Vol. 171, No. 3JOURNAL OF BACTERIOLOGY, Mar. 1989, p. 1386-13930021-9193/89/031386-08$02.00/0Copyright C) 1989, American Society for Microbiology

Toluene Transposons Tn4651 and Tn4653 Are Class II TransposonsMASATAKA TSUDA,* KOH-ICHI MINEGISHI, AND TETSUO IINO

Laboratory of Genetics, Department of Biology, Faculty of Science, University of Tokyo, Hongo, Tokyo 113, Japan

Received 31 August 1988/Accepted 9 December 1988

The toluene degradative transposon Tn4651 is included within another transposon, Tn4653, and both ofthese elements are members of the Tn3 family. The tnpA gene product of each element mediates formation ofcointegrates as intermediate products of transposition, and the tnpS and tnpT gene products encoded by Tn4651take part in resolution of both Tn4651- and Tn4653-mediated cointegrates. Sequence analysis demonstratedthat Tn4651 and Tn4653 have 46- and 38-base-pair terminal inverted repeats, respectively, and that bothelements generate 5-basevpair duplication of the target sequence upon transposition. Complementation tests ofthe Tn4651- and Tn4653-encoded transposition functions with those of Tn3, Tn2l, and Tnl721 showed that (i)the trans-acting transposition functions encoded by Tn4651 were not interchangeable with those encoded by thefour other transposons, (ii) the Tn4653 tnpA function was interchangeable with the Tnl721 function, and (iii)Tn4653 coded for a resolvase (tnpR gene product) that complemented the tnpR mutations of Tn2l and Tn)721.The Tn4653 tnpR gene was located just 5' upstream of the tnpA gene and shared extensive sequence homologywith the Tnl721 tnpR gene. The res region was located adjacent to the tnpR gene, and sequence analysisindicated that failure of the Tn4653 tnpR product to resolve the Tn4653-mediated cointegrates is ascribed to anincomplete structure of the res region.

The Tn3-related (class II) transposons usually transposeby a two-step process by using two trans-acting factors (fora review, see reference 8). The tnpA product, transposase,catalyzes the first step, formation of a cointegrate of donorand target DNA molecules connected by two directly re-peated copies of the element, one at each junction. The tnpRproduct, resolvase, catalyzes the second step, site-specificresolution of the cointegrate between the two res regions.These class II transposons are also similar structurally,duplicating 5 base pairs (bp) of the target sequence uponinsertion, having short (35- to 48-bp) terminal invertedrepeats (IRs) of related sequences, and having some homol-ogy at the amino acid sequence level for their transposasesas well as resolvases. In general, this class of transposonscan be classified into two distinct groups, i.e., the Tn3 andTnl721 groups, based on the organization of their transpo-sition genes and on the interchangeability of the resolutionfunctions (Fig. 1; 5). The latter group can be further dividedinto the Tn2l and TnJ721-TnSOl subgroups based on theinterchangeability of the cointegration functions (Fig. 1; 6).A set of toluene degrading (xyl) genes on the Pseudomo-

nas TOL plasmid pWWO are located in the 56-kilobase (kb)transposon Tn4651 (23), and this element is in turn includedwithin a 70-kb transposon designated Tn4653 (24). Bothelements also transpose through the formation of the cointe-grates, and their respective tnpA genes, which indepen-dently mediate the cointegration, exhibit the genetic proper-ties common to those specified by the usual class IItransposons (23, 24). The two toluene transposons, how-ever, show some unique aspects in their resolution step (23,24). Resolution of both Tn4651- and Tn4653-mediatedcointegrates requires three Tn4651-encoded factors: one isthe cis-acting region, res, and the two others are the trans-acting factors, the tnpS and tnpT gene products. Further-more, the DNA fragment encoding these three factors islocated 48 kb from the Tn4651 tnpA gene (Fig. 1).

In this study, Tn4651 and Tn4653 were characterized in

* Corresponding author.

more detail by nucleotide sequencing of their ends and bycomplementation tests of their transposition functions withthose of the well-studied class II transposons, namely, Tn3,Tn2J, and Tnl721. The results allowed us to allocate Tn4653to the Tnl 721-Tn501 subgroup and Tn4651 to an entirely newgroup of the class II transposons.

MATERIALS AND METHODSMedia. L broth, L broth agar, and L broth top agar were

prepared as previously described (13, 23). Supplementsadded to the media were as follows, in micrograms permilliliter: ampicillin (Ap, 50); chloramphenicol (Cm, 30);kanamycin (Km, 50); nalidixic acid (Nal, 20); streptomycin(Sm, 200); tetracycline (Tc, 10); trimethoprim (Tp, 800);isopropyl-3-D-thiogalactopyranoside (IPTG, 0.1 mM); and5-bromo-4-chloro-3-indolyl-p-D-galactopyranoside (X-Gal,0.004%).

Strains, bacteriophages, and plasmids. The Escherichiacoli strains used were DH1 (recAl endAl gyrA96 thi-JhsdRJ7 supE44 relAI) (11), HB101 (hsdS20 recA13 ara-14proA2 lacYl galK2 rpsL20 xyl-5 mtl-l supE44) (11), andJM109 [recAl endAl gyrA96 thi-J hsdRJ7 supE44 relAlA(lac-proAB) (F' traD36 proAB+ lacIq ZAMJ5)] (28). Twoderivatives of bacteriophage M13, M13mp18 and M13mpl9(28), were employed as the vectors for DNA sequencing.The plasmids used are listed in Table 1 and also are depictedin Fig. 1 and Fig. 2.DNA manipulations and DNA sequencing. Plasmid DNA

preparation, its digestion with restriction endonucleases,filling in of cohesive ends by Klenow fragment of DNApolymerase I, agarose and polyacrylamide gel electrophore-ses, ligation, and transformation were carried out by theestablished procedures (11).The DNA fragment to be sequenced was cloned into the

M13 vector and propagated in JM109 (28). Sequencing wascarried out by the chain termination method of Sanger et al.(18) by using [o-32P]dCTP as the radioactive nucleotide. Fordetermination of the insertion sites of Tn1000, the uniqueSstI site in Tn1000 (7) was employed for cloning of the DNAfragments to be sequenced.

