1

Unit 7: Molecular biology and genetics

The fact that DNA is a self-replicating molecule and can make copies of itself is the basis of all life forms. It is the essence of what life is. Indeed, according to Richard Dawkins in his book The Selfish Gene, DNA is the life form on planet Earth, perpetuating itself by using its code to direct the building of living organisms. Those best adapted organisms will survive and their DNA will proliferate in their descendants.

On successful completion of this topic you will: • be able to carry out experimental techniques involving manipulating

DNA, RNA and protein (LO3).

To achieve a Pass in this unit you will need to show that you can: • explain the process of DNA replication (3.1) • safely perform techniques to isolate DNA and mRNA (3.2) • describe the polymerase chain reaction (3.3).

DNA replication7.3

2

Unit 7: Molecular biology and genetics

7.3: DNA replication

1 DNAEvery time a cell divides to produce new cells its DNA is copied. Each molecule of DNA undergoes semi-conservative replication. Put very simply, the DNA unwinds and unzips to expose nucleotide bases. DNA polymerases catalyse the addition of activated DNA nucleotides, according to complementary base-pairing rules, to make two new identical molecules of DNA, each one containing one old strand and one new strand. Hence each new molecule contains half of the original molecule.

Before DNA synthesis begins the original strands are separated and the synthesis of the daughter strands begins at the replication fork at a site called an origin of replication where a replisome is assembled from many proteins. The initiation complex that is formed attracts DNA polymerases.

Synthesis of the new strands is called elongation and is aided by the proteins in the replisome.

Lastly the termination site replicates (see Figures 7.3.1 and 7.3.2).

Leading strand

Most recentlysynthesized

DNA

5’

3’

3’3’

3’

5’5’

5’

5’

3’5’

3’

3’3’

3’

5’5’

5’

5’

3’

Lagging strand withOkzaki fragments

Enzyme

Primasesynthesises RNA

DNA polymerase IIIextends RNA primerinto Okazaki fragments

DNA polymerase Iuses nick translationto replace RNA primerwith DNA

Next Okazaki fragmentis synthesised

Ligase seals the nick

Figure 7.3.1: The DNA replication fork. Because both daughter strands are

synthesised in the 5’ to 3’ direction, the DNA complementary to the lagging

strand is synthesised in small fragments called Okazaki fragments. These

fragments are then joined together.

Figure 7.3.2: Enzymes involved in DNA replication.

3

Unit 7: Molecular biology and genetics

7.3: DNA replication

The replisomeThe replisome consists of many proteins, including helicase, gyrase/topoisomerase, primase, DNA polymerases, RNAse H and ligase. One DNA polymerase complex synthesises the lagging strand and another synthesises the leading strand. There are also factors, called replication proteins, that protect both the unstable single-stranded unwound leading and lagging strands from making hydrogen bonds with themselves and forming hairpins.

Helicase Helicase causes the hydrogen bonds between complementary base pairs to break and so catalyses the separation of the two parental strands that will act as templates for synthesis of the daughter molecules. Helicase moves along the DNA in a 3’ to 5’ direction.

GyraseGyrase (a form of topoisomerase) unwinds the resulting supercoil that forms upstream of the section of unwound DNA.

DNA polymerasesDNA polymerases catalyse the elongation phase of replication.

Clamp proteinsClamp proteins help keep the DNA polymerases attached to the leading and lagging strands and make sure the process proceeds at a suitably fast rate.

PrimingIn eukaryotic cells a DNA-dependent RNA polymerase creates an RNA primer, of about 10 bases long, on both the newly separated leading and lagging strands, once for the leading strand and once per Okazaki fragment (about 1000 base pairs long) on the lagging strand. The RNA primer attached to its DNA template is called A-form DNA. (Normal DNA is called B-form DNA.)

In prokaryotes primase creates an RNA primer at the beginning of the newly separated leading and lagging strands. DNA polymerase enzymes cannot bind directly to single-stranded DNA and these primers provide a short chain of nucleotides that give the correct configuration to allow the active site of DNA polymerase to fit on and begin elongation.

