these cells. This observation correlates with the absence of TRPC1 and

ani et al. [34] showing that certain epidermal diseases wereharacterized by ER Ca2+ alteration as well as modificationsn plasma membrane TRPC1 activity.

.4. TRP channels are major components of calciumomeostasis in keratinocytes

TRP channels, particularly TRPC1 and TRPC4, are con-idered candidates for SOC [35]. Nevertheless, recent studiesuggested a new SOC candidate, Orai1 [32,36,37], whichs regulated by STIM1 in a stoichiometric manner [37]. AsRPC1 and TRPC4 may also interact physically with STIM1

33], SOC entry is probably mediated by different proteins,epending on the cell model.

By treating HaCaT cells with antisense oligonucleotides,e determined that TRPC1 and TRPC4 but neither TRPC5or TRPC7 were involved in SOC current (Fig. 4). Indeed,e recently demonstrated that TRPC7 was not activated byR Ca2+-store depletion in these cells, but by diacylglyc-rol [17]. Interestingly, the pattern of TRPC1 and TRPC4xpression changed according to cell differentiation statusFig. 5): ED keratinocytes were characterized by overexpres-

ion of TRPC1 and the appearance of TRPC4 compared tondifferentiated cells (where only TRPC1 was expressed).hese results are consistent with those reported by Cai et al.,

n human gingival keratinocytes [38]. Thus, in our model,

5 alcium

tiFpwtiscs

psEwenigCcOc

4n

oatpriiaDcatTpm[

4c

a(lcoso

agcSridopoikp

R

[

[

[

[

[

04 B. Beck et al. / Cell C

he enhancement of SOC entry in ED keratinocytes may,n part, be a consequence of SOC channel overexpression.urthermore, we demonstrated that involvement of TRPCroteins in SOC current depended on differentiation. Indeed,hile TRPC1 and TRPC4 carried SOC current in differen-

iated cells, TRPC1 was apparently the only TRPC channelnvolved in SOC current in undifferentiated cells. We thushowed, for the first time, that the increase in SOC-mediatedalcium influxes in early differentiated keratinocytes is a con-equence of TRPC overexpression.

In spite of the apparent variation of SOC channels com-osition during cell differentiation, we did not observedignificant differences between ISOC in undiffereniated andD keratinocytes. Moreover, ISOC biophysical propertiesere different from those described for heterologously

xpressed TRPC1/C4. The complex composition of endoge-ous SOC channels could explain these differences. Otheron channels and partner proteins might be involved in theenesis of ISOC in epidermal cells. The high permeability toa2+ is not a fingerprint of TRPC channels but might be theonsequence of the involvement of other ion channels likeRAI1 in ISOC. Nevertheless, this hypothesis needs to be

onfirmed in a further study.

.5. Expression of TRPC channels carrying SOCE isecessary for differentiation

We observed that TRPC1 down-expression by antisenseligonucleotides or siRNA strongly inhibited SOC currentnd SOCE, and almost abolished calcium-induced differen-iation. This major result demonstrates that SOC channelslay a crucial role in the differentiation mechanism. Aseported by Pillai and Bikle, a blockade of calcium entrynhibited differentiation [7]. Our results show that TRPC4,n contrast to TRPC1, is specific to differentiated ker-tinocytes and is involved in SOC current in these cells.own-expression of TRPC4 led to a decrease in SOC

urrent and SOC entry, specifically in differentiated ker-tinocytes. Intriguingly, knockdown of this protein also ledo a marked decrease in the level of differentiation markers.his suggests that, like other TRPC channels in hippocam-al neurons or cornel epithelial cells, TRPC4 is involved inaintaining the differentiation state in human epidermal cells

12,39].

.6. Absence of TRPC1 and TRPC4 expressionorrelated with failure to differentiate in BCC cells

Recent studies demonstrated that grave pathologies, suchs immunodeficiency, were related to a lack of CRACcalcium release activated channel)-mediated Ca2+ entry inymphocytes [40]. Similarly, our results showed that the most

ommon skin cancer, BCC, was also associated with a lackf SOCE. Finally, the Ca2+-switch did not induce the expres-ion of classic differentiation markers, such as cytokeratin 10r transglutaminase 1 (Fig. 7).

[

43 (2008) 492–505

This failure of BCC to differentiate correlated with anbsence of TRPC1 or TRPC4 expression, irrespective of therowth conditions used. Contrary to our findings for HaCaTells and human primary keratinocytes, no InsP3-activatedOC current was recorded in these skin cancer cells. Theseesults suggest that BCC cells do not differentiate, at leastn part, due to the loss of the SOC channels necessary forifferentiation in human keratinocytes (Fig. 8). The conceptf a TRPC-related pathology in the epidermis was recentlyroposed in a study of TRPC1 in Darier’s disease [34]. More-ver, in this study, the authors suggested that TRPC1 was alsonvolved in proliferation. This duality of TRPC1 in humaneratinocytes may explain the lack of differentiation and slowroliferation rate characteristic of basal cell carcinoma cells.

eferences

[1] H. Hennings, F.H. Kruszewski, S.H. Yuspa, R.W. Tucker, Intracellu-lar calcium alterations in response to increased external calcium innormal and neoplastic keratinocytes, Carcinogenesis 10 (1989) 777–780.

