Topic 17. Lecture 26. Evolution of Populations and Ecosystems-I

Last time, we considered whatever little is understood regarding Macroevolution at the functional level of molecules, cells, and multicellular organisms.

Now we are moving at the upper levels of populations andecosystems. At these levels, organisms are treated as individuals, ignoring their internal complexity and taking into account only their external features that characterize them as members of populations.

Naturally, the key problems of evolution cannot be addressed in this way - we will not attempt to understand complex adaptations by considering individuals. Still, many important and fascinating issues can be studied at the level of populations, including evolution of sex, aging , and interactive behavior.

Within its domain of applicability, treating organisms as individuals, and considering only simple external phenotypes, is a very productive approach to Macroevolution.

ACGATCGACGACGATCGATCGACGATCGA

Organism Individual

What questions can be addressed by considering Macroevolution of simple phenotypes?

Independently evolving individuals: Gene transmission: 1. Phenotypic plasticity 1. Mutation 2. Non-interactive behavior 2. Maintenance of sex 3. Semelparity and iteroparity 3. Crossing-over 4. Clutch size 4. Systems of mating 5. Dormancy 5. Origin of sex 6. Aging 6. Outcomes of genetic conflicts

Interactions between individuals: Complex population-level phenomena: 1. Warning coloration 1. Multicellularity and coloniality 2. Dispersal 2. Anisogamy and sex allocation 3. Aggression 3. Mate choice 4. Cooperation and altruism 4. Female preferences and male displays 5. Conflicts between gametes and sexes 6. Conflicts between relatives 7. Eusociality

For some of these questions, surprisingly definite answers have been obtained. For other questions, there are no definite answers yet, but, at least, we know how to look for them.

Independently evolving individuals: 1) phenotypic plasticity

Obviously, an individual can increase its fitness by developing the phenotype that suits its particular environment. The ability to do this is called phenotypic plasticity.

The norm of reaction of a genotype refers to the set of phenotypes that can be produces by this genotype under all feasible environments.

Some forms of phenotypic plasticity may be just imposed by physical laws, and not evolved - think of low fecundity under starvation.

When exposed to predators, a growing Daphnia develops "horns" (left) that offer it some protection.

The tadpoles of Pacific treefrog Pseudacris regilla develop different shapes in different environments. In the presence of predatory insects, tadpoles develop deep tails and bodies, while in the presence of predatory fish, tadpoles develop shallow tails and bodies.

Plants also often develop very different phenotypes under different environments, even when they are genetically identical, as these two plants are.

Independently evolving individuals: 2) non-interactive behavior

Let us consider just one aspect of non-interactive behavior, foraging. If the environment consists of "patches", foraging involves two decisions. The first is whether to enter a patch in search of food, and the second is to judge how long to continue searching for food in that location. The predator attempts to maximize

E/(H+S),

where E is the energy obtained from prey, S is the search time involved, and H is handling time that includes capture, killing, eating and digesting. For a range of prey, the predators average intake rate is

Eaverage/(Haverage+Saverage).

When the predator has found a new item, it has two choices. It can eat the new item, in which case the profitability is Enew/Hnew, or it can leave it and search for an item already in its diet, in which case the expected profitability is Eaverage/(Haverage+Saverage).

The predator should eat this new item if

Enew/Hnew ≥ Eaverage/(Haverage+Saverage).

This simple analysis leads to several predictions:

1) Predators with long Haverage and short Saverage should be specialists. Lions have a very low Saverage but a high Haverage, which can be prohibitively large for some prey individuals.

2) Predators with short Haverage and long Saverage should be generalists and consume a wide range of items.

3) Only predators with both Haverage and Saverage being short can afford using small prey with low Eaverage. An extreme case of such evolution is provided by star-nosed moles.

Unusual anatomical and behavioral specializations of star-nosed moles resulted from selection for speed, allowing the progressive addition of small prey to their diet.

Obviously, this analysis assumes that evolution can produce optimality, which may be justified because the phase space is simple in this case. Of course, there are trade-off's between E, H, and S - it is impossible to handle a moose in 120ms.

Independently evolving individuals: 3) semelparity and iteroparity

Many organisms are iteroparous, i. e. can reproduce repeatedly, often in the course of many years. However, some organisms are semelparous (monocarpic), and reproduce only once and then die. A three examples of semelparous species:

Agava Echium Salmon

Semelparity is taxonomically and ecologically widespread.

