Upload
jalil
View
214
Download
0
Embed Size (px)
Citation preview
Transdifferentiation of bone marrow stromal cellsinto cholinergic neuronal phenotype: a potential
source for cell therapy in spinal cord injury
Majid Naghdi1*, Taki Tiraihi1, Seyed Alireza Mesbah Namin2
and Jalil Arabkheradmand3
1Department of Anatomical Sciences, 2Department of Clinical Biochemistry, Tarbiat Modares University, Tehran, Iran,
and 3Neuroscience Center, Khatam Al- Anbia hospital, Tehran, Iran
Background aims
Cholinergic neurons are very important cells in spinal cord injuries
because of the deficits in motor, autonomic and sensory neurons. In this
study, bone marrow stromal cells (BMSC) were evaluated as a source
of cholinergic neurons in a rat model of contusive spinal cord injury.
Methods
BMSC were isolated from adult rats and transdifferentiated into
cholinergic neuronal cells. The BMSC were pre-induced with
b-mercaptoethanol (BME), while the induction was done with nerve
growth factor (NGF). Neurofilament (NF)-68, -160 and -200
immunostaining was used for evaluating the transdifferentiation of
BMSC into a neuronal phenotype. NeuroD expression, a marker for
neuroblast differentiation, and Oct-4 expression, a marker for stemness,
were evaluated by reverse transcriptase (RT)-polymerase chain
reaction (PCR). Choline acetyl transferase (ChAT) immunoreactivity
was used for assessing the cholinergic neuronal phenotype. Anti-
microtubule-associated protein-2 (MAP-2) and anti-synapsin
I antibodies were used as markers for the tendency for synptogenesis.
Finally, the induced cells were transplanted into the contused spinal
cord and locomotion was evaluated with the Basso-Beattie-Bresnahan
(BBB) test.
Results
At the induction stage, there was a decline in the expression of NF-68
associated with a sustained increase in the expression of NF-200,
NF-160, ChAT and synapsin I, whereas MAP-2 expression was
variable. Transplanted cells were detected 6 weeks after their injection
intraspinally and were associated with functional recovery.
Conclusions
The transdifferentiation of BMSC into a cholinergic phenotype is
feasible for replacement therapy in spinal cord injury.
Keywords
Bone marrow stromal cells, cholinergic neurons, regeneration, spinal
cord injury, transplantation.
IntroductionCholine acetyltransferase (ChAT) immunoreactive neu-
rons have been evaluated in the postnatal life of rats,
where ChAT-immunoreactive neurons were subdivided
into two main types: somatic motoneurons and sympa-
thetic pre-ganglionic cells. Small ChAT-immunoreactive
neurons were also noticed around the central canal,
while immunoreactive neurons were detected at birth in
the laminae of the dorsal horn. Each type of ChAT-
immunoreactive neurons was reported to achieve adult
levels of staining intensity at different times during
development [1]. In adult rats, ChAT-immunoreactive
motoneurons are located in the medial, central and
lateral motor columns of the ventral horn; small ChAT-
immunoreactive neurons are clustered around the central
canal at the central gray matter, whereas intermediate
Correspondence to: Taki Tiraihi, Department of Anatomical Sciences, School of Medical Sciences, Tarbiat Modares University, PO Box 14155-
4838, Tehran, Iran. E-mail: [email protected], [email protected]
*Present address: Shiraz University of Medical Sciences (SUMS), Namazi Hospital.
Cytotherapy (2009) Vol. 11, No. 2, 137�152
– 2009 ISCT DOI: 10.1080/14653240802716582
gray matter consists of partition neurons, which are
medium to large ChAT-immunoreactive multipolar cells.
At autonomic spinal levels, ChAT-immunoreactive pre-
ganglionic sympathetic or parasympathetic neurons are
intermingled with extensions of the partition neurons.
Moreover, ChAT-immunoreactive neurons have been
noticed in the dorsal horn [2].
The spinal cord contusion model in rats has been
documented as a useful model for human spinal cord
injury, from functional, electrophysiologic and high-
resolution magnetic resonance imaging aspects [3], as
well as histology [4,5]. While cell death has been
reported in spinal motoneurons following the spinal
cord contusion model in rats, dysfunction of the choli-
nergic neurons of the autonomic nervous system with
blood pressure dysregulation, disorders in voiding, defe-
cation and reproduction have also been documented
[6,7]. These problems are caused by the destruction of
brain pathways that control spinal autonomic neurons
lying caudal to the lesion [8], resulting in loss of pre-
ganglionic neurons [9] with progressive retrograde death
[10].
Cell-based therapy for neurologic diseases with neu-
ronal loss has been carried out in different animal models
[11]. Several sources of cells have been suggested for this
modality of treatment, including embryonic stem cells
and adult stem cells, which hold tremendous promise for
replacement therapy for a variety of neurodegenerative
diseases [12]. Webber & Minger [13] revealed the possible
differentiation of stem cells into a wide range of cell
types, making stem cells a valuable source for cell-based
replacement therapy. For example, regarding Parkinson’s
disease, dopaminergic neurons derived from stem cells
resulted in improvement in diseased animals [14]. The
differentiation of spinal neural progenitors into a choli-
nergic phenotype has been documented, and the survival
of transplanted progenitor cells in the host tissue reported
[15]. Human fetal neural stem cells have also improved
behavioral test in rats with spinal cord injury [16];
moreover, cholinergic neurons derived from human
neural stem cells innervated the muscle of motoneuron-
deficient rats [17]. However, we have found no report
regarding transdifferentiation of bone marrow stromal
cells (BMSC) into a cholinergic phenotype.
The purpose of this study was to develop a protocol for
transdifferentiating BMSC into cholinergic neurons and
evaluate the functional recovery of animals treated with
the transdifferentiated cells.
MethodsCell preparation and cell characterization
The femurs and tibias from 6�8-week-old Sprague�Dawleyrats were removed and dissected. The proximal and distal
ends were cut, and the bone marrow (BM) flushed out with
5 mL alpha-modified Eagle medium (aMEM; Gibco,
Paisley, UK) supplemented with 10% fetal bovine serum
(FBS; Gibco). The whole marrow cells were cultured for 24
h in aMEM medium supplemented with 10% FBS as well
as penicillin and streptomycin (Gibco), then the non-
adherent cells were removed and washed with phosphate-
buffered saline (PBS). As confluency of the cells reached
about 80%, the cells were detached with a 0.25% trypsin,
0.04% EDTA solution and reseeded (at a density of 8000
cells/cm2) in plastic flasks. Anti-fibronectin antibody (Ab)
was used for characterizing the BMSC [18]. The cells were
split 1:3 and passaged up to five times for subsequent
experiments, and the culture medium was changed every
other day until the cells became confluent. The viability of
the cultured cells, which was about 95%, was assessed
before seeding.