1386

on April 12, 2018 by guest

http://jb.asm.org/

Dow

nloaded from

TOLUENE TRANSPOSONS Tn4651 and Tn4653 1387

2 kb I

Dl ASs Sm Ss A Bg Sm

r mm---

4-

B V V~H~XiZ~ZI~Tn3

'-1,-ipMTl 216L.....--. J.......pMTI 204H V X D

AI t- Tn4652n pMT397

r-I pMT472r--' pMT506

I' pMT425EBg V V S Pv Pv E4-jTjiA 4152 i-'1*Ii~iLZAt~ ¢Tn4654__________________ ________________________________pMT1 590rpMTI 562

t.............IpMTl765&pMT1768

--TTnl72E Ps PvP E

Tnl721 -aI % )H TcpMT1 302

r-ee ipMTl 298LpMT1 294

E

cIi~B

E EA4 Ha Tn50L-A Tn51

B HH E4SuISmL T n 2 1Tn2

.---pMT1258r-i i - - pMT1248

L - 'pMT1 251

FIG. 1. Structures of various class II transposons. Maps are taken from references 3, 4, 9, 23, 24, and 25, and they are drawn so that theirtnpA genes are situated at the right-hand ends and transcribed in the rightward direction. (Note that the direction of the transcription of theTn4652 tnpA gene has not been determined.) A, tnpA gene; R, tnpR gene; S, tnpS gene; T, tnpT gene. Symbols: 4, left IR; *, right IR; *,res region; and , Kmr determinant in pMT1216. Tn4652 and Tn4654 are derived from Tn4651 and Tn4653, respectively, by in vivo deletionof the common internal 39-kb region containing all the xyl genes, and this deletion event is mediated by reciprocal recombination between thetwo directly repeated copies of a 1.4-kb sequence, leaving one copy (indicated by arrow) on the deletant transposons (12, 23, 24).Interchangeability has been reported for the resolvase functions among Tn2I, Tn1722, and Tn501 (5) and for the transposase functionsbetween Tnl722 and TnSOJ (6). Only the relevant restriction sites are depicted in the figure: A, AatII; B, BamHI; Bg, BglII; D, Dral; E,EcoRI; H, Hindlll; Ps, PstI; Pv, PvuII; S, Sall; Sm, SmaI; Ss, SstII; V, EcoRV; and X, XhoI. . and '-i indicate the DNA fragmentspresent on the pACYC184-based and the ColEl- or pBR322-based plasmids, respectively.

In vitro construction of plasmids. Plasmids pMT1251 andpMT1298 are HindIII- and PvuII-generated deletants ofpMT1233 and pMT1291, respectively (Fig. 1). PlasmidpMT1294 was obtained from pMT1286 by deletion of theDNA segment between the EcoRV site in the pBR322moiety and the PvuII site in the tnpR gene ofTnJ722 (Fig. 1).A derivative of pMT1244 deleting all the BamHI fragmentsin the Tn2J moiety was used to construct pMT1248 bysubsequent deletion of an HindlIl fragment in the Tn2J tnpRgene (Fig. 1). The pUC4K-derived Kmr determinant (26) wassubstituted for the BglII-PvuII fragment in pMT1489, thePstI-PvuII fragment in pMT1291, and all the EcoRI frag-ments in pMT1244 to construct pMT1590, pMT1302, andpMT1258, respectively. Insertion of this Kmr determinantinto the BamHI site on the EcoRV-generated deletant ofpMT1209 gave rise to pMT1216 (Fig. 1). Plasmid pMT1204,which carries a Kmr determinant and the Tn3-specified tnpAgene (Fig. 1), was constructed from RSF2124 (22) by inser-tion of the pUC4K-derived Kmr determinant at the SmaI sitein the ColEl moiety, followed by deletion of the DNAsegment between the Mlul site in the ColEl moiety and theBamHI site in the Tn3 moiety.

Assay of transposition functions. Transposition of variousmutant transposons was achieved by using the "mating-out"experiment (23). The pACYC184-based plasmid loaded withan appropriate transposon derivative (usually defective inthe tnpA gene but marked with the pUC4K-derived Kmrdeterminant) was introduced into the derivative of DH1containing R388, a conjugal plasmid devoid of transposableelements (4), and the ColEl- or pBR322-based plasmidcarrying a relevant tnpA gene. The resulting strain was used

as the donor to mate with the recipient strain HB101, and thetransposition frequency was expressed as the number of theKmr Smr transconjugants per R388 transconjugant.To investigate the resolution function, the mating-out

experiment was also adopted to construct the cointegrate ofR388 and a pACYC184-based plasmid connected by a rele-vant transposon derivative. This cointegrate was transferredinto the DH1 derivative harboring the ColEl- or pBR322-based plasmid with an insert of the whole appropriatetransposon sequence or a part of it. After overnight cultiva-tion of the resulting strain in L broth, stability of thecointegrate was examined by (i) agarose gel electrophoresisof the cleared lysate, (ii) restriction analysis of the resolvedplasmids, and (iii) mating with the recipient strain HB101 toselect for the Tpr transconjugants, followed by examinationof the coinheritance of the unselected Tcr or Cmr markerspecified by the pACYC184 replicon. (Lack of resolutioncould be indicated by the complete coinheritance of theselected and unselected markers in the transconjugants.)

RESULTS

Employment of Tn4652, Tn4654, and Tn1722. A 39-kbregion containing a set of xyl genes on Tn4651 and Tn4653 isbracketed by directly repeated copies of a 1.4-kb sequence(12), and this 39-kb region was, especially when introducedinto E. coli, eliminated at high frequency by recombinationbetween the direct repeats, forming Tn4652 and Tn4654,respectively (Fig. 1; 23, 24). Since the excised region doesnot encode transposition functions for Tn4651 and Tn4653(23, 24), we have restricted this study to Tn4652 and Tn4654.

VOL. 171, 1989

on April 12, 2018 by guest

http://jb.asm.org/

Dow

nloaded from

1388 TSUDA ET AL.

TABLE 1. Plasmids used in this study

Plasmid Characteristics Reference orsource

pBR322 Apr Tcr 2pUC4K Apr Kmra 26R388 Tra' Tpr, Sur 27RSF2124 Iel+ Apr, ColE1::Tn3 22pTY151 Iel+ Hgr Sur Smr, ColE1::Tn2l Y. SanopJOE106 Apr, pJOE100::Tnl722 20pMT252 Tcr, pACYC184A(ScaI-PvuII) 23pMT258 Cmr, pACYC184A(XbaI-SaII) 23pMT362 Apr, pBR322tet::Tn4652b 23pMT397 Tcr, Kmr pMT252::Tn4652-397 (Fig. 1); all the DraI fragments in Tn4652 are 23

replaced by a Kmr determinantpMT425 Apr, pBR322 derivative carrying the Tn4652 tnpA gene 23pMT472 Cmr, pMT258::Tn4652-472 (Fig. 1), A(tnpA tnpS) 23pMT506 Tcr, pMT252::Tn4652-506 (Fig. 1), A(tnpA tnpT) 23pMT1209 Cmr Apr, pMT258::Tn3c This studypMT1233 Apr Tcr Hgr Sur Smr, pBR322::Tn2lb,c.d This studypMT1244 Tcr Hgr Sur Smr, pMT252::Tn2lc This studypMT1286 Apr Tcr, pBR322::Tn1722b,c,d This studypMT1291 Tcr, pMT252::Tn1722c This studypMT1489 Tcr Kmr, pMT252::Tn4654-1476e 24pMT1500 Apr Tcr Kmr, pBR322::Tn4654-1476bde 24pMT1562 Cmr Kmr, pMT258::Tn4654-1562 (Fig. 1); all the EcoRV fragments in Tn4654 24

are replaced by a Kmr determinantpMT1765 Apr, pMT1500A(SaIIY This studypMT1768 Apr, pMT150OA(SaII-ClaIY 24

a The Kmr determinant is flanked by inverted repeats of the oligonucleotides containing the restriction sites for EcoRI, BamHI, Sail, and PstI.b The transposon is inserted in the orientation so that its right end relative to the left one (Fig. 1) is clockwise on the pBR322 map (15).c The plasmid was constructed by the mating-out experiment, and the donor plasmid used was the R388 derivative, which had acquired Tn3, Tn21, or Tnl722

from RSF2124, pTY151, or pJOE106, respectively.d The transposon is located between the PvuII site and its closest AccI site on pBR322 (15).eTn4654-1476 carries the insertion of the pUC4K-derived Kmr determinant at the unique BgII site in the Tn4652 moiety (Fig. 1).f The derivative of pMT1500 lacking the DNA segment between the rightmost Sall site in the Tn4654 moiety (Fig. 1) and the Satl site (in the case of pMT1765)

or the ClaI site (in the case of pMT1768) in the pBR322 moiety.

Transposon Tnl722 occupies the left half of Tnl721 (Fig.1), and the right-hand ends of both elements are identical insequence for at least 89 bp (19). Furthermore, both elementstranspose by use of the tnpA and tnpR genes and the resregion of Tnl722, thus revealing no essential difference intheir transposable properties (25). This study therefore em-ployed Tn1722 as a precursor for construction of variants.Complementation of cointegration functions. Complemen-

tation of the tnpA mutations of the five transposons Tn4652,Tn4654, Tnl722, Tn2J, and Tn3 was attempted by provisionin trans of any one of the five wild-type tnpA genes. TheTn4652 tnpA function was not interchangeable with those of

E E

Y~I \Yk~kcT T \TM

the four other transposons (Table 2). In contrast, Tn4654showed interchangeability with Tnl722 at high efficienciesand with Tn21 at much lower efficiencies; the efficiencies ofcomplementation between Tn4654 and Tn21 were compara-ble to those between Tnl722 and Tn2J. In contrast to ourresults, Grinsted et al. (6) have reported that the Tnl722transposase did not complement a tnpA mutation of Tn2J.One possible explanation for this discrepancy might be themuch higher expression of the Tn1722 tnpA gene bypMT1294 than by the complementing plasmid used by Grin-sted et al. (6).Complementation of resolution functions. The two mini-

1.0 kb. o

tnpR mtnpAI I I IJ I I

S Pv E Av Pv E Pv Av E

pMT1768 L

pMTI 772E

EpMT1 771 1

AvpMTI 802 L A

pMT1 770 L

E

Av

E.U

FIG. 2. Map of Tn4654 tnpR and tnpA genes. Depicted is the physical map of the rightmost 3.7-kb fragment of Tn4654 present onpMT1768, and abbreviations for restriction sites are the same as those in Fig. 1, except for Av (AvaI). L , DNA fragment present on thedeletion derivative of pMT1768. The insertion sites of the pUC4K-derived Kmr determinant (V) and TniOOO (V) on pMT1768 (24) areindicated above the physical map.

J. BACTERIOL.

on April 12, 2018 by guest

http://jb.asm.org/

Dow

nloaded from

TOLUENE TRANSPOSONS Tn4651 and Tn4653 1389

.%D A 10 20 30 40 50 60n H H 3H H 3 B Tn3L GGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGggattttggtcatgagattatc

" t R --------------------------------------caacgttttctgcctctgacgco"° =]5r5 -°0O Tn4SS2L GGGGTCATGCCGAGATAAGGCAAAAATTAGGACATTCGTTCTCTAAgctattgtatttaaC

oD0 :T Tn4652_HHHn H ~~~rAA R----T-------------------G---atatatgatttaaa

1< CD&' ° B , J Tn4654L GGGGACGATAGAGAATTCGGAAAAAATCGTACGCTAAGcttcgcgagttcttgtaaccaa

R -----GCCCGC --------------------------gttttccgggcaaccgtagcgg

L GGGGGAACCGCAGAATTCGGAAAAAATCGTACGCTAAGctaacggtgttctcgtgacagcC248A A A A Tn R ----AGC---- ----gttttccgggcatccgtaaggg

(3 x -Ooo o Tn5O1L GGGGGAACCGCAGAATTCGGAAAAAATCGTACGCTAAGctaacggtgttctcgtgacagcXX -----GCT------------------------------gttttccgggcatccgtagggg1D 0x x x x x R

o . 00g 0 Tn21L GGGGGCACCTCAGAAAACGGAAAATAAAGCACGCTAAGgcatagctgaccttgccaggccI -lCD 3 3 x x.x x R ----T-GT------------------------------ccggttgcagaggccgtagcggP CD A A A A0 -0 CD W W W O _0 CDf Y.. _ B Y L S P L G W E H I N L T Go cD x x x x Tn4654 AATACCTGTCGCCGCTGGGCTGGGAACACATCAACCTGACCGGCOC CD ~ Tn501 ---c------------------G-----------C------CDo So o S o-5fD<< < < D Y V W (R) Q S R R L E D G K F R P L R L

meD a Tn4654 GATTACGTCTGG ... CAGAGCCGCAGGCTGGAGGACGGGAAGTTCAGGCCGCTACGGTTG

°. 8 5 Tn501 ------------CGG-----------A-----A-----------TC----C--AAAA A Tn1722 ----------A-----A-----------TC----CT-

g 3Or5 £ F- < W<P G K P END3=D x x x x xX X X X X ~ ~~= Tn4654 CCCGGAAAACCTTAGCGTACGATTTTTTCCGAATTCTGCGGGCTCCCC-o oooo H Tn501 -------A--C----

eCD .0 .+ >Tl2 ---------------------------------------------CD Tn172?-

0 A A A t- A - FIG. 3. Comparison of the nucleotide sequences of the ends of0CLo class II transposons. We define the left (L) and right (R) ends of each3vz5XXX X transposon to be those distal and proximal, respectively, to the tnpA

CD o o gene (Fig. 1). (A) Left and right ends including terminal IRs.x 0 0 0 - m Sequence data on the transposons other than Tn4652 and Tn4654 area O"&

compiled from references 9, 19, and 29. The Tn4652-derived se-m xQ o 3 quences determined are those located outside of the outermost DraIeaCLBAA P P sites (Fig. 1), whereas the Tn4654-derived sequences determined are< n 00 I -i-- those located outside of the leftmost BglII site for the left-hand end

CD c0 Io 1o= ° (Fig. 1) and those outside of the insertion site of TnIO00-49 for the

CD0.X X X X X 4-+~~~~~~CDc X x x x x right-hand end (Fig. 2). For simplicity, only the outermost 60

00 Qo O O O ^3 F ct nucleotides are drawn, and the EcoRI site is underlined. The,g,x.oXs~£xo°nucleotides located inside and outside of the IRs are represented by

B CD -- 00 ~ ~A A ^3 - 3 uppercase and lowercase letters, respectively. When an identical° 2- 0° 0 0> 0 3 nucleotide is occupied at the same position between a pair of theX X,x 1 IRs, such nucleotides in the right IR are replaced by hyphens. (B)

2 CL0 °- " o The 3' part of the putative tnpA gene of Tn4654. Depicted is the

nucleotide sequence of Tn4654 from the insertion site of TnlO00-490So5O- ox s O Ut; (Fig. 2) to the right terminus. The deduced amino acid sequence of0. 0 t the C-terminal domain of the-putative transposase is represented by

o .3 5 (> A A n a one-letter code, and the right IR is underlined. The nucleotideCD W 1-' 00 - C sequences ofthe 3' parts ofthe Tnl 722 and Tn5OJ tnpA genes (3, 14)_W Qare also shown for comparison, and the hyphen indicates the

0

2. X-X X X X nucleotide identical to that of Tn4654. The nucleotide causing amino° 2. o o o acid substitution is circled. Note that the nucleotide sequence of

xa o ~ ~ £ e v Tn4654 is aligned with a three-base deletion (represented by dots) to0 WWo A A - maximize the homology.

co) 5 X Xi-° 1x x x0

o oCD Tn4652 derivatives, Tn4652472 and Tn4652-506, are TnpS-OqI>3os O O and TnpT-, respectively (Fig. 1; 23). Both Tn4652472- and

Tn4652-506-mediated cointegrates resolved, albeit not athigh efficiencies, by provision in trans of the whole se-

ow, o A A quences of Tn4652 and Tn4654 (Table 3). Derivatives ofTn4654 lacking tnpS or tnpT genes did not, however, pro-

CD<° x xx x x mote the resolution (data not shown), suggesting that theQ '-'xoo o ooresolution ability of Tn4654 is due to the expression of the

CD tnpS and tnpT genes in the Tn4652 portion. Low efficienciesog-=A A of the TnpS and TnpT functions would be intrinsic proper-0 0=_o A s ~ t ties of the Tn4652-specified resolution system (23). Tn4652

C 0g , xx failed to complement the tnpR mutants of Tn3, Tn2J, andTnl722 (Table 3).The cointegrate formed by Tn4654-1562 (Fig. 1) remained

stable even in coresidence with pMT1500, a pBR322: :Tn4654

VOL. 171, 1989

on April 12, 2018 by guest

http://jb.asm.org/

Dow

nloaded from

1390 TSUDA ET AL.

TABLE 3. Complementation of resolution functionsa

No. of Cmr or Tcr transconjugants/no. of Tpr transconjugantsCointegrate formed by