How can semelparity evolve? Why death after reproduction is often favored by selection?

Semelparous plants have a higher reproductive output per episode than iteroparous species. An organism that puts all available resources into reproduction will have a higher reproductive output than an organism that withholds some resources for future growth and survival.

For example, if a 10% increase in reproductive effort results in more than a 10% increase in reproductive success, then this increase will be favored by selection. If this differential holds over all levels of reproduction, natural selection favors putting all resources into reproduction, i. e. semelparity.

Again, we ignore internal functioning of the organism, and simply consider different dependencies of R. S. on R. E.

Independently evolving individuals: 4) clutch size

Parents can be expected to produce clutches of the size that maximizes their fitness (the number of surviving young) - and not the fitness of each individual offspring. Moreover, parents can also trade current against future reproduction, and the optimal clutch size is the one which maximizes lifetime reproductive success.

Highly fecund organisms sacrifice offspring size and viability for their increased numbers.

Relation between egg size and relative recapture rate (scaled to a maximum of 1) of juvenile Atlantic salmon. Dashed lines represent the derivative of the function relating maternal reproductive success to egg size.

Independently evolving individuals: 5) dormancy

Many species produce eggs or seeds that refrain from hatching despite developmental preparedness and favorable environmental conditions. Instead, these propagules hatch in intervals over long periods, although their viability declines with age. Such variable hatch tactics represents bet-hedging, by maternal individuals, against future catastrophes and evolve due to individual selection.

Germination and emergence are stimulated by environmental cues, but strongly influenced by maternal controls.

Independently evolving individuals: 6) aging

Aging (senescence) is a decline in performance and fitness with advancing age. The rate of aging is not prescribed by hard laws of physics, and "why individuals age at a particular rate?" is a perfectly legitimate evolutionary question.

Should selection be opposed to aging and favor immortality? Not necessarily: there is no selection in favor of high performance of an organism at ages that are never reached in nature .

However, this is not the whole story. There are two possible, fundamentally different, mechanisms of evolution of aging when potential fitness gain from old individuals is low:

1) Simple neglect: late performance deteriorates without any associated improvements, due to accumulation of age-specific deleterious mutations that affect only old individuals (MA = mutation accumulation).

2) Tradeoff: deterioration of late performance increases early performance, if the amount of resources allocated on maintenance decreases, more can be allocated on reproduction (AP = antagonistic pleiotropy).

In other words: is aging a part of the optimal life history, due to hard constraint that prevents evolution from improving early and late performance of the same individual?

Suppose that we did all what is possible to postpone aging without compromising early performance - by how much aging will be postponed? Extreme answers are: 1) indefinitely (MA) and 2) not at all (AP)

but the truth is probably somewhere in between (J. Evol. Biol. 20, 433-447, 2007).

B - control population,O - population selected for reproduction at old age.

In one of these experiments, the mean longevity of females increased by 25% after 15 generations, but the early-life fecundity was depressed.

Discovery of single-gene mutations that confer extended longevity also provide support for the AP model.

Antagonistic pleiotropy is supported by data from artificial selection experiments and from analysis of longevity-enhancing mutations in D. melanogaster. The artificial selection experiments used selective breeding from old individuals.

The MA also received some experimental support. A unique prediction of this model is that MA should lead to age-related increases in inbreeding depression and in the genetic variance of fitness components.

Age-specific estimates of additive genetic variance in fitness, with standard error bars.

Perhaps, both AP and MA mechanisms are important for the evolution of aging, but more data is needed (TREE 8, 458-463 AUG 2006).

Gene transmission: 1) mutation

Does mutation occur "out of necessity" or deliberately? A thought experiment: if there were no cost of DNA handling fidelity, would evolution lead to zero or to non-zero mutation rates? In other words, are the natural mutation rates minimal feasible or optimal? We do not know the answer.

One the one hand, most of non-neutral mutations are deleterious, so that reduction of the mutation rate can be favored by selection. On the other hand, occasional beneficial mutations are very important, and are necessary for evolution.

If natural mutation rates are the minimal ones that are not yet involved with prohibitive cost, evolution occurs only because laws of physics prevent evolution of zero mutation rate - which would stop all future evolution.

Gene transmission: 2) maintenance of sex

“We do not even in the least know the final cause of sexuality; why new beings should be produced by the union of the two sexual elements, instead of by a process of parthenogenesis?" (Darwin, 1861). Sexual forms are often capable of asex (apomixis, parthenogenesis): facultative asex is quite common. In particular, many forms independently evolved "cyclical asex":

A sample of cyclical asexuals: a monogonont rotifer, an aphid, and a cladoceran.