Cell transdifferentiation
A two-stage induction protocol (1/6), where the initial
stage (pre-induction, 1 day) proceeded to the next stage
(induction, 6 days), was used. In order to select an optimal
pre-induction method, two pre-inducers were examined:
b-mercaptoethanol (BME) and dimethyl sulfoxide
(DMSO). The selection of the pre-inducer was based on
the results of the expression of four sets of genes. The first set
was Oct-4 gene, a stemness marker, which was detected by
reverse transcriptase�polymerase chain reaction (RT-PCR).
The second set was the neuronal differentiation genes,
including neurofilament (NF)-68, NF-160 and NF-200,
which were detected by immunocytochemistry. NeuroD
gene was evaluated by RT-PCR. The third set was synap-
togenesis genes, includingmicrotubule-associated protein-2
(MAP-2) and synapsin I, which were detected by immuno-
cytochemistry. The fourth set was the cholinergic neuron
marker (ChAT), which was detected by immunocytochem-
istry as well. The culturing medium was changed with
serum-free media containing either 1 mM BME or 2%
DMSO,whichwere incubated for 24 h. Based on the findings
138 M. Naghdi et al.
of the markers, BMEwas selected as an optimal pre-inducer.
For the pre-induction stage, the cells were treated with
aMEM medium containing 1 mM BME (Sigma, St Louis,
MO, USA) for 24 h. For the induction stage, nerve growth
factor (NGF) (100 ng/mL) was used as cholinergic neuron
inducer, and the cells were incubated for 6 days.
Two negative controls were included in the study. The
first control was uninduced BMSC, which were used
without pre-induction and induction. The second control
consisted of BMSC treated with BME for 7 days. All the
proneural, neural, synaptic and cholinergic markers were
checked in this group at days 1 and 7.
Immunocytochemistry
For all immunocytochemical staining, a negative control
was used by staining with secondary Ab only. The
immunocytochemical evaluation was done at the following
time-points: before pre-induction, pre-induction (day 1)
Figure 1. A phase-contrast photomicrograph of culture BMSC. (A) Primary culture of BMSC (scale bar 100 mM); (B) cultured BMSC after 5
passages (scale bar 50 mM); (C) pre-induced BMSC with BME (scale bar 30 mM); (D) pre-induced BMSC with DMSO (scale bar 30 mM).
Table I. The means and SEM of the percentages of immunoreactive cells stained with different markers, showing the
following time-points: after pre-induction with BME (day 1) and induction with NGF (days 3, 5 and 7)
Marker Day 1 Day 3 Day 5 Day 7
NF-68 81.9891.63 58.7291.48 34.0292.1 11.0299.69
NF-160 58.8091.77 73.3891.57 81.4691.81 85.7492.09
NF-200 15.7291.01 22.4691.2 46.8491.24 55.4090.52
MAP-2 70.6095.56 65.4893.01 8.6890.80 84.1092.55
Synapsin I 21.6292.29 26.3891.82 49.2892.61 79.8494.60
ChAT 4.6690.7827 41.6490.12 75.1891.28 81.7491.52
There were statistically significant differences between the means of the percentages of immunoreactive cells except in the following comparisons: at day 1, when
ChAT was compared with NF-200 and MAP-2 compared with NF-68; at day 3, synapsin with NF-200; at day 5, ChAT with MAP-2 and NF-160, MAP-2
with NF-160, and synapsin with NF-200; and at day 7, ChAT with MAP-2, synapsin and NF-160, MAP-2 with synapsin, and NF-160, NF-68 and
synapsin with NF-160. Also in the following comparisons: when ChAT at day 5 was compared with ChAT of day 7; MAP-2 at day 1 with MAP-2 at days 3
and 5; MAP-2 at day 5 with MAP-2 at day 7; NF-200 at day 1 with NF-200 at days 3 and 7; NF-160 at day 3 with NF-160 at days 5 and 7; and synapsin
at day 3 with synapsin at day 1.
Differentiation of marrow stromal cells into cholinergic neurons 139
and induction (days 3, 5 and 7 of the experiment). The
counting was done at 200�magnification by using a
random table for selecting the fields; a total of 200 cells
was counted and the percentage of immunoreactive cells
estimated. A Zeiss Axiophot (Oberkochen, Germany) with
Intervideo WinDVR3 software was used. Cells located at
the upper and left sides of the selected fields were
excluded from the counting.
Characterization of BMSC
The cells were washed with PBS three times, fixed with
acetone for 15 min and washed with PBS again. The cells
Figure 3. A photomicrograph of immunocytochemistry for the negative control stained with rabbit anti-mouse secondary Ab conjugated with FITC
and counterstained with ethidium bromide (left panel); the right represents the phase contrast (scale bar 20 mM).
Figure 2. (A) A photomicrograph of immunohistochemistry for fibronectin used for characterizing the BMSC before pre-induction at the fifth
passage, immunostained with anti-fibronectin Ab (primary Ab) followed by incubation with FITC-conjugated secondary Ab and counterstained with
ethidium bromide. (B) A phase-contrast of the same image (scale bar 20 mM). (C) After 7 days pre-induction (1 day) and induction (6 days), the
cells showed negative immunoreactivity to anti-fibronectin Ab; (D) phase-contrast of the same image (scale bar 20 mM).
140 M. Naghdi et al.
were treated with 0.3% Triton X-100 for 1 h, and the non-
specific Ab reaction was blocked with 10% normal goat
serum for 30 min at room temperature (RT). This was
followed by incubation with monoclonal mouse anti-
fibronectin Ab (Chemicon, International, Temecula, CA,
USA) for 2 h (1:300 dilution) and anti-mouse fluorescein
isothiocyanate (FITC)-conjugated Ab (Chemicon) for 1 h
(1:100 dilution) at RT. The labeled cells were visualized
using a fluorescence microscope and photographed digi-
tally (Zeiss Axiophot).
Neuronal differentiation marker
In order to evaluate neurofilament immunoreactivity, pre-
induced cells were fixed with 4% paraformaldehyde
(Merck, Damstadt, Germany) and immunocytochemistry
carried out according to the above-mentioned method,
with a monoclonal mouse anti-NF-200 Ab (1:400 dilution;
Chemicon), a monoclonal mouse anti-NF-160 Ab (dilu-
tion 1:300; Chemicon) and a monoclonal mouse anti-NF-
68 Ab (dilution 1:300; Chemicon). This was followed by
incubation with a secondary Ab, anti-mouse FITC-con-
jugated Ab (dilution 1:100; Chemicon) for 1 h at RT.
Synaptogenesis gene expression
Synaptogenesis gene expression included MAP-2 and
synapsin I, which were evaluated using polyclonal rabbit
anti-MAP-2 (dilution 1:500; Chemicon) and polyclonal
rabbit anti-synapsin I (dilution 1:400; Chemicon) as
primary Ab, followed by secondary anti-rabbit FITC-
conjugated Ab (dilution 1:100; Chemicon) for 1 h at RT.
Each experiment was replicated at least five times in order
to ensure reproducibility.
Neuronal type marker
The cholinergic neuron marker was ChAT. This was
evaluated using a monoclonal mouse anti-ChAT Ab
(dilution 1:300; Chemicon) and followed by incubation
with a secondary anti-mouse FITC conjugated Ab (dilu-
tion 1:100; Chemicon) for 1 h at RT.
RT-PCR
Expression of the following genes was included in the
study: Oct-4 (accession number NM-001009178), a marker
for BMSC stemness, using AAGCTGCTGAAACAGAAG
AGG as a forward primer and ACACGGTTCTCAATGC
TAGTC as a reverse primer; NeuroD (accession number
XM-341822), a neuroblast marker, using AAGCACCAGA
TGGCACTGTC as a forward primer and CAGGACTT
GCATTCGATACAC as a reverse primer; and b2-micro-
globulin (accession number NM-012512), an internal
control, using CCGTGATCTTTCTGGTGCTT as a
forward primer and TTTTGGGCTCCTTCAGAGTG
as a reverse primer.
The total RNA was extracted using an RNX plusTM
kit according to the manufacturer’s recommendations
(Cinnagen, Tehran, Iran). Briefly, 1 mL RNX plus was
added to a tube containing 1�2 million homogenized
cells, and the mixture incubated at RT for 5 min.
Figure 4. A histogram showing the effect of the pre-inducers BME (white columns) and DMSO (black columns) on BMSC, with the percentages of
NF-68, NF-160, NF-200, ChAT, MAP-2 and synapsin I immunoreactive cells. The results show no statistical differences in the mean percentages
of NF-160 and NF-200 immunoreactive cells, while the percentage of NF-68 immunoreactive cells pre-induced with BME was significantly higher
than that of DMSO. Accordingly, the expressions of ChAT, MAP-2 and synapsin I were higher in the BME-treated BMSC. The statistical
analysis showed that there were no statistical differences in the means of the percentages of immunoreactive cells in ChAT, NF-160 and NF-200.
The means of the percentages of immunoreactive cells in MAP-2, synapsin I and NF-68 were significantly higher in BME than in DMSO,
represented by an asterisk.
Differentiation of marrow stromal cells into cholinergic neurons 141
Chloroform was added to the solution and centrifuged
for 15 min at 12 000 g. The upper phase was then
transferred to another tube and an equal volume of
isopropanol was added. The mixture was centrifuged for
15 min at 12 000 g and the resulting pellet washed in
70% ethanol and dissolved in diethyl pyrocarbonate
(DEPC)-treated water. The purity and integrity of the
extracted RNA were evaluated by optical density
measurements (260/280 nm ratio) and examined using
electrophoresis on an agarose gel.
Figure 5. Photomicrographs of immunocytochemistry for the neurofilaments used for characterizing the transdifferentiated BMSC at day 1 after
pre-induction with BME. The right panels represent the phase-contrast of the immunostained cells. (A) Immunostained cells with anti-NF-68 Ab,
which reacted with FITC-conjugated secondary Ab (counterstained with ethidium bromide); (B) phase-contrast of the same image (scale bar 50
mM). (C) Immunostained cells with anti-NF-160 Ab, which reacted with FITC-conjugated secondary Ab (counterstained with ethidium bromide);
(D) phase-contrast of the same image (scale bar 50 mM). (E) Immunostained cells with anti-NF-200 Ab, which reacted with FITC-conjugated
secondary Ab (counter stained with ethidium bromide); (F) phase-contrast of the same image (scale bar 50 mM).
142 M. Naghdi et al.
One microgram of the total RNAwas used as a template
in a 20-mL volume cDNA synthesis reaction containing
0.5 mg oligodT(18). This solution was first denaturated at
708C for 5 min and chilled on ice immediately. Then a
mixture of 20 U ribonuclease inhibitor, 1 mM dNTPs, 5�buffer supplied by the manufacturer and deionized water
Figure 6. Photomicrographs of immunocytochemistry for the other markers used for characterizing the transdifferentiated BMSC at day 1 after
pre-induction with BME. The right panels represent the phase-contrast of the immunostained cells. (A) Immunostained cells with anti-synapsin I
Ab, which reacted with FITC-conjugated secondary Ab (counterstained with ethidium bromide); (B) phase-contrast of the same image (scale bar 50
mM). (C) Immunostained cells with anti-MAP-2 Ab, which reacted with FITC-conjugated secondary Ab (counterstained with ethidium bromide);
(D) phase-contrast of the same image (scale bar 10 mM). (E) Immunostained cells with anti-ChAT Ab, which reacted with FITC-conjugated
secondary Ab (counterstained with ethidium bromide); (f) phase-contrast of the same image (scale bar 50 mM).
Differentiation of marrow stromal cells into cholinergic neurons 143
(nuclease free) up to 19 mLwas added and the new mixture
incubated at 378C for 5 min; 200 U RevertAidTM M-MuLV
reverse transcriptase (Fermentas, Graiciuno, Lithuania) was
added to the reaction and the tube incubated in a
thermocycler (BIO RAD, Hercules, CA, USA) at 428C for
60 min and 708C for 10 min.
