25
Translation © 2007 Paul Billiet ODWS

Translation © 2007 Paul Billiet ODWSODWS. The tRNA molecule tRNA molecules do the final translating At one end the have a specific amino acid attached

Embed Size (px)

Citation preview

Page 1: Translation © 2007 Paul Billiet ODWSODWS. The tRNA molecule tRNA molecules do the final translating At one end the have a specific amino acid attached

Translation

© 2007 Paul Billiet ODWS

Page 2: Translation © 2007 Paul Billiet ODWSODWS. The tRNA molecule tRNA molecules do the final translating At one end the have a specific amino acid attached

The tRNA molecule tRNA molecules do the

final translating At one end the have a

specific amino acid attached by a tRNA activating enzymeThese enzymes do the first part of translating

At the other end they have an anticodon which is complementary to the mRNA codons © St Edward’s University: Dept Chemistry and Biochemistry

© 2007 Paul Billiet ODWS

Page 3: Translation © 2007 Paul Billiet ODWSODWS. The tRNA molecule tRNA molecules do the final translating At one end the have a specific amino acid attached

The 3-D structure of a tRNA

© ThinkQuest.org

Page 4: Translation © 2007 Paul Billiet ODWSODWS. The tRNA molecule tRNA molecules do the final translating At one end the have a specific amino acid attached

The genetic code

Made of 64 triplets of bases (codons)

© 2007 Paul Billiet ODWS

Page 5: Translation © 2007 Paul Billiet ODWSODWS. The tRNA molecule tRNA molecules do the final translating At one end the have a specific amino acid attached

1st position

2nd position 3rd position ↓

U C A G

U Phe Ser Tyr Cys U

Phe Ser Tyr Cys C

Leu Ser STOP STOP A

Leu Ser STOP Trp G

C Leu Pro His Arg U

Leu Pro His Arg C

Leu Pro Gln Arg A

Leu Pro Gln Arg G

A Ile Thr Asn Ser U

Ile Thr Asn Ser C

Ile Thr Lys Arg A

Met Thr Lys Arg G

G Val Ala Asp Gly U

Val Ala Asp Gly C

Val Ala Glu Gly A

Val Ala Glu Gly GAcidic Basic Uncharged Polar Non-polar

© 2007 Paul Billiet ODWS

Page 6: Translation © 2007 Paul Billiet ODWSODWS. The tRNA molecule tRNA molecules do the final translating At one end the have a specific amino acid attached

The degenerate genetic code

A few amino acids are coded for by a single codon

Most are coded for by more than one codon

Some are coded for by up to six codons This is degeneracy in the code

© 2007 Paul Billiet ODWS

Page 7: Translation © 2007 Paul Billiet ODWSODWS. The tRNA molecule tRNA molecules do the final translating At one end the have a specific amino acid attached

Grammar in the code?

Three codons are nonsense codons they represent the end of the information = STOP

The codon for methionine found at the beginning of the information to be transcribed it means START

The methionine amino acid is usually removed from the finished protein

© 2007 Paul Billiet ODWS

Page 8: Translation © 2007 Paul Billiet ODWSODWS. The tRNA molecule tRNA molecules do the final translating At one end the have a specific amino acid attached

1st position ↓

2nd position 3rd position ↓

U C A G

UPhe Ser Tyr Cys U

Phe Ser Tyr Cys C

Leu Ser STOP STOP A

Leu Ser STOP Trp G

CLeu Pro His Arg U

Leu Pro His Arg C

Leu Pro Gln Arg A

Leu Pro Gln Arg G

AIle Thr Asn Ser U

Ile Thr Asn Ser C

Ile Thr Lys Arg A

Met Thr Lys Arg G

GVal Ala Asp Gly U

Val Ala Asp Gly C

Val Ala Glu Gly A

Val Ala Glu Gly G© 2007 Paul Billiet ODWS

Page 9: Translation © 2007 Paul Billiet ODWSODWS. The tRNA molecule tRNA molecules do the final translating At one end the have a specific amino acid attached

Genetic code: characteristics

Only 61 triplets or codons code for amino acids

3 stop codons (aka nonsense codons or terminator codons) UUA UAG UGA

© 2007 Paul Billiet ODWS

Page 10: Translation © 2007 Paul Billiet ODWSODWS. The tRNA molecule tRNA molecules do the final translating At one end the have a specific amino acid attached

Codon Amino acid Codon Amino acid

UUU UUA

Phenylalanine Leucine

UUC UUG

Both pyrimidines

Both purines

The code is degenerative code Several codons code for the same amino acid

The first two letters seem to be the most important the third one tends to be interchangeable

© 2007 Paul Billiet ODWS

Page 11: Translation © 2007 Paul Billiet ODWSODWS. The tRNA molecule tRNA molecules do the final translating At one end the have a specific amino acid attached

Similar amino acids have similar codons

ExampleAspartic acid codons GAU and GACGlutamic acid codons GAA and GAG Both are acidic amino acids

© 2007 Paul Billiet ODWS

Page 12: Translation © 2007 Paul Billiet ODWSODWS. The tRNA molecule tRNA molecules do the final translating At one end the have a specific amino acid attached

Punctuation?