However, sex is only rarely lost completely, and when it happens, obligate asexuals are usually evolutionarily young. We known just two examples of "ancient asexual scandals":

Bdelloid rotifer Darwinulid ostracod

So, what prevents, in almost all cases, the complete loss of sex? Asex is much more efficient as a means of self-propagation. Moreover, in the case of 50:50 resource allocation between males and females, asex confers a two-fold advantage.

A rare clone of asexual females will DOUBLE its frequency every generation. Clearly, sex must confer a large, short-term advantage.

Sex apparently does not confer any immediate physiological benefits.

Thus, sex can only be advantageous due to genetic changes it causes in the offspring.

However, sex does not "improve" genotypes directly - it does not change allele frequencies.

Thus, sex could only confer an indirect advantage, by increasing genetic variation and thus making selection more efficient.

However, for this mechanism to work, two conditions must be met:

1) some factor(s) must create non-random associations between distributions of alleles at different loci - sex can only randomize genotypes and, without such associations, it would have no impact.

[AB] = [A]x[B]; [Ab] = [A]x[b]; [aB] = [a]x[B]; [ab] = [a]x[b]; dAB = 0; sex does nothing!

2) some factor(s) must make sure that overrepresented genotypes have LOW fitnesses - otherwise, reshuffling these genotypes by sex could only be deleterious.

If [AB] > [A]x[B], sex could be advantageous only if wAB if low!

There are two feasible reasons why each of these two conditions could be met. Thus, we arrive to a general 2x2 classification of hypotheses on the maintenance of sex:

What makes distributions of alleles at different loci non-independent: genetic drift selectionWhat makes overrepresented genotypes maladapted: changing environment ES ED (positive selection) deleterious mutations MS MD (negative selection)

ES = environmental stochastic,ED = environmental deterministic,MS = mutational stochastic,MD = mutational deterministic.

There are some hypotheses that do not fit into this classification, but they appear to be unlikely. Thus, let us consider the four classes of hypotheses: ES, ED, MS, and MD.

ES (environmental stochastic, or Fisher-Muller) hypothesis. Sex is beneficial because it can bring together beneficial mutations that appeared in different genotypes.

This mechanism could only work if many positive selection-driven allele replacements occur at the same time. Apparently, this is not the case.

The same is probably true for a variety of the ED (environmental deterministic) hypotheses - selection can hardly fluctuate in the way that could make sex advantageous.

Thus, let us consider a variety of stochastic hypotheses that involve deleterious mutations (some of them also involve beneficial mutations). We already encountered them.

(a) Accumulation of weakly deleterious mutations by background selection. In a large, non-recombining population at mutation-selection balance, only Y chromosomes free of strongly deleterious mutations will contribute to the ancestry of future generations. The effective population size (Ne) of the Y can therefore be greatly reduced. This reduces efficiency of selection and increases the rate of fixation of weakly deleterious mutations.

(b) Muller's ratchet. This process involves the stochastic loss of all Y chromosomes carrying the fewest number of deleterious mutations from a finite population. In the absence of recombination and back mutation, this class of chromosomes cannot be restored. The next best class then replaces it (i. e. the class of chromosomes with the next fewest number of deleterious mutations). This class can in turn be lost, in a succession of irreversible steps. Each such loss is quickly followed by the fixation of a deleterious mutation on the Y.

(c) Genetic hitchhiking by favorable mutations. The spread of a favorable mutation on a non-recombining Y-chromosome will drag to fixation any deleterious mutation initially associated with it. Thus, hitchhiking requires that selection coefficients for beneficial mutations are larger than for deleterious alleles. Successive adaptive substitutions on an evolving Y chromosome can lead to the fixation of deleterious mutations at many loci.

(d) Lack of adaptation on the non-recombining Y chromosome. The rate of adaptation on a non-recombining chromosome can be greatly reduced, owing to interference of positive mutations with linked deleterious alleles. If selection coefficients for beneficial mutations are of the same magnitude or smaller than those for deleterious mutations, only beneficial mutations on Y-chromosomes free of deleterious alleles can contribute to adaptation.

Evolutionary advantage of sex can be due to the same factors that cause degeneration of non-recombining sex chromosomes. However, all these mechanisms are long-term: loss of sex can be penalized only after a long delay. This appears to be a fatal flaw.