[2] H. Hennings, D. Michael, C. Cheng, P. Steinert, K. Holbrook, S.H.Yuspa, Calcium regulation of growth and differentiation of mouse epi-dermal cells in culture, Cell 19 (1980) 245–254.

[3] D.D. Bikle, A. Ratnam, T. Mauro, J. Harris, S. Pillai, Changes incalcium responsiveness and handling during keratinocyte differenti-ation. Potential role of the calcium receptor, J. Clin. Invest. 97 (1996)1085–1093.

[4] C.L. Tu, W. Chang, D.D. Bikle, The extracellular calcium-sensingreceptor is required for calcium-induced differentiation in human ker-atinocytes, J. Biol. Chem. 276 (2001) 41079–41085.

[5] J.W. Putney Jr., A model for receptor-regulated calcium entry, CellCalcium 7 (1986) 1–12.

[6] Z. Hu, J.M. Bonifas, J. Beech, G. Bench, T. Shigihara, H. Ogawa, S.Ikeda, T. Mauro, E.H. Epstein Jr., Mutations in ATP2C1, encodinga calcium pump, cause Hailey-Hailey disease, Nat. Genet. 24 (2000)61–65.

[7] S. Pillai, D.D. Bikle, Lanthanum influx into cultured human ker-atinocytes: effect on calcium flux and terminal differentiation, J. Cell.Physiol. 151 (1992) 623–629.

[8] S.L. Karvonen, T. Korkiamaki, H. Yla-Outinen, M. Nissinen, H.Teerikangas, K. Pummi, J. Karvonen, J. Peltonen, Psoriasis and alteredcalcium metabolism: downregulated capacitative calcium influx anddefective calcium-mediated cell signaling in cultured psoriatic ker-atinocytes, J. Invest. Dermatol. 114 (2000) 693–700.

[9] D.E. Clapham, TRP channels as cellular sensors, Nature 426 (2003)517–524.

10] C. Montell, L. Birnbaumer, V. Flockerzi, The TRP channels, a remark-ably functional family, Cell 108 (2002) 595–598.

11] B. Nilius, Store-operated Ca2+ entry channels: still elusive!, Sci. STKE(2004) pe36.

12] A. Greka, B. Navarro, E. Oancea, A. Duggan, D.E. Clapham, TRPC5 isa regulator of hippocampal neurite length and growth cone morphology,Nat. Neurosci. 6 (2003) 837–845.

13] C.L. Tu, W. Chang, D.D. Bikle, Phospholipase cgamma1 is required foractivation of store-operated channels in human keratinocytes, J. Invest.Dermatol. 124 (2005) 187–197.

14] S. Cai, S. Fatherazi, R.B. Presland, C.M. Belton, F.A. Roberts, P.C.

Goodwin, M.M. Schubert, K.T. Izutsu, Evidence that TRPC1 con-tributes to calcium-induced differentiation of human keratinocytes,Pflugers Arch. 452 (2006) 43–52.

15] S. Tamiji, J.C. Beauvillain, L. Mortier, N. Jouy, M. Tual, E. Delaporte,P. Formstecher, P. Marchetti, R. Polakowska, Induction of apoptosis-

alcium

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

B. Beck et al. / Cell C

like mitochondrial impairment triggers antioxidant and Bcl-2-dependent keratinocyte differentiation, J. Invest. Dermatol. 125 (2005)647–658.

16] E.Y. Seo, J.H. Namkung, K.M. Lee, W.H. Lee, M. Im, S.H. Kee, G.Tae Park, J.M. Yang, Y.J. Seo, J.K. Park, C. Deok Kim, J.H. Lee,Analysis of calcium-inducible genes in keratinocytes using suppressionsubtractive hybridization and cDNA microarray, Genomics 86 (2005)528–538.

17] B. Beck, A. Zholos, V. Sydorenko, M. Roudbaraki, V. Lehen’kyi, P.Bordat, N. Prevarskaya, R. Skryma, TRPC7 is a receptor-operatedDAG-activated channel in human keratinocytes, J. Invest. Dermatol.126 (2006) 1982–1993.

18] R.L. Eckert, J.F. Crish, N.A. Robinson, The epidermal keratinocyte as amodel for the study of gene regulation and cell differentiation, Physiol.Rev. 77 (1997) 397–424.

19] H. Hennings, K. Holbrook, P. Steinert, S. Yuspa, Growth and differ-entiation of mouse epidermal cells in culture: effects of extracellularcalcium, Curr. Probl. Dermatol. 10 (1980) 3–25.

20] H. Hennings, K.A. Holbrook, Calcium regulation of cell-cell contactand differentiation of epidermal cells in culture. An ultrastructuralstudy, Exp. Cell Res. 143 (1983) 127–142.

21] G. Owsianik, K. Talavera, T. Voets, B. Nilius, Permeation and selectiv-ity of TRP channels, Annu. Rev. Physiol. 68 (2006) 685–717.

