Upload
arthur-freeman
View
218
Download
3
Tags:
Embed Size (px)
Citation preview
The ProblemThe Problem
Information must be transcribed from Information must be transcribed from DNA in order function further.DNA in order function further.
REMEMBER:REMEMBER:
DNADNARNARNAProteinProtein
Tanscription in ProkaryotesTanscription in Prokaryotes Polymerization catalyzed by RNA Polymerization catalyzed by RNA
polymerasepolymerase Can initiate synthesis Can initiate synthesis Uses rNTPsUses rNTPs Requires a templateRequires a template Unwinds and rewinds DNAUnwinds and rewinds DNA
4 stages4 stages Recognition and bindingRecognition and binding InitiationInitiation ElongationElongation Termination and release Termination and release
RNA PolymeraseRNA Polymerase 5 subunits, 449 kd (~1/2 size of DNA 5 subunits, 449 kd (~1/2 size of DNA
pol III)pol III) Core enzymeCore enzyme
2 2 subunits---hold enzyme together subunits---hold enzyme together --- links nucleotides together--- links nucleotides together ’’---binds templates---binds templates
---recognition---recognition Holoenzyme= Core + sigmaHoloenzyme= Core + sigma
RNA Polymerase FeaturesRNA Polymerase Features Starts at a Starts at a promoterpromoter sequence, sequence,
ends at ends at termination signaltermination signal Proceeds in 5’ to 3’ directionProceeds in 5’ to 3’ direction Forms a temporary DNA:RNA Forms a temporary DNA:RNA
hybridhybrid Has complete processivityHas complete processivity
RNA PolymeraseRNA Polymerase X-ray studies reveal a X-ray studies reveal a
“hand”“hand” Core enzyme closedCore enzyme closed Holoenzyme openHoloenzyme open Suggested mechanismSuggested mechanism NOTE: when sigma NOTE: when sigma
unattached, hand is unattached, hand is closedclosed
RNA polymerase stays RNA polymerase stays on DNA until on DNA until termination. termination.
Recognition Recognition Template strandTemplate strand Coding strandCoding strand PromotersPromoters
Binding sites for RNA pol on template Binding sites for RNA pol on template strandstrand
~40 bp of specific sequences with a ~40 bp of specific sequences with a specific order and distance between specific order and distance between them.them.
Core promoter elements for E. coliCore promoter elements for E. coli -10 box (Pribnow box)-10 box (Pribnow box) -35 box-35 box
Numbers refer to distance from Numbers refer to distance from transcription start site transcription start site
Template and Coding Template and Coding StrandsStrands
5’–TCAGCTCGCTGCTAATGGCC–3’3’–AGTCGAGCGACGATTACCGG–5’
5’–UCAGCUCGCUGCUAAUGGCC–3’
Sense (+) strandDNA coding strandNon-template strand
DNA template strandantisense (-) strand
RNA transcript
transcription
Typical Prokaryote PromoterTypical Prokaryote Promoter
Pribnow box located at –10 (6-7bp) Pribnow box located at –10 (6-7bp) -35 sequence ~(6bp)-35 sequence ~(6bp) Consensus sequences: Strongest Consensus sequences: Strongest
promoters match consensuspromoters match consensus Up mutation: mutation that makes Up mutation: mutation that makes
promoter more like consensuspromoter more like consensus Down Mutation: virtually any mutation Down Mutation: virtually any mutation
that alters a match with the consensusthat alters a match with the consensus
Consensus sequences
In Addition to Core Promoter In Addition to Core Promoter ElementsElements
UP (UP (uupstream pstream ppromoter) elementsromoter) elements Ex. E. coli rRNA genesEx. E. coli rRNA genes
Gene activator proteinsGene activator proteins Facilitate recognition of weak promoterFacilitate recognition of weak promoter
E. coli can regulate gene E. coli can regulate gene expression in many waysexpression in many ways
Stages of Stages of TranscriptionTranscription
Template recognitionTemplate recognition RNA pol binds to DNARNA pol binds to DNA DNA unwoundDNA unwound
InitiationInitiation ElongationElongation
RNA pol moves and RNA pol moves and synthesizes RNAsynthesizes RNA
Unwound region moves Unwound region moves TerminationTermination
RNA pol reaches endRNA pol reaches end RNA pol and RNA releasedRNA pol and RNA released DNA duplex reformsDNA duplex reforms
Transcription InitiationTranscription Initiation StepsSteps
Formation of closed promoter (binary) Formation of closed promoter (binary) complex complex
Formation of open promoter complexFormation of open promoter complex Ternary complex (RNA, DNA, and Ternary complex (RNA, DNA, and
enzyme), abortive initiation enzyme), abortive initiation Promoter clearance (elongation ternary Promoter clearance (elongation ternary
complex)complex) First rnt becomes unpaired First rnt becomes unpaired Polymerase loses sigmaPolymerase loses sigma NusA bindsNusA binds
Ribonucleotides added to 3’ endRibonucleotides added to 3’ end
HoloenzymeHoloenzyme Core + Core +
Closed (Promoter) Closed (Promoter) Binary ComplexBinary Complex
Open binary Open binary complexcomplex
Ternary complexTernary complex
Promoter clearancePromoter clearance
Back
Sigma (Sigma () Factor ) Factor Essential for recognition of promoterEssential for recognition of promoter Stimulates transcriptionStimulates transcription Combines with holoenzymeCombines with holoenzyme
““open hand” conformationopen hand” conformation Positions enzyme over promoterPositions enzyme over promoter
Does NOT stimulate elongationDoes NOT stimulate elongation Falls off after 4-9 nt incorporatedFalls off after 4-9 nt incorporated ““Hand” closesHand” closes
Variation in SigmaVariation in Sigma Variation in promoter sequence affects Variation in promoter sequence affects
strength of promoterstrength of promoter Sigmas also show variabilitySigmas also show variability Much less conserved than other RNA Much less conserved than other RNA
pol subunitspol subunits Several variants within a single cell. EX:Several variants within a single cell. EX:
E. coli has 7 sigmasE. coli has 7 sigmas B. subtilis has 10 sigmasB. subtilis has 10 sigmas
Different Different respond to different respond to different promoterspromoters
Sigma Variability in E. coliSigma Variability in E. coli Sigma70 (-35)TTGACA (-10)TATAAT
Primary sigma factor, or housekeeping sigma factor.
Sigma54 (-35)CTGGCAC (-10)TTGCA alternative sigma factor involved in transcribing
nitrogen-regulated genes (among others). Sigma32
heat shock factor involved in activation of genes after heat shock.
SigmaS (sigma38) stationary phase sigma factor. Activates genes involved in long term survival, eg.
peroxidase.
Sigma and Phage SP01Sigma and Phage SP01 Early promoter—recognized by Early promoter—recognized by
bacterial sigma factor. Transcription bacterial sigma factor. Transcription includes product, includes product, gp28gp28. .
gp28gp28 recognizes a phage promoter for recognizes a phage promoter for expression of mid-stage genes, expression of mid-stage genes, includingincluding
gp33/34gp33/34, which recognizes promoters , which recognizes promoters for late gene expression.for late gene expression.
Promoter Clearance and Promoter Clearance and ElongationElongation
Occurs after 4- 10 nt are addedOccurs after 4- 10 nt are added First rnt becomes unpaired from antisense First rnt becomes unpaired from antisense
(template) strand.(template) strand.DNA strands re-annealDNA strands re-anneal Polymerase loses sigma, sigma recycledPolymerase loses sigma, sigma recycled
Result “Closed hand” surrounds DNAResult “Closed hand” surrounds DNA NusA binds to core polymeraseNusA binds to core polymerase As each nt added to 3’, another is melted As each nt added to 3’, another is melted
from 5’, allowing DNA to re-anneal. from 5’, allowing DNA to re-anneal. RNA pol/NusA complex stays on until RNA pol/NusA complex stays on until
termination. Rate=20-50nt/second.termination. Rate=20-50nt/second.
TerminationTermination Occurs at specific sites on template Occurs at specific sites on template
strand called Terminatorsstrand called Terminators Two types of terminationTwo types of termination
Intrinsic terminatorsIntrinsic terminators Rho (Rho () dependent treminators) dependent treminators
Sequences required for termination Sequences required for termination are in transcribed regionare in transcribed region
Variation in efficiencies.Variation in efficiencies.
Intrinsic TerminatorsIntrinsic Terminators DNA template contains inverted repeats (G-C DNA template contains inverted repeats (G-C
rich)rich) Can form hairpinsCan form hairpins
6 to 8 A sequence on the DNA template that 6 to 8 A sequence on the DNA template that codes for Ucodes for U
Consequences of poly-U:poly-A stretch?Consequences of poly-U:poly-A stretch?
UUUUU
Intrinsic Intrinsic Termination Termination
RNA pol passes over RNA pol passes over inverted repeatsinverted repeats
Hairpins begin to Hairpins begin to form form in the in the transcripttranscript
Poly-U:poly-A Poly-U:poly-A stretch meltsstretch melts
RNA pol and RNA pol and transcript fall offtranscript fall off
Rho (Rho () Dependent ) Dependent TerminatorsTerminators
rho factor is ATP dependent rho factor is ATP dependent helicasehelicase
catalyses unwinding of RNA: DNA catalyses unwinding of RNA: DNA hybridhybrid
(17 bp)Rho Rho Dependent Dependent TerminatioTerminatio
nn rho factor rho factor is ATP is ATP dependent dependent helicasehelicase
catalyzes catalyzes unwinding unwinding of RNA: of RNA: DNA DNA hybridhybrid
50~90 50~90 nucleotidenucleotides/secs/sec
hexamer
Rho: Mechanism
Rho binds to transcript at loading site (up stream of terminator)
Hairpin forms, pol stalls
Rho helicase releases transcript and causes termination
mRNAmRNA Function—Transcribe message from DNA to Function—Transcribe message from DNA to
protein synthesis machineryprotein synthesis machinery CodonsCodons Bacterial—polycistronicBacterial—polycistronic Eukaryotic– monocistronicEukaryotic– monocistronic Leader sequence—non-translated at 5’ endLeader sequence—non-translated at 5’ end
May contain a regulatory region (attenuator)May contain a regulatory region (attenuator) Also untranslated regions at 3’ end.Also untranslated regions at 3’ end. Spacers (untranslated intercistronic Spacers (untranslated intercistronic
sequences)sequences) Prokaryotic mRNA—short livedProkaryotic mRNA—short lived Eukaryotic mRNA-can be long livedEukaryotic mRNA-can be long lived
Stable RNAStable RNA rRNA -Structural component of rRNA -Structural component of
ribosomesribosomes tRNA-Adaptors, carry aa to ribosometRNA-Adaptors, carry aa to ribosome SynthesisSynthesis
Promoter and terminatorPromoter and terminator Post-transcriptional modification (RNA Post-transcriptional modification (RNA
processing)processing) EvidenceEvidence
Both have 5’ monophospatesBoth have 5’ monophospates Both much smaller than primary transcriptBoth much smaller than primary transcript tRNA has unusual bases. EX pseudouridinetRNA has unusual bases. EX pseudouridine
Eukaryotic Eukaryotic TranscriptionTranscription
3 classes RNA pol (I-III)3 classes RNA pol (I-III) Many mRNA long livedMany mRNA long lived 5’ and 3’ ends of 5’ and 3’ ends of
mRNA modified. EX. mRNA modified. EX. 5’ cap5’ cap Poly-A tailPoly-A tail
Primary mRNA Primary mRNA transcript large, transcript large, introns removedintrons removed
MonocistronicMonocistronic
Eukaryotic TranscriptionEukaryotic Transcription Regulation very complexRegulation very complex Three different pols distinguished by Three different pols distinguished by
-amanitin sensitivity-amanitin sensitivity Pol I—rRNA, least sensitivePol I—rRNA, least sensitive Pol II– mRNA, most sensitivePol II– mRNA, most sensitive Pol III– tRNA and 5R RNA moderately Pol III– tRNA and 5R RNA moderately
sensitivesensitive Each polymerase recognizes a Each polymerase recognizes a
distinct promoterdistinct promoter
Eukaryotic RNA Eukaryotic RNA Polymerases Polymerases
RNA Pol. Location Products -Amanitin Sensitivity
Promoter
II NucleolusNucleolus Large rRNAs Large rRNAs (28S, 18S, (28S, 18S, 5.8S)5.8S)
InsensitiveInsensitive bipartite bipartite promoterpromoter
IIII NucleusNucleus Pre-mRNA, Pre-mRNA, some snRNAssome snRNAs
Highly Highly sensitivesensitive
UpstreamUpstream
IIIIII NucleusNucleus tRNA, small tRNA, small rRNA (5S), rRNA (5S),
snRNAsnRNA
Intermediate Intermediate sensitivitysensitivity
Internal Internal promoter and promoter and terminatorterminator
RNA Pol.RNA Pol. LocationLocation ProductsProducts--Amanitin Amanitin sensitivitysensitivity
II NucleolusNucleolusLarge rRNAs Large rRNAs
(28S, 18S, 5.8S)(28S, 18S, 5.8S)InsensitiveInsensitive
IIII NucleusNucleusPre-mRNA, some Pre-mRNA, some
snRNAs, snRNAs, snoRNAssnoRNAs
Highly Highly sensitivesensitive
IIIIII NucleusNucleustRNA, small tRNA, small rRNA (5S), rRNA (5S),
snRNAsnRNA
Intermediate Intermediate sensitivitysensitivity
Eukaryotic RNA PolymerasesEukaryotic RNA Polymerases