MD (mutational deterministic) hypothesis. Sex is beneficial because it increases variance of the number of deleterious mutations in genotypes, making narrowing negative selection against them more efficient.

The most efficient forms of selection, truncation and truncation-like, are narrowing and, thus, undermine their own efficiency. Sex can restore it, by randomizing the distribution of deleterious alleles within the population, and greatly diminish the mutation load. This mechanism can work under two conditions:

1) U > 1, as otherwise L is low even without sex. Recent data indicate that U > 1.

2) Narrowing selection (truncation-like selection, selection with synergistic epistasis) against deleterious mutations - this is controversial.

We still do not know why sex is the prevailing more of reproduction in eukaryotes.

Gene transmission: 3) crossing-over

Generally, crossing-over within sexual population is favored under the same conditions that favor sex over asex. However, in order to make crossing-over in a multochromosome genome substantially beneficial, some really strong selection must operate. A simple graph shows why this is the case:

If the genetic load is less than 50% under truncation selection, the immediate impact of crossing-over which increases the variance of the trait under selection is to reduce fitness.

Only if the genetic load is over 50% under truncation selection, the immediate impact of crossing-over is to increase fitness.

Thus, we the ubiquity of crossing-over is even more mysterious than the ubiquity of sex. It is wrong to claim that crossing-over is simply necessary for meiosis.

Gene transmission: 4) systems of mating

Usually, sex is accompanied by differentiation of gametes. Two kinds of gamete classes are particularly important:

1) Female (large) and male (small) gametes, a phenomenon known as anisogamy. The male–female dichotomy has evolved independently in nearly all clades of multicellular organisms.

2) Exogamous classes of gametes different from female-male dichotomy (mating types). They are common in ciliates, basidiomycetes, and flowering plants.

Inbreeding depression, is the likely cause of the evolution of such classes. Other mechanisms of inbreeding avoidance, including social taboos, are also common.

Gene transmission: 5) origin of sex

We have no direct data on the origin of sex, because it probably evolved before diversification of modern eukaryotes. Still, there is a plausible scenario for gradual origin of sex from asex:

1) Asexual ploidy cycle - alternation of genome duplications and reductions. Such cycles are known in several protozoans.

2) Origin of outcrossing by occasional cell fusions, followed by genetic reduction due to random chromosome loss.

3) Origin of regular amphimictic life cycle and crossing-over (from the already present mechanisms of DNA repair).

Nobody knows whether this is what actually happened - but there is no reasons to claim that gradual origin of sex by natural selection is impossible.

Gene transmission: 6) outcomes of genetic conflicts

Without sex, all genes that constitutes a genotype are in the same boat, forever. In contrast, sex makes different genes from the same genotype independent. This opens a possibility for conflicts between different genes in sexual populations.

An example of a genetic conflict:Mitochondria are inherited maternally. An allele of a mitochondrial gene that forces the organism to produce only ovules would spread in the population.

Left: this is what a nuclear gene wants - we will soon see, why.

Right: this is what a mitochondrial gene wants.

A genetic conflict occurs when the spread of an allele lowers the fitness of its bearer.

Segregation distorters (SD) is a common class of selfish alleles that create genetic conflicts by distorting fair Mendelian segregation.

Segregation distorters are known in Drosophila, mouse, and many other organisms.

Selfish elements involved in conflicts are often efficiently suppressed. Male killing, in which maternally inherited micro-organisms distort the sex ratio by killing male embryos, is the most deleterious form of sex ratio distortion for the host, leading to the double fitness cost of mortality and failure to produce the rare sex.

Suppression of male killer wBol1 evolved recently in many populations of Hypolimnas bolina. Independent evolution of selfish elements and their suppressors in different lineages may create Dobzhansky-Muller incompatibilities between them.

How important are genetic conflicts in general? If individual genes are selfish and can pursue their own evolutionary "interests", should we regard organisms just as temporary assemblages of genes of very limited importance?

Probably, the answer is negative: asexuals, protected from tyranny of individual genes pursuing their own interests are not much different from sexuals.

There are also more complex conflicts that involve different organisms - parent-offspring, male-female, etc. They will be considered later.

Left: A bdelloid rotifer - fully asexual for ~100 My, master of its genes.

Right: A monogonont rotifer - facultatively asexual, but going through sex regularly.

Quiz:

Propose an experiment that could finally determine what evolutionary mechanism is responsible for the maintenance of sex (I need ideas for the next grant application).