ElongationThe leading and lagging strands are anti-parallel. In the leading strand nucleotide synthesis (catalysed by DNA polymerase epsilon in eukaryotes and by DNA polymerase III in prokaryotes) proceeds in the 5’ to 3’ direction (3’ to 5’ direction on the template strand) and makes a continuous complementary strand. Synthesis of the other strand in the opposite direction cannot occur at the same time so replication of the lagging strand is discontinuous. It involves making short discrete nucleotide chains, called Okazaki fragments, that are then joined by DNA repair enzymes, such as DNA polymerase I and ligase, so it is not made in one continuous strand.

Key termsLagging strand: The DNA strand that is synthesised (during replication) in a 5’ to 3’ direction away from the replication fork in short, Okazaki fragments that are then joined.

Leading strand: The DNA strand that is synthesised (during replication) with no or few interruptions, in a 5’ to 3’ direction towards the replication fork.

Primers: Short, single-stranded sequences of DNA or RNA, usually of around 10–20 bases long.

4

Unit 7: Molecular biology and genetics

7.3: DNA replication

This can only happen once a sufficient length of DNA has been unwound so replication of this strand lags behind that of the leading strand.

RNAse H enzymes remove the unstable RNA primers from the newly synthesised fragments and replace them with DNA fragments.

DNA ligase (aided by polymerase I in prokaryotes) enzyme connects the Okazaki fragments, closing the gaps between their sugar-phosphate backbones by catalysing the formation of phosphodiester bonds.

Proofreading enzymes correct any mistakes due to insertion of incorrect bases.

Case study: Investigation to find if the replisome moves along the DNA moleculeYou probably envisage the replisome moving along the DNA molecule. In 2000 Katherine Lemon and Alan Grossman, at the Massachusetts Institute of Technology (MIT), carried out an experiment using the bacteria Bacillus subtilis. They tagged the replisomes with a green fluorescent protein and used microscopy to observe its position in the cell during DNA replication. The replisome was always in the same position.

• What can you conclude from this investigation – does the replisome move along the DNA molecule or is the DNA fed through the replisome?

The polymerase chain reaction (PCR)First developed in 1983 by Kary Mullis, the polymerase chain reaction (PCR) is a way of amplifying small amounts of DNA in a laboratory for analysis. It is similar to DNA replication that happens in cells but it can only be used to amplify short lengths of DNA – up to 40-kilo base pairs – not whole chromosomes. Figure 7.3.3 summarises the process.

• Taq DNA polymerase is obtained from a thermophilic bacterium, Thermus aquaticus, so that the temperature does not have to be lowered to 37 °C at any stage, and this speeds up the process.

• Heat (95 °C), rather than helicase, causes the DNA strands to separate. • The temperature is reduced to 55 °C and DNA primers, complementary to

the 3’ ends of each strand of the DNA, are added to anneal at the ends of the separated chains and initiate DNA polymerase activity.

• Now DNA polymerase and a supply of activated DNA nucleotides (ATP, GTP, CTP and TTP) are added, the temperature is raised to 72 °C and the DNA is replicated.

• This one cycle has doubled the DNA. It can be repeated, increasing the DNA exponentially.

This process used to be lengthy, as it involved using water baths and timers, but it is now carried out in a PCR thermocycler that adjusts temperatures as necessary.

Activity: How many cycles?1 How many PCR cycles does it take to amplify one length of DNA into (a) 1 million lengths

(b) 2 million lengths?2 If it takes 8.5 seconds for one PCR cycle, how long does it take to amplify one length of DNA to

1 million copies of it?

Activity: Semi-discontinuous and semi-conservative1 Explain why the replication

of DNA is described as semi-discontinuous.

2 Explain why the replication of DNA is described as semi-conservative.

3 Research and write an illustrated account to show how Meselson and Stahl’s experiment confirmed that DNA replication is semi-conservative.

4 Make a 3D poster showing how a piece of DNA replicates.

Portfolio activity: PCR reactionCarry out PCR amplification of a DNA sample.

5

Unit 7: Molecular biology and genetics

7.3: DNA replication

Activity: Comparing DNA replication and PCRCompare the process of DNA replication with the polymerase chain reaction. You may want to use annotated diagrams or a table of information.