(mutant of Tn) RSF2124 pMT362 pMT1500 pMT1286 pMT1233(Tn3) (Tn4652) (Tn46S4) (TnI722) (Tn2J)

pMT1216 (Tr3tnpR) 0/48 48/48 48/48 48/48 48/48pMT472 (Tn4652AtnpS) 48/48 18/48 18/48 48/48 48/48pMT506 (Tn4652AtnpT) 48/48 22/48 18/48 48/48 48/48pMT1562 (Tn4654AEcoRV) 48/48 48/48 48/48 48/48 48/48pMT1298 (Tn) 722AtnpR) 48/48 48/48 0/48 0/48 0/48pMT1248 (Tn2lAtnpR) 48/48 48/48 0/48 0/48 0/48

a The DH1 derivative containing the complementing plasmid and the transposon-mediated cointegrate of R388 and the pACYC184-based plasmid was matedwith HB101 to select for the TpT transconjugants, and such transconjugants were examined for the coinheritance of the pACYC184-encoded Tcr or Cmr markers.

plasmid, confirming our previous result (24). The stability ofthis cointegrate was also unaffected by provision of Tn3,Tn2J, and TnJ722. It was, however, found that Tn4654coded for a trans-acting factor that complemented the tnpRmutations of Tn2l and Tnl722 (Table 3). This Tn46S4-specified factor and its gene are hereby designated resolvaseand tnpR, respectively.Examination with various deletion mutants of pMT1500

showed that the Tn4654 tnpR gene is present on pMT1768, apBR322 derivative carrying the rightmost 3.7-kb region ofTn4654 (Fig. 2). Since our previous analysis (24) has dem-onstrated that the Tn4654 tnpA gene is also located in theright-hand 3.0-kb fragment within this region, various dele-tion and insertion derivatives of pMT1768 (Fig. 2; 24) werefurther examined for their ability to complement the tnpRmutants of Tn21 and Tnl722, as well as the tnpA mutants ofTn4654 and Tnl722. The results (Table 4) show that the0.75-kb fragment between the TnJOOO insertion sites 57 and83 was required for full expression of the tnpR gene. TnlOOO

TABLE 4. Analysis of Tn4654 tnpA and tnpR genes by use ofinsertion and deletion mutantsa

No. of TcrDeletion or Position of transconjugants/ Transpositioninsertion insertion (bp)b no. of Tpr frequencyd

transconjugantsc

None (pMT1768) 0/48 3.0 x 10-4DeletionspMT1772 48/48 2.5 x 1o-4pMT1771 48/48 <1.2 x 10-8pMT1802 0/48 <1.1 x 10-8pMT1770 0/48 <1.3 x 10-8

InsertionsTnlO00-57 61-65 0/48 4.2 x 10-4Tnl000-41t 153-157 48/48 3.3 x 1o-4Kmr gene 250-255 (PvuII) 48/48 2.5 x 1o-4Kmr gene 451-456 (EcoRI) 48/48 3.3 x 10-4TnlO00-71 517-521 48/48 1.6 x 10-4TnO000-45 703-707 48/48 1.0 X 10-6TnJ000-83 766-770 0/48 <1.0 X 10-8TnJ000-27 827-831 0/48 <1.8 x 10-8TnJ000-49 Not determined 0/48 <1.0 X 10-8a Mutants of pMT1768 depicted in Fig. 2 were examined for their ability (i)

to resolve the cointegrate of R388 and pMT1298 and (ii) to complement thetransposition defect of Tn46S4-1590 (in pMT1590) by the procedures de-scribed in Materials and Methods. Similar results were obtained whenpMT1248 and pMT1302 were used instead of pMT1298 and pMT1590,respectively.

b See Fig. 2 and Fig. 4.Resolution ability. See footnote a of Table 3.

d See footnote b of Table 2.e Judged from agarose gel electrophoresis of the cleared lysate, this

insertion mutant possessed very weak ability to resolve the cointegrate.

insert 45 affected the expression of both tnpR and tnpAgenes.

Sequence analysis of ends of Tn4652 and Tn4654. The fourpBR322 derivatives, pMT362 and pMT363 as the pBR322::Tn4652 plasmids (23) and pMT1498 and pMT1500 as thepBR322::Tn4654 plasmids (24), were used for determinationof the junction sequences of the transposons in the pBR322plasmids (Fig. 3A).Each of the Tn4652 inserts was associated with a 5-bp

duplication of the pBR322 sequence, i.e., GGGGA (537 to541 bp on the coordinates of the pBR322 map [15]) andGTTAG (3716 to 3720 bp) in pMT362 and pMT363, respec-tively. This transposon contains the 46-bp terminal IRs (2-bpmismatched) with limited sequence homology to those ofwell-studied class II transposons (Fig. 3A).The Tn4654 inserts in the two plasmids were also flanked

by 5-bp direct repeats of the pBR322 sequences, that is,CTCTA (380 to 384 bp) and TGTAA (2143 to 2147 bp) inpMT1498 and pMT1S00, respectively, and this transposoncontains the 38-bp terminal IRs (contiguous 6-bp mis-matched) (Fig. 3A). The Tn46S4 IRs share extensive se-quence homology with those of Tn1722 and Tn51, andnotably, the right IR of Tn4654 is identical to that of Tn)722(Fig. 3A). The high degree of sequence homology among thethree transposons can be further expanded to the DNAregions inside of their right IRs (Fig. 3B). Assignment of thecorresponding region of Tn4654 to the 3' part of the tnpAgene is supported by (i) genetic mapping of the Tn4654 tnpAgene at this region (Fig. 2; 24), (ii) allocation of the 3' partsof the tnpA genes of both Tnl722 and TnSOJ at these regions(3, 14), and (iii) the interchangeability of the tnpA functionsbetween Tn4654 and Tn)722 (Table 2) and between Tnl722and TnSOJ (6).