22] M. Hoth, R. Penner, Calcium release-activated calcium current in ratmast cells, J. Physiol. 465 (1993) 359–386.

23] T. Voets, J. Prenen, A. Fleig, R. Vennekens, H. Watanabe, J.G. Hoen-derop, R.J. Bindels, G. Droogmans, R. Penner, B. Nilius, CaT1 andthe calcium release-activated calcium channel manifest distinct poreproperties, J. Biol. Chem. 276 (2001) 47767–47770.

24] H.T. Ma, K. Venkatachalam, H.S. Li, C. Montell, T. Kurosaki, R.L.Patterson, D.L. Gill, Assessment of the role of the inositol 1,4,5-trisphosphate receptor in the activation of transient receptor potentialchannels and store-operated Ca2+ entry channels, J. Biol. Chem. 276(2001) 18888–18896.

25] D.D. Bikle, S. Pillai, E. Gee, Squamous carcinoma cell lines produce1,25 dihydroxyvitamin D, but fail to respond to its prodifferentiatingeffect, J. Invest. Dermatol. 97 (1991) 435–441.

26] M. Sebag, J. Henderson, J. Rhim, R. Kremer, Relative resistance to1,25-dihydroxyvitamin D3 in a keratinocyte model of tumor progres-sion, J. Biol. Chem. 267 (1992) 12162–12167.

27] M.E. Maloney, Histology of basal cell carcinoma, Clin. Dermatol. 13(1995) 545–549.

[

43 (2008) 492–505 505

28] M. Michalak, E.F. Corbett, N. Mesaeli, K. Nakamura, M. Opas, Cal-reticulin: one protein, one gene, many functions., Biochem. J. 344 (Pt2) (1999) 281–292.

29] E.F. Corbett, K.M. Michalak, K. Oikawa, S. Johnson, I.D. Campbell,P. Eggleton, C. Kay, M. Michalak, The conformation of calreticulin isinfluenced by the endoplasmic reticulum luminal environment, J. Biol.Chem. 275 (2000) 27177–27185.

30] K. Nakamura, A. Zuppini, S. Arnaudeau, J. Lynch, I. Ahsan, R. Krause,S. Papp, H. De Smedt, J.B. Parys, W. Muller-Esterl, D.P. Lew, K.H.Krause, N. Demaurex, M. Opas, M. Michalak, Functional specializationof calreticulin domains, J. Cell. Biol. 154 (2001) 961–972.

31] P. Draber, L. Draberova, Lifting the fog in store-operated Ca2+ entry,Trends Immunol. 26 (2005) 621–624.

32] J. Roos, P.J. DiGregorio, A.V. Yeromin, K. Ohlsen, M. Lioudyno,S. Zhang, O. Safrina, J.A. Kozak, S.L. Wagner, M.D. Cahalan, G.Velicelebi, K.A. Stauderman, STIM1, an essential and conserved com-ponent of store-operated Ca2+ channel function, J. Cell Biol. 169(2005) 435–445.

33] G.N. Huang, W. Zeng, J.Y. Kim, J.P. Yuan, L. Han, S. Muallem, P.F.Worley, STIM1 carboxyl-terminus activates native SOC, I(crac) andTRPC1 channels, Nat. Cell Biol. (2006).

34] B. Pani, E. Cornatzer, W. Cornatzer, D. Min Shin, M.R. Pittelkow,A. Hovnanian, I.S. Ambudkar, B.B. Singh, Up-regulation of TRPC1following SERCA2 gene silencing promotes cell survival: a potentialrole for TRPC1 in Darier’s disease, Mol. Biol. Cell (2006).

35] C. Montell, Physiology, phylogeny, and functions of the TRP super-family of cation channels, Sci. STKE (2001) RE1.

36] M. Prakriya, S. Feske, Y. Gwack, S. Srikanth, A. Rao, P.G. Hogan,Orai1 is an essential pore subunit of the CRAC channel, Nature (2006).

37] J. Soboloff, M.A. Spassova, X.D. Tang, T. Hewavitharana, W. Xu,D.L. Gill, Orai1 and STIM reconstitute store-operated calcium channelfunction, J. Biol. Chem. 281 (2006) 20661–20665.

38] S. Cai, S. Fatherazi, R.B. Presland, C.M. Belton, K.T. Izutsu, TRPCchannel expression during calcium-induced differentiation of humangingival keratinocytes, J. Dermatol. Sci. 40 (2005) 21–28.

39] X. Wu, T.K. Zagranichnaya, G.T. Gurda, E.M. Eves, M.L. Villereal,A TRPC1/TRPC3-mediated increase in store-operated calcium entry

is required for differentiation of H19-7 hippocampal neuronal cells, J.Biol. Chem. 279 (2004) 43392–43402.

40] S. Feske, M. Prakriya, A. Rao, R.S. Lewis, A severe defect in CRACCa2+ channel activation and altered K+ channel gating in T cells fromimmunodeficient patients, J. Exp. Med. 202 (2005) 651–662.