ATCGTAGCTACAGTACGCT

TAGCATCGATGTCATGCGA

TA

GC

AT

CG

AT

GT

CA

TG

CG

A

ATCGTAGCTACAGTACGCT

ATCGTAGCTACAGTACGCTGCGA

TAGCATCGATGTCATGCGA

ATCG

T

T CC

C

G G

G

G

G

T

TAGCTACAG

CGATGTCAT

TAGCATCGATGTCATGCGA

ATCG

ATCGTAGCTACAGTACGCT

GCGA

T

A

AA

C

T

A

1 Double-stranded DNA sample

3 Add primers and reduce temperature to 55 °C to allow primers to anneal

4 Raise temperature to 72 °C DNA polymerase binds and extends primers using free nucleotides

2 Heat to 95 °C – strands separated

PCR

Figure 7.3.3: The polymerase chain reaction (PCR).

Kacper works in a hospital laboratory, using the PCR reaction for pre-implantation genetic testing. If both parents carry a recessive allele, for example, for cystic fibrosis, they may choose to have IVF. Eggs are fertilised and grown in vitro until they reach the eight-cell stage. Without damaging the embryos, one cell can be taken and its DNA extracted and amplified using PCR. It can then be tested to see if it has normal alleles for the CFTR gene. One or two healthy embryos will then be implanted into the mother’s uterus.Pre-implantation genetic

testing technician

Patience is a molecular biologist who carries out genetic testing for several conditions including cystic fibrosis, coeliac disease, Down’s syndrome and HIV at a private pathology company. This involves extracting DNA from biological samples and amplifying it using the PCR. She begins each day by checking the worklist on the lab computer to see which tests have to be carried out that day. She then plans the day, according to how many tests and how long each one will take, so that she can get them all done. It takes a long time to extract DNA for HPV (human papilloma virus) assay so she extracts these first.

She has A levels in biology, chemistry and maths and a degree in biomedical science. She hopes to become a registered clinical scientist, which will take about six years and involves passing an exam so she can register with the Health Professions Council. This will open up many more career opportunities for her.

Molecular biologist

6

Unit 7: Molecular biology and genetics

7.3: DNA replication

ChecklistAt the end of this topic guide you should be familiar with the following ideas:

DNA is a self-replicating molecule and is duplicated during the S phase of the cell cycle, before the cell divides

replisomes, complexes of many proteins, most acting as enzymes, direct the DNA replication, which is semi-conservative and semi-discontinuous

as a molecule of DNA begins to unwind it forms the replication fork where unpaired nucleotides are exposed and can bind to complementary activated nucleotides – this process starts at the 3’ end of the template strand and is continuous on one strand (the leading strand), starting where an RNA primer has been added

on the other strand (the lagging strand), antiparallel to the leading strand, new DNA is synthesised in short Okazaki fragments, each started by an RNA primer that is then displaced, and ligase enzyme then joins the fragments together

proofreading enzymes check for errors

the polymerase chain reaction is a useful laboratory technique for augmenting small amounts of smaller lengths of DNA for forensic or clinical analysis.

AcknowledgementsThe publisher would like to thank the following for their kind permission to reproduce their photographs:

Corbis: MedicalRF.com

All other images © Pearson Education

We are grateful to the following for permission to reproduce copyright material:

Figure 7.3.1: The DNA replication fork, from Molecular biology of the cell, 5th ed. Alberts et al. Copyright 2008 from Molecular Biology of the Cell, Fifth Edition by Alberts et al. Reproduced by permission of Garland Science/Taylor & Francis LLC; Figure 7.3.2: Enzymes involved in DNA replication, from Genes by Benjamin Lewin, published by OUP, 1997. Used by permission; Figure 7.3.3: The polymerase chain reaction (PCR), from OCR A2 Biology, Pearson. Used with permission of Pearson Education Ltd.

Every effort has been made to trace the copyright holders and we apologise in advance for any unintentional omissions. We would be pleased to insert the appropriate acknowledgement in any subsequent edition of this publication.