PCR was performed using 2 mL synthesized cDNA
with 1.25 U Taq polymerase (Cinnagen), 1.5 mM MgCl2,
Figure 7. Photomicrographs of immunohistochemistry for the neurofilaments used for characterizing the transdifferentiated BMSC at day 7 (the
end of induction). The right panels represent the phase-contrast of the immunostained cells. (A) Immunostained cells with anti-NF-68 Ab, which
reacted with FITC-conjugated secondary Ab (counterstained with ethidium bromide); (B) phase-contrast of the same image (scale bar 50 mM). (C)
Immunostained cells with anti-NF-160 Ab, which reacted with FITC-conjugated secondary Ab (counterstained with ethidium bromide), note
neurite extensions can be seen; (D) phase-contrast of the same image (scale bar 50 mM). (E) Immunostained cells with anti-NF-200 Ab, which
reacted with FITC-conjugated secondary Ab (counterstained with ethidium bromide); (F) phase-contrast of the same image (scale bar 50 mM).
144 M. Naghdi et al.
200 mM dNTPs, 1 mM of each primer, 10� buffer
supplied by the company and deionized distilled water in
a 50-mL total reaction volume. All common components
were added into the master mix and then aliquoted into
tubes. The cycling conditions were as follows: initial
denaturation at 948C for 5 min, followed by 35 cycles at
948C for 30 s, 56�588C (depending on the primers)
for 30 s, 728C for 45 s and a final extension of 728C for
5 min.
Each experiment was repeated at least three times in
order to ensure reproducibility.
The size of the digested products was checked with
1.5% agarose gel electrophoresis.
A semi-quantitative analysis was done using UVI Tech
software, where the ratio of band density of NeuroD to that
of b2-microglobulin for assessing NeuroD gene expression
was calculated.
The control in Oct-4 was undifferentiated BMSC. Two
controls were included for NeuroD: undifferentiated
BMSC and embryonic rat spinal cord.
Cell selection for transplantation
Data were obtained from the time�course using immuno-
cytochemical and RT-PCR studies, and cells at day 3 of
the experiment (the cells were pre-induced with BME for
1 day and induced with NGF for 2 days) were selected for
transplantation.
Cell labeling
Cells were labeled with bromodeoxyuridine (BrdU) by
adding 0.1 mM BrdU (Sigma) into the culture medium
before pre-induction (48�72 h), then were pre-induced for
1 day and induced for 2 days. The incorporation of BrdU
was confirmed by immunocytochemistry [19].
Animals
Adult female Sprague�Dawley rats (230�250 g) were
purchased from the Razi Institute, Tehran, Iran. Spinal
cord contusion was done using the New York Weighting
drop device (NYW) [20]. Briefly, the animals were
anesthetized with ketamine (80 mg/kg) and xylazine
(10 mg/kg) and a laminectomy carried out at T13. With
this method, the vertebral column is stabilized prior to the
injury. A 10-g weight rod, 2.5 mm in diameter, is dropped
from a height of 2.5 cm onto the dura matter of the spinal
cord. After injury, the muscle was sutured over the
laminectomy site and the skin closed. Post-operatively,
the rats received a 5-mL injection of Ringer lactate
subcutaneously and injections of ceftazoline (50 mg/kg)
twice a day for 3 days, and Tramadol (20 mg) intramuscu-
larly for 2 days.
Four groups of rats were included in the study: sham
operated (SO); untreated controls injected with normal
saline (NS) (9 mL: 3 mL at the epicenter, 3 mL above and 3
mL below the epicenter); undifferentiated BMSC (UB)
(300 000 cells in 9 mL: 100 000 in 3 mL at the epicenter,
100 000 in 3 mL above and 100 000 in 3 mL below the
epicenter); and transdifferentiated cholinergic-like neu-
rons (TC) (300 000 cells in 9 mL: 100 000 in 3 mL at the
epicenter, 100 000 in 3 mL above and 100 000 in 3 mL below
the epicenter). Seven days after laminectomy in NS and
contusion injury in UB and TC, the rats were anesthetized
and the surgical site re-opened for relevant treatment. The
Figure 8. An electrophorogram showing the expression of Oct-4 gene
(upper panel) in the untreated BMSC, C. The BMSC were pre-
induced with BME for 24 h, Pr, and then induced with NGF for 3, 5
and 7 days, I3, I5 and I7, respectively. L represents the DNA ladder. O
and M represent Oct-4 and b2-microglobulin bands, respectively. The
lower panel shows an electrophorogram of the expression of NeuroD
gene in untreated BMSC, C. BMSC were pre-induced with BME for
24 h, Pr, then induced with NGF for 3, 5 and 7 days, I3, I5 and I7,
respectively. S represents the expression profile of NeuroD in the
embryonic spinal cord as a positive control. L represents the DNA
ladder. N and M represent NeuroD and b2-microglobulin bands,
respectively.
Differentiation of marrow stromal cells into cholinergic neurons 145
wounds of the animals were closed and the animals
maintained for 6 weeks. A BBB behavioral test was carried
out before the experiment and weekly during the experi-
ment. The wounds in the SO group were re-opened and
sutured. Statistical analysis was done using one-way
analysis of variance (ANOVA) and Tukey’s test post-hoc.
A one-sample Kolmogorov�Smirnov test was used to
evaluate the normality of the data.
Figure 9. Photomicrographs of immunohistochemistry for ChAT, MAP-2 and synapsin I, used for characterizing the transdifferentiated BMSC
day 7 (the end of induction). (A) Immunostained cells with anti-ChAT Ab, which reacted with FITC-conjugated secondary Ab (counterstained with
ethidium bromide), note neurite extensions can be seen; (B) phase-contrast of the same image (scale bar 20 mM). (C) Immunostained cells with anti-
MAP-2 Ab, which reacted with FITC-conjugated secondary Ab (counterstained with ethidium bromide); (D) phase-contrast of the same image
(scale bar 20 mM). (E) Immunostained cells with anti-synapsin I Ab, which reacted with FITC-conjugated secondary Ab (counterstained with
ethidium bromide), note neurite extensions can be seen; (F) phase-contrast of the same image (scale bar 20 mM).
146 M. Naghdi et al.
ResultsResults of in vitro study
The viability of the BMSC isolated from the rat femurs
was 95%; after five passages of BMSC, 95% of the
subcultured cells (Figure 1) were immunoreactive for
fibronectin (Figure 2). The negative control for immuno-
cytochemical staining is presented in Figure 3; the
cultured cells were stained with a secondary Ab conjugated
with FITC and counterstained with ethidium bromide and
the image showed no autofluoresence or non-specific
staining. The BMSC untreated control showed no im-
munoreactive cells for all the markers used in the
immunostaining. The data obtained from the other
negative control group (BMSC treated with BME for
7 days) showed no immunoreactivity to ChAT, synapsin I,
MAP-2, NF-160 and NF-200, while only 2% of the cells
showed immunoreactivity for NF-68. However, the viabi-
lity of the cells in this control was low (50%).
The immunocytochemistry of BMSC transdifferentia-
tion into neuronal-like cells was assessed with NF-200,
NF-160 and NF-68, which were used as neuronal markers.
MAP-2 and synapse I were used as synaptogenesis
markers, while ChAT was the cholinergic neuron marker.
Another set of genes was used as markers for BMSC
conversion into neuronal phenotype, including Oct-4
(BMSC stemness) and NeuroD (neuroblast marker) in
both the pre-induction and induction stages.
Pre-induction stage
Figure 4 shows a comparative study between the two pre-
inducers BME and DMSO. At the pre-induction stage, the
mean percentage of immunoreactive cells (MPIC) of
different markers, including NF-68, NF-160, NF-200,
ChAT, MAP-2 and synapsin I, was evaluated. The MPIC
of NF-160 and NF-200 showed no significant differences
between BME and DMSO, while ChAT showed significant
differences between them. Other markers, including
MAP-2 and synapsin I as well as NF-68, showed
significant statistical differences between the two pre-
inducers. The immunocytochemical staining of these
markers using BME as pre-inducer is presented in Figures
5 and 6.
Induction stage
A time�course (1, 3, 5 and 7 days) was applied in order to
evaluate the induction with NGF (time-points at days 3, 5
and 7) following pre-induction with BME (time-point at
day 1). Statistical analysis of the different time-points of
the differentiation showed normality of data. Table I shows
the means and standard error of the means (SEM) of the
percentages of the immunoreactive cells for NF-200, NF-
160, NF-68, ChAT, MAP-2 and synapsin I. The table
shows the means and SEM of each of the above markers. A
sustained increase was noticed in the expression of NF-
200, NF-160, ChAT and synapsin I, but the level of NF-68
decreased while the level of MAP-2 expression was
variable. The neuronal differentiation markers (NF-68,
NF-160 and NF-200) showed significant differences
except when NF-68 at day 1 was compared with NF-160
at days 5 and 7, NF-68 at day 3 with NF-200 at day 7 and
NF-160 at day 1, and NF-68 at day 7 with NF-200 at day
1. The percentages of the immunoreactive cells to synapsin
I at day 3 showed no significant difference from that of
day 1, while comparisons of synapsin I immunostaining at
other time-points were significant. Accordingly, MAP-2 at
day 1 showed no significant difference with days 3 and 5,
nor day 5 with day 7. On the other hand, comparisons
of time-points of MAP-2 with synapsin I was significant
except for synapsin I at day 7 with MAP-2 at days 1, 5
and 7. Comparisons of different time-points of ChAT
showed significant differences except for time-point day 5
with day 7.
Figure 7 represents the immunoreactivity of markers for
BMSC pre-induced with BME and induced with NGF.
Figure 8 demonstrates the electrophoresis of Oct-4 and
NeuroD in the untreated, pre-induced and induced
Figure 10. A photomicrograph of an animal subjected to contusion
injury using the NYW technique, which shows a cavity, C, in the
spinal cord at the epicenter 4 weeks after injury (scale bar 225 mM).
Differentiation of marrow stromal cells into cholinergic neurons 147
BMSC. Expression of cells induced with NGF was
analyzed at days 3, 5 and 7. Semi-quantitative NeuroD
expression was assessed using densitometry of the electro-
phoresis NeuroD expression band. The mean ratio of
NeuroD band density to that of b2-microglobulin (NDRB)
was obtained at days 3, 5 and 7. At day 1 using BME only
as pre-inducer (negative control), NDRB was 1.290.4, at
day 3 (pre-induction 1 day and induction for 2 days) it was
1.190.2, at day 5 (pre-induction 1 day and induction for 4
days) it was 0.990.1, and at day 7 (pre-induction 1 day and
induction for 6 days) it was 0.790.3. The results of the
time�course showed that there was a general declining
trend in NeuroD expression that was not statistically
significant. The immunoreactivity of the induced cells to
ChAT, MAP-2 and synapsin I is presented in Figure 9.
Result of the animal model
Figure 10 shows the post-injury cavitation in the spinal
cord, and the immunoreactive cells for BrdU-labeled
cholinergic-like neurons transplanted in a rat with a
contusive spinal cord are shown in Figure 12. The
histogram represents the results of the BBB scores in the
groups used in the study, including NS, UB and TC, which
showed significantly lower scores than those of SO. The
Figure 12. A histogram showing the BBB scores of the animal groups used in the study: the sham-operated group (SO) is shown by the white
column; the untreated control group injected with normal saline (NS) (9 mL: 3 mL at the epicenter, 3 mL above and 3 mL below the epicenter) is
shown by the solid black column; the undifferentiated BMSC transplantation group (UB) (300 000 cells in 9 mL: 100 000 in 3 mL at the epicenter,
100 000 in 3 mL above and 100 000 in 3 mL below the epicenter) is shown by a dotted pattern; the transdifferentiated cholinergic-like neuron
transplantation group (TC) (300 000 cells in 9 mL: 100 000 in 3 mL at the epicenter, 100 000 in 3 mL above and 100 000 in 3 mL below the
epicenter) is shown by a cross-hatched pattern. The scoring was done at the day of the injection (D0), 1 week after the injection (W1) and at 2, 3, 4,
5 and 6 weeks after the injection, W2, W3, W4, W5 and W6, respectively. SO shows significant differences from the other groups; ‘a’ represents a
significant difference with NS, ‘b’ represents a significant difference with UB. The significance level was PB0.05.
Figure 11. A photomicrograph of immunocytochemistry for BrdU-labeled cholinergic-like neurons (arrow heads) delivered intraspinally. The
labeled cells were incubated with mouse anti-BrdU monoclonal Ab and reacted with rabbit anti-mouse secondary Ab conjugated with FITC (left
panel). The right panel shows the phase-contrast image of the same field of the injured spinal cord at the end of the experiment (scale bar 50 mM).
148 M. Naghdi et al.
BBB scores of the animals in TC were significantly higher
than those for UB during the third and fourth weeks. and
no significant difference was noticed with those of UB in
other weeks. The scores in the NS group were significantly
lower than those of TC at the second, third, fourth, fifth
and sixth weeks, while they were significantly lower than
the UB group at the sixth week (Figure 12).
DiscussionSpinal cord injury is a devastating and debilitating
condition, with social impacts and costly financial burdens
[21]. The growing interest in BMSC is justified because of
their availability as an autologous source for transplanta-
tion [22,23]. Moreover, Harvey & Chopp have suggested
advantages of using BMSC in the treatment of brain injury
[24], because BMSC can be delivered as an autologous
graft, so avoiding immunologic rejection, and can be
administered intravenously, minimizing complications.
Transdifferentiation of embryonic stem cells into
a cholinergic neuronal phenotype was reported by
Soundararajan et al. [25], while others have reported
differentiation of embryonic stem cells into spinal moto-
neurons [26] and specification of human embryonic stem
cells into motoneurons [27].
Differentiation of neural stem cells into a cholinergic
phenotype has also been documented [28]. BMSC trans-
differentiation into a neuronal phenotype was reported by
Woodbury et al. [29] and other investigators have con-
firmed these findings [30�33]. Two methods for pre-
induction have been compared in order to optimize the
differentiation protocol. The results of pre-induction
showed that the percentage of NF-68 immunoreactive
cells, a marker for neuroblast, was higher with BME than
DMSO. This indicates that BME is more efficient at
transdifferentiating BMSC into neuroblasts [34], because
the expression of NF-68 was reported to occur at the
beginning of the neuronal differentiation, while NF-160
was expressed during neurite formation, which was then
followed by NF-200 expression, which is consistent with
the finding of this investigation [35].
Accordingly, other makers, such as MAP-2 and synapsin
I, have confirmed these findings. Both BME and DMSO
have shown that fewer cells tend to express NF-200, which
indicates that the majority of cells have transdifferentiated
into neuroblasts [36�39]. BME alone [29] or in combina-
tion with retinoic acid has been used as a pre-induction
agent in transdifferentiating BMSC into a neuronal
phenotype [40�42].The markers of synaptogenesis, MAP-2, located at the
pre-synaptic and post-synaptic sides [43], and synapsin I,
at the pre-synaptic side only [44,45], were not equivalent.
This may indicate that the synapses are not efficiently
formed. The profile of MAP-2 and synapsin I expression at
the pre-induction stage is consistent with immaturity of
the differentiating cells [46�48]. The pattern of MAP-2
and synapsin I expression is consistent with ChAT
expression, which is low at the pre-induction stage. The
results of this investigation show that there is a decline in
the expression of NT-68 in BMSC differentiated into a
neuronal phenotype, which is consistent with the findings
of Chiu et al. [49].
Lu et al. [50] reported that BME activity in the cultured
BMSC was an artifact, while Hung et al. [36] reported that
the induction of BMSC into a neuronal phenotype was not
a stable process, with transdifferentiated cells reverting to
the original phenotype. However, in this investigation
NGF was used following pre-induction and resulted in
progressive transdifferentiation of the pre-induced cells
into a neuronal phenotype with an 80% yield of
differentiation of BMSC into cholinergic neuron-like cells.
Moreover, NGF is a strong neuroprotectant [51] that can
protect the cells injured by BME. On the one hand, BME
has been reported to inhibit neuronal oxidative stress by
increasing glutathione levels, on the other hand Ni et al.
[40] reported that glutathione could substantially increase
the activity of ChAT, resulting in alteration of neurite
outgrowth patterns. In addition, an in vivo study on the
effect of NGF on the developing nervous system reported
an increase in the expression of genes regulating the
synthesis of acetylcholine ([52]), which is consistent with
the results of this investigation.
The pattern of expression of Oct-4, a marker for BMSC
stemness, is consistent with other investigations [18,53],
while the pre-induced BMSC with NGF resulted in early
expression of the neuronal marker NeuroD, which is
confirmed by other investigations [54,55]. Other investi-
gators have reported Oct-4 expression by adult neural
stem cells following treatment with retinoic acid [28].
Therefore, the pattern of Oct-4 expression in uninduced
BMSC followed by Oct-4 suppression in induced cells is
consistent with the suppression of NeuroD. NeuroD is a
basic helix loop helix (b-HLH) protein, which is con-
sidered a neuronal determination gene [54,55]. The
Differentiation of marrow stromal cells into cholinergic neurons 149
expression of NeuroD has been reported to induce a
neuronal phenotype by increasing Neurogenin1 expres-
sion in mesenchymal stromal cells: The expression of
NeuroD has been reported to induce a neuronal pheno-
type by increasing Neurogenin1 expression in mesenchy-
mal stromal cells, which results in exit of the mesencymal
stromal cells from their cell cycle and terminally differ-
entiated into a neuronal phenotype; the expression of
NeuroD in the induced BMSC is in agreement with other
studies [56]. The expression of NeuroD in rat embryonic
spinal cord (used as a positive control in this study) is
consistent with other investigations that have reported the
expression of NeuroD in embryonic spinal cord [57].
Cholinergic neurons are important in the spinal cord
because they are involved in sensory as well as somatic
and visceral motility [1,2]. Li et al. [58] transplanted NGF
gene-modified BMSC in a rat model of Alzheimer’s
disease, which resulted in the differentiation of these cells
into cholinergic neurons and improvement in the model.
This is consistent with our results. Moreover, the trans-
plantation of the transdifferentiated BMSC into a choli-
nergic phenotype initially (at the third and fourth weeks)
enhanced the locomotive activity of rats with contusive
spinal cord injury, showing significantly higher BBB scores
than those of undifferentiated BMSC; no significant
differences were subsequently noticed at the fifth and
sixth weeks. This may indicate the need of transdiffer-
entiated cells for NGF in order to sustain their cholinergic
activity in vivo.
AcknowledgementsWe are grateful to Mrs H. H. AliAkbar for editing the
manuscript. Also, we are deeply indebted to Mr G. R. Kaka
for his co-operation in this investigation. The project was
supported in part by Janbazan Medical and Engineering
Center. We are grateful for Tarbiat Modares University,
The Office of Assistant of President for Scientific Research
and Technology.
Declaration of interest: The authors report no conflicts of
interest. The authors alone are responsible for the content
and writing of the paper.
