DNA AND CELL BIOLOGYVolume 9, Number 10, 1990Mary Ann Liebert, Inc., PublishersPp. 777-781

LABORATORY METHODS

A Simplified Method for the Preparationof Transcriptionally Active Liver Nuclear Extracts

MASAHIRA HATTORI,* ANTONIO TUGORES,* LINDA VELOZ,* MICHAEL KARIN.tand DAVID A. BRENNER*

ABSTRACT

We have developed a simplified method for the preparation of liver nuclear extracts to study gene regulationand protein-DNA interactions. This protocol uses conventional laboratory equipment and standard re-

agents. The liver tissue is homogenized in a low-salt solution at physiological molarity with subsequent ad-justment of the molarity and purification of nuclei by density sedimentation. The nuclear extracts are tran-scriptionally active in a validated cell-free transcription assay and contain functional DNA-binding proteins.This protocol results in the rapid preparation of highly reproducible and active liver nuclear extracts.

INTRODUCTION

TISSUE AND CELL-TYPE-SPECIFIC EXPRESSION Of genes ÍSmediated by the interaction of irons-acting DNA-bind-

ing proteins with specific as-acting elements in the DNA(Gorski et ai, 1986; Scheidereit et ai, 1987; Karin et ai,1990). The first step in the biochemical analysis of thiscomplex system requires the preparation of nuclear ex-

tracts from the tissue or cell type of interest. These extractsare then used for in vitro transcription and the analysis ofDNA-protein binding. Most studies in this area utilize im-mortal tissue culture cells as a source of nuclear extractsthat are relatively simple to prepare (Ohlsson and Edlund,1986; Bodner et ai, 1987; Scheidereit et ai, 1987). How-ever, transformed cell lines may not reflect accurately thestate of differentiation seen in vivo. In addition, expres-sion of certain tissue specific genes is either highly reducedor completely extinguished in cell lines compared to nor-

mal tissue. Preparation of nuclear extracts from the pri-mary tissue, although advantageous, is far more difficultbecause of the presence of organ capsules, vascular struc-tures, interstitial connective tissue, extracellular proteases,and cellular heterogeneity. To circumvent these problems,elaborate protocols have been designed for the preparationof transcriptionally active nuclear extracts, some of which

require the construction of new equipment. Here we de-scribe a simplified method for the preparation of nuclearextracts from rat liver. The quality of these extracts wastested by in vitro transcription and mobility-shift assays.They are highly active in transcription and show appropri-ate tissue specificity.

METHODS

Preparation of nuclear extractsAll solutions, tubes, and centrifuges were maintained at

0-4°C. For each nuclear extract preparation, two maleFisher rats (150-250 grams) were anesthetized and killed byexsanguination. The preparation of rat liver nuclear ex-tracts was based on previous methods that produced func-tional DNA-binding proteins (Graves et ai, 1986; Johnsonet ai, 1987) or transcriptionally active extracts (Gorski etai, 1986; Lichtsteiner and Schibier, 1989). Hepatectomieswere performed, and the livers were cut with scissors intoapproximately 3-mm cubes in 10 ml of homogenizationbuffer (0.3 M sucrose, 10 mM HEPES pH 7.6, 0.74 mMspermidine, 0.15 mM spermine, 0.1 mM EDTA, 0.1 mMEGTA, 10 mM KC1, 1 mM DTT, 0.5 mM PMSF, and 2fig/m\ each of aprotinin, leupeptin, and bestatin). Excess

Departments of 'Medicine and tpharmacology, Center for Molecular Genetics, University of California, San Diego, La Jolla, CA92093.

777

778 HATTORI ET AL.

tissue and blood were removed. Half of the minced tissuewas added to 25 ml of homogenization buffer in a 55-mlPotter homogenizer and was homogenized with two or

three strokes by a motor-driven Teflon pestle. The homog-enate was transferred to a precooled 250-ml cylinder by fil-tering through a cheese cloth to remove debris. The re-

maining half of the tissue was homogenized following thesame procedure. The homogenized tissue (50 ml in solu-tion) was then mixed with 100 ml of cushion buffer (identi-cal to homogenization buffer except that the concentrationof sucrose was 2.2 M), resulting in a final sucrose concen-tration of 1.57 M. The homogenate was laid over 10 ml ofcushion buffer in 38-ml polyallomer ultracentrifuge tubes.The tubes were spun at 24,000 rpm for 50 min at FC in anSW28 ultracentrifuge rotor. The supernatant, including an

upper layer of lipids and intact cells, was removed and thetube was inverted for 10 min in ice to drain remaining buf-fer from the nuclear pellet.At this point, the resulting hepatic nuclei may be flash-

frozen in liquid nitrogen after resuspending the six nuclearpellets in 20 ml of nuclear storage buffer (25% glycerol, 50mM HEPES pH 7.6, 3 mM MgCl2, 0.1 mA/ EDTA, 1.0mM DTT, 0.1 mM PMSF). Subsequently, a volume of 5ml of frozen nuclei was reconstituted by the addition of 25ml of storage reconstitution buffer (12.5% glycerol, 2 mMHEPES pH 7.6, 116 mM KC1, 3 mM MgCl2, 0.1 mMEDTA, 1 mM DTT, 0.1 mM PMSF, 1.0 mM NaMo04, 2/¿g/ml aprotinin, 2 /¿g/ml leupeptin, 2 /¿g/ml bestatin). Thenuclei were resuspended with one stroke of a B pestle in a40-ml Dounce homogenizer (Wheaton) and lysed as de-scribed below.Alternatively, each fresh nuclear pellet was resuspended in

5 ml of nuclear lysis buffer (10% glycerol, 10 mM HEPESpH 7.6, 100 mM KC1, 3 mM MgCL, 0.1 mM EDTA,1.0 mM DTT, 0.1 ¡iM PMSF, and 2 /tg/ml each of aproti-nin, leupeptin, and bestatin). The nuclei were resuspendedby one stroke of a B pestle of a 40-ml Dounce homoge-nizer and brought to a final volume of 40 ml with nuclearlysis buffer; 20 ml of this nuclear suspension was trans-ferred to each 30-ml Oakridge tube. Next 2 ml of 4 M am-monium sulfate pH 7.9 was added to each tube, mixedwell, and incubated for 30-60 min with gentle agitation ona rocker platform at 4°C. The tubes were spun at 35,000rpm for 60 min at FC in a 55.2 Ti ultracentrifuge rotor.The supernatant was measured and transferred to cleanOakridge tubes avoiding the chromatin pellets. Then, 0.33mg of finely powdered ammonium sulfate per milliliter ofsupernatant was added to each tube. After the ammoniumsulfate was dissolved, the tubes continued incubating with-out shaking at 0°C for 15 min. The tubes were spun at35,000 rpm for 20 min at FC in a Ti 55.2 ultracentrifugerotor. The supernatant was discarded and the tubes wereinverted for 10 min on ice. The resulting nuclear proteinpellet was resuspended in 500 ¡A of nuclear dialysis buffer(20% glycerol, 20 mM HEPES pH 7.6, 0.1 M KC1, 0.2mM EDTA, 2 mM DTT, 0.1 mM PMSF, 1 mM NaMoO,,and 2 /ig/ml each of aprotinin, leupeptin, and bestatin).This pellet can be kept on ice overnight. Each tube waswashed with an additional 100 ¡A of nuclear dialysis bufferand transferred to a sterile, washed dialysis tubing. The

nuclear protein extract was dialyzed against 250 ml of nu-clear dialysis buffer with one change of dialysis solution.After 4 hr of dialysis, the nuclear extract was clarified byspinning in a microfuge at 4°C for 10 min. The superna-tant was aliquoted, flash-frozen in liquid nitrogen, andstored in liquid nitrogen.

Other methodsPlasmid DNA was prepared by the alkaline-NaDodSO.,

method followed by RNase A treatment and PEG precipi-tation, as previously described (Hattori and Sakaki, 1986).Cell-free transcription assays were performed with up to100 /ig of protein per reaction using the "G-free cassette"plasmids AdML 390 and Alb 400 according to the methodof Gorski et ai (1986). Mobility-shift assays were per-formed using 5-10 ¡ig of protein per reaction according tothe method of Fried and Crothers (1981) with some modi-fications (Hattori et ai, 1990). The double-stranded oligo-nucleotides used in the mobility-shift assays were theHNF-1 binding site in rat albumin (TGTGGTTAATGA-TCTACAGTTA) (Cereghini et ai, 1988), the consensus

sequence of the NF-1 binding site (GATCATTTTGGC-TTGAAGCCAATATGA) (Chodosh et ai, 1988), the con-sensus sequence of the AP-1 binding site (CTAGTGAT-GAGTCAGCCGGATC) (Angel et ai, 1987), the acute-phase response element (APRE) in rat c*2-macroglobulin(CTAGAGTGAGCAGTTTCTGGGAATTCTTTAAT-CCTTCTGGGAATTCTGGCT) (Hattori et ai, 1990), andthe NFxB binding site in the mouse Ig x enhancer (GGA-TCCTCAACAGAGGGGACTTTCCGAGGCCA) (Senand Baltimore, 1986).

RESULTS

The protocol described above yields 7-15 mg of nuclearextract protein per liver. The most stringent evaluation ofthese nuclear extracts was their use in cell-free transcrip-tion. Three liver nuclear extracts were independently pre-pared and tested in cell-free transcription assays using "G-free cassette" plasmids containing the adenovirus-2 majorlate promoter (AdML 360) (Fig. 1, lanes 3-5) and themouse albumin promoter (Alb 400) (Fig. 1, lanes 8-10) astemplates. Alb400 contains 650 bp of DNA upstream fromthe start site of transcription of the rat albumin promoter.These sequences were previously shown to be sufficient forconferring cell type specificity in vitro (Gorski et ai, 1986;Lichtsteiner et ai, 1987). AdmL390 contains 404 bp up-stream from the start of transcription of the adenovirus-2major late promoter, which is expressed efficiently in awide variety of tissues. The transcriptional activity of theseextracts was highly reproducible, as demonstrated in thethree extracts shown in Fig. 1, and in 27 other nuclear ex-tracts prepared in this laboratory. Two liver nuclear ex-tracts prepared by the method of Lichtsteiner and Schibler(1989) were also utilized in cell-free transcription for com-parison (Fig. 1, lanes 1, 2, 6, and 7).The basic parameters for the cell-free transcription assay

were optimized using the well-characterized Alb 400 plas-

SIMPLIFIED METHOD FOR LIVER NUCLEAR EXTRACTS 779

AdML390 Alb400MWI

603-

B.

Alb40020 40 80 120 160

Alb40015' 30' 45' 60' 90'

310- Alb400

a°° *0° %°v --¿>0-oV Alb400 AdML390

281-271-

234-

2 3 4 5 6 7 8 9 10

FIG. 1. Cell-free transcription products. Three indepen-dent liver nuclear extracts prepared using this protocol(lanes 3-5 and 6-10) and two nuclear extracts prepared bythe method of Lichtsteiner and Schibler (1989) (lanes 1-2and 6-7) were used to transcribe the G-free cassette plas-mids AdML 390 and Alb 400. The assay included 70 fig ofnuclear extract protein and 800 ng of template plasmid in-cubated for 45 min.

mid as template. Using 800 ng of template DNA, the tran-scription assay had maximal activity with 80 fig of nuclearextract per reaction (Fig. 2A). The transcriptional activityincreased with time of incubation until 30 min and thensubsequently reached a plateau (Fig. 2B). Using 70 fig ofnuclear extract, the transcriptional activity was maximalwith 800 ng of plasmid template per reaction (Fig. 2C).Transcription from AdML 390 and Alb 400 was eliminatedin the presence of 1 ¡ig/ml of a-amanitin (Fig. 2D), dem-onstrating that the observed transcripts were synthesizedby RNA polymerase II.The nuclear extracts were also used to characterize DNA

binding proteins by mobility shift assays (Fig. 3) andDNAse I protection assays (Hattori et ai, manuscript inpreparation). The extracts prepared by this protocolyielded highly reproducible binding to the binding site ofthe general transcriptional factor NF-1 (Fig. 3A) and to theliver-specific transcriptional factor HNF-1 (Fig. 3B). Com-

FIG. 2. Effect of varying conditions on the cell-free tran-scription products. A. Effect of nuclear extract concen-tration on the cell-free transcription of Alb 400. A total of800 ng of template plasmid was incubated for 45 min withdifferent concentrations of nuclear extract (20, 40, 80, 120,and 160 fig). B. Effect of incubation time on cell-freetranscription of Alb 400. A total of 800 ng of templateplasmid and 70 fig of nuclear extract protein were incu-bated for different lengths of time (15, 30, 45, 60, and 90min). C. Effect of template plasmid concentration on thecell-free transcription of Alb 400. A total of 70 fig of nu-clear extract protein was incubated for 45 min with differ-ent concentrations of Alb 400 plasmid (200, 400, 800,1,200, 1,600, and 2,000 ng). D. Effect of a-amanitin oncell-free transcription. A total of 70 fig of nuclear extractand 800 ng of template plasmid (Alb 400 or AdML 390)were incubated for 45 min in the absence (-) or presence(+) of 1 /ig/ml of a-amanitin.

petition experiments with unlabeled oligonucleotides in500-fold excess demonstrated the specificity of the DNAprotein binding (Fig. 3).

DISCUSSION

The biochemical mechanism involved in the regulationof cell-type and tissue-specific gene expression can be ef-fectively analyzed by using cell-free in vitro transcriptionsystems (Bodner and Karin, 1987; Scheidereit et ai, 1987;Lichtsteiner and Schibler, 1989). This approach resulted inthe characterization of transcription factors mediating cell-

780 HATTORI ET AL.

_<*] _# ¿¡^ y y ^ • ///V/

FIG. 3. Sequence specificity of protein DNA complexes.Mobility-shift assays were performed with 0.1 ng of radio-labeled probe [the binding site of NF-1 (A) or HNF-1 (B)]after incubating with no protein (0), 5 /¿g of liver nuclearextract alone (+ne), or 5 /ig of liver nuclear extract in thepresence of 50 ng of cold competing oligonucleotides [thebinding sites for NF-1, HNF-1, the acute-phase responsivefactor of a2-macroglobulin (APRE), AP-1 and NFxB].

type specificity. Several of these factors were purified to

homogeneity, their transcriptional activating functiondemonstrated in the in vitro transcription system, and theircDNAs cloned (Bodner et ai, 1988; Scheidereit et ai,1988; Frain et ai, 1989).Cell-free systems for transcription initially used either

whole-cell extracts (Manley et ai, 1980) or extracts of nu-clei isolated from cultured cells at low ionic strength (Dig-nam et ai, 1983a,b; Cereghini et ai, 1987). In subsequentprotocols for the preparation of tissue nuclear extracts,liver, and other tissues were homogenized in a low-salt,highly viscous sucrose-glycerol solution with centrifuga-tion to obtain highly purified sedimented nuclei (Gorski etai, 1986; Lichtsteiner et ai, 1987; Lichtsteiner and Schib-ier, 1989). A modified Waring Blendor was required to op-timize the latter procedure to exclude air and preventoxidation and degradation of the nuclei during homogeni-zation of the tissue in the viscous solution.In this protocol, homogenization is easily performed in a

low-salt solution at physiological molarity using conven-

tional equipment. The molarity of the homogenized solu-tion is then increased, and purified nuclei are pelletedthrough a 2.2 M sucrose gradient. Chelating agents, sper-mine, spermadine, a phosphatase inhibitor (NaMo04), andprotease inhibitors are used extensively. It was not neces-

sary to homogenize the tissue in highly viscous solutionsusing high-torque engines for driving the pestle or a modi-fied Waring Blendor.Previous methods have prepared DNA-binding proteins

by homogenizing liver cells in a low-sucrose buffer prior topurifying nuclei by antrifugation through a high-sucrosecushion (Graves et ai, 1986; Johnson et ai, 1987). How-ever, the protocol used in the present study consistentlyproduced a higher yield of nuclear extract with a highertranscriptional activity. The higher final concentration ofsucrose in the overlaying homogenization solution in thisstudy might explain in part the higher yield of nuclei (i.e.,less nuclei were lost at the interface between the overlayingsolution and the cushion). Also, the extensive use of pro-tease inhibitors resulted in greater transcriptional activityper milligram of nuclear extract protein. Finally, theNaMo04 increased the yield of phosphorylated DNA-binding proteins, such as the interleukin-6 responsive fac-tor in the a2-macroglobulin gene (Hattori et ai, unpub-lished observations).The extracts prepared by this protocol give faithful tran-

scription initiation and are highly active in both transcrip-tion and binding to specific DNA sequences. The use ofthis procedure for preparations of nuclear extracts shouldfacilitate the biochemical analysis of tissue-specific geneexpression.

REFERENCES

ANGEL, P., IMAGAWA, M., CHIU, R., STEIN, B., IMBRA,R.J., RAHMSDORF, H.F., JONAT, C, HERRLICH, P.,and KARIN, M. (1987). Phorbol ester-inducible genes containa common eis element recognized by a TPA-modulated trans-

acting factor. Cell 49, 729-739.BODNER, M., CASTRILLO, J.L., THEILL, L.E., DEERINK,T., ELLISMAN, M., and KARIN, M. (1988). The pituitary-specific transcription factor GHF-1 is a homeobox-containingprotein. Cell 55, 505-518.

BODNER, M., and KARIN, M. (1987). A pituitary-specificfrans-acting factor can stimulate transcription from the growthhormone promoter in extracts of non-expressing cells. Cell 50,267-275.

CEREGHINI, S., BLUMENFELD, M., and YANIV, M. (1988).A liver-specific factor essential for albumin transcription dif-fers between differentiated and dedifferentiated rat hepatomacells. Genes Dev. 2, 957-974.

CEREGHINI, S., RAYMONDJEAN, M., CARRANCA, A.G.,HERBOMEL, P., and YANIV, M. (1987). Factors involved incontrol of tissue-specific expression of albumin gene. Cell 50,627-638.

CHODOSH, L.A., BALDWIN, A.S., CARTHEW, R.W., andSHARP, P.A. (1988). Human CCAAT-binding proteins haveheterologous subunits. Cell 53, 11-24.

DIGNAM, J.D., LEBOVITZ, R.M., and ROEDER, R.G.(1983a). Accurate transcription initiation by RNA polymeraseII in a soluble extract from isolated mammalian nuclei. NucleicAcids Res. 11, 1475-1489.

DIGNAM, J.D., MARTIN, P.L., SHASTRY, B.S., and ROE-DER, R.G. (1983b). Eukaryotic gene transcription with puri-fied components. Methods Enzymol. 101, 582-598.

FRAIN, M., SWART, G., MONACI, P., NICOSIA, A.,STÄMPFIL, S., FRANK, R., and CÓRTESE, R. (1989). The

SIMPLIFIED METHOD FOR LIVER NUCLEAR EXTRACTS 781

liver-specific transcription factor LF-B1 contains a highly di-verged homeobox DNA binding domain. Cell 59, 145-157.

FRIED, M., and CROTHERS, D.M. (1981). Equilibria and ki-netics of lac repressor operator interactions by polyacrylamidegel electrophoresis. Nucleic Acids Res. 9, 6505-6525.

GORSKI, K., CARNEIRO, M., and SCHIBLER, U. (1986). Tis-sue-specific in vitro transcription from the mouse albumin pro-moter. Cell 47, 767-776.

GRAVES, B.J., JOHNSON, P.F., and McKNIGHT, S.L.(1986). Homologous recognition of a promoter domain com-mon to the MSV LTR and the HSV tk gene. Cell 44, 565-576.

HATTORI, M., ABRAHAM, L.J., NORTHEMANN, W., andFEY, G.H. (1990). Acute-phase reaction induces a specificcomplex between hepatic nuclear proteins and the interleukin 6response element of the rat a2-macroglobulin gene. Proc. Nati.Acad. Sei. USA 87, 2364-2368.

HATTORI, M., and SAKAKI, Y. (1986). Dideoxy sequencingmethod using denatured plasmid templates. Anal. Biochem.152, 232-238.

JOHNSON, P.F., LANDSCHULZ, W.H., GRAVES, B.J., andMcKNIGHT, S.L. (1987). Identification of a rat liver nuclearprotein that binds to the enhancer core element of three animalviruses. Genes Dev. 1, 133-146.

KARIN, M., CASTRILLO, J.-L., and THEILL, L.E. (1990).Growth hormone gene regulation: A paradigm for cell-type-specific gene activation. Trends Genet. 6, 92-96.

LICHTSTEINER, S., and SCHIBLER, U. (1989). A glycosylatedliver-specific transcription factor stimulates transcription of thealbumin gene. Cell 57, 1179-1197.

LICHTSTEINER, S., WUARIN, J., and SCHIBLER, U. (1987).The interplay of DNA-binding proteins on the promoter of themouse albumin gene. Cell 51, 963-973.

MANLEY, J.L., FIRE, A., LARRO, A., SHARP, P.A., andGEFTER, M.L. (1980). DNA dependent transcription ofadenovirus genes in soluble whole-cell extract. Proc. Nati.Acad. Sei. USA 77, 3855-3859.

OHLSSON, H., and EDLUND, T. (1986). Sequence-specificinteractions of nuclear factors with the insulin gene enhancer.Cell 45, 35-44.

SCHEIDEREIT, C.S., HEGUY, A., and ROEDER, R.G.(1987). Identification and purification of a human lymphoid-specific octamer-binding protein (OTF-2) that activates tran-

scription of an immunoglobulin promoter in vitro. Cell 51,783-793.

SCHEIDEREIT, C.S., CROMLISH, J.A., GERSTER, T.,KAWAKAMI, K., BALMACEDA, C.-G., CURR1E, R.A.,and ROEDER, R.G. (1988). A human lymphoid-specific tran-scription factor that activates immunoglobulin genes is ahomeobox protein. Nature 336, 551-557.

SEN, R., and BALTIMORE, D. (1986). Multiple nuclear factorsinteract with the immunoglobulin enhancer sequence. Cell 46,705-716.

Address reprint requests to:Dr. David A. Brenner

University of California, San DiegoDepartment of Medicine, 0623D

School ofMedicine9500 Gilman Drive

La Jolla, CA 92093-0623

Received for publication June 22, 1990, and in revised formAugust 20, 1990.

This article has been cited by:

1. Cibele C. Cardoso, Daniela A. Cabrini, Markus May, Claudia S. Bhagat, Nelida Eleno, Cécile Cayla, Thomas Walther,Michael Bader. 2011. Functional expression of angiotensinogen depends on splicing enhancers in exon 2. Molecularand Cellular Endocrinology 332:1-2, 228-233. [CrossRef]

2. Jie Wei, Hye Won Kang, David E. Cohen. 2009. Thioesterase superfamily member 2 (Them2)/acyl-CoA thioesterase13 (Acot13): a homotetrameric hotdog fold thioesterase with selectivity for long-chain fatty acyl-CoAs. BiochemicalJournal 421:2, 311-322. [CrossRef]

3. Yan Dong, Hua Dong Liu, Rui Zhao, Chun Zhang Yang, Xiao Qian Chen, Xin Hong Wang, Lok Ting Lau, JianguoChen, Albert Cheung Hoi Yu. 2009. Ischemia activates JNK/c-Jun/AP-1 pathway to up-regulate 14-3-3# in astrocyte.Journal of Neurochemistry 109, 182-188. [CrossRef]

4. Hyung Keun Kim, Hae Ryoun Park, Jun Sik Lee, Tae Sung Chung, Hae Young Chung, Jin Chung. 2007. Down-regulation of iNOS and TNF-# expression by kaempferol via NF-#B inactivation in aged rat gingival tissues.Biogerontology 8:4, 399-408. [CrossRef]

5. Kyung Jin Jung , Naoki Maruyama , Akihito Ishigami , Byung Pal Yu , Hae Young Chung . 2006. The Redox-SensitiveDNA Binding Sites Responsible for Age-Related Downregulation of SMP30 by ERK Pathway and Reversal by CalorieRestriction. Antioxidants & Redox Signaling 8:3-4, 671-680. [Abstract] [PDF] [PDF Plus]

6. Hyung Keun Kim, Hae Ryoun Park, Kyoung Hee Sul, Hae Young Chung, Jin Chung. 2006. Induction of RANTESand CCR5 through NF-#B Activation via MAPK Pathway in Aged Rat Gingival Tissues. Biotechnology Letters 28:1,17-23. [CrossRef]

7. E. K. Go, K. J. Jung, J. Y. Kim, B. P. Yu, H. Y. Chung. 2005. Betaine Suppresses Proinflammatory Signaling DuringAging: The Involvement of Nuclear Factor- B via Nuclear Factor-Inducing Kinase/I B Kinase and Mitogen-ActivatedProtein Kinases. The Journals of Gerontology Series A: Biological Sciences and Medical Sciences 60:10, 1252-1264.[CrossRef]

8. Rajakishore Mishra, Bibhu Ranjan Das. 2005. Activation of STAT5-cyclin D1 Pathway in Chewing Tobacco MediatedOral Squamous Cell Carcinoma. Molecular Biology Reports 32:3, 159-166. [CrossRef]

9. S. Laurent, P. Starkel, I. A. Leclercq, L. Lambotte, D. Maiter, Y. Horsmans. 2005. Molecular events associated withaccelerated proliferative response in rat livers when partial hepatectomy is preceded by a sham operation. EuropeanJournal of Clinical Investigation 35:2, 140-147. [CrossRef]

10. B. Sung, S. Park, B. P. Yu, H. Y. Chung. 2004. Modulation of PPAR in Aging, Inflammation, and Calorie Restriction.The Journals of Gerontology Series A: Biological Sciences and Medical Sciences 59:10, B997-B1006. [CrossRef]

11. K Tanaka. 2004. Aging increases DNase #, an apoptosis-related endonuclease, in rat liver nuclei: effect of dietaryrestriction. Experimental Gerontology 39:2, 195-202. [CrossRef]

12. Jee Hyun Um, Su Jin Kim, Dong Won Kim, Mee Young Ha, Jung Hee Jang, Dong Wan Kim, Byung Seon Chung, ChiDug Kang, Sun Hee Kim. 2003. Tissue-specific changes of DNA repair protein Ku and mtHSP70 in aging rats and theirretardation by caloric restriction. Mechanisms of Ageing and Development 124:8-9, 967-975. [CrossRef]

13. Elsa Rodrigues, Marie-Jose Vilarem, Vera Ribeiro, Patrick Maurel, Maria C. Lechner. 2003. Two CCAAT/enhancerbinding protein sites in the cytochrome P4503A1 locus. Potencial role in the glucocorticoid response. European Journalof Biochemistry 270:3, 556-564. [CrossRef]

14. H Kim. 2002. Influence of aging and calorie restriction on MAPKs activity in rat kidney. Experimental Gerontology37:8-9, 1041-1053. [CrossRef]

15. Hyon Jeen Kim, Kyung Jin Jung, Arnold Young Seo, Jae Sue Choi, Byung Pal Yu, Hae Young Chung. 2002. Calorierestriction modulates redox-sensitive AP-1 during the aging process. AGE 25:3, 123-130. [CrossRef]

16. Hyon-Jeen Kim, Byung-Pal Yu, Hae-Young Chung. 2002. Molecular exploration of age-related NF-#B/IKKdownregulation by calorie restriction in rat kidney. Free Radical Biology and Medicine 32:10, 991-1005. [CrossRef]

17. H Yabe. 2002. Lack of matrix metalloproteinase (MMP)-1 and -3 expression in Ewing sarcoma may be due to lossof accessibility of the MMP regulatory element to the specific fusion protein in vivo. Biochemical and BiophysicalResearch Communications 293:1, 61-71. [CrossRef]

18. Hyun Joo Kwon, Bo Kyung Sung, Jung Won Kim, Ji Hyeon Lee, Nam Deuk Kim, Mi Ae Yoo, Ho Sung Kang,Hyung Suk Baek, Song Ja Bae, Jae Sue Choi, Ryoya Takahashi, Sataro Goto, Hae Young Chung. 2001. The effect oflipopolysaccharide on enhanced inflammatory process with age: Modulation of NF-#B. AGE 24:4, 163-171. [CrossRef]

19. Mark E. Hansen, Fumio Matsumura. 2001. Down-regulation of particulate protein kinase C? and up-regulation of nuclearactivator protein-1 DNA binding in liver following in vivo exposure of B6C3F1 male mice to heptachlor epoxide.Journal of Biochemical and Molecular Toxicology 15:1, 1-14. [CrossRef]

20. T Badger. 2000. Cyclic Expression of Class I Alcohol Dehydrogenase in Male Rats Treated with Ethanol,. Biochemicaland Biophysical Research Communications 274:3, 684-688. [CrossRef]

21. P Supakar. 2000. Identification of Novel Sequence-Specific Nuclear Factors Interacting with Mouse Senescence MarkerProtein-30 Gene Promoter. Biochemical and Biophysical Research Communications 272:2, 436-440. [CrossRef]

22. Hyon-Jeen Kim, Kyu-Won Kim, Byung-Pal Yu, Hae-Young Chung. 2000. The effect of age on cyclooxygenase-2 geneexpression. Free Radical Biology and Medicine 28:5, 683-692. [CrossRef]

23. PASCALE L. ZIMMERMANN, CHRISTOPHE E. PIERREUX,1,3, GILDAS RIGAUD, GUY G. ROUSSEAU,FREDERIC P. LEMAIGRE. 1997. In Vivo Protein—DNA Interactions on a Glucocorticoid Response Unit of a Liver-Specific Gene: Hormone-Induced Transcription Factor Binding to Constitutively Open Chromatin. DNA and CellBiology 16:6, 713-723. [Abstract] [PDF] [PDF Plus]

24. P Vandoolaeghe. 1997. C/EBP Binds over the TATA Box and Can Activate the M Promoter of 6-Phosphofructo-2-kinase/fructose- 2,6-bisphosphatase. Biochemical and Biophysical Research Communications 232:1, 247-250.[CrossRef]

25. De-Zhong Liao, Agneta Blanck, Jan-Åke Gustafsson, Inger Porsch Hällström. 1996. Expression of the c-jun, jun-B,ets-2 and liver regeneration factor-1 (LRF-1) genes during promotion and progression of rat liver carcinogenesis in theresistant hepatocyte model. Cancer Letters 100:1-2, 215-221. [CrossRef]

26. Caryn M. Berkowitz, Cynthia S. Shen, Bahri M. Bilir, Edgardo Guibert, Jorge J. Gumucio. 1995. Different hepatocytesexpress the cholesterol 7#-hydroxylase gene during its circadian modulationin vivo. Hepatology 21:6, 1658-1667.[CrossRef]

27. Per Flodby, De-Zhong Liao, Agneta Blanck, Kleanthis G. H. Xanthopoulos, Inger Porsch Hällström. 1995. Expressionof the liver-enriched transcription factors C/EBP#, C/EBP#, HNF-1, and HNF-4 in preneoplastic nodules andhepatocellular carcinoma in rat liver. Molecular Carcinogenesis 12:2, 103-109. [CrossRef]

28. H MASAKAZU, I TAKASHI, I YOSHINORI, I TORU, H MASAHIRA, K SHINICHI, N YOSHIYUKI, SYOSHIYUKI. 1994. Expression of the #2-macroglobulin-encoding gene in rat brain and cultured astrocytes. Gene 141:2,155-162. [CrossRef]

29. S FITZPATRICK, J RICHARDS. 1993. Regulation of the rat aromatase gene in ovarian granulosa cells and R2C Leydigcells#. The Journal of Steroid Biochemistry and Molecular Biology 44:4-6, 429-433. [CrossRef]

30. MICHAEL C. NEHLS, MARIA L. GRAPILON, DAVID A. BRENNER. 1992. NF-I/Sp1 Switch Elements RegulateCollagen #1(I) Gene Expression. DNA and Cell Biology 11:6, 443-452. [Abstract] [PDF] [PDF Plus]

31. Ryutaro Izumi, Takeshi Yamada, Shun-ichi Yoshikai, Hiroyuki Sasaki, Masahira Hattori, Yoshiyuki Sakaki. 1992.Positive and negative regulatory elements for the expression of the Alzheimer's disease amyloid precursor-encodinggene in mouse. Gene 112:2, 189-195. [CrossRef]