Triple Gene-Deleted Oncolytic Herpes Simplex Virus Vector

Double-Armed with Interleukin 18 and Soluble

B7-1 Constructed by Bacterial Artificial

Chromosome–Mediated System

Hiroshi Fukuhara,1,2Yasushi Ino,

1,3Toshihiko Kuroda,

1Robert L. Martuza,

1and Tomoki Todo

1,3,4

1Molecular Neurosurgery Laboratory, Massachusetts General Hospital, Harvard Medical School, Charlestown, Massachusetts andDepartments of 2Urology, 3Neuro-oncology and Molecular Therapeutics, and 4Neurosurgery, The University of Tokyo, Tokyo, Japan

Abstract

Conditionally replicating herpes simplex virus type 1 (HSV-1)vectors are promising therapeutic agents for cancer. Certainantitumor functions may be added to oncolytic activities ofrecombinant HSV-1 vectors by inserting transgenes into theviral genome. Because conventional homologous recombina-tion techniques had required time-consuming processes tocreate ‘‘armed’’ oncolytic HSV-1 vectors, we established aninnovative construction system using bacterial artificialchromosome and two recombinase systems (Cre/loxP andFLPe/FRT). Using G47#, a safe and efficacious oncolytic HSV-1 with triple gene mutations, as the backbone, this systemallowed a rapid generation of multiple vectors with desiredtransgenes inserted in the deleted ICP6 locus. Four oncolyticHSV-1 vectors, expressing murine interleukin 18 (mIL-18),soluble murine B7-1 [B7-1-immunoglobulin (B7-1-Ig)], both,or none, were created simultaneously within 3 months.In vitro , all newly created recombinant vectors exhibited virusyields and cytopathic effects similar to the parental G47#.In two immunocompetent mouse tumor models, TRAMP-C2prostate cancer and Neuro2a neuroblastoma, the vectorexpressing both mIL-18 and B7-1-Ig showed a significantenhancement of antitumor efficacy via T-cell–mediatedimmune responses. The results show that ‘‘arming’’ withmultiple transgenes can improve the efficacy of oncolyticHSV-1 vectors. The use of our system may facilitate thedevelopment and testing of various armed oncolytic HSV-1vectors. (Cancer Res 2005; 65(23): 10663-8)

Introduction

The key to developing useful oncolytic herpes simplex virustype 1 (HSV-1) vectors is to acquire high antitumor efficacy withoutcompromising safety, obtaining as wide therapeutic window aspossible. G207 is one of the first oncolytic HSV-1 vectors used inclinical trials (1) and has deletions in both copies of the c34.5 geneand a lacZ insertion inactivating the ICP6 gene (2). The doublemutations permit viral replication within cancer cells that cancomplement these mutations but not in normal cells. G207,however, may be considerably attenuated not only for thepathogenicity but also for the tumor cell killing capability compared

with wild-type HSV-1. G47D was constructed by creating a furtherdeletion within the a47 gene and the overlapping US11 promoter ofthe G207 genome (3). This additional deletion conferred enhancedviral replication in tumor cells and partial restoration of MHC class Iexpression in infected human cells, resulting in drastic improve-ment of antitumor efficacy while preserving the safety features.One of the advantages of HSV-1 vectors is the capacity to

incorporate large and/or multiple transgenes within the viralgenome. Aside from the extent of replication capability within thetumor, the efficacy of an oncolytic HSV-1 depends on the extent ofantitumor immunity induction (4, 5). Therefore, the genes ofimmunomodulatory molecules would be reasonable candidates for‘‘arming’’ oncolytic HSV-1 vectors. Conventionally, recombinantHSV-1 vectors have been constructed using homologous recombi-nation techniques, which required time-consuming processes ofselection and structure confirmation. Bacterial artificial chromo-some (BAC) enables manipulation of large eukaryotic sequencessuch as oversized HSV-1 amplicons and HSV-1 genomes in plasmids(6–11). In this article, we used BAC and two recombinase systems(Cre/loxP and FLPe/FRT) to develop a method that allowed a rapid,reliable, and simultaneous construction of multiple ‘‘armed’’oncolytic HSV-1 vectors using G47D as the backbone.

Materials and Methods

Cells and viruses. Vero, Neuro2a, Pr14-2, and TRAMP-C2 cells were

cultured as described (3). G47D was grown in Vero cells and virus titers

were determined as described (2, 3).Generation of BAC-G47# plasmid. BAC-G47D was created by a

homologous recombination of G47D DNA and pBAC-ICP6EF, a plasmid

that contains the insertion sequences of the ICP6 coding region.5

Transfections were done on Vero cells by using 0.9 Ag of DNA composedof a 1:1:1 mixture of G47D DNA purified by Na/I method, pBAC-ICP6EF

(undigested), and pBAC-ICP6EF linearized with Asc I digestion, with

Lipofectamine (Invitrogen, Carlsbad, CA). At a 30% to 50% cytopathic

effect, recombinant viruses forming green fluorescent protein (GFP)–positive plaques were selected and further passaged in Vero cells

(Supplementary Fig. S1). After three rounds of GFP-positive and lacZ-

negative selection, circular virus DNA from infected Vero cells was isolatedby the Hirt method (12, 13) and electroporated into E.coli DH10B

(Invitrogen). Antibiotic-resistant colonies were isolated, BAC-G47D plasmid

DNA was purified, and the structure was confirmed by endonuclease

digestions (Supplementary Fig. S2).Construction of shuttle vectors. The shuttle vector pVec9 was

constructed to contain a 45-bp FRT adaptor (5V-GATCCGAAGTTCCTATA-CTTTCTAGAGAATAGGAACTTCCTCGAG-3V), a 50-bp loxP adaptor (5V-AGCT-TATAACTTCGTATAATGTATGCTATACGAAGTTATCCATGGCTGCA-3V),

Note: Supplementary data for this article are available at Cancer Research Online(http://cancerres.aacrjournals.org/).

Requests for reprints: Tomoki Todo, Department of Neurosurgery, The Universityof Tokyo, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113-8655, Japan. Phone: 81-3-5800-8853; Fax:81-3-5800-8655; E-mail: toudou-nsu@umin.ac.jp.

I2005 American Association for Cancer Research.doi:10.1158/0008-5472.CAN-05-2534 5 T. Kuroda, manuscript in preparation.

www.aacrjournals.org 10663 Cancer Res 2005; 65: (23). December 1, 2005

Priority Report

Research. on October 1, 2020. © 2005 American Association for Cancercancerres.aacrjournals.org Downloaded from

the lacZ gene from pcDNA6E/Uni-lacZ (Clontech, Mountain View, CA),an expression cassette with the cytomegalovirus (CMV) promoter and bovine

growth hormone poly(A) frompVP22/myc-His2 (Invitrogen), a 3,989-bp fragment

of the E HindIII DNA, and a multiple cloning site sequence of AvrII, StuI,

and NotI (GATCCTTCCTAGGTTAGGCCTAAGCGGCCGCTTCCGCGG).A 2.4-kb HindIII-NotI fragment containing the extracellular domain of

B7-1 and the Fc portion of human immunoglobulin G (IgG) gene from B7.1-

pIg (5) was inserted into the AvrII site of pVec9 to generate murine B7-1-Ig

(mB7-1-Ig)/Vec9. A 582-bp EcoRI fragment containing a mouse IFN-h signalsequence and a mature interleukin 18 (IL-18) sequence from pCEXV3/

hybrid IL-18 (provided by Dr. Isao Hara, Kobe University, Kobe, Japan;

ref. 14) was inserted into the StuI site of pVec9 to generate mIL-18/Vec9.

A 3.3-kb fragment containing the hybrid IL-18 gene inserted into thepolylinker region of pIRES (Clontech) and the B7-1-Ig gene was inserted

into the AvrII site of pVec9 to generate IL18-B7/Vec9.

Reconstitution of BAC-G47# virus. Mutagenesis of the BAC-G47Dplasmid was done by a two-step replacement procedure. Mixture of BAC-

G47D plasmid (1.5 Ag) and mB7-1-Ig/Vec9, mIL-18/Vec9, IL18-B7/Vec9,

or empty Vec9 (150 ng each) was incubated with Cre recombinase (NEB,

Ipswich, MA) at 37jC for 30 minutes in 10 AL of solution and waselectroporated into E.coli DH10B. To select those that contained the mutant

BAC plasmid, the bacteria were streaked onto LB plates containing Cm

(15 Ag/mL) and Kan (10 Ag/mL) and incubated at 37jC overnight. DNA

structures of the recombinant BAC-G47D/Vec9 plasmids were confirmed bygel analyses following endonuclease digestions (Supplementary Fig. S3).

Transfections were done on Vero cells by using 2 Ag of BAC-G47D/Vec9 DNA and 0.5 Ag of pCAGGSFlpeIRES with 15 AL of Lipofectamine.

Transfected cells were incubated in DMEM/10% FCS at 37jC overnight,

then medium was replaced with DMEM/1% heat-inactivated FCS the

next day, and incubation was continued for several days until plaquesappeared. The progeny viruses were selected for GFP negativity by an

inverted fluorescence microscope and for lacZ positivity by X-gal

staining. Three rounds of limiting dilution were done to pick out a

single clone. Recombinant vectors were harvested and the structure ofthe viral DNA was confirmed by endonuclease digestions and Southern

blot analyses.

In vitro cytotoxicity studies and virus yield studies. In vitro

cytotoxicity studies were done as described (2, 3). The number ofsurviving cells was counted daily with a Coulter Counter (Beckman

Coulter, Fullerton, CA) and expressed as a percentage of mock-infected

controls. For viral yield studies, Vero cells were seeded on six-well platesat 3 � 105 per well. Wells were infected with four clones each of G47D-

empty, G47D-mIL-18, G47D-mB7-1-Ig, and G47D-IL18/B7 in duplicate

wells at a multiplicity of infection (MOI) of 0.01 for 48 hours. G47D was

used as a control. After 48 hours of infection, the cells were scraped andlysed by three cycles of freezing and thawing. The progeny virus was

titrated on Vero cells by a plaque assay as described (2, 3). Results

represent the average of duplicates.

Immunocytochemistry and ELISA. Cells were plated in 24-well platesand incubated at 37jC for 24 hours. Cells in duplicate wells were

Figure 1. A, a schema describing the system for constructing armed oncolytic HSV-1 vectors with the G47D backbone. The desired transgene for arming is insertedinto the multiple cloning site of the shuttle vector (pVec9). The first step is to insert the entire sequence of the shuttle vector into the loxP site of BAC-G47D bya Cre-mediated recombination, followed by an electroporation into E.coli DH10B. The second step is to cotransfect the cointegrate with a plasmid expressing FLPeonto Vero cells to excise the BAC sequence flanked by the FRT sites. The objective armed oncolytic HSV-1 vectors appear as GFP-negative and lacZ-positivevirus plaques. Nonrecombined viruses do not appear due to the presence of the lambda stuffer sequence causing an oversize of the genome. B, structure of thearmed oncolytic HSV-1 vector (G47D-transgene) constructed using the system. Boxes on the top line, inverted repeat sequences flanking the long (UL) and short(US ) unique sequences of HSV-1 DNA. G47D-transgene contains 1.0-kb deletions in both copies of the c34.5 gene, a 312-bp deletion in the a47 gene, and an894-bp deletion in the ICP6 gene. The lacZ gene and the CMV promoter-driven transgene, placed in opposite directions, are inserted in the deleted ICP6 locus.Thick arrows, transcribed regions. N, Nco I; Bs, BstEII; St,Stu I; X,Xho I; B,BamHI; G,Bgl II; EN,EcoNI; Nr,Nru I. C, structure of the shuttle vector pVec9. The desiredtransgene would be cloned in the multiple cloning site under the CMV promoter.