Sequence analysis of the Td4654 tnpR gene and its surround-ing region. Since the Tn46S4 DNA fragment between therightmost SalI site and the insertion site of TnlO00-27 coversthe whole of the tnpR gene and a part of the tnpA gene (Fig.2), we determined the nucleotide sequence of this 831-bpfragment, as well as the sites of the Tn)O00 inserts allocatedwithin this fragment (Fig. 4). A 558-bp open reading frame(ORF) starting at nucleotide 190 is preceded by the typicalpromoter and ribosome-binding sequences. The insertionmutations which resulted in complete loss of the tnpRfunction were mapped into this ORF, whereas the insertionmutation TnJOOO-41, which resulted in a much-reducedexpression of this gene, was mapped between the promoterand ribosome-binding sequences (Table 4; Fig. 4). Further-more, the deduced amino acid sequence of this ORF isidentical to that of the Tnl722 resolvase (17). This informa-tion allowed us to conclude that this ORF corresponds to theTn4654 tnpR gene, which is distinguished from the Tnl722

J. BACTERIOL.

on April 12, 2018 by guest

http://jb.asm.org/

Dow

nloaded from

TOLUENE TRANSPOSONS Tn4651 and Tn4653 1391

.60GTCGACT ATA &T"GTC,Ti4CJTTCTGAAAGTGACAGCCGCGCCGCTTAGTCA

-35 -10 .120

GAGTCATCTTTCGCATTTTTGACACATGCCTGCGAAGGTCATAGATTTCAGCCTG

.180ACAGAAACGGGGTTTGAGGCACAACGGAACAGAGCACTTAAGCCGCCTTCAACCAA

.M Q G H R I G. Y V R .V S S F D Q N.240

GGAGACATCSTGCAGGGGCACCGCATCGGCTACGTJCGGGTCAGCAGCTT GACCAGAACL-*npR

P E R .0 L E Q T Q V. S K 1' .F T D K A S G.300CCGGAACGCCAGCTGGAACAGACACAGGTGAGCAAGGTGTTCACCGACAAGGCATCGGGC

PvuIIK D T .Q R P Q L E A. L L S F V R E G D T.360

AAGGACACCCAGCGCCCCCAGCTCGAAGCGCTGCTGAGCTTCGTCCGCGAAGGCGATACA

V V V .H S M D R L A. R N L .D D L R R L v.420GTGGTAGTGCACAGCATGGATCG CTGGCGCGCAACCTGGATGACCTGCGCCGCCTGTG

Q K L .T Q R G V R I. E F L .K E G L V F T.480

CAGAAGCTGACCCAGCGCGGCGTGCGIATCGATTCTGAAAGAGGGCCTAGTJTTCACJ0 'P~~~~EcoRI '

G E D .S P M A N L M. L S V .M G A F' A E F.540GGCGAGGACTCGCCGATGGCCAACCTCATGCTGTCGEmGGTGCCTTCGCCGAGTTC

0 710 0

E R A .L I R E R 0 R. E G I .A L A K Q R G.600GAGCGCGCCCTGATCCGCGAGCGGCAGCGTGAGGGTATCGCCTTGGCCAAGCAGCGTGGC

0

A Y R .G R K K A L S. D E Q .A A T L R Q R.660GCGTACCGAGGCCGCAAGAAAGCCCTGTCAGATGAGCAGGCTGCTACCCTGCGGCAGCGA

A T A .G E P K A Q L. A R E F N I S R E T.720GCGACGGCCGGCGAGCCCAAGGCGCAGCTTGCCCGCGAGTT3C~AGCCGGGAAACC

L Y Q Y L R D END M P R R L I L S A.780

CTCTACCAGTACCTCCGCACGGACGACTGATACATGCCGCGTCGC ~CCTCTCGGCC*L-* tnpA 83T E R D T L L A L P. E S Q sD D M i.831

ACGGAGCGGGACACCCTGCTTGCG;TGCCAGAAAGCCAGGATGACATC0 27

FIG. 4. DNA sequence of Tn4654 containing its tnpR gene. An831-bp DNA fragment between the rightmost Sall site on Tn4654(Fig. 1) and the insertion site of TnlOOO-27 (Fig. 2) was sequenced,and the nucleotides are numbered from the SalI site on the top.Deduced amino acid sequences of the resolvase and transposase areshown by one-letter code, and arrows indicate the putative transla-tional start points of these two genes. Putative promoter sequencesand ribosome-binding sequences (SD) are also depicted. The boxedsequences are the sites of the TnlOOO inserts described in Fig. 2 andTable 4. Nucleotides which can distinguish Tn4654 from Tn1722 (5,16, 17) (@) are shown.

and Tn21 tnpR genes by 24- and 132-nucleotide substitu-tions, respectively (Fig. 4; 5, 17).

Just downstream of the 3' end of the Tn4654 tnpR gene, asecond ORF starts at nucleotide 754 and extends rightwardup to the end of the sequenced fragment. Assignment of thistruncated ORF to the 5' part of the tnpA gene is supportedby a high degree of sequence homology to the 5' parts of theTnl 722 and TnSOJ tnpA genes (3, 17) and by allocation of theTnJO00 inserts 83 and 27 (Table 4) into this ORF (Fig. 4). Asis the case with the Tnl 722 sequence (1, 5, 17), no typicalpromoter sequence is detected within the 300-bp regionupstream of the putative translational starting site of thetnpA gene. However, allocation of the Tnl000 insert 45,which resulted in a much-reduced expression of the tnpAgene (Table 4), to the position 50 bp upstream of the startingsite suggests that the tnpA gene is preceded by a regulatorysequence(s) for its expression.The res region of Tnl722 has been demonstrated to be

located just 5' upstream of its tnpR gene and to contain thethree resolvase-binding sites designated I, II, and III (16).The 5' upstream region of the Tn4654 tnpR gene alsopossesses the nucleotide sequences extensively homologous

to those of sites II and III of TnJ722 (Fig. 5). There is, atleast within the sequenced fragment of Tn4654, no obvioushomolog corresponding to site I of Tnl722 (Fig. 5).

DISCUSSION

Our present study has shown that Tn4652 has terminal46-bp IRs (Fig. 3A) and generates a 5-bp duplication at thetarget site upon transposition. These features of Tn4652, inconjunction with its overall mechanism of transposition,have prompted us to place it with the class II transposons.However, the Tn4652 IRs show considerable sequence di-vergence from well-studied class II transposons (Fig. 3A),and coincidentally, the Tn4652 transposase was not inter-changeable with those of the four class II transposonsexamined (Table 2). Furthermore, neither the tnpS productnor the tnpT product was functionally interchangeable withthe resolvases encoded by the four other transposons (Table3). It is therefore conceivable that Tn4652 represents amember of an entirely new group of the class II transposons.