References
1 Phelps PE, Barber RP, Houser CR, Crawford GD, Salvaterra
PM, Vaughn JE. development of neurons containing choline
acetyltransferase in rat spinal cord: an immunocytochemical
study. J Comp Neurol. 1984;229:347�61.2 Barber RP, Phelps PE, Houser CR, Crawford GD, Salvaterra
PM, Vaughn JE. The morphology and distribution of neurons
containing choline acetyltransferase in the adult rat spinal cord:
an immunocytochemical study. J Comp Neurol 1984;229:329�46.3 Metz GA, Curt A, van de Meent H, Klusman I, Schwab ME,
Dietz V. Validation of the weight-drop contusion model in rats: a
comparative study of human spinal cord injury. J Neurotrauma
2000;17:1�17.4 Basso DM, Beattie MS, Bresnahan JC. Graded histological and
locomotor outcomes after spinal cord contusion using the NYU
weight-drop device versus transection. Exp Neurol 1996;139:
244�56.5 Behrmann DL, Bresnahan JC, Beattie MS, Shah BR. Spinal cord
injury produced by consistent mechanical displacement of the
cord in rats: behavioral and histologic analysis. J Neurotrauma
1992;9:197�217.6 Grossman SD, Rosenberg LJ, Wrathall JR. Temporal�spatial
pattern of acute neuronal and glial loss after spinal cord
contusion. Exp Neurol 2001;168:273�82.7 Collazos-Castro JE, Soto VM, Gutierrez-Davila M, Nieto-
Sampedro M. Motoneuron loss associated with chronic locomo-
tion impairments after spinal cord contusion in the rat. J
Neurotrauma 2005;22:544�58.8 Llewellyn-Smith IJ, Weaver LC, Keast JR. Effects of spinal cord
injury on synaptic inputs to sympathetic preganglionic neurons.
Prog Brain Res 2006;152:11�26.9 McLachlan EM, Brock JA. Adaptations of peripheral vasocon-
strictor pathways after spinal cord injury. Prog Brain Res 2006;
152:289�97.10 Hoang TX, Havton LA. Novel repair strategies to restore
bladder function following cauda equina/conus medullaris
injuries. Prog Brain Res 2006;152:195�204.11 Lindvall O, Kokaia Z. Stem cells for the treatment of
neurological disorders. Nature 2006;441(7097):1094�6.12 Yu D, Silva GA. Stem cell sources and therapeutic approaches
for central nervous system and neural retinal disorders.
Neurosurg Focus. 2008;24:E11.
13 Webber DJ, Minger SL. Therapeutic potential of stem cells in
central nervous system regeneration. Curr Opin Investig Drugs
2004;5:714�9.14 Astradsson A, Cooper O, Vinuela A, Isacson O. Recent advances
in cell-based therapy for Parkinson disease. Neurosurg Focus.
2008;24(3�4):E6.15 Tzeng SF. Neural progenitors isolated from newborn rat spinal
cords differentiate into neurons and astroglia. J Biomed Sci
2002;9:10�6.16 Tarasenko YI, Gao J, Nie L, Johnson KM, Grady JJ, Hulsebosch
CE et al. Human fetal neural stem cells grafted into contusion-
injured rat spinal cords improve behavior. J Neurosci Res
2007;85:47�57.17 Gao J, Coggeshall RE, Tarasenko YI, Wu P. Human neural stem
cell-derived cholinergic neurons innervate muscle in moto-
neuron deficient adult rats. Neuroscience 2005;131:257�62.
150 M. Naghdi et al.
18 Movaghar B, Tiraihi T, Mesbah-Namin SA. Transdifferentiation
of bone marrow stromal cells into Schwann cell phenotype using
progesterone as inducer. Brain Res 2008;1208:17�24.19 Khalatbary AR, Tiraihi T. Localization of bone marrow stromal
cells in injured spinal cord treated by intravenous route depends
on the hemorrhagic lesions in traumatized spinal tissues. Neurol
Res 2007;29:21�6.20 Basso DM, Beattie MS, Bresnahan JC. A sensitive and reliable
locomotor rating scale for open field testing in rats.
J Neurotrauma 1995;12:1�21.21 Ackery A, Tator C, Krassioukov A. A global perspective on
spinal cord injury epidemiology. J Neurotrauma 2004;21:1355�70.22 Lee JB, Kuroda S, Shichinohe H, Yano S, Kobayashi H, Hida
K et al. A pre-clinical assessment model of rat autogeneic bone
marrow stromal cell transplantation into the central nervous
system. Brain Res Brain Res Protoc 2004;14:37�44.23 Enzmann GU, Benton RL, Talbott JF, Cao Q , Whittemore SR.
Functional considerations of stem cell transplantation therapy
for spinal cord repair. J Neurotrauma 2006;23:479�95.24 Harvey RL, Chopp M. The therapeutic effects of cellular
therapy for functional recovery after brain injury. Phys Med
Rehabil Clin N Am 2003;14(Suppl 1):S143�51.25 Soundararajan P, Lindsey BW, Leopold C, Rafuse VF. Easy and
rapid differentiation of embryonic stem cells into functional
motoneurons using sonic hedgehog-producing cells. Stem Cells
2007;25:1697�706.26 Wichterle H, Lieberam I, Porter JA, Jessell TM. Directed
differentiation of embryonic stem cells into motor neurons. Cell
2002;110:385�97.27 Li XJ, Du ZW, Zarnowska ED, Pankratz M, Hansen LO, Pearce
RA et al. Specification of motoneurons from human embryonic
stem cells. Nat Biotechnol 2005;23:215�21.28 Takahashi J, Palmer TD, Gage FH. Retinoic acid and neuro-
trophins collaborate to regulate neurogenesis in adult-derived
neural stem cell cultures. J Neurobiol 1999;38:65�81.29 Woodbury D, Schwarz EJ, Prockop DJ, Black IB. Adult rat and
human bone marrow stromal cells differentiate into neurons. J
Neurosci Res 2000;61:364�70.30 Sanchez-Ramos J, Song S, Cardozo-Pelaez F, Hazzi C, Stedeford
T, Willing A et al. Adult bone marrow stromal cells differentiate
into neural cells in vitro. Exp Neurol 2000;164:247�56.31 Munoz-Elıas G, Woodbury D, Black IB. Marrow stromal cells,
mitosis, and neuronal differentiation: stem cell and precursor
functions. Stem Cells 2003;21:437�48.32 Garcıa R, Aguiar J, Alberti E, de la Cuetara K, Pavon N. Bone
marrow stromal cells produce nerve growth factor and glial cell
line-derived neurotrophic factors. Biochem Biophys Res Commun
2004;316:753�4.33 Rismanchi N, Floyd CL, Berman RF, Lyeth BG. Cell death and
long-term maintenance of neuron-like state after differentiation
of rat bone marrow stromal cells: a comparison of protocols.
Brain Res 2003;991:46�55.34 Carden MJ, Trojanowski JQ , Schlaepfer WW, Lee VM. Two-
stage expression of neurofilament polypeptides during rat
neurogenesis with early establishment of adult phosphorylation
patterns. J Neurosci 1987;7:3489�504.35 Lariviere RC, Julien JP. Functions of intermediate filaments in
neuronal development and disease. J Neurobiol 2004;58:131�48.36 Hung SC, Cheng H, Pan CY, Tsai MJ, Kao LS, Ma HL. In vitro
differentiation of size-sieved stem cells into electrically active
neural cells. Stem Cells 2002;20:522�9.37 Abouelfetouh A, Kondoh T, Ehara K, Kohmura E. Morpholo-
gical differentiation of bone marrow stromal cells into neuron-
like cells after co-culture with hippocampal slice. Brain Res 2004;
1029:114�9.38 Park S, Lee KS, Lee YJ, Shin HA, Cho HY, Wang KC et al.
Generation of dopaminergic neurons in vitro from human
embryonic stem cells treated with neurotrophic factors. Neurosci
Lett 2004;359:99�103.39 Ishiuchi S, Nakazato Y, Iino M, Ozawa S, Tamura M, Ohye C. In
vitro neuronal and glial production and differentiation of human
central neurocytoma cells. J Neurosci Res 1998;51:526�35.40 Ni L, Wen Y, Peng X, Jonakait GM. Antioxidants N-acetylcys-
teine (NAC) and 2-mercaptoethanol (2-ME) affect the survival
and differentiative potential of cholinergic precursors from the
embryonic septal nuclei and basal forebrain: involvement of ras
signaling. Brain Res Dev Brain Res 2001;130:207�16.41 Kim TS, Nakagawa T, Kita T, Higashi T, Takebayashi S,
Matsumoto M et al. Neural connections between embryonic
stem cell-derived neurons and vestibular hair cells in vitro. Brain
Res 2005;1057:127�33.42 Kondo T, Johnson SA, Yoder MC, Romand R, Hashino E. Sonic
hedgehog and retinoic acid synergistically promote sensory fate
specification from bone marrow-derived pluripotent stem cells.
Proc Natl Acad Sci USA 2005;102:4789�94.43 Sheng M. Molecular organization of the postsynaptic specializa-
tion. Proc Natl Acad Sci USA 2001;98:7058�61.44 Fernandez-Chacon R, Sudhof TC. Genetics of synaptic vesicle
function: toward the complete functional anatomy of an
organelle. Annu Rev Physiol 1999;61:753�76.45 Zhai RG, Vardinon-Friedman H, Cases-Langhoff C, Becker B,
Gundelfinger ED, Ziv NE et al. Assembling the presynaptic
active zone: a characterization of an active one precursor vesicle.
Neuron 2001;29:131�43.46 Kitamura C, Shirai K, Inoue M et al. Changes in the subcellular
distribution of microtubule-associated protein 1B during synap-
togenesis of cultured rat cortical neurons. Cell Mol Neurobiol
2007;27:57�73.47 Finley MF, Kulkarni N, Huettner JE. Synapse formation and
establishment of neuronal polarity by P19 embryonic carcinoma
cells and embryonic stem cells. J Neurosci 1996;16:1056�65.48 Ma W, Liu QY, Jung D, Manos P, Pancrazio JJ, Schaffner AE et al.
Central neuronal synapse formation on micropatterned surfaces.
Brain Res Dev Brain Res 1998;111:231�43.49 Chiu FC, Feng L, Chan SO, Padin C, Federoff JH. Expression of
neurofilament proteins during retinoic acid-induced differentia-
tion of P19 embryonal carcinoma cells. Brain Res Mol Brain Res
1995;30:77�86.
Differentiation of marrow stromal cells into cholinergic neurons 151
50 Lu P, Blesch A, Tuszynski MH. Induction of bone marrow
stromal cells to neurons: differentiation, transdifferentiation, or
artifact? J Neurosci Res 2004;77:174�91.51 Koike T, Tanaka S. Evidence that nerve growth factor
dependence of sympathetic neurons for survival in vitro may
be determined by levels of cytoplasmic free Ca2�. Proc Natl Acad
Sci USA 1991;88:3892�6.52 Aloe L, Alleva E, Bohm A, Levi-Montalcini R. Aggressive
behavior induces release of nerve growth factor from mouse
salivary gland into the bloodstream. Proc Natl Acad Sci USA
1986;83:6184�7.53 Lamoury FM, Croitoru-Lamoury J, Brew BJ. Undifferentiated
mouse mesenchymal stem cells spontaneously express neural
and stem cell markers Oct-4 and Rex-1. Cytotherapy 2006;8:
228�42.54 von Bohlen Und Halbach O. Immunohistological markers for
staging neurogenesis in adult hippocampus. Cell Tissue Res
2007;329:409�20.
55 Gallo R, Zazzeroni F, Alesse E, Mincione C, Borello U, Buanne
P, D’Eugenio R et al. REN: a novel, developmentally regulated
gene that promotes neural cell differentiation. J Cell Biol
2002;158:731�40.56 Kim SS, Yoo SW, Park TS, Ahn SC, Jeong HS, Kim JW et al.
Neural induction with neurogenin1 increases the therapeutic
effects of mesenchymal stem cells in the ischemic brain. Stem
Cells 2008;26:2217�28.57 Lee JK, Cho JH, Hwang WS, Lee YD, Reu DS, Suh-Kim H.
Expression of neuroD/BETA2 in mitotic and postmitotic
neuronal cells during the development of nervous system. Dev
Dyn 2000;217:361�7.58 Li LY, Li JT, Wu QY, Li J, Feng ZT, Liu S et al. Transplantation
of NGF-gene-modified bone marrow stromal cells into a rat
model of Alzheimer’s disease. J Mol Neurosci 2008;34:157�63.
152 M. Naghdi et al.