Upload
miller
View
39
Download
0
Tags:
Embed Size (px)
DESCRIPTION
Genome 351, 12 April 2013, Lecture 4. Today…. mRNA splicing Promoter recognition Transcriptional regulation Mitosis: how the genetic material is partitioned during cell division. In bacteria (most) mRNAs are co-linear with their corresponding genes. Promoter. terminator. gene. - PowerPoint PPT Presentation
Citation preview
PowerPoint Presentation
TodayGenome 351, 12 April 2013, Lecture 4mRNA splicing
Promoter recognition
Transcriptional regulation
Mitosis: how the genetic material is partitioned during cell division1In bacteria (most) mRNAs are co-linear with their corresponding genes+1Promoterterminatorbacteria:AACUGACGAAACTGACGAmRNAAACGAgene2Events involved in RNA processingNon-codingNon-codingCoding sequenceCoding sequenceNoncodingExon1Exon2IntronNon-codingNon-codingContinuous stretch of coding sequenceAAAAA
Non-codingNon-codingContinuous stretch of coding sequenceTransport to the cytoplasmPre-mRNA3
Proteins can be modular-Different regions can have distinct functionsand the modules can correspond to exonsWhy does transcript splicing occur?4Interrupted structure allows genes to be modularsecretioncell anchorenzymebinding module5secretioncell anchorenzymebinding modulesecretioncell anchorenzymebinding modulePre-mRNA:Processed-mRNAInterrupted structure allows genes to be modularsecretioncell anchorenzymebinding moduleAAAA6secretioncell anchorenzymebinding modulesecretionenzymebinding modulePre-mRNA:Processed-mRNAAlternative splicing or:One mRNAs exon is another ones intron!AAAAsecretionenzymebinding moduleone alternative form7secretioncell anchorenzymebinding moduleenzymebinding modulePre-mRNA:Processed-mRNAAlternative splicing or:One mRNAs exon is another ones intron!AAAAenzymebinding moduleanother alternative form8How do RNA polymerases know where to begin transcription and which way to go?promotermRNAmRNApromotergenegenegenemRNApromoterFirst worked out in bacteria by:-comparing sequences near the start sites of transcription of many genes-by studying where RNA polymerase likes to bind to DNA9Comparing sequences at the promoter region of many bacterial genes provides clues:How do RNA polymerases know where to begin transcription and which way to go?consensussequence: TTGACAT15-17bpTATAAT
transcription start sitedirection of transcription+1-10 region-35 regiononly coding (sense) strand is shown; all sequences 5-310RNA polymerase binds to the consensus sequences in bacterial promotersRNA polymerase binds to the -35 and -10 regions:+1-10 region-35 regionTATAATdirection of transcriptionWould you expect RNA polymerase to bind the other way around and transcribe in the reverse direction?TTGACATRNA polymerase11RNA polymerase binds to the consensus sequences in bacterial promotersRNA polymerase binds to the -35 and -10 regions:+1-10 region-35 regionTATAATdirection of transcriptionWould you expect RNA polymerase to bind the other way around and transcribe in the reverse direction?TTGACATRNA polymerase12RNA polymerase binds to the consensus sequences in bacterial promoters+1-10 region-35 regionTATAATTTGACATRNA polymerasedirection of transcriptionRNA polymeraseTAATATTACAGTTdirection of transcriptionWould you expect RNA polymerase to bind this sequence and initiate transcription?13mRNAmRNAgenegenegenemRNAHow do RNA polymerases know where to begin transcription and which way to go?In bacteria RNA polymerase binds specific sequences near the start site of transcription that orient the polymerase:-10 region-35 regionTTGACATTATAAT-35 region-10 regionTACAGTTTAATATIn eukaryotes, RNA polymerase is regulated by DNA-binding proteinsRNA polymerase:transcription factors (TFs):+1RNA polymerase does not efficiently bind to DNA and activate transcription on its own +1But TFs that bind to specific DNA sequences & to RNA polymerase can recruit RNA polymerase & activate transcription 15In eukaryotes, RNA polymerase is regulated by DNA-binding proteinsRNA polymerase:Some TFs can also inhibit transcriptiontranscription factors (TFs):+1+1But TFs that bind to specific DNA sequences & to RNA polymerase can recruit RNA polymerase & activate transcription 16Switches and Regulators - A MetaphorSwitches control transcription (which take the form of DNA sequence)- Called regulatory elements (REs) or enhancers- Adjoin the promoter region, but can be quite distantRegulators, which take the form of proteins that bind the DNA, operate the switches- Called transcription factors (TFs) When and how much RNA is made often is the product of multiple elements and regulators
17Control of gene expressionEach cell contains the same genetic blueprint
Cell types differ in their protein content
Some genes are used in almost all cells (housekeeping genes)
Other genes are used selectively in different cell types or in response to different conditions.
18An imaginary regulatory regionPromoterRE1RE2RE3RE4RE5RE619Antennapedia gene is normally only transcribed in the thorax; legs are made.A mutant promoter causes the Antennapedia gene to be expressed in the thorax and also in the head, where legs result instead of antennae!Example: Antennapedia gene in fruit fliesExpressing a regulatory gene in the wrong place can have disastrous consequences!!!
20
Lactose tolerance: A human example of a promoter mutation21Lactase levels in humansLactase levelsAge in years21022World wide distribution of lactose intolerance
23The cellular life cycle
fertilized egg; a single cell!
Mitosis: dividing the content of a cell24Chromosomes - a reminder How many do humans have?
Photo: David McDonald, Laboratory of Pathology of Seattle22 pairs of autosomes2 sex chromosomes
Each parent contributes one chromosome to each pair
Chromosomes of the same pair are called homologs
Others are called non-homologous25Homologous and non-homologous chromosomes
1p1m2p2m3p3m21p22m22p21mXp or YXmThe zygote receives one paternal (p) and one maternal (m) copy of each homologous chromosome 26The DNA of human chromosomes
# genes# base pairs# genes# base pairs27The cellular life cycle
cell growth; chromosome duplicationchromosome segregationcell growth; chromosome duplicationchromosomes decondensedchromosome segregationchromosomes condensedrepeat
Elements of mitosis:
28Chromosome replication a reminder
Mechanism of DNA synthesis ensure that each double stranded DNA gets copied only once.
The products of DNA replication have one new DNA strand and one old one (semi-conservative replication)29Chromosome structure a reminder
chromosome structure during cell growth & chromosome replication (decondensed)sister chromatids; double-stranded DNA copies of the SAME homologheld together at the centromere30Mitosis -- making sure each daughter cell gets one copy of each pair of chromosomes
Copied chromosomes (sister chromatids) stay joined together at the centromere.
Proteins pull the two sister chromatids to opposite poles
Each daughter cell gets one copy of each homolog.31
Mitosis -- homologous chromosomes 1m1p2 copies 1m2 copies 1p1m1p1m1pjoined at centromere2 copies 1m
1m1p1m1p
2 copies 1p
exact copies32
Mitosis following the fate of CFTRCFTR+CFTR-CFTR+CFTR-2 copies CFTR+2 copies CFTR-2 copies CFTR+2 copies CFTR-CFTR+CFTR-CFTR+CFTR-CFTR+CFTR-A CFTR heterozygote (CFTR+/CFTR-)33GTGCACCTGACTCCTGAGGAGCTCCTCAGGAGTCAGGTGCAC
GTGCACCTGACTCCTGTGGAGCTCCACAGGAGTCAGGTGCAC
Mitosis -- 2 copies of each chromosome at the startPaternal chromosomeMaternal chromosomeA closer look at the chