Transcriptional Regulation of JARID1B/KDM5B Histone ...Regulation of JARID1B Expression by Ikaros, HDAC1, and CK2! 1!! Transcriptional Regulation of JARID1B/KDM5B Histone Demethylase

Regulation of JARID1B Expression by Ikaros, HDAC1, and CK2

1

Transcriptional Regulation of JARID1B/KDM5B Histone Demethylase by Ikaros, Histone

Deacteylase 1 (HDAC1), and Casein Kinase 2 (CK2) in B Cell Acute Lymphoblastic Leukemia*

Haijun Wang1,2, #, Chunhua Song2,# Yali Ding2, Xiaokang Pan2, Zheng Ge2, Bi-Hua Tan2, Chandrika Gowda2, Mansi Sachdev2, Sunil Muthusami2, Hongsheng Ouyang1, Liangxue Lai1, Olivia L. Francis3, Christopher L. Morris3, Hisham Abdel-Azim4, Glenn Dorsam5, Meixian Xiang6, Kimberly J. Payne3,

and Sinisa Dovat2,7

From 1 Department of Pathology, Xinxiang Medical University, Xinxiang 453003, Henan, China, 2Pennsylvania State University College of Medicine, Hershey, PA 17033

3Loma Linda University, Loma Linda CA, 92350 4Division of Hematology, Oncology and Blood & Marrow Transplantation, Childrens Hospital Los

Angeles, University of Southern California Keck School of Medicine, CA 90027 5North Dakota State University, Fargo, ND 58108

6College of Pharmacy, South-Central University for Nationalities, Wuhan, 430074, China # These authors contributed equally. *Running Title: Regulation of JARID1B Expression by Ikaros, HDAC1, and CK2 7 To whom correspondence should be addressed: Sinisa Dovat, MD, PhD, Division of Pediatric Hematology/Oncology, Department of Pediatrics, Pennsylvania State University College of Medicine, Hershey, PA17033. E-mail: [email protected]

Key Words: Gene regulation, Signal transduction, Cell biology, Tumor suppressor gene, Chromatin remodeling, Histone modifications, Transcriptional regulation, Leukemia, Epigenetics

ABSTRACT Impaired function of the Ikaros (IKZF1) protein is associated with the development of high-risk B-cell precursor acute lymphoblastic leukemia (B-ALL). The mechanisms of Ikaros tumor suppressor activity in leukemia are unknown. Ikaros binds to the upstream regulatory elements (UREs) of its target genes and regulates their transcription via chromatin remodeling, Here, we report that Ikaros represses transcription of the histone H3K4 demethylase, JARID1B (KDM5B). Transcriptional repression of JARID1B is associated with increased global levels of H3K4 tri-methylation. Ikaros-mediated repression of JARID1B is dependent on the activity of the histone deacetylase, HDAC1, which binds to the

URE of JARID1B in complex with Ikaros. In leukemia, JARID1B is overexpressed and its inhibition results in cellular growth arrest. Ikaros-mediated repression of JARID1B in leukemia is impaired by pro-oncogenic Casein Kinase 2 (CK2). Inhibition of CK2 results in increased binding of the Ikaros-HDAC1 complex to the promoter of JARID1B, with increased formation of H3K27me3 and decreased H3K9 acetylation. In cases of high-risk B-ALL that carry deletion of one Ikaros (IKZF1) allele, targeted inhibition of CK2 restores Ikaros binding to the JARID1B promoter and repression of JARID1B. In summary, the presented data suggest a mechanism through which Ikaros and HDAC1 regulate the epigenetic signature in leukemia: via regulation of

http://www.jbc.org/cgi/doi/10.1074/jbc.M115.679332The latest version is at JBC Papers in Press. Published on December 10, 2015 as Manuscript M115.679332

Copyright 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

by guest on February 5, 2020http://w

ww

.jbc.org/D

ownloaded from

http://www.jbc.org/cgi/doi/10.1074/jbc.M115.679332

http://www.jbc.org/


2

JARID1B transcription. Presented data identify JARID1B as a novel therapeutic target in B-ALL and provide a rationale for the use of CK2 inhibitors in the treatment of high-risk B-ALL.

IKZF1 encodes the Ikaros DNA-binding zinc

finger protein (1-4). Ikaros is essential for normal hematopoiesis and acts as a tumor suppressor (5,6). In humans, deletion of a single Ikaros allele is associated with the development of high-risk B-cell precursor acute lymphoblastic leukemia (B-ALL) that is characterized by resistance to chemotherapy and poor prognosis (7-9). Alterations in the Ikaros have also been associated with T cell ALL (10,11) and myeloid leukemias (12-16). Ikaros regulates transcription of its target genes via chromatin remodeling (9). Ikaros has been shown to directly bind histone deacetylases HDAC1 and HDAC2 and to associate with the chromatin remodeling complex NuRD through interaction with the Mi-2 protein (9,17).

Ikaros is hypothesized to recruit chromatin remodeling complexes to the regulatory elements of its target genes resulting in chromatin modifications (primarily histone deacetylation) and transcriptional repression or activation of its target genes (18-20). Mechanisms of Ikaros-mediated repression that are independent of histone deacetylase have also been described (18,19). This hypothesis is supported by reports that describe Ikaros activity during differentiation of murine thymocytes. Ikaros binds to UREs of dntt, the gene encoding terminal deoxynucleotide transferase (4), and regulates its transcription (21). The binding of Ikaros to dntt is associated with the induction of epigenetic changes that are characteristic of transcriptionally repressed chromatin.

The function of Ikaros is regulated by posttranslational modifications (22-24). Phosphorylation of Ikaros by oncogenic CK2 and

the role of this phosphorylation in regulating Ikaros activity have been studied most extensively (22,25). Data from these studies suggest that Ikaros is phosphorylated by CK2 at multiple residues, and that CK2-mediated phosphorylation reduces the DNA-binding affinity of Ikaros and abolishes its localization to pericentromeric heterochromatin (26,27). These data led to a model of leukemogenesis in which CK2 promotes malignancy by inhibiting Ikaros function as a transcriptional regulator (28).

Despite extensive studies of Ikaros function in murine hematopoiesis, the molecular mechanisms by which Ikaros regulates transcription of its target genes and its role in the epigenetic control of gene expression in human leukemia remain unknown. Here, we report that Ikaros directly represses transcription of JARID1B (KDM5B) histone demethylase, which specifically demethylates histone H3 at lysine 4. We show that Ikaros represses expression of JARID1B by recruiting the histone deacetylase, HDAC1, to the JARID1B promoter resulting in epigenetic alterations that lead to the formation of a repressive chromatin environment. Our data suggest that in leukemia, CK2-mediated phosphorylation interferes with Ikaros-mediated repression of JARID1B. We demonstrate that inhibition of CK2 results in the downregulation of JARID1B and a global increase in trimethylation of histone H3 at lysine 4 (H3K4me3). We propose a model whereby CK2, Ikaros and HDAC1 regulate H3K4me3 in leukemia via transcriptional control of JARID1B.

EXPERIMENTAL PROCEDURES Cells, Cell Culture and Reagents—Nalm6, CCRF-CEM (CEM), U937, and MOLT4 leukemia cell lines were obtained from American Type Culture Collection (ATCC), Manassas, VA, and cultured in RPMI 1640 medium (Cellgro) supplemented with 10% fetal bovine serum


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


3

(Hyclone). HEK 293T cells were cultured in DMEM (Cellgro) supplemented with 10% fetal calf serum and 1% L-glutamine (Cellgro). DN3 cells have been described previously (29). MS275 (Cayman), Quinalizarin (Calbiochem), PBIT (2-4(4-methylphenyl)-1,2-benzisothiazol-3(2H)-one) (PH009215), and TBB (4,5,6,7-Tetrabromobenzotriazole) were purchased from Sigma (St. Louis). CX-4945 was a gift from Cylene Pharmaceuticals (San Diego, CA). Cells were incubated at 37°C in a humidified atmosphere of 5% CO2. Primary leukemia and normal cells were obtained from Loma Linda University (Loma Linda, CA) and Childrens Hospital Los Angeles and their use was approved by the Institutional Review Boards at the respective institutions and at Penn State Hershey College of Medicine. The wild type full-length Ikaros or Ikaros deletion in patient samples were confirmed by Western blot and/or genomic sequencing. For TBB treatment, the primary B-ALL (IKhaplo) cells were cultured briefly (1 day) in the same conditions as Nalm6.

ChIP-seq experiments-ChIP-seq assays for Ikaros and HDAC1 in leukemia cells were performed as previously reported (30,31). For ChIP-seq library, affinity purified anti-Ikaros antibody (24), or anti-HDAC1 antibody (ab7028) were incubated with chromatin. ChIP-seq libraries were created using ChIP-seq DNA sample prep kit (Illumina), size-selected and the 200-400 bp fraction was extracted and purified. Libraries were sequenced at the High Throughput Genomics Center at University of Washington, Seattle. ChIP-seq sequences were generated by Illumina Hiseq 2000 or Genome Analyzer II and then were mapped onto HG19 (Human Genome version 19 from NCBI) using ELAND algorithm at the Genome Sequencing Center, University of Washington, Seatle, WA. CisGenome 2.0 (32) was used to detect binding peaks on HG19. Parameters

lpcut = 1e-3 and c = 2 were selected. Other parameters remain at default settings for the program run.

Antibodies––The antibodies used to immunoprecipitate and detect the C terminus of Ikaros (Ikaros-CTS) have been described previously (33). The antibodies used for quantitative chromatin immunoprecipitation (qChIP) for epigenetic changes and Western blot were as follows: anti-H3K9ac (ab4441, Abcam), anti-H3K27me3 (07-449, Millipore), anti-HDAC1 (ab7028, Abcam), anti-HDAC2 (39934, active motif) ,anti-HDAC3 (3945P, cell signaling), anti-HDAC8 (ab137474, abcam), anti-H3K4me3 (ab8580, Abcam), JARID1B (ab56759, Abcam), PCNA (FL-261, Santa Cruz), Histone H3 (ab1791, Abcam), Actin (sc-1616-R, Santa Cruz), Casein Kinase II (made by ProSci Inc. against CK2α catalytic subunit-GST), anti-Rabbit IgG (ab46540, Abcam), and secondary anti-rabbit IgG (HRP) (abcam, ab6721).

Cell Proliferation Assay—The cell proliferation assay was performed as described previously (34). Briefly, the colorimetric assay (WST-1 reagent) from Roche was performed in 96-well white clear bottom plates (Costar, 3603). 104 cells were seeded per well with no treatment or PBIT treatment at the indicated concentration and cultured for 72 h. The WST-1 reagent was added (10 µl/well) for 4 h, and absorbance at 440 nm was measured using the BioTek Synergy Mx plate reader.

Plasmid Construction––Wild-type human HA-tagged Ikaros (IKZF1) cDNA was cloned into BglII and EcoRI sites into the pMSCV bicistronic retroviral vector (MIG vector) which contains a 5’ long-terminal-repeat, internal ribosome entry site (IRES), and enhanced green fluorescent protein (EGFP) (35). For construction of pGL4.15-promoter of JARID1B (pGL4.15-JARID1B), the promoter region of


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


4

JARID1B (-2.5kb from TSS) was amplified by PCR from the genomic DNA of Nalm6 cells by using primers: F ：

CCCGAGCTCGCCCTAGACGAGACAATGCG, R: CCCAAGCTTAGGCTGGGCAAGGGCGAGGCG, The PCR product was cloned into the pGL4.15 vector by SacI and HindⅢ restrict enzymes (New England Biolabs).

Retroviral Gene Transfer and Cell Sorting––Retroviruses were produced by transient transfection in amphotropic packaging 293 cell lines as described previously (26). Nalm6 cells were plated in 24-well plates at 4x105 cells/well and suspended in retroviral supernatants with 12 µg/mL polybrene and centrifuged at 1,400 g, at 32 °C, for 2 hrs. The cells were then suspended in fresh 10% FBS RPMI 1640 and cultured at 37°C, 5% CO2 for 3 days. The cells were isolated by Ficoll separation and the GFP (+) cells were sorted using a FACSAria High speed sorter (Becton Dickinson). Sorted cells were further cultured followed by RNA isolation.

Luciferase Assay—HEK293T cells were seeded into 24-well plates and transiently transfected with 150 ng of indicated promoter reporter constructs and 150 ng of pcDNA3.1-Ikaros or pcDNA3.1 vector as a control using lipofectamine 2000 transfection reagent (Invitrogen). As an internal control, the pGL4.74[hRluc/TK] vector was cotransfected, which led to the constitutive expression of Rennila luciferase (Promega). Twenty-four hours after transfection, cells were collected and lysed in 100 µl of 1x passive lysis buffer in luciferase reporter assay kit (Promega) following the manufacture’s manual. Luciferase assays were carried out with 20 µl of lysate on the dual luciferase reporter assay system (Promega GloMax 20/20 Luminometer). The activity of firefly luciferase was normalized to the activity of Rennila luciferase. Luciferase activities were expressed as fold change relative to

values obtained from pGL4.74 [hRluc/TK] vector only control cells. Each experiment was performed in triplicate, and all transfection and reporter assays were performed independently at least three times.

HDAC1 siRNA knockdown in Luciferase

reporter assay. Four unique 29mer shRNA constructs for human HDAC1 in GFP vector (pGFP-V-RS) were purchased from Origene. The set of 4 shRNA plasmids for HDAC1 were tested first by western blot, and the optimal gene knockdown shRNA plasmid was selected for further studies. HEK293 cells were transiently transfected with 0.2µg of scramble shNRA (siCTL) or HDAC1 shRNA (siHDAC1) plasmids together with 150 ng of indicated promoter reporter constructs and 150 ng of pcDNA3.1-Ikaros or pcDNA3.1 vector as a control using lipofectamine 2000 transfection reagent (Invitrogen). The luciferase reporter assays were performed following the same protocol as above.

Quantitative Chromatin Immunoprecipitation

ChIP (qChIP)––qChIP assays were performed as reported previously (31). Briefly, cells were collected by centrifugation at 2000g for 5 min and cross-linked in cross-link solution containing 1% formaldehyde for 10 min on ice. The reaction was stopped by adding glycine to a final concentration of 0.125 M. Ikaros ChIP samples were prepared as follows: 2x107 Nalm6 cells or primary leukemia cells (4-10x106) per condition were treated with solution I (50 mM Hepes KOH, pH7.5, 140 mM NaCl, 1 mM EDTA, 10% Glycerol, 0.5% NP-40, 0.25% Triton X-100, protease inhibitor) with rotation at 4°C for 10 min. The cells were pelleted and treated with solution II 0.2 M NaCl, 1 mM EDTA pH 8.0, 0.5 mM EGTA pH8.0, 10 mM Tris pH 8.0, protease inhibitor) with rotation for 10min


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


5

at room temperature. The chromatin was fragmented in solution III (1mM EDTA pH 8.0, 0.5 mM EGTA pH 8.0, 10 mM Tris pH 8.0, protease inhibitor) with a Bioruptor (Diagenode,) for 14 min (30 s pulses, 90 s pauses) to obtain an average size of 400 bp and the chromatin was centrifuged at 4000 RPM for 10 min at 4°C and added with 10% glycerol. ChIP assays were performed by incubation of the chromatin in buffer (1% triton X-100, 0.1% deoxycholate, 1X TE and protease inhibitor) with 20 µL rabbit polyclonal anti-Ikaros sera or normal rabbit IgG (Abcam, ab46540) or mouse IgG (Cell signaling, 5415S) as control, which was pre-coated onto Goat-anti-rabbit IgG or sheep-anti-Mouse IgG Dyneabeads(Invitrogen). Following overnight incubation at 4°C, protein/DNA complexes were captured with Magnetic Particle Concentrator (Invitrogen). Beads were extensively washed with RIPA buffer (50 mM Hepes pH 8.0, 1 mM EDTA pH8.0, 1% NP-40, 0.7% deoxycholate, 0.5M LiCl) and TE. ChIPed DNA was eluted with 50µl elution buffer (10 mM Tris pH 8.0, 1 mM EDTA, 1%SDS). Crosslinks were reversed in the presence of 0.6 M NaCl at 65°C overnight. Samples were treated with proteinase K, extracted with phenol/chloroform, and then treated with RNaseA. Finally, the DNA was purified using the QIAquick PCR Purification kit (QIAGEN). Enrichment of the ChIP sample over input was evaluated by qPCR with specific primers in the promoter region of target genes. Three or more technical replicates were performed for most sites. Fold enrichment is calculated by the formula: 2−CTsample/2−CTinput, where CT represents threshold cycle number of sample and input. Relative concentration of ChIP-qPCR product was presented as the fold change of DNA-Ikaros complex level of samples relative to control. qChIP assays of HDAC1 and histone modification markers were performed according to the same

protocol as Ikaros qChIP except using 1x107 cells and 1-5 mg of antibody for the histone modification markers.

DNA sequence analysis––Sequence analysis of the URE of mouse and human JARID1B was performed using DNA BLAT program (http://www.genome.ucsc.edu/cgi-bin/hgBlat).

qChIP Primers––Primers for JARID1B URE: Sense–TCCGCCCATGTAAACATCATAA; Antisense–AACCTAGGGACCGAGAGGACTCT. Primers for JARID1B promoter and location relative to TSS: P1 (–507 to –423bp), Sense: AATTAGAACAGTGCCTAGGATATGAAAGT, Antisense: CATGTTCATGAGAAGGCAATAGTAGTAA. P2 (–354 to –290 bp), Sense: CCCCCTCCTGGGTTTTACTG, Antisense: CCCATAAGCCAATCATTCAATCA. P3 (–259 to –183 bp), Sense: CAGGGCAGGAACTCTGATACATAGT, Antisense: GGATGGAGTTTATCCTTAGGGTTTC. P4 (–39 to 22 bp), Sense: CGTCGGAGG CTGAAAAAGC, Antisense: GCAACAGCAAGTCCGAGTTG. P5 (+242 to +296 bp), Sense: GCGGACCCCTTCGCTTT, Antisense: TGCCAGTCTGCTCGGCTAT. Primer sequences for qChIP to detect Ikaros binding across the URE are as follows (location relative to transcriptional JARID1B start site in parenthesis): URE1 (-2818 to -2756 bp), Sense ：AGGATGGAGACACCTAG GGATGT, Antisense: CAAACCGCCCTCATTT GTG; URE2 (-2412 to -2350 bp), Sense：CGCGGTGTGGCTGTCA, Antisense ：

CCTTGCCCTTTATGATGTTTACATG; URE3 (-2157 to -2098 bp), Sense ：

CCGGACTGGGAGACCTTGA, Antisense ：TTCTCAGCTGCGTCCTACGA; URE4 (-1943 to -1880 bp), Sense ：


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


6

GCACATGACACTACATGAGCTTCA, Antisense：GGCTCTT TGGTGCGCATT; URE5 (-1672 to -1610 bp), Sense ： AAAGACTCCAGGTCCCAAAGC, Antisense：GTGGTCCTGGGAGAACGTATTC.

Quantitative Reverse-Transcriptase PCR (qRT-PCR)—Total RNA was isolated using the RNeasy Mini Kit (QIAGEN). 1 µg total RNA was reverse transcribed using a SuperScriptTM First-Strand Synthesis System for RT-PCR Kit (Invitrogen). qRT-PCR was performed with PerfeCtaTM SYBR Green FastMix (Quanta BiosciencesTM) using StepOne Plus real-time PCR system (Applied Biosystems). Results were normalized to those obtained with 18sRNA and presented as fold induction over control cells. Each experiment was performed in triplicate. Human Primers: 18s RNA, sense: GTAACCCGTTGAACCCCATT, antisense: CCATCCAATCGGTAGTAGCG; JARID1B sense: CAGCCCGACGAGCAAAA, antisense: CGTTGTCTCCTCGGGTTCTATT. CK2α (CSNK2A1), sense AGCGATGGGAACGCTTTG, antisense AAGGCCTCAGGGCTGACAA. Ikaros (IKZF1) sense GGCGCGGTGCTCCTCCT, anti-sense TCCGACACGCCCTACGACA. Mouse primers: mGAPDH, sense: CTCAACTACATGGTCTACATGTTCCA, anti-sense:CCATTCTCGGCCTTGACTGT. JARID1B, sense: TGGCAGCACCCAGTATTTCA, antisense: CCTCCGACAGTGAGGACAAAG.

Biochemical Experiments––Nuclear extraction and Western blot were performed as described previously (25,35). Band intensities were quantified by ImageJ software. For quantitative comparison, the results were normalized to PCNA and Histone H3 to correct for variations in sample loading, and the protein expression level as percentages of control signals (% control) in each blot to correct for variations between blots.

Histone Extraction––Cells were harvested and washed twice with ice-cold PBS supplemented with 5mM sodium butyrate to retain levels of histone acetylation. Histone extraction was performed using the Abcam histone extraction protocol (www.abcam.com). Briefly, the cell pellet was lysed in cold lysis buffer [PBS containing 0.5% Triton X-100 v/v, 50 mMTris (pH 7.5), 150 mM sodium chloride, 2 mM phenylmethylsulfonil fluoride (PMSF), 0.02% (w/v) Sodium Nitrite] at cell density of 107 cells/mL for 10 min on ice while gently stirring, and centrifuged at 6,500 g for 10 min at 4°C to spin down the nuclei. The pelleted nuclei were washed in lysis buffer and resuspended in 0.2 N HCl overnight at 4°C for acid extraction. The samples were centrifuged to get rid of debris and supernatant containing the histones was transferred to a clean tube. The protein was quantified using the Bradford assay and used for western blot analysis.

Ikaros and CK2 shRNA Knockdown––Four unique 29mer shRNA constructs for human Ikaros (IKZF1) in GFP vector (pGFP-V-RS) were purchased from Origene. The Nalm6 cells were transiently transfected with 0.5µg of plasmids per well in 24-well plates using the Neon Transfection System (Invitrogen). The set of 4 shRNA plasmids for Ikaros were tested first, and the optimal gene knockdown shRNA plasmid was selected for further studies. Three days after transfection, the Nalm6 cells with transfection efficiency ranging from 70%-80% (green cells) and more than 95% cell viability were harvested for total RNA isolation. The 29-mer scrambled shRNA cassette in pGFP-V-RS vector was used as a control.

Four unique 29mer shRNA constructs for human CK2α (CSNK2A1) in a GFP vector (pGFP-V-RS) were purchased from Origene, and the optimal gene knockdown shRNA plasmid for each gene was selected for further studies. Nalm6


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


7

cells were transiently transfected using the Neon Transfection System (Invitrogen). After transfection for 2 day, cells with transfection efficiency ranges from ~80% (green cells) and more than 95% cell viability were harvested for total RNA isolation. The 29-mer scrambled shRNA cassette in pGFP-V-RS vector was also used as a control. Knockdown of CK2 was confirmed by qRT-PCR measurement of its mRNA level. RESULTS

Ikaros Binds the URE of JARID1B––To identify Ikaros target genes in leukemia, we determined the genome-wide occupancy of Ikaros in the human B-ALL cell line, Nalm6, using chromatin immunoprecipitation followed by deep-sequencing (ChIP-seq). Results show that Ikaros binds to the DNA sequence upstream of the promoter of the JARID1B (KDM5B) gene in Nalm6 cells (Fig 1A).

Ikaros binding at the JARID1B URE was confirmed by quantitative chromatin immunoprecipitation assay (qChIP) of leukemia cell lines representing multiple blood lineages: the Nalm6 B-cell precursor acute lymphoblastic leukemia (B-ALL) cell line, the U937 acute myeloid leukemia (AML) cell line, and the CEM early-T cell acute lymphoblastic leukemia (T-ALL) cell line (Fig. 1B), as well as in primary B-ALL, AML and T-ALL cells from leukemia patients (Fig. 1C). Ikaros binding to the URE of JARID1B was not detected in primary B-ALL with haploinsufficiency of Ikaros due to deletion of one allele (Fig. 1C, bar 4). The strong binding of Ikaros at the JARID1B URE in cells from a range of hematopoietic lineages supports the functional relevance of Ikaros in regulating JARID1B expression.

Sequence analysis of the URE of human and mouse JARID1B (KDM5B) revealed a domain

where the Ikaros consensus core binding element (5’-GGGA-3’) (35) occurs at high frequency and in close proximity (Fig. 1D). The frequency of core binding elements was 7-fold (human) and 5-fold (mouse) greater than that expected based on a random nucleotide distribution. Comparative analysis of human and mouse genomes within the URE of JARID1B identified the presence of multiple evolutionarily-conserved Ikaros consensus binding sites in close proximity to each other, along with several evolutionarily conserved Ikaros core binding elements surrounding the transcriptional start site (TSS) of JARID1B (data not shown). This suggests that the binding of Ikaros to the URE of JARID1B is functionally important.

Ikaros Represses Transcription of JARID1B––The effect of Ikaros binding on transcriptional regulation of JARID1B, was determined using gain-of-function and loss-of-function experiments. We used the luciferase reporter assay to analyze the direct effect of Ikaros binding to the JARID1B upstream regulatory region on its transcription. The URE containing the Ikaros binding sites was cloned into a luciferase reporter plasmid. HEK-293T cells were co-transfected each with the JARID1B-luciferase constructs and either a control plasmid pcDNA3.1-HA or a plasmid encoding human or mouse Ikaros (pcDNA3.1-HA-hIK-VI or pcDNA3.1-HA-mIK-VI respectively). The effect of co-transfection with the murine or human full-length Ikaros isoform was compared to the negative control with empty plasmid. Results showed that expression from the JARID1B promoter was 2-fold higher without Ikaros as compared to cells that expressed murine or human Ikaros (Fig. 2A). These data suggest that Ikaros can directly repress transcription of JARID1B.

Next, we tested the effect of Ikaros on JARID1B transcription in leukemia. First we used the DN3 cell line – a T cell leukemia derived from


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


8

the Ikaros knock-out mouse (29). These cells do not express Ikaros. Retroviral transduction of DN3 cells with Ikaros resulted in reduced transcription of JARID1B as indicated by qRT-PCR (Fig 2B) when compared to control cells transduced with empty retroviral vector. These data suggest that Ikaros represses JARID1B transcription in leukemia.

Next, we compared JARID1B expression in human Nalm6 B-ALL cells transduced with retrovirus containing wild type Ikaros or with empty retroviral vector (negative control). The effect of Ikaros overexpression on JARID1B transcription was studied using qRT-PCR and at the protein level by Western blot. Results show that cells with increased Ikaros expression have 2.5-fold reduced transcription of JARID1B as measured by qRT-PCR (Fig. 2C). Western blot shows that increased Ikaros protein in Nalm6 cells correlates with reduced JARID1B protein levels (reduced to one third that observed in control cells (Fig. 2D, E-left panel).

JARID1B acts as a histone H3 demethylase, targeting the histone H3K4me3 epigenetic modification, and thus is one of the primary enzymes controlling the global level of H3K4me3 modifications in the nucleus (36). To determine whether Ikaros overexpression results in changes in the level of H3K4me3 modifications, we performed Western blots with antibodies specific to Ikaros and to H3K4me3. Our results show that overexpression of Ikaros leads to reduced levels of the JARID1B protein and greater than 2-fold increase in H3K4me3 histone modifications in Nalm6 cells (Fig. 2D, and Fig 2E, right panel).

To study the effect of reduced Ikaros activity on JARID1B transcription, we targeted Ikaros with shRNA (Fig. 2F left panel). Nalm6 cells transfected with Ikaros shRNA showed increased transcription of JARID1B, as measured by qRT-PCR when compared to controls (Fig. 2F,

right panel). Taken together, gain-of-function and

loss-of-function experiments provide evidence that Ikaros acts as a transcriptional repressor of JARID1B and that increased Ikaros activity results in reduced JARID1B leading to global changes in the histone methylation status of H3K4me3.

Repression of JARID1B by Ikaros Occurs via

HDAC1––Next, we studied the mechanism by which Ikaros represses JARID1B. Previous reports show that although Ikaros can directly activate or repress gene transcription, it often regulates gene expression by recruiting chromatin remodeling complexes to the regulatory regions of its target genes (20,37). In vivo, Ikaros associates with HDAC1, a component of the NuRD histone deacetylase complex (17). We tested whether HDAC1 binds to the URE of JARID1B at the same site as Ikaros in leukemia cells. ChIP-seq experiments demonstrate that HDAC1 binds to the URE of JARID1B in close proximity to Ikaros binding (Figure 3A). To confirm HDAC1 occupancy at JARID1B upstream regulatory regions, qChIP assays were performed using HDAC1 antibody on the leukemia cell lines and samples and with the qChIP primers used to determine Ikaros occupancy in Fig. 1. Strong HDAC1 binding was detected at the JARID1B URE in all leukemia cell lines, as well as in primary leukemia cells from multiple blood lineages (Fig. 3B-C). In contrast, no binding of other class I histone deacetylases (HDAC2, HDAC3 and HDAC8) at the JARID1B URE was detected in B-ALL or T-ALL cell lines (Fig. 3B middle panel and right panel), or in primary B-ALL and T-ALL cells (Fig. 3C, middle panel and right panel). This suggested that Ikaros binds the URE of JARID1B in complex with HDAC1. Next, we evaluated the functional significance of HDAC1 binding by determining if histone


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


9

deacetylase activity is essential for Ikaros-mediated repression of JARID1B. As previously shown in luciferase reporter assays (Fig. 2A), co-transfection of Ikaros downregulated transcription of JARID1B in 293T cells. However, treatment of 293T cells with the general histone deacetylase inhibitor, trichostatin (TSA), abolished Ikaros-mediated repression of JARID1B (Fig. 3D, bar 3). These results suggest that histone deacetylase activity is essential for Ikaros-mediated repression of JARID1B. To determine specifically whether HDAC1 is essential for Ikaros-mediated repression of JARID1B, 293T cells were treated with the HDAC1 inhibitor MS-275, at a concentration that is specific for HDAC-1 and does not inhibit other class I histone deacetylases (38-40). Treatment with MS-275 abolished Ikaros-mediated repression of JARID1B (Fig. 3D, bar 4) in a manner similar to that observed when cells were treated with TSA. In addition, transfection of 293T cells with the HDAC1-specific siRNA abolished Ikaros-mediated repression of JARID1B (Fig. 3E, bar 4 compared to bar 2). These results suggest that the activity of HDAC1 is essential for Ikaros-mediated repression of JARID1B.

Casein Kinase II (CK2) Inhibits Ikaros-Mediated Repression of JARID1B––Our next goal was to determine the signal transduction pathway that regulates Ikaros-mediated repression of JARID1B transcription. Previously published data show that Ikaros is a direct phosphorylation target of Casein Kinase II (CK2) and that phosphorylation of Ikaros by CK2 at its N-terminal serines/threonines reduces its DNA-binding ability and alters its subcellular localization (26). The role of CK2 in Ikaros-mediated repression of JARID1B was studied by luciferase reporter assay in 293T cells (Fig. 4A). Results showed that co-transfection of Ikaros exhibits stronger repressor activity in the

presence of the CK2-specific inhibitor TBB (Fig. 4A, bar 3 compared to bar 2). Next, we used phosphomimetic and phosphoresistant Ikaros mutants to further test whether phosphorylation by CK2 kinase affects Ikaros-mediated repression of JARID1B. Known CK2 phosphorylation sites in Ikaros (serine or threonine) were mutated to alanine (to produce Ikaros phosphoresistant mutants), or to aspartate (to produce Ikaros phosphomimetic mutants). The ability of Ikaros phosphomimetic and phosphoresistant mutants to repress transcription from the URE of JARID1B was tested by luciferase reporter assay. Results show that an Ikaros phosphoresistant mutant (with mutations at all 11 amino acids phosphorylated by CK2 – #13, #21, #23, #63, #101, #294, #389, #393, #394, #396, #398 as described previously – mutant IK-A11(27)) act as a transcriptional repressor of JARID1B in luciferase assays, and represses gene expression at least as well as wild type Ikaros (Fig. 4A bars 2 and 5). However, the phosphomimetic Ikaros mutant with mutations that mimic phosphorylation at five N-terminal amino acids phosphorylated by CK2 (mutant IK-D5) (26) was unable to repress transcription of JARID1B in the luciferase reporter assay (Fig. 4A bar 4 compared to bar 2). Treatment with the CK2-specific kinase inhibitor TBB did not result in transcriptional repression of JARID1B (Fig. 4A bar 6), unless cells were transfected with wild-type Ikaros (Fig. 4A bar 3 as compared to bar 6). These results suggest that phosphorylation of Ikaros at N-terminal CK2 phosphosites inhibits its ability to repress JARID1B transcription. These data also provide evidence that the inhibition of CK2 does not repress JARID1B transcription in the absence of Ikaros expression.

CK2 activity is increased in leukemia as compared to normal bone marrow (41,42). Since the results in Fig 4A suggest that phosphorylation by CK2 can regulate Ikaros’ ability to repress


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


10

transcription of JARID1B, we hypothesized that increased CK2 activity interferes with Ikaros-mediated repression of JARID1B in leukemia. To test this hypothesis, the effect of CK2 inhibition on Ikaros regulation of JARID1B transcription in leukemia was determined. Molecular inhibition of CK2 function using shRNA against the CK2 catalytic subunit CK2 alpha resulted in reduced transcription of JARID1B (as measured by qRT-PCR) (Fig 4B). The effect of pharmacological inhibition of CK2 on JARID1B transcription was tested using three different CK2 inhibitors – TBB, Quinalizarin and CX-4945. TBB has been used as a standard CK2-specific inhibitor for many years, however Quinalizarin exhibited a higher specificity toward CK2 when tested against a panel of 80 kinases (43). CX-4945 is the inhibitor that has the highest known specificity against CK2 (44,45) and is currently being tested in Phase I clinical trial. The effect of these CK2-specific inhibitors, on JARID1B transcription was measured by qRT-PCR in a panel of leukemia cells. Results showed that CK2 inhibition with TBB had a profound repressive effect on JARID1B transcription in all types of leukemia cells tested, except in DN3 cells – a T cell leukemia that is derived from Ikaros knock-out mice and thus lacks the Ikaros (Ikzf1) gene (Fig. 4C, column 5). Treatment with Quinalizarin and CX-4945 had similar effects on JARID1B transcription in leukemia cell lines (Fig. 4C, middle and right panels respectively). Western blot analysis demonstrated that the inhibition of CK2 also results in reduced expression of the JARID1B protein in various types of leukemia cells (Fig. 4D). Decreased expression of JARID1B was associated with increased levels of the histone H3K4me3 modification as documented by Western blot (Fig. 4D). Next, we determined whether the presence of Ikaros is necessary for the

transcriptional repression of JARID1B following CK2 inhibition. Nalm6 cells were transfected with scramble or Ikaros shRNA. The effect of CK2 inhibition on the transcription of JARID1B was compared in cells with reduced Ikaros expression and in control cells. Expression analysis shows that the CK2 inhibitor CX-4945 represses JARID1B transcription in cells treated with scramble shRNA (Figure 4E bar 3 vs. bar 1). However, the ability of CX-4945 to repress JARID1B is abolished, in cells with shRNA knock-down of Ikaros, as compared to control cells with scramble shRNA (Figure 4E, bar 4 as compared to bar 3, vs. bar 1). These results, along with inability of CK2 inhibitors to repress JARID1B transcription in cells that do not express Ikaros (293T cells-Fig. 4A, bar 6, and DN3 cells-Fig 4C, column 5) suggest that the JARID1B repression following CK2 inhibition requires Ikaros function as a transcriptional repressor.

Inhibition of CK2 Enhances Ikaros Binding and Recruitment of HDAC1 to the JARID1B URE––The effect of CK2 inhibition on Ikaros DNA-binding affinity toward the JARID1B URE was studied by qChIP. Results show that CK2 inhibition enhances Ikaros DNA-binding affinity toward the JARID1B URE in Nalm6 cells (Fig. 5A). In addition, CK2 inhibition is associated with enhanced HDAC1 recruitment as indicated by the much stronger HDAC1 binding at the regulatory region upstream of JARID1B that spans the area of Ikaros binding (Fig. 5B). These results suggest that CK2 activity regulates Ikaros-mediated repression of JARID1B via direct phosphorylation of Ikaros and possibly by affecting HDAC1 recruitment to the JARID1B URE.

Inhibition of CK2 Kinase Represses JARID1B Expression via Chromatin Remodeling––Both Ikaros and HDAC1 regulate transcription of their target genes via chromatin remodeling by inducing epigenetic changes around the transcriptional start


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


11

site (TSS). Since inhibition of CK2 activity results in repression of JARID1B via Ikaros and HDAC1, we tested whether repression of JARID1B is achieved through an epigenetic mechanism. Changes in the epigenetic markings around the TSS of JARID1B were measured by serial qChIP following CK2 inhibition. The five sets of primers used in qChIP spanned the promoter region from –500 bp to +300 bp relative to the JARID1B TSS (Fig. 5C). Results show that the inhibition of CK2 induces a strong enrichment in histone H3 trimethylation at lysine 27 (H3K27me3) throughout the promoter region of JARID1B (Fig. 5D). In addition, the acetylation of lysine 9 of Histone H3 at the JARID1B promoter was diminished following CK2 inhibition (Fig. 5E).

These results demonstrate that in leukemia cells, chromatin at the JARID1B promoter is in an open configuration, permissive to transcription, with strong H3K9 acetylation and the absence of H3K27me3 and high-level expression of JARID1B. CK2 inhibition results in increased Ikaros binding and enhanced recruitment of HDAC1 to the URE of JARID1B. This is associated with the formation of repressive chromatin, characterized by the loss of H3K9ac and the emergence of H3K27me3 at the JARID1B promoter and transcriptional repression of JARID1B.

Inhibition of CK2 Restores Ikaros-Mediated Repression of JARID1B in High-Risk B-Cell Precursor Acute Lymphoblastic Leukemia (B-ALL)––Deletion of a single Ikaros allele leads to the development of high-risk B-ALL that is characterized by poor prognosis and increased chance of relapse (8). Since CK2 activity interferes with Ikaros function, it has been hypothesized that the inhibition of CK2 might restore or enhance activity of the remaining Ikaros allele (28). To address this question, we tested whether CK2 regulates Ikaros-mediated repression of JARID1B in primary high-risk B-ALL cells.

These cells were obtained from a high-risk B-ALL patient with a deletion in one Ikaros allele resulting in Ikaros haploinsufficiency (IKhaploid).

qChIP analysis of IKhaploid B-ALL cells showed a lack of Ikaros binding at the URE of JARID1B. Following inhibition of CK2 by TBB for 24 hours, Ikaros binding to the same URE was detected by qChIP (Fig. 6A left columns). Similarly, binding of HDAC1 was undetectable in untreated IKhaploid B-ALL cells, but following CK2 inhibition with TBB, HDAC1 binding to the URE of JARID1B in IKhaploid B-ALL cells was demonstrated by qChIP (Fig. 6A right columns). Both Ikaros and HDAC1 occupancy of the URE of JARID1B was detected by qChIP using two different sets of primers that span a 200 bp region (Fig. 6A and data not shown). These data suggest that CK2-mediated phosphorylation of Ikaros can abolish the ability of Ikaros to bind the URE of JARID1B in high-risk leukemia. Inhibition of CK2 restores the ability of Ikaros to bind the URE of JARID1B and results in simultaneous recruitment of HDAC1 to this site.

We tested whether restoration of Ikaros binding to the URE of JARID1B following CK2 inhibition affects HDAC1 occupancy at the promoter region of JARID1B in high-risk leukemia. Results showed that HDAC1 does not bind to the JARID1B promoter in untreated high-risk leukemia cells, but inhibition of CK2 (TBB) results in HDAC1 occupancy at the JARID1B promoter (Fig. 6B).

These results suggest that recruitment of HDAC1 to the URE and promoter of JARID1B is directly related to Ikaros binding at this site, and thus, that Ikaros binding is the critical step responsible for the regulation of JARID1B transcription following CK2 inhibition.

Expression analysis shows that TBB treatment of IKhaploid B-ALL cells results in transcriptional repression of JARID1B, suggesting that the


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


12

restoration of Ikaros binding and the recruitment of HDAC1 to the URE and promoter of JARID1B leads to transcriptional repression of JARID1B (Fig. 6C).

We tested whether the inhibition of CK2 in primary high-risk IKhaploid B-ALL affects the epigenetic signature around the TSS of JARID1B as it does in the Nalm6 B-ALL cell line. Serial qChIP experiments spanning the JARID1B promoter show that the inhibition of CK2 induces high levels of the H3K27me3 repressive chromatin mark, along with reduced H3K9ac at the JARID1B promoter (Fig 6D-E). Taken together, these results demonstrate that the inhibition of CK2 kinase in high-risk B-cell precursor leukemia restores Ikaros binding to the JARID1B URE, along with recruitment of HDAC1 and transcriptional repression of JARID1B via chromatin remodeling.

Inhibition of JARID1B impairs leukemia cell proliferation. We analyzed the impact of Ikaros-mediated repression of JARID1B on leukemia cells. First, we compared expression of JARID1B in primary cells from patients with (B-ALL) and from normal bone marrow using qRT-PCR. Results showed that JARID1B is strongly upregulated in B-ALL as compared to normal bone marrow (Fig. 8A). These results are consistent with previously published results (46) and suggest that overexpression of JARID1B might play a significant role in the development of B-ALL.

Molecular inhibition of JARID1B using siRNA has shown that JARID1B is important for hematopoietic stem cells renewal (47,48). Here, we tested the effect of pharmacological inhibition of JARID1B on the proliferation of leukemia cells. Leukemia cell lines representing various lineages (as described in Fig. 1B) were treated with the specific JARID1B inhibitor, PBIT (34). Our results show that the inhibition of JARID1B by PBIT leads to severely impaired cellular

proliferation (Fig. 8B). This effect is more pronounced in ALL than in AML cell lines (Fig 8B left panel vs. right panel). PBIT similarly affects cellular proliferation in primary human leukemia cells (Fig. 8C). These data provide evidence that JARID1B expression and/or activity is essential for leukemia cell growth. These data suggest that one of the mechanisms by which Ikaros exerts its tumor suppressor activity in leukemia involves transcriptional repression of JARID1B, and identify JARID1B as a potential therapeutic target in leukemia.

DISCUSSION

Ikaros acts as a tumor suppressor in human leukemia by regulating the expression of a large set of genes. Although in vivo Ikaros binding at the promoter regions of multiple genes has been shown by ChIP-seq experiments, the mechanism through which Ikaros regulates global gene expression remains unknown (49,50). The studies presented here use gain-of-function and loss-of-function experiments to show that Ikaros represses transcription of JARID1B and regulates the global cellular level of H3K4me3. Our data suggest that Ikaros represses JARID1B by recruiting HDAC1 to the JARID1B promoter inducing a repressive state of chromatin.

JARID1B contains a JmjC domain that functions to remove tri- and di-methyl groups from lysine 4 of histone H3 (H3K4) (51). H3K4me2/3 modifications at the transcriptional start site (TSS) are a marker of actively transcribed genes (52-54). Overexpression of JARID1B is associated with breast (55,56), melanoma (57), prostate (51) and bladder (57,58) cancers. A search of the Oncomine database (59,60) showed that JARID1B is upregulated in multiple types of leukemia (46). JARID1B is important for hematopoietic stem cell renewal (47,48) and is overexpressed in acute myeloid leukemia (AML).


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


13

Our data demonstrated a strong increase in expression of JARID1B in B-ALL as compared to normal bone marrow. Drug development studies of small molecule inhibitors of JARID1B and vaccine-based immunotherapy directed at JARID1B are ongoing (34,36,58). The strong upregulation of JARID1B expression in leukemia coupled with growth arrest following JARID1B inhibition in various types of leukemia suggest an essential role for JARID1B in leukemia proliferation. This suggests that one mechanism of Ikaros tumor suppression involves negative regulation of JARID1B expression.

CK2 is a pro-oncogenic kinase that is upregulated in various types of cancer including leukemia (41). CK2 directly phosphorylates Ikaros at specific amino acids and impairs its function. (26,27). It has been hypothesized that CK2 exerts its pro-oncogenic potential by inhibiting the tumor suppressor activity of Ikaros (28). Several lines of evidence presented here suggest that CK2 regulates JARID1B transcription by impairing Ikaros function as transcriptional repressor: 1) Ikaros mutants that mimic CK2 phosphorylation lose the ability to repress JARID1B expression, while phosphoresistant mutants restore repression of JARID1B in luciferase reporter assays (Fig. 2A); 2) Both molecular (with shRNA) and pharmacological inhibition (with 3 different inhibitors) of CK2 results in JARID1B repression; 3) CK2 inhibition has no effect of on JARID1B repression in cells that do not express Ikaros (e.g. 293T and DN3 cells), or in B-ALL cells with Ikaros knock-down using shRNA. These data suggest that Ikaros is has an important and potentially critical role in the regulation of JARID1B transcription in B-ALL. Overall, the data presented here reveal the role of CK2, Ikaros and HDAC1 in regulating JARID1B transcription via epigenetic modifications and chromatin remodeling. Based on these results, we propose a

model by which CK2, Ikaros, and HDAC1 regulate transcription of JARID1B in B-ALL (Fig. 8). In this model, Ikaros, in complex with HDAC1, represses JARID1B transcription by inducing the formation of repressive chromatin with H3K27me3 and loss of H3K9ac. Phosphorylation by CK2 decreases Ikaros DNA binding affinity, which also impairs the recruitment of HDAC1 to the JARID1B promoter, resulting in the loss of H3K27me3-associated repression at the JARID1B TSS together with increased H3K9ac and consequently increased transcription of JARID1B. Inhibition of CK2 restores Ikaros-mediated repression of JARID1B via chromatin remodeling as described above. These results suggest the presence of a CK2-Ikaros-HDAC1-JARID1B pathway that is involved in global epigenetic regulation in leukemia. In this model, abrogation of Ikaros-mediated repression of JARID1B is one mechanism by which CK2 exerts its oncogenic action in leukemia, as well as a mechanism by which CK2 regulates the global epigenetic landscape leading to increased levels of H3K4me3.

The presence of defects in a single Ikaros allele is associated with B-ALL that is at high risk for relapse (8). Defects in a single copy of Ikaros results in the presence of one wild type allele and a second allele that either 1) does not produce Ikaros proteins or that 2) produces forms of Ikaros that are defective in DNA binding and which can potentially act as “dominant negative” mutants and inhibit (or impair) the function of the remaining wild type Ikaros. It is debatable whether cells with dominant-negative forms of Ikaros have any remaining Ikaros function. The elevated CK2 activity present in leukemia further abolishes the activity of any Ikaros produced by the remaining wildtype Ikaros allele. Since Ikaros likely binds DNA as a dimer or multimer (21), we hypothesize that the presence of short, potentially dominant negative, Ikaros isoforms that result from the


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


14

deletion of one allele do not completely impair the activity of the wild type allele, but rather that the loss of Ikaros activity in high-risk leukemia is the result of a combination of one defective allele and the functional inhibition of the wildtype Ikaros by CK2. Experiments presented in Fig. 7 were performed on primary high-risk ALL cells that have an Ikaros deletion affecting one allele and resulting in the expression of short DNA non-binding Ikaros proteins as well as wildtype Ikaros. Data shown here suggest that in these cells Ikaros activity as a repressor of JARID1B is lost, but that the inhibition of CK2 restores Ikaros-mediated repression of JARID1B via chromatin remodeling. These data support a model by which both increased CK2 activity and the deletion of a single Ikaros allele result in the loss of Ikaros function in high-risk ALL. More importantly, this suggests that CK2 inhibition can enhance the activity of the remaining wild type Ikaros allele and restore Ikaros tumor suppressor function, at least with respect to the regulation of JARID1B transcription. Recently, CK2 inhibition has been shown to restore Ikaros-mediated repression of the cell cycle-promoting genes and

genes that regulate the PI3K pathway in high-risk ALL with deletion of a single Ikaros allele, which supports our proposed model of JARID1B regulation by CK2 and Ikaros (61). CK2 is considered a target for treatment in various types of malignancies, and a phase I clinical trial with CK2 inhibitors has recently been completed for solid tumors. Further testing of this model through studies that examine the role of CK2 inhibition in restoring Ikaros tumor suppressor activity will be important.

In summary, we have presented data suggesting that Ikaros, in complex with HDAC1, regulates the transcription of JARID1B via chromatin remodeling. In leukemia, this process is impaired by the pro-oncogenic kinase, CK2. Treatment with CK2 inhibitors restores Ikaros-mediated repression of JARID1B causing increased global levels of H3K4me3. These studies provide a mechanistic rationale for the use of CK2 inhibitors as a potential therapeutic option in leukemia and suggest the presence of a CK2-Ikaros-HDAC1-JARID1B pathway that controls global epigenetic regulation in this disease.

Acknowledgements: The work has been supported by NIH grant R01 HL095120, a St. Baldrick’s Foundation Career Development Award, a Hyundai Hope on Wheels Scholar Grant Award, the Four Diamonds Fund of the Pennsylvania State University, College of Medicine, and the John Wawrynovic Leukemia Research Scholar Endowment (to SD). This work was also supported by NIH grant R21CA162259, a St. Baldrick’s Foundation Research Grant, a Hyundai Hope on Wheels Grant, (to KJP) the Department of Pathology and Human Anatomy, the Department of Basic Sciences (Grant to Promote Collaborative and Translational Research to KJP and CLM), and the Center for Health Disparities and Molecular Medicine (NIH P20MD006988) at Loma Linda University School of Medicine. This work was partially funded by NIH grant 1R15AI101968-01A1 (to GPD), and by the Natural Science Foundation of China (31200264), the Natural Science Foundation of Hubei Province (2015BCA268), “Chenguang Planning” from Natural Science Foundation of Wuhan City (2015070404010201 and 2014070404010210) (to MX). Conflict of interest: The authors declare that they have no conflicts of interest with the contents of this article.


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


15

Author contributions: SD conceived and coordinated the study and wrote the paper. HW, CS, and KJP wrote the paper. XP, ZG, CS, YD, OLF and KJP designed, performed and analyzed the experiments shown in Figure 1. HW, CG, GD, YD, ZG, MX, and CS designed, performed and analyzed the experiments shown in Figure 2. HW, XP, ZG, and BT designed, performed and analyzed the experiments shown in Figure 3. HW, YD, SM and CS designed, performed and analyzed the experiments shown in Figure 4. HW, ZG, and CG designed, performed and analyzed the experiments shown in Figure 5. HW, SM, MS and ZG designed, performed and analyzed the experiments shown in Figure 6. HW, OLF, CLM, KJP, HA, MX, and MS designed, performed and analyzed the experiments shown in Figure 7. HO and LL, analyzed and reviewed the data. All authors contributed to interpretation of data, manuscript revision and critical discussion. All authors reviewed the results and approved the final version of the manuscript. REFERENCES 1. Molnár, A., and Georgopoulos, K. (1994) The Ikaros gene encodes a family of functionally diverse zinc

finger DNA-binding proteins. Mol Cell Biol 14, 8292-8303 2. Georgopoulos, K., Moore, D. D., and Derfler, B. (1992) Ikaros, an early lymphoid-specific transcription

factor and a putative mediator for T cell commitment. Science 258, 808-812 3. Lo, K., Landau, N. R., and Smale, S. T. (1991) LyF-1, a transcriptional regulator that interactswith a novel

class of promoters for lymphocyte-specific genes. Mollecular Cellular Biology 11, 5229-5243

4. Ernst, P., Hahm, K., and Smale, S. T. (1993) Both LyF-1 and an Ets protein interact with a critical promoter element in the murine terminal transferase gene. Mol Cell Biol 13, 2982-2992

5. Georgopoulos, K., Bigby, M., Wang, J. H., Molnar, A., Wu, P., Winandy, S., and Sharpe, A. (1994) The Ikaros gene is required for the development of all lymphoid lineages. Cell 79, 143-156

6. Winandy, S., Wu, P., and Georgopoulos, K. (1995) A dominant mutation in the Ikaros gene leads to rapid development of leukemia and lymphoma. Cell 83, 289-299

7. Mullighan, C. G., Goorha, S., Radtke, I., Miller, C. B., Coustan-Smith, E., Dalton, J. D., Girtman, K., Mathew, S., Ma, J., Pounds, S. B., Su, X., Pui, C. H., Relling, M. V., Evans, W. E., Shurtleff, S. A., and Downing, J. R. (2007) Genome-wide analysis of genetic alterations in acute lymphoblastic leukaemia. Nature 446, 758-764

8. Mullighan, C. G., Su, X., Zhang, J., Radtke, I., Phillips, L. A., Miller, C. B., Ma, J., Liu, W., Cheng, C., Schulman, B. A., Harvey, R. C., Chen, I. M., Clifford, R. J., Carroll, W. L., Reaman, G., Bowman, W. P., Devidas, M., Gerhard, D. S., Yang, W., Relling, M. V., Shurtleff, S. A., Campana, D., Borowitz, M. J., Pui, C. H., Smith, M., Hunger, S. P., Willman, C. L., Downing, J. R., and Children's Oncology, G. (2009) Deletion of IKZF1 and prognosis in acute lymphoblastic leukemia. N Engl J Med 360, 470-480

9. Kim, J., Sif, S., Jones, B., Jackson, A., Koipally, J., Heller, E., Winandy, S., Viel, A., Sawyer, A., Ikeda, T., Kingston, R., and Georgopoulos, K. (1999) Ikaros DNA-binding proteins direct formation of chromatin remodeling complexes in lymphocytes. Immunity 10, 345-355

10. Zhang, J., Ding, L., Holmfeldt, L., Wu, G., Heatley, S. L., Payne-Turner, D., Easton, J., Chen, X., Wang, J.,


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


16

Rusch, M., Lu, C., Chen, S. C., Wei, L., Collins-Underwood, J. R., Ma, J., Roberts, K. G., Pounds, S. B., Ulyanov, A., Becksfort, J., Gupta, P., Huether, R., Kriwacki, R. W., Parker, M., McGoldrick, D. J., Zhao, D., Alford, D., Espy, S., Bobba, K. C., Song, G., Pei, D., Cheng, C., Roberts, S., Barbato, M. I., Campana, D., Coustan-Smith, E., Shurtleff, S. A., Raimondi, S. C., Kleppe, M., Cools, J., Shimano, K. A., Hermiston, M. L., Doulatov, S., Eppert, K., Laurenti, E., Notta, F., Dick, J. E., Basso, G., Hunger, S. P., Loh, M. L., Devidas, M., Wood, B., Winter, S., Dunsmore, K. P., Fulton, R. S., Fulton, L. L., Hong, X., Harris, C. C., Dooling, D. J., Ochoa, K., Johnson, K. J., Obenauer, J. C., Evans, W. E., Pui, C. H., Naeve, C. W., Ley, T. J., Mardis, E. R., Wilson, R. K., Downing, J. R., and Mullighan, C. G. (2012) The genetic basis of early T-cell precursor acute lymphoblastic leukaemia. Nature 481, 157-163

11. Sun, L., Heerema, N., Crotty, L., Wu, X., Navara, C., Vassilev, A., Sensel, M., Reaman, G. H., and Uckun, F. M. (1999) Expression of dominant-negative and mutant isoforms of the antileukemic transcription factor Ikaros in infant acute lymphoblastic leukemia. Proc Natl Acad Sci U S A 96, 680-685

12. Yagi, T., Hibi, S., Takanashi, M., Kano, G., Tabata, Y., Imamura, T., Inaba, T., Morimoto, A., Todo, S., and Imashuku, S. (2002) High frequency of Ikaros isoform 6 expression in acute myelomonocytic and monocytic leukemias: implications for up-regulation of the antiapoptotic protein Bcl-XL in leukemogenesis. Blood 99, 1350-1355.

13. Jager, R., Gisslinger, H., Passamonti, F., Rumi, E., Berg, T., Gisslinger, B., Pietra, D., Harutyunyan, A., Klampfl, T., Olcaydu, D., Cazzola, M., and Kralovics, R. (2010) Deletions of the transcription factor Ikaros in myeloproliferative neoplasms. Leukemia 24, 1290-1298

14. Tefferi, A. (2010) Novel mutations and their functional and clinical relevance in myeloproliferative neoplasms: JAK2, MPL, TET2, ASXL1, CBL, IDH and IKZF1. Leukemia 24, 1128-1138

15. Theocharides, A. P., Dobson, S. M., Laurenti, E., Notta, F., Voisin, V., Cheng, P. Y., Yuan, J. S., Guidos, C. J., Minden, M. D., Mullighan, C. G., Torlakovic, E., and Dick, J. E. (2015) Dominant-negative Ikaros cooperates with BCR-ABL1 to induce human acute myeloid leukemia in xenografts. Leukemia 29, 177-187

16. Rudant, J., Orsi, L., Bonaventure, A., Goujon-Bellec, S., Corda, E., Baruchel, A., Bertrand, Y., Nelken, B., Robert, A., Michel, G., Sirvent, N., Chastagner, P., Ducassou, S., Rialland, X., Hemon, D., Leverger, G., and Clavel, J. (2013) Are ARID5B and IKZF1 polymorphisms also associated with childhood acute myeloblastic leukemia: the ESCALE study (SFCE)? Leukemia 27, 746-748

17. Koipally, J., Renold, A., Kim, J., and Georgopoulos, K. (1999) Repression by Ikaros and Aiolos is mediated through histone deacetylase complexes. Embo J 18, 3090-3100

18. Koipally, J., and Georgopoulos, K. (2000) Ikaros interactions with CtBP reveal a repression mechanism that is independent of histone deacetylase activity. The Journal of biological chemistry 275, 19594-19602

19. Koipally, J., and Georgopoulos, K. (2002) Ikaros-CtIP interactions do not require C-terminal binding protein and participate in a deacetylase-independent mode of repression. The Journal of biological chemistry 277, 23143-23149

20. Brown, K. E., Guest, S. S., Smale, S. T., Hahm, K., Merkenschlager, M., and Fisher, A. G. (1997) Association of transcriptionally silent genes with Ikaros complexes at centromeric heterochromatin. Cell 91, 845-854

21. Trinh, L. A., Ferrini, R., Cobb, B. S., Weinmann, A. S., Hahm, K., Ernst, P., Garraway, I. P., Merkenschlager, M., and Smale, S. T. (2001) Down-regulation of TdT transcription in CD4+CD8+ thymocytes by Ikaros proteins in direct competition with an Ets activator. Genes and Development 15,


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


17

1817-1832 22. Gomez-del Arco, P., Maki, K., and Georgopoulos, K. (2004) Phosphorylation controls Ikaros's ability to

negatively regulate the G(1)-S transition. Mol Cell Biol 24, 2797-2807 23. Gomez-del Arco, P., Koipally, J., and Georgopoulos, K. (2005) Ikaros SUMOylation: switching out of

repression. Mol Cell Biol 25, 2688-2697 24. Dovat, S., Ronni, T., Russell, D., Ferrini, R., Cobb, B. S., and Smale, S. T. (2002) A common mechanism

for mitotic inactivation of C2H2 zinc finger DNA-binding domains. Genes Dev 16, 2985-2990 25. Li, Z., Song, C., Ouyang, H., Lai, L., Payne, K. J., and Dovat, S. (2012) Cell cycle-specific function of

Ikaros in human leukemia. Pediatr Blood Cancer 59, 69-76 26. Gurel, Z., Ronni, T., Ho, S., Kuchar, J., Payne, K. J., Turk, C. W., and Dovat, S. (2008) Recruitment of

ikaros to pericentromeric heterochromatin is regulated by phosphorylation. The Journal of biological chemistry 283, 8291-8300

27. Popescu, M., Gurel, Z., Ronni, T., Song, C., Hung, K. Y., Payne, K. J., and Dovat, S. (2009) Ikaros stability and pericentromeric localization are regulated by protein phosphatase 1. The Journal of biological chemistry 284, 13869-13880

28. Dovat, S., Song, C., Payne, K. J., and Li, Z. (2011) Ikaros, CK2 kinase, and the road to leukemia. Mol Cell Biochem 356, 201-207

29. Kathrein, K. L., Lorenz, R., Innes, A. M., Griffiths, E., and Winandy, S. (2005) Ikaros induces quiescence and T-cell differentiation in a leukemia cell line. Mol Cell Biol 25, 1645-1654

30. Wang, Z., Zang, C., Rosenfeld, J. A., Schones, D. E., Barski, A., Cuddapah, S., Cui, K., Roh, T. Y., Peng, W., Zhang, M. Q., and Zhao, K. (2008) Combinatorial patterns of histone acetylations and methylations in the human genome. Nat Genet 40, 897-903

31. Fujiwara, T., O'Geen, H., Keles, S., Blahnik, K., Linnemann, A. K., Kang, Y. A., Choi, K., Farnham, P. J., and Bresnick, E. H. (2009) Discovering hematopoietic mechanisms through genome-wide analysis of GATA factor chromatin occupancy. Mol Cell 36, 667-681

32. Ji, H., Jiang, H., Ma, W., Johnson, D. S., Myers, R. M., and Wong, W. H. (2008) An integrated software system for analyzing ChIP-chip and ChIP-seq data. Nat Biotechnol 26, 1293-1300

33. Hahm, K., Cobb, B. S., McCarty, A. S., Brown, K. E., Klug, C. A., Lee, R., Akashi, K., Weissman, I. L., Fisher, A. G., and Smale, S. T. (1998) Helios, a T cell-restricted Ikaros family member that quantitatively associates with Ikaros at centromeric heterochromatin. Genes Dev 12, 782-796

34. Sayegh, J., Cao, J., Zou, M. R., Morales, A., Blair, L. P., Norcia, M., Hoyer, D., Tackett, A. J., Merkel, J. S., and Yan, Q. (2013) Identification of small molecule inhibitors of Jumonji AT-rich interactive domain 1B (JARID1B) histone demethylase by a sensitive high throughput screen. The Journal of biological chemistry 288, 9408-9417

35. Ronni, T., Payne, K. J., Ho, S., Bradley, M. N., Dorsam, G., and Dovat, S. (2007) Human Ikaros function in activated T cells is regulated by coordinated expression of its largest isoforms. The Journal of biological chemistry 282, 2538-2547

36. Blair, L. P., Cao, J., Zou, M. R., Sayegh, J., and Yan, Q. (2011) Epigenetic Regulation by Lysine Demethylase 5 (KDM5) Enzymes in Cancer. Cancers (Basel) 3, 1383-1404

37. Su, R. C., Brown, K. E., Saaber, S., Fisher, A. G., Merkenschlager, M., and Smale, S. T. (2004) Dynamic assembly of silent chromatin during thymocyte maturation. Nat Genet 36, 502-506


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


18

38. Mai, A., Perrone, A., Nebbioso, A., Rotili, D., Valente, S., Tardugno, M., Massa, S., De Bellis, F., and Altucci, L. (2008) Novel uracil-based 2-aminoanilide and 2-aminoanilide-like derivatives: histone deacetylase inhibition and in-cell activities. Bioorg Med Chem Lett 18, 2530-2535

39. Hu, E., Dul, E., Sung, C. M., Chen, Z., Kirkpatrick, R., Zhang, G. F., Johanson, K., Liu, R., Lago, A., Hofmann, G., Macarron, R., de los Frailes, M., Perez, P., Krawiec, J., Winkler, J., and Jaye, M. (2003) Identification of novel isoform-selective inhibitors within class I histone deacetylases. J Pharmacol Exp Ther 307, 720-728

40. Khan, N., Jeffers, M., Kumar, S., Hackett, C., Boldog, F., Khramtsov, N., Qian, X., Mills, E., Berghs, S. C., Carey, N., Finn, P. W., Collins, L. S., Tumber, A., Ritchie, J. W., Jensen, P. B., Lichenstein, H. S., and Sehested, M. (2008) Determination of the class and isoform selectivity of small-molecule histone deacetylase inhibitors. Biochem J 409, 581-589

41. Kim, J. S., Eom, J. I., Cheong, J. W., Choi, A. J., Lee, J. K., Yang, W. I., and Min, Y. H. (2007) Protein kinase CK2alpha as an unfavorable prognostic marker and novel therapeutic target in acute myeloid leukemia. Clinical cancer research : an official journal of the American Association for Cancer Research 13, 1019-1028

42. Gomes, A. M., Soares, M. V., Ribeiro, P., Caldas, J., Povoa, V., Martins, L. R., Melao, A., Serra-Caetano, A., de Sousa, A. B., Lacerda, J. F., and Barata, J. T. (2014) Adult B-cell acute lymphoblastic leukemia cells display decreased PTEN activity and constitutive hyperactivation of PI3K/Akt pathway despite high PTEN protein levels. Haematologica 99, 1062-1068

43. Pagano, M. A., Bain, J., Kazimierczuk, Z., Sarno, S., Ruzzene, M., Di Maira, G., Elliott, M., Orzeszko, A., Cozza, G., Meggio, F., and Pinna, L. A. (2008) The selectivity of inhibitors of protein kinase CK2: an update. Biochem J 415, 353-365

44. Siddiqui-Jain, A., Drygin, D., Streiner, N., Chua, P., Pierre, F., O'Brien, S. E., Bliesath, J., Omori, M., Huser, N., Ho, C., Proffitt, C., Schwaebe, M. K., Ryckman, D. M., Rice, W. G., and Anderes, K. (2010) CX-4945, an orally bioavailable selective inhibitor of protein kinase CK2, inhibits prosurvival and angiogenic signaling and exhibits antitumor efficacy. Cancer Res 70, 10288-10298

45. Battistutta, R., Cozza, G., Pierre, F., Papinutto, E., Lolli, G., Sarno, S., O'Brien, S. E., Siddiqui-Jain, A., Haddach, M., Anderes, K., Ryckman, D. M., Meggio, F., and Pinna, L. A. (2011) Unprecedented selectivity and structural determinants of a new class of protein kinase CK2 inhibitors in clinical trials for the treatment of cancer. Biochemistry 50, 8478-8488

46. Haferlach, T., Kohlmann, A., Wieczorek, L., Basso, G., Kronnie, G. T., Bene, M. C., De Vos, J., Hernandez, J. M., Hofmann, W. K., Mills, K. I., Gilkes, A., Chiaretti, S., Shurtleff, S. A., Kipps, T. J., Rassenti, L. Z., Yeoh, A. E., Papenhausen, P. R., Liu, W. M., Williams, P. M., and Foa, R. (2010) Clinical utility of microarray-based gene expression profiling in the diagnosis and subclassification of leukemia: report from the International Microarray Innovations in Leukemia Study Group. J Clin Oncol 28, 2529-2537

47. Cellot, S., Hope, K. J., Chagraoui, J., Sauvageau, M., Deneault, E., Macrae, T., Mayotte, N., Wilhelm, B. T., Landry, J. R., Ting, S. B., Krosl, J., Humphries, K., Thompson, A., and Sauvageau, G. (2013) RNAi screen identifies Jarid1b as a major regulator of mouse HSC activity. Blood 122, 1545-1555

48. Stewart, M. H., Albert, M., Sroczynska, P., Cruickshank, V. A., Guo, Y., Rossi, D. J., Helin, K., and Enver, T. (2015) The histone demethylase Jarid1b is required for hematopoietic stem cell self-renewal in mice.


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


19

Blood 125, 2075-2078 49. Zhang, J., Jackson, A. F., Naito, T., Dose, M., Seavitt, J., Liu, F., Heller, E. J., Kashiwagi, M., Yoshida, T.,

Gounari, F., Petrie, H. T., and Georgopoulos, K. (2012) Harnessing of the nucleosome-remodeling-deacetylase complex controls lymphocyte development and prevents leukemogenesis. Nat Immunol 13, 86-94

50. Ferreiros-Vidal, I., Carroll, T., Taylor, B., Terry, A., Liang, Z., Bruno, L., Dharmalingam, G., Khadayate, S., Cobb, B. S., Smale, S. T., Spivakov, M., Srivastava, P., Petretto, E., Fisher, A. G., and Merkenschlager, M. (2013) Genome-wide identification of Ikaros targets elucidates its contribution to mouse B-cell lineage specification and pre-B-cell differentiation. Blood 121, 1769-1782

51. Xiang, Y., Zhu, Z., Han, G., Ye, X., Xu, B., Peng, Z., Ma, Y., Yu, Y., Lin, H., Chen, A. P., and Chen, C. D. (2007) JARID1B is a histone H3 lysine 4 demethylase up-regulated in prostate cancer. Proc Natl Acad Sci U S A 104, 19226-19231

52. Santos-Rosa, H., Schneider, R., Bannister, A. J., Sherriff, J., Bernstein, B. E., Emre, N. C., Schreiber, S. L., Mellor, J., and Kouzarides, T. (2002) Active genes are tri-methylated at K4 of histone H3. Nature 419, 407-411

53. Bernstein, B. E., Humphrey, E. L., Erlich, R. L., Schneider, R., Bouman, P., Liu, J. S., Kouzarides, T., and Schreiber, S. L. (2002) Methylation of histone H3 Lys 4 in coding regions of active genes. Proc Natl Acad Sci U S A 99, 8695-8700

54. Bernstein, B. E., Mikkelsen, T. S., Xie, X., Kamal, M., Huebert, D. J., Cuff, J., Fry, B., Meissner, A., Wernig, M., Plath, K., Jaenisch, R., Wagschal, A., Feil, R., Schreiber, S. L., and Lander, E. S. (2006) A bivalent chromatin structure marks key developmental genes in embryonic stem cells. Cell 125, 315-326

55. Barrett, A., Madsen, B., Copier, J., Lu, P. J., Cooper, L., Scibetta, A. G., Burchell, J., and Taylor-Papadimitriou, J. (2002) PLU-1 nuclear protein, which is upregulated in breast cancer, shows restricted expression in normal human adult tissues: a new cancer/testis antigen? Int J Cancer 101, 581-588

56. Madsen, B., Spencer-Dene, B., Poulsom, R., Hall, D., Lu, P. J., Scott, K., Shaw, A. T., Burchell, J. M., Freemont, P., and Taylor-Papadimitriou, J. (2002) Characterisation and developmental expression of mouse Plu-1, a homologue of a human nuclear protein (PLU-1) which is specifically up-regulated in breast cancer. Mech Dev 119 Suppl 1, S239-246

57. Roesch, A., Fukunaga-Kalabis, M., Schmidt, E. C., Zabierowski, S. E., Brafford, P. A., Vultur, A., Basu, D., Gimotty, P., Vogt, T., and Herlyn, M. (2010) A temporarily distinct subpopulation of slow-cycling melanoma cells is required for continuous tumor growth. Cell 141, 583-594

58. Hayami, S., Yoshimatsu, M., Veerakumarasivam, A., Unoki, M., Iwai, Y., Tsunoda, T., Field, H. I., Kelly, J. D., Neal, D. E., Yamaue, H., Ponder, B. A., Nakamura, Y., and Hamamoto, R. (2010) Overexpression of the JmjC histone demethylase KDM5B in human carcinogenesis: involvement in the proliferation of cancer cells through the E2F/RB pathway. Mol Cancer 9, 59

59. Rhodes, D. R., Yu, J., Shanker, K., Deshpande, N., Varambally, R., Ghosh, D., Barrette, T., Pandey, A., and Chinnaiyan, A. M. (2004) ONCOMINE: a cancer microarray database and integrated data-mining platform. Neoplasia 6, 1-6

60. Rhodes, D. R., Kalyana-Sundaram, S., Mahavisno, V., Varambally, R., Yu, J., Briggs, B. B., Barrette, T. R., Anstet, M. J., Kincead-Beal, C., Kulkarni, P., Varambally, S., Ghosh, D., and Chinnaiyan, A. M. (2007) Oncomine 3.0: genes, pathways, and networks in a collection of 18,000 cancer gene expression profiles.


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


20

Neoplasia 9, 166-180 61. Song, C., Gowda, C., Pan, X., Ding, Y., Tong, Y., Tan, B. H., Wang, H., Muthusami, S., Ge, Z., Sachdev,

M., Amin, S. G., Desai, D., Gowda, K., Gowda, R., Robertson, G. P., Schjerven, H., Muschen, M., Payne, K. J., and Dovat, S. (2015) Targeting casein kinase II restores Ikaros tumor suppressor activity and demonstrates therapeutic efficacy in high-risk leukemia. Blood 126, 1813-1822

FOOTNOTES 1 College of Animal Sciences, Jilin University, Changchun 130062, China 2 Pennsylvania State University College of Medicine, Hershey, PA 17033 3 Loma Linda University, Loma Linda CA, 92350 4 Division of Hematology, Oncology and Blood & Marrow Transplantation, Childrens Hospital Los Angeles, University of Southern California Keck School of Medicine, CA 90027 5 North Dakota State University, Fargo, ND 58108 6 College of Pharmacy, South-central University for Nationalities, Wuhan, 430074, China 7 To whom correspondence should be addressed: Sinisa Dovat, MD, PhD, Division of Pediatric Hematology/Oncology, Department of Pediatrics, Pennsylvania State University College of Medicine, Hershey, PA17033. E-mail: [email protected] 8 The abbreviations used are: JARID1B, Lysine-Specific Demethylase 5B; CK2, Casein Kinase 2; TSS, transcriptional start site; ALL, acute lymphoblastic leukemia; CEM, CCRF-CEM cell line; TBB, 4,5,6,7-Tetrabromobenzotriazole; B-ALL, B cell precursor acute lymphoblastic leukemia; IKhaplo, Ikaros haploinsufficiency; Ikaros-CTS, C terminus of Ikaros protein; qChIP, quantitative chromatin immunoprecipitation; PBIT (2-4(4-methylphenyl)-1,2-benzisothiazol-3(2H)-one); IRES, internal ribosomal entry site; EGFP, enhanced green fluorescent protein; T-ALL, early T-cell acute lymphoblastic leukemia; AML, acute myelogenous leukemia; TSA, trichostatin; qRT-PCR, quantitative reverse-transcriptase PCR; URE, URE FIGURE LEGENDS FIGURE 1. Ikaros binding in the URE of JARID1B. A, Representative ChIP-seq signal map for Ikaros binding to the JARID1B (KDM5B) locus in Nalm6 cells. Arrows depict ChIP-seq locations of Ikaros binding sites that are in close proximity to the transcription start site (TSS) of JARID1B. B, Quantitative chromatin immunoprecipitation (qChIP) analysis of Ikaros occupancy at the JARID1B URE in human leukemia cell lines and C, in primary leukemia cells from patients, originating from a range of blood lineages, with wild type Ikaros (Panel B and C, bars 1-3) or deletion of one Ikaros allele (Panel C, bar 4). Graphed data are the mean +/– SD of triplicates representative of one of 3 independent experiments. D, Schematic diagram of Ikaros consensus binding motifs in the human and mouse JARID1B UREs. Two horizontal lines represent the human (top) and mouse (bottom) 5′-flanking UREs. UREs were aligned based on sequence homology and transcriptional start sites (TSS). Vertical dashed lines connecting the two promoters indicate potentially conserved Ikaros core binding elements between species. The dark


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


21

horizontal line (qChIP) indicates the high affinity Ikaros binding site that was used in qChIP experiments. FIGURE 2. Ikaros represses transcription of JARID1B. A, The effect of Ikaros on transcription under the control of the URE of human JARID1B as measured by luciferase assay following transfection with human Ikaros (hIK, bar 2) or mouse Ikaros (mIK, bar 3) or control vector (bar 1). Western blots of Ikaros and actin under indicated conditions are shown at the top of the panel. B, qRT-PCR analysis of JARID1B expression in the mouse DN3 cell line or the C, human Nalm6 B-ALL cell line transduced with empty vector as a control (MIG) or with Ikaros (MIG-IK). D, Protein levels of JARID1B and H3K4me3 as measured by Western blot in Nalm6 cells transduced with empty vector control (MIG) or with Ikaros (MIG-IK). Western blot for PCNA and Histone H3 were used as a loading control. E, Quantification of changes in levels of JARID1B (left panel) and H3K4me3 (right panel) in Nalm6 cells following transduction with Ikaros (MIG-IK) as measured by scanning densitometry of Western blots and normalized to the control–Nalm6 transduced with empty vector (MIG). F, qRT-PCR analysis of Ikaros (left panel) and JARID1B (right panel) mRNA levels in Nalm6 cells transduced with scrambled shRNA (Ctrl-shRNA) or with Ikaros-shRNA (IK-shRNA). Graphed is the mean +/– SD of triplicates representative of one of 3 independent experiments. FIGURE 3. Repression of JARID1B by Ikaros occurs via HDAC1 A. Representative ChIP-seq signal map for HDAC1 binding to the JARID1B locus in Nalm6 cells. Arrows depict ChIP-seq locations of HDAC1 binding sites that are in close proximity to the transcription start site (TSS) of JARID1B. B, qChIP analysis of HDAC1, HDAC2, HDAC3 and HDAC8 occupancy at the JARID1B URE (URE) in human leukemia cell lines and C, in primary human leukemia cells originating from a range of blood lineages. D, Expression from the URE of JARID1B as measured by luciferase reporter assay following transfection with human Ikaros (hIK) in the absence (bar 2) or presence (bar 3) of the HDAC inhibitor trichostatin (TSA), or HDAC1-specific inhibitor MS-275 (bar 4) normalized to control vector. Western blots of Ikaros and actin under each condition are shown at the top of the panel. Graphed data is the mean +/– SD of triplicates representative of one of 3 independent experiments. E. Additional luciferase reporter assays measured expression from the URE of JARID1B following co-transfection with human Ikaros (hIK) and scramble siRNA (bar 3) or HDAC1-specific siRNA (bar 4), normalized to control vector. FIGURE 4. CK2 inhibits Ikaros-mediated repression of JARID1B. A, Expression from the URE (URE) of JARID1B, as measured by luciferase assay, following transfection with wild type Ikaros (bars 2-3) in the absence (bar 2) or presence (bar 3) of the CK2 inhibitor, TBB; with an Ikaros phosphomimetic mutant (mIK-D5–CK2 N-terminal phosphosites mutated to mimic phosphorylation) (bar 4); or with an Ikaros phosphoresistant mutant (mIK-A11–all identified CK2 phosphosites mutated, bar 5). The effect of the CK2 inhibitor, TBB on cells that were not transfected with Ikaros is shown (bar 6). B, qRT-PCR analysis showing the effects of molecular inhibition of the catalytic subunit of CK2 (CK2α-shRNA) on expression of JARID1B (left panel) and CK2α (right panel). C, qRT-PCR analysis of JARID1B expression in indicated leukemia cell lines that were cultured without (grey bars) or with the CK2 inhibitors, TBB (30µM), Quinalizarin (Quina, 100µM) or CX-4945 (5 µM) (black bars) as indicated. Top panel shows Western Blot of Actin from harvested cells to verify equal cell number for qRT-PCR


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


22

reactions. D, Protein levels of JARID1B and H3K4me3 as measured by Western blot in indicated leukemia cell lines that were cultured without (–) or with (+) TBB for 24 or 48 hours. PCNA and histone H3 were used as loading controls. Graphed data are the mean +/– SD of triplicates representative of one of 3 independent experiments. E, Effect of Ikaros knockdown on changes in JARID1B expression induced by CK2 inhibition with CX-4945 as measured by qRT-PCR. Figure 5. Inhibition of CK2 enhances Ikaros binding and recruitment of HDAC1 to the JARID1B URE A, qChIP analysis of Ikaros occupancy of the JARID1B URE in Nalm6 cells that were cultured without (–) or with (+) the CK2 inhibitor, TBB. B, qChIP analysis of HDAC1 occupancy of the JARID1B URE in Nalm6 cells that were cultured without (–) or with (+) TBB. C-E, Inhibition of CK2 induces transcriptionally repressive epigenetic changes at the JARID1B promoter. C, Schematic depicting the region of the JARID1B promoter used to analyze epigenetic changes by qChIP assay following CK2 inhibition with TBB. Positions of primers used for qChIP are indicated relative to the JARID1B transcription start site (TSS). D-E, qChIP analysis of the distribution of epigenetic changes: D, H3K27me3 and E, H3K9ac at the JARID1B promoter in Nalm6 cells that were cultured without (–) or with (+) the CK2 inhibitor, TBB. Graphed data are the mean +/– SD of triplicates representative of one of 3 independent experiments. FIGURE 6. Inhibition of CK2 restores Ikaros-mediated JARID1B repression in primary B cell precursor acute lymphoblastic leukemia (B-ALL) with Ikaros haploinsufficiency. Analyses of primary B-ALL cells that are Ikaros haploinsufficient (B-ALL IKhaploid) following culture without (–) or with (+) the CK2 inhibitor (TBB). A, qChIP analysis of Ikaros and HDAC1 occupancy at the JARID1B URE. B, qChIP analysis of HDAC1 occupancy of the JARID1B promoter using the primers described in Fig. 5. C, qRT-PCR analysis of JARID1B expression. D-E, qChIP analysis of the distribution of epigenetic changes: D, H3K27me3 and E, H3K9ac at the JARID1B promoter. Graphed data are the mean +/– SD of triplicates representative of one of 3 independent experiments. FIGURE 7. Targeting JARID1B with a specific inhibitor has an anti-leukemia effect. A. qRT-PCR analysis of JARID1B expression in primary normal bone marrow (BM) cells (control) as compared to leukemia samples from patients with B-ALL. n = 17 normal BM and 11 primary B-ALL. B-C. WST-1 cell proliferation assays of (B) leukemia cell lines and (C) primary leukemia cells untreated or treated with various doses of the JARID1B-specific inhibitor, PBIT. Shown are the ratio of absorbance at 440 nm of day 3/day 0 (D3/D0). Graphed in B-E are means + SD of triplicates representative of one of 3 independent experiments. FIGURE 8. A working model for the regulation of JARID1B transcription in leukemia by CK2, Ikaros, and HDAC1. In leukemia, CK2 phosphorylates Ikaros which decreases its DNA binding and recruitment of HDAC1 to the URE of JARID1B. The loss of Ikaros-mediated HDAC1 recruitment is associated with the enrichment of H3K9ac and absence of H3K27me3 at the JARID1B promoter and strong expression of JARID1B. Inhibition of CK2 results in dephosphorylation of Ikaros which increases its DNA binding affinity for the URE of JARID1B, recruitment of HDAC1, and epigenetic changes (loss


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


23

of H3K9ac and emergence of H3K27me3) at the JARID1B promoter. These changes downstream of CK2 inhibition lead to JARID1B repression and increased levels of H3K4me3 in the cell.


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


24

Fig 1


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


25

Fig. 2


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


26

Fig. 3


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


27

Fig. 4


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


28

Fig. 5


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


29

Fig. 6


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


30

Fig. 7


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


31

Fig. 8


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

Kimberly J. Payne and Sinisa DovatFrancis, Christopher L. Morris, Hisham Abdel-Azim, Glenn Dorsam, Meixian Xiang,

Gowda, Mansi Sachdev, Sunil Muthusami, Hongsheng Ouyang, Liangxue Lai, Olivia L. Haijun Wang, Chunhua Song, Yali Ding, Xiaokang Pan, Zheng Ge, Bi-Hua Tan, Chandrika

Lymphoblastic LeukemiaHistone Deacteylase 1 (HDAC1), and Casein Kinase 2 (CK2) in B Cell Acute

Transcriptional Regulation of JARID1B/KDM5B Histone Demethylase by Ikaros,

published online December 10, 2015J. Biol. Chem.

10.1074/jbc.M115.679332Access the most updated version of this article at doi:

Alerts:

When a correction for this article is posted•

When this article is cited•

to choose from all of JBC's e-mail alertsClick here


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/lookup/doi/10.1074/jbc.M115.679332

http://www.jbc.org/cgi/alerts?alertType=citedby&addAlert=cited_by&cited_by_criteria_resid=jbc;M115.679332v1&saveAlert=no&return-type=article&return_url=http://www.jbc.org/content/early/2015/12/10/jbc.M115.679332

http://www.jbc.org/cgi/alerts?alertType=correction&addAlert=correction&correction_criteria_value=early/2015/12/10/jbc&saveAlert=no&return-type=article&return_url=http://www.jbc.org/content/early/2015/12/10/jbc.M115.679332

http://www.jbc.org/cgi/alerts/etoc

http://www.jbc.org/

Documents

Transcriptional Regulation of JARID1B/KDM5B Histone ...Regulation of JARID1B Expression by Ikaros, HDAC1, and CK2! 1!! Transcriptional Regulation of JARID1B/KDM5B Histone Demethylase