The is no punctuation between each codon

The reading frame is set at the beginning of the gene

Frame shift mutations can be caused by the ADDITION or DELETION of only one or two bases. Everything downstream is misread

© 2007 Paul Billiet ODWS

Page 13: Translation © 2007 Paul Billiet ODWSODWS. The tRNA molecule tRNA molecules do the final translating At one end the have a specific amino acid attached

Reading the code

The reading of mRNA is always in the same direction 5’ to 3’ (the same way as transcription and replication)

The polypeptide chain is constructed from the amino end to the carboxyl end

© 2007 Paul Billiet ODWS

Page 14: Translation © 2007 Paul Billiet ODWSODWS. The tRNA molecule tRNA molecules do the final translating At one end the have a specific amino acid attached

A universal code

The code is used by all organisms So it is very ancient Permits investigations into common

ancestry Permits genetically transformed organisms

© 2007 Paul Billiet ODWS

Page 15: Translation © 2007 Paul Billiet ODWSODWS. The tRNA molecule tRNA molecules do the final translating At one end the have a specific amino acid attached

20 is the limit

Some amino acids are chemically altered AFTER translation.

e.g. In collogen proline is converted to hydroxyproline

Therefore the total number of amino acids found in proteins is greater than 20 but the total used in translation is only 20

© 2007 Paul Billiet ODWS

Page 16: Translation © 2007 Paul Billiet ODWSODWS. The tRNA molecule tRNA molecules do the final translating At one end the have a specific amino acid attached

Translation plan

TRANSLATION

Polypeptide chain

Complete protein

Ribosomes

Stop codon Start codon

© 2007 Paul Billiet ODWS

Page 17: Translation © 2007 Paul Billiet ODWSODWS. The tRNA molecule tRNA molecules do the final translating At one end the have a specific amino acid attached

Translation1

AUGGGAUACACUUUUUGA

mRNARibosome

© 2007 Paul Billiet ODWS

Page 18: Translation © 2007 Paul Billiet ODWSODWS. The tRNA molecule tRNA molecules do the final translating At one end the have a specific amino acid attached

Translation 2

AUGGGAUACACUUUUUGA

met

UAC

tRNA

amino acid

anticodon

© 2007 Paul Billiet ODWS

Page 19: Translation © 2007 Paul Billiet ODWSODWS. The tRNA molecule tRNA molecules do the final translating At one end the have a specific amino acid attached

Translation 3

CCU

gly

AUGGGAUACACUUUUUGA

UAC

met

© 2007 Paul Billiet ODWS

Page 20: Translation © 2007 Paul Billiet ODWSODWS. The tRNA molecule tRNA molecules do the final translating At one end the have a specific amino acid attached

Translation 4

AUGGGAUACACUUUUUGA

CCU

gly

UAC

met

peptide bond

© 2007 Paul Billiet ODWS

Page 21: Translation © 2007 Paul Billiet ODWSODWS. The tRNA molecule tRNA molecules do the final translating At one end the have a specific amino acid attached

Translation 5

UAC

AUGGGAUACACUUUUUGA

CCU

glymet

AUG

tyr

© 2007 Paul Billiet ODWS

Page 22: Translation © 2007 Paul Billiet ODWSODWS. The tRNA molecule tRNA molecules do the final translating At one end the have a specific amino acid attached

Translation 6

AUGGGAUACACUUUUUGACCU AUG

glymet tyr

© 2007 Paul Billiet ODWS

Page 23: Translation © 2007 Paul Billiet ODWSODWS. The tRNA molecule tRNA molecules do the final translating At one end the have a specific amino acid attached

Translation 7

UGA

thr

CCU

AUGGGAUACACUUUUUGAAUG

glymet tyr

© 2007 Paul Billiet ODWS

Page 24: Translation © 2007 Paul Billiet ODWSODWS. The tRNA molecule tRNA molecules do the final translating At one end the have a specific amino acid attached

Translation 8

AAA

phe

AUGGGAUACACUUUUUGA

AUGUGA

glymet tyr thr

polypeptide chain

© 2007 Paul Billiet ODWS

Page 25: Translation © 2007 Paul Billiet ODWSODWS. The tRNA molecule tRNA molecules do the final translating At one end the have a specific amino acid attached

Translation: the sequence The tRNA molecules with the correct anticodons

are lined up with their bases complementary to the mRNA codons

Two tRNA molecules at a time can fit on the ribosome

A peptide bond forms between their amino acids

The first tRNA leaves the ribosome and mRNA move along to accept a new tRNA

The process of translation proceeds in the same direction as replication and transcription (5’ to 3’)

© 2007 Paul Billiet ODWS