Genetic analysis of Tn4654 indicated that this transposoncarries the tnpA and tnpR genes, which can complement therespective mutations of TnJ722 (Tables 2 and 3). Further-more, these two transposons showed extensive sequencehomology in their terminal IRs, the 5' and 3' parts of theirtnpA genes, and both promoter and coding regions of theirtnpR genes (Fig. 3 and 4). These results permit us to proposethat Tn4654 and Tnl722 have arisen from a common ances-tral transposon.The sequence conservation between Tn4654 and Tnl722

terminates, when viewed from their tnpR genes, at a pointbetween sites I and II of the Tnl722 res region, and Tn4654apparently lacks the sequence corresponding to site I ofTnJ722, where the putative crossover point for cointegrateresolution has been mapped (Fig. 5; 16). Such incompletestructure of the Tn4654 res region can account for theparadox that the resolvases encoded by Tn4654, Tnl 722, andTn2J failed to carry out the resolution of the Tn4654-mediated cointegrate. This abrupt termination of the se-quence conservation between Tn4654 and Tn1722 impliesthat a genetic rearrangement(s) (such as the insertion of aDNA sequence of unknown origin or a deletion, or both) hasoccurred within the functional res region presumably presentin the primordial transposon of Tn4654.The results of this study indicate that insertion of Tn4651

or its related element (such as Tn4652) into the Tnl722-likeelement has given rise to Tn4653 or its precursor form.However, it is unknown at present what mechanism isresponsible for incorporation of a set of the xyl genes intoTn4651 and Tn4653. Tn4651 contains directly repeated cop-ies of a 1.4-kb sequence that bracket all the xyl genes (12,23). This 1.4-kb sequence might have been an insertionsequence element, thus acting in pairs to mobilize theintervening segment containing the xyl genes, although todate our repeated attempts have been unable to demonstratethe transposable properties of the 1.4-kb sequence. Alterna-tively, one copy of the repeated sequences presumablypresent in the primordial form of Tn4652 or Tn4654 mighthave provided the homologous region for integration of theforeign DNA region in which another copy of the repeatsmight have been lying adjacent to the whole set of the xylgenes.On the basis of a comparison of the genetic organization of

the xyl genes on the three TOL plasmids (pWWO, pWW53,and pDK1), P. A. Williams et al. have recently proposed thatthe present organization of the xyl genes on pWWO has been

VOL. 171, 1989

on April 12, 2018 by guest

http://jb.asm.org/

Dow

nloaded from

1392 TSUDA ET AL.

SITE ITn 1722 CGCATGTCAATCTAGGCTATACCCTAACTTGATGTCA 3CAGGGCCGCGCCG TCGTCATn2l -CGCC----GGT-GA-GC- C--- TGCCATGTGTA T-G-----Tn4654 GT-GAC-TTGGA--TTTCG-G-TG-CG-C-TC--AA--TG-CA-------- ---A----

10 20 30 40 50 60

SITE II -35 SITE III -10Tnl 722 GAATAGAGTCTGCTTTCCCATTTTTT ACATG CC GAAGGTTATAGATTTCAGCCTTn2l -G----GA-TGAA---TGA----A------T-- C-GT------c-----G-CTTC---Tn4654 ---------- AT-----G--.------------- -T- ------C--

70 80 89 99 109 119

Tnl 722 GACAGAATGGGCTTTGAGGCACAACGGAACAGAAAGTGCACTTAAGCCGCCTTCAACCATn2l ----TTT GC..................................................Tn4654 ------- --- G----------------------G-A----------------------

129 139 149 159 169 179

S .D. tnpRTnl722 AGGAGACATCGTGCAGGGGCTn2l ---GA-TTC-A--ACT--A-Tn4654 --------------------

189 199FIG. 5. Comparison of 5' upstream regions of tnpR genes among Tnl722, Tn46S4, and Tn21. Sequence data are taken from Rogowsky et

al. (16, 17) for Tn1722 and Tn2I and from Fig. 4 of this paper for Tn46S4. Nucleotides of Tn46S4 and Tn2l identical to those of TnJ722 arereplaced by hyphens, and the dots denote the absent nucleotides. The putative promoter and ribosome-binding (S.D.) sequences are alsodepicted in the figure. The putative crossover point for resolution of the TnJ722-mediated cointegrate has been reported to exist within the11-bp nucleotides from positions 19 to 29 on the Tnl722 map in this figure (16).

established after successive acquisition of the three separateDNA modules, i.e., the "upper pathway" operon, the"lower pathway" operon, and a block of two regulatorygenes with unknown order (10, 21). If this is the case,investigation of the molecular mechanism(s) responsible forassembly of these three DNA molecules would shed someinteresting light for our understanding of the evolutionaryprocesses of establishment of Tn4651 and Tn4653.

ACKNOWLEDGMENTS

We thank Y. Sano and R. Schmitt for providing pTY151 andpJOE106, respectively. We are also indebted to H. Iguchi for herexcellent technical assistance.

This work was supported by a Grant-in-Aid for Scientific Re-search from the Ministry of Education, Science, and Culture, Japan.

LITERATURE CITED1. Altenbuchner, J., and R. Schmitt. 1983. Transposon Tnl721:

site-specific recombination generates deletions and inversions.Mol. Gen. Genet. 190:300-308.

2. Bolivar, F., R. L. Rodriguez, P. J. Greene, M. C. Betlach, H. L.Heyneker, H. W. Boyer, J. H. Crosa, and S. Falkow. 1977.Construction and characterization of new cloning vehicles. II. Amultipurpose cloning system. Gene 2:95-113.

3. Brown, N. L., J. N. Winnie, D. Fritzinger, and R. D. Pridmore.1985. The nucleotide sequence of the tnpA gene completes thesequence of the Pseudomonas transposon TnSOI. Nucleic AcidsRes. 3:5657-5669.

4. de la Cruz, F., and J. Grinsted. 1982. Genetic and molecularcharacterization of Tn21, a multiple resistance transposon fromR100.1. J. Bacteriol. 151:222-228.

5. Diver, W. P., J. Grinsted, D. C. Fritzinger, N. L. Brown, J.Altenbuchner, P. Rogowsky, and R. Schmitt. 1983. DNA se-quences of and complementation by the tnpR genes of Tn21,Tn501 and Tnl721. Mol. Gen. Genet. 191:189-193.

6. Grinsted, J., F. de la Cruz, J. Altenbuchner, and R. Schmitt.1982. Complementation of tranposition of tnpA mutants of Tn3,Tn2l, Tn501, and Tn1721. Plasmid 8:276-286.

7. Guyer, M. S. 1983. Uses of the transposon -yb in the analysis of

cloned genes. Methods Enzymol. 101:362-369.8. Heffron, F71983. The Tn3 and its relatives, p. 223-260. In J. A.

Shapiro (ed.), Mobile genetic elements. Academic Press, Inc.,New York.

9. Heffron, F., B. J. McCarthy, H. Ohtsubo, and E. Ohtsubo. 1979.DNA sequence analysis of the transposon Tn3: three genes andthree sites involved in transposition of Tn3. Cell 18:1153-1163.

10. Keil, H., S. Keil, and P. A. Williams. Molecular analysis ofregulatory and structural xyl genes of the TOL plasmid pWW53-4. J. Gen. Microbiol. 133:1149-1158.

11. Maniatis, T., E. F. Fritsch, and J. Sambrook. 1982. Molecularcloning: a laboratory manual. Cold Spring Harbor Laboratory,Cold Spring Harbor, N.Y.

12. Meulien, P., R. G. Downing, and P. Broda. 1981. Excision of the40kb segment of the TOL plasmid from Pseudomonas putidamt-2 involves direct repeats. Mol. Gen. Genet. 184:97-101.

13. Miller, J. H. 1972. Experiments in molecular genetics. ColdSpring Harbor Laboratory, Cold Spring Harbor, N.Y.

14. Motsch, S., R. Schmitt, P. Avila, F. de la Cruz, E. Ward, and J.Grinsted. 1985. Junction sequences generated by 'one-endedtransposition.' Nucleic Acids Res. 13:3335-3342.

15. Peden, K. W. C. 1983. Revised sequence of the tetracycline-resistance gene of pBR322. Gene 22:277-280.

16. Rogowsky, P., S. E. Halford, and R. Schmitt. 1985. Definition ofthree resolvase binding sites at the res loci of Tn2l and Tn1721.EMBO J. 4:2135-2141.

17. Rogowsky, P., and R. Schmitt. 1985. Tnl721-encoded resolvase:structure of the tnpR gene and its in vitro functions. Mol. Gen.Genet. 200:176-181.

18. Sanger, F., S. Nicklen, and A. R. Coulson. 1977. DNA sequenc-ing with chain-terminating inhibitors. Proc. Natl. Acad. Sci.USA 74:5463-5467.

19. Schmitt, R., J. Altenbuchner, K. Wiebauer, W. Arnold, A.Puihler, and F. Schoffi. 1981. Basis of transposition and geneamplification by Tnl721 and related tetracycline-resistancetransposons. Cold Spring Harbor Symp. Quant. Biol. 45:59-65.

20. Schoffl, F., W. Arnold, A. Ptihler, J. Altenbuchner, and R.Schmitt. 1981. The tetracycline resistance transposons Tn1721and Tn1771 have three 38-base-pair repeats and generate five-base-pair direct repeats. Mol. Gen. Genet. 181:87-94.

21. Shaw, L. E., and P. A. Williams. 1988. Physical and functional

J. BACTERIOL.

on April 12, 2018 by guest

http://jb.asm.org/

Dow

nloaded from

TOLUENE TRANSPOSONS Tn4651 and Tn4653 1393

mapping of two cointegrate plasmids derived from RP4 andTOL plasmid pDK1. J. Gen. Microbiol. 134:2463-2474.

22. So, M., R. Gill, and S. Falkow. 1975. The generation of aColE1-Apr cloning vehicle which allows detection of insertedDNA. Mol. Gen. Genet. 142:239-249.

23. Tsuda, M., and T. lino. 1987. Genetic analysis of a transposoncarrying toluene degrading genes on a TOL plasmid pWWO.Mol. Gen. Genet. 210:270-276.

24. Tsuda, M., and T. Iino. 1988. Identification and characterizationof Tn4653, a transposon covering the toluene transposonTn4651 on TOL plasmid pWWO. Mol. Gen. Genet. 213:72-77.

25. Ubben, D., and R. Schmitt. 1986. Tnl721 derivatives for trans-poson mutagenesis, restriction mapping and nucleotide se-quence analysis. Gene 41:145-152.

26. Vieira, J., and J. Messing. 1982. The pUC plasmids, anM13mp7-derived system for insertion mutagenesis and sequenc-ing with synthetic universal primers. Gene 19:259-268.

27. Ward, J. M., and J. Grinsted. 1982. Physical and geneticanalysis of the Inc-W group plasmids, R388, Sa, and R7K.Plasmid 7:239-250.

28. Yanisch-Perron, C., J. Vieira, and J. Messing. 1985. ImprovedM13 phage cloning vectors and host strains: nucleotide se-quences of the M13mpl8 and pUC19 vectors. Gene 33:103-119.

29. Zheng, Z. X., M. Chandler, R. Hipskind, M. Clerget, and L.Caro. 1981. Dissection of the r-determinant of the plasmidR100.1: the sequence at the extremities of Tn2l. Nucleic AcidsRes. 9:6265-6278.

VOL. 171, 1989

on April 12, 2018 by guest

http://jb.asm.org/

Dow

nloaded from