Cancer Research

Cancer Res 2005; 65: (23). December 1, 2005 10664 www.aacrjournals.org

Research. on October 1, 2020. © 2005 American Association for Cancercancerres.aacrjournals.org Downloaded from

infected with each virus and further incubated at 39.5jC for 18 hours.Cells were fixed and immunostained for B7-1-Ig as described (5). The

IL-18 concentration of the media was measured using a mouse IL-18

ELISA kit (MBL, Nagoya, Japan). Results represent the average of

duplicates.Animal studies. Six-week-old male C57BL/6 mice (Harlan Laboratories,

Indianapolis, IN), female A/J mice [National Cancer Institute (NCI),

Frederick, MD], and male/female athymic (BALB/c nu/nu) mice (NCI)

were used. All animal procedures were approved by the InstitutionalCommittee on Research Animal Care. S.c. tumor therapy was done as

described (4). Statistical analysis was done by unpaired t test.

Results and Discussion

The established system involves two steps (Fig. 1A). The firststep requires BAC-G47D, a plasmid of the G47D genome with theBAC-containing sequence inserted into the deleted ICP6 locusflanked by loxP and FRT sites. Also required is the shuttle vector(pVec9), a replication-conditional plasmid that contains the lacZgene (without a promoter), loxP and FRT sites, a CMV promoter,and a multiple cloning site where the desired transgene is cloned(Fig. 1C). The first step of this system is to insert the entiresequence of the shuttle vector into the loxP site of BAC-G47D by aCre-mediated recombination (15). It is designed so that, after therecombination, lacZ is placed under the ICP6 promoter of G47Dand expressed. The transgene cassette is placed in the downstreamof lacZ , driven in the opposite direction (Fig. 1B). The second stepis to cotransfect the cointegrate with a plasmid expressing FLPeonto Vero cells to excise the BAC sequence flanked by the FRTsites (16, 17). The lambda stuffer sequence is included in theshuttle vector so that, without a successful excision of the BACsequence, there is no virus formation due to an oversized genome(Fig. 1C). The objective recombinant HSV-1 vector is obtained byharvesting GFP-negative and lacZ-positive plaques and isolatedby limiting dilution. The entire procedure is typically done within3 months.To test and use the system, we used the murine IL-18 (mIL-18)

gene, the B7-1-Ig gene, both genes connected by the equine CMVinternal ribosomal entry site (IRES) sequence, or no transgene tosimultaneously create four different HSV-1 vectors, G47D-mIL-18,G47D-B7-1-Ig, G47D-IL18/B7, and G47D-empty, respectively. Theresultant vectors should have triple gene deletions in the c34.5,ICP6 , and a47 genes, and the transgene driven by the CMVpromoter and the lacZ gene driven by the ICP6 promoter bothinserted in the deleted ICP6 locus. More than 99% of virus plaquesformed after the FLPe recombination were both GFP negative andlacZ positive (Supplementary Fig. S4). Four clones of each HSV-1vector were isolated by two-round limiting dilution and theconstruct was confirmed by restriction endonuclease digestion andSouthern blot analyses (Fig. 2).To check the replication capability of the armed oncolytic

HSV-1 vectors, we determined the yield of progeny virus 48 hoursafter infection of Vero cells (3 � 105 per well) at an MOI of 0.01(Table 1A). The virus yield was not significantly altered by thepresence or the size of inserted transgenes. The transgeneexpression was tested by ELISA for murine IL-18 and by immuno-cytochemistry for murine B7-1 or human IgG (Fc). The mediumof Vero cells 48 hours after infection with each virus clone ofG47D-IL18/B7 or G47D-mIL-18 at an MOI of 1 contained anaverage of 1,000 pg/mL of murine IL-18 (Table 1A). All virus clonesof G47D-IL18/B7 and G47D-B7-1-Ig expressed murine B7-1-Ig 48hours after infection of Vero cells (Table 1A).

Because no significant difference was observed among clones,the first clone from each HSV-1 vector was used for furtheranalyses. The in vitro cytopathic activities of the four oncolyticHSV-1 vectors were evaluated in mouse cell lines TRAMP-C2(prostate cancer) and Neuro2a (neuroblastoma). Whereas mousecells are generally less susceptible to HSV-1 infection than Verocells, all four vectors killed tumor cells as rapid as the parentalG47D in both cell lines when infected at an MOI of 0.1 (Fig. 3A).The transgene expression of G47D-IL18/B7 and G47D-mIL-18 wasdetected in all mouse cell lines tested (Table 1B).The in vivo efficacy of the armed oncolytic HSV-1 vectors was

screened in two immunocompetent mouse tumor models, TRAMP-C2 tumors in syngeneic C57BL/6 mice and Neuro2a tumors insyngeneic A/J mice (Fig. 3B and C). When established s.c. tumorsreached f6 mm in diameter, mock, G47D, G47D-empty, G47D-mIL-18, G47D-B7-1-Ig, or G47D-IL18/B7 [5 � 106 plaque-formingunits (pfu) for TRAMP-C2 and 5 � 105 pfu for Neuro2a] wasinoculated into the tumor on days 0 and 3. In the TRAMP-C2model, whereas all HSV-1 vectors caused a significant inhibition oftumor growth compared with mock, the G47D-IL18/B7 treatmentshowed the greatest efficacy, resulting in a significantly smaller

Figure 2. Southern blotting analyses confirming the structures of theBAC-G47D plasmid, the BAC-G47D/Vec9-empty plasmid, and the recombinantG47D-empty virus. After HindIII, Xho I, or Kpn I digestion, DNA fragments wereseparated by electrophoresis on 0.6% agarose gels in 1� Tris-borate-EDTAbuffer for 14 to 18 hours at 2.5 V/cm. One of DNA fragments of EcoRI-digestedpcDNA6E/Uni-lacZ corresponding to the lacZ sequence was used as thehybridization probe.

Oncolytic HSV Double-Armed with IL-18 and Soluble B7-1

www.aacrjournals.org 10665 Cancer Res 2005; 65: (23). December 1, 2005

Research. on October 1, 2020. © 2005 American Association for Cancercancerres.aacrjournals.org Downloaded from

tumor size than the treatment with G47D-mIL-18 or G47D-B7-1-Ig(P < 0.05 versus G47D-mIL-18 on days 19 and 23 and versusG47D-B7-1-Ig on days 23 and 26; Fig. 3B). Also in the Neuro2amodel, in which tumors grow more aggressively than TRAMP-C2,all HSV-1 vectors caused a significant inhibition of tumor growthcompared with mock. Only the G47D-IL18/B7 treatment wassignificantly more efficacious than G47D and G47D-empty (P < 0.05on day 17; Fig. 3C). When athymic mice harboring s.c. Neuro2atumors were treated in the same manner, there was no differencein efficacy between armed oncolytic vectors and unarmed controlvectors, indicating that the enhancement of antitumor efficacy byarming with the IL-18 and/or B7-1-Ig gene(s) requires T cells (datanot shown).Our system has several important advantages over previously

reported methods that use BAC to manipulate HSV-1 genomes(9, 11). The most time-consuming process for generating recom-binant HSV-1 has been the selection of a correctly structured cloneamong, literally, millions of candidates after homologous recom-bination. We drastically improved the probability of a preciserecombination occurrence by using recombinase systems. In fact,14 of 16 of BAC-G47D/shuttle vector clones after the first step(Cre recombination) possessed the expected insert and over 99% ofthe clones after the second step (FLPe recombination) had theexpected phenotype (Supplementary Fig. S1). We also used multipledevices for easy selection of correct recombinants. In addition to

the use of antibiotic-resistant genes, the GFP gene was used for apositive selection in the process of creating the BAC-G47D plasmid(Supplementary Fig. S1) and also for a negative selection in thefinal step. It is also advantageous to have the GFP gene removed inthe final product because GFP is known to be relatively cytotoxicand immunogenic (18, 19). The lacZ gene was used for a positiveselection in the final step (therefore, a dual marker selectionwith the negative GFP) and as the histochemical marker of thegenerated vector. The final vector does not contain any portionof BAC sequences and the stuffer sequence of the shuttle vectorprevents virus formation when the excision by FLPe recombi-nation is unsuccessful. The sequence of using the tworecombinase systems, first Cre then FLPe, was carefully chosenso that the first recombination is done not in cells but efficientlyin a tube, and the second recombination is done in Vero cells,which directly results in virus plaque formation. Most impor-tantly, the system has G47D as the backbone structure and thegenerated vectors would have triple gene deletions in four widelyspread loci. To develop clinically applicable armed oncolyticHSV-1 vectors, it is crucial to use an efficacious and safebackbone HSV-1 vector with a large therapeutic window, such asG47D, especially because the transgene expression may result inincreased toxicity.A series of armed oncolytic HSV-1 vectors may be developed not

only to improve the efficacy but also to cope with a wide variation

Table 1. The replication capability and transgene expression of constructed armed oncolytic HSV-1 vectors in Vero cells (A)and mouse tumor cells (B)

(A)

Virus Virus yields (pfu) mIL-18 (pg/mL) B7-1-Ig expression

G47D 2.0 � 107 (�)G47D-empty.1 7.5 � 106 (�)

G47D-empty.2 6.1 � 106 (�)

G47D-empty.3 6.3 � 106 (�)

G47D-empty.4 7.2 � 106 (�)G47D-IL18/B7.1 7.6 � 106 1,002 (+)

G47D-IL18/B7.2 4.4 � 106 818 (+)

G47D-IL18/B7.3 8.3 � 106 986 (+)

G47D-IL18/B7.4 5.7 � 106 338 (+)G47D-mIL-18.1 1.3 � 107 1,418

G47D-mIL-18.2 3.2 � 106 730

G47D-mIL-18.3 9.6 � 106 1,710G47D-mIL-18.4 7.6 � 106 994

G47D-B7-1-Ig.1 1.6 � 107 (+)

G47D-B7-1-Ig.2 3.9 � 106 (+)

G47D-B7-1-Ig.3 1.2 � 107 (+)G47D-B7-1-Ig.4 5.8 � 107 (+)

(B)

Virus and cells mIL-18 (pg/mL) B7-1-Ig expression

G47D-IL18/B7 in Neuro2a 538 (+)

G47D-IL18/B7 in Pr14-2 572 (+)

G47D-IL18/B7 in TRAMP-C2 806 (+)G47D-mIL-18 in Neuro2a 483 (�)

G47D-mIL-18 in Pr14-2 658 (�)

G47D-mIL-18 in TRAMP-C2 673 (�)

Cancer Research

Cancer Res 2005; 65: (23). December 1, 2005 10666 www.aacrjournals.org

Research. on October 1, 2020. © 2005 American Association for Cancercancerres.aacrjournals.org Downloaded from

of cancer types, progression stages, or routes of administration.We believe our system facilitates the progress of such cancertherapeutics development.

AcknowledgmentsReceived 7/20/2005; accepted 9/29/2005.

Grant support: James S. McDonnell Foundation Brain Cancer Program, theMassachusetts General Hospital/Giovanni Armenise Neuro-Oncology and Related

Disorders Grants Program, and the Ministry of Education, Culture, Sports, Scienceand Technology of Japan (T. Todo); NIH grants R01 NS032677 and R01 CA102139(R.L. Martuza); and Uehara Memorial Foundation postdoctoral fellowship(H. Fukuhara).

The costs of publication of this article were defrayed in part by the payment of pagecharges. This article must therefore be hereby marked advertisement in accordancewith 18 U.S.C. Section 1734 solely to indicate this fact.

We thank Drs. Yoshinaga Saeki, Samuel D. Rabkin, and E. Antonio Chiocca for theirhelpful advice, Miyuki Hikasa for technical assistance, and Dr. Isao Hara for providingmurine IL-18 cDNA.

Figure 3. The efficacy of armed oncolytic HSV-1 vectors (G47D-transgene). A, cytopathic effect of the recombinant oncolytic HSV-1 vectors in vitro .TRAMP-C2 or Neuro2a cells were plated into six-well plates at 2 � 105 per well. After a 24-hour incubation, cells were infected with G47D, G47D-empty, G47D-mIL-18,G47D-B7-1-Ig, or G47D-IL18/B7 at an MOI of 0.1 or without virus (Control ). The number of surviving cells was counted daily and expressed as a percentage ofmock-infected controls. Points, mean of triplicates; bars, SD. B, in vivo efficacy of armed oncolytic HSV-1 vectors in male C57BL/6 mice harboring TRAMP-C2mouse prostate cancer (n = 6 per group). When established s.c. tumors in the left flank reached f6 mm in diameter, mock, G47D, G47D-empty, G47D-mIL-18,G47D-B7-1-Ig, or G47D-IL18/B7 (5 � 106 pfu) was inoculated into the tumor on days 0 and 3. The G47D-IL18/B7 treatment showed the greatest efficacy, resulting in asignificantly smaller tumor size than the treatment with G47D-mIL-18 or G47D-B7-1-Ig (P < 0.05 versus G47D-mIL-18 on days 19 and 23 and versus G47D-B7-1-Igon days 23 and 26). C, in vivo efficacy of armed oncolytic HSV-1 vectors in female A/J mice harboring s.c. Neuro2a mouse neuroblastoma (n = 6 per group).Animals were treated in the same manner as above (5 � 105 pfu). Only the G47D-IL18/B7 treatment was significantly more efficacious than G47D and G47D-empty(P < 0.05 on day 17). Tumor volume = length � width � height (mm). Bars, SE.

References

1. Markert JM, Medlock MD, Rabkin SD, et al. Condi-tionally replicating herpes simplex virus mutant, G207for the treatment of malignant glioma: results of a phaseI trial. Gene Ther 2000;7:867–74.

2. Mineta T, Rabkin SD, Yazaki T, Hunter WD, MartuzaRL. Attenuated multi-mutated herpes simplex virus-1

for the treatment of malignant gliomas. Nat Med 1995;1:938–43.

3. Todo T, Martuza RL, Rabkin SD, Johnson PA. Oncolyticherpes simplex virus vector with enhanced MHC class Ipresentation and tumor cell killing. Proc Natl Acad SciU S A 2001;98:6396–401.

4. Todo T, Rabkin SD, Sundaresan P, et al. Systemicantitumor immunity in experimental brain tumor

therapy using a multimutated, replication-competentherpes simplex virus. Hum Gene Ther 1999;10:2741–55.

5. Todo T, Martuza RL, Dallman MJ, Rabkin SD. In situexpression of soluble B7–1 in the context of oncolyticherpes simplex virus induces potent antitumor immu-nity. Cancer Res 2001;61:153–61.

6. Saeki Y, Breakefield XO, Chiocca EA. Improved HSV-1

Oncolytic HSV Double-Armed with IL-18 and Soluble B7-1

www.aacrjournals.org 10667 Cancer Res 2005; 65: (23). December 1, 2005

Research. on October 1, 2020. © 2005 American Association for Cancercancerres.aacrjournals.org Downloaded from

Cancer Research

Cancer Res 2005; 65: (23). December 1, 2005 10668 www.aacrjournals.org

amplicon packaging system using ICP27-deleted,oversized HSV-1 BAC DNA. Methods Mol Med 2003;76:51–60.

7. Saeki Y, Ichikawa T, Saeki A, et al. Herpes simplex virustype 1 DNA amplified as bacterial artificial chromosomein Escherichia coli : rescue of replication-competentvirus progeny and packaging of amplicon vectors.Hum Gene Ther 1998;9:2787–94.

8. Stavropoulos TA, Strathdee CA. An enhanced packag-ing system for helper-dependent herpes simplex virusvectors. J Virol 1998;72:7137–43.

9. Horsburgh BC, Hubinette MM, Qiang D, MacDonaldML, Tufaro F. Allele replacement: an application thatpermits rapid manipulation of herpes simplex virus type1 genomes. Gene Ther 1999;6:922–30.

10. Suter M, Lew AM, Grob P, et al. BAC-VAC, a novelgeneration of (DNA) vaccines: a bacterial artificialchromosome (BAC) containing a replication-competent,packaging-defective virus genome induces protective

immunity against herpes simplex virus 1. Proc Natl AcadSci U S A 1999;96:12697–702.

11. Kambara H, Okano H, Chiocca EA, Saeki Y. Anoncolytic HSV-1 mutant expressing ICP34.5 undercontrol of a nestin promoter increases survival ofanimals even when symptomatic from a brain tumor.Cancer Res 2005;65:2832–9.

12. Bennett JJ, Malhotra S, Wong RJ, et al. Interleukin 12secretion enhances antitumor efficacy of oncolyticherpes simplex viral therapy for colorectal cancer. AnnSurg 2001;233:819–26.

13. Liu BL, Robinson M, Han ZQ, et al. ICP34.5 deletedherpes simplex virus with enhanced oncolytic, immunestimulating, and anti-tumour properties. Gene Ther2003;10:292–303.

14. Hara S, Nagai H, Miyake H, et al. Secreted type ofmodified interleukin-18 gene transduced into mouserenal cell carcinoma cells induces systemic tumorimmunity. J Urol 2001;165:2039–43.

15. Logvinoff C, Epstein AL. A novel approach for herpessimplex virus type 1 amplicon vector production, usingthe Cre-loxP recombination system to remove helpervirus. Hum Gene Ther 2001;12:161–7.

16. Buchholz F, Angrand PO, Stewart AF. Improvedproperties of FLP recombinase evolved by cyclingmutagenesis. Nat Biotechnol 1998;16:657–62.

17. Umana P, Gerdes CA, Stone D, et al. Efficient FLPerecombinase enables scalable production of helper-dependent adenoviral vectors with negligible helper-virus contamination. Nat Biotechnol 2001;19:582–5.

18. Goto H, Yang B, Petersen D, et al. Transduction ofgreen fluorescent protein increased oxidative stress andenhanced sensitivity to cytotoxic drugs in neuroblasto-ma cell lines. Mol Cancer Ther 2003;2:911–7.

19. Gambotto A, Dworacki G, Cicinnati V, et al.Immunogenicity of enhanced green fluorescent protein(EGFP) in BALB/c mice: identification of an H2-Kd-restricted CTL epitope. Gene Ther 2000;7:2036–40.

Research. on October 1, 2020. © 2005 American Association for Cancercancerres.aacrjournals.org Downloaded from

2005;65:10663-10668. Cancer Res   Hiroshi Fukuhara, Yasushi Ino, Toshihiko Kuroda, et al.   System

Mediated−Constructed by Bacterial Artificial Chromosome Double-Armed with Interleukin 18 and Soluble B7-1

Triple Gene-Deleted Oncolytic Herpes Simplex Virus Vector

  Updated version

  http://cancerres.aacrjournals.org/content/65/23/10663

Access the most recent version of this article at:

  Material

Supplementary

  http://cancerres.aacrjournals.org/content/suppl/2005/11/28/65.23.10663.DC1

Access the most recent supplemental material at:

   

   

  Cited articles

  http://cancerres.aacrjournals.org/content/65/23/10663.full#ref-list-1

This article cites 19 articles, 6 of which you can access for free at:

  Citing articles

  http://cancerres.aacrjournals.org/content/65/23/10663.full#related-urls

This article has been cited by 5 HighWire-hosted articles. Access the articles at:

   

  E-mail alerts related to this article or journal.Sign up to receive free email-alerts

  Subscriptions

Reprints and

  .pubs@aacr.orgDepartment at

To order reprints of this article or to subscribe to the journal, contact the AACR Publications

  Permissions

  Rightslink site. (CCC)Click on "Request Permissions" which will take you to the Copyright Clearance Center's

.http://cancerres.aacrjournals.org/content/65/23/10663To request permission to re-use all or part of this article, use this link

Research. on October 1, 2020. © 2005 American Association for Cancercancerres.aacrjournals.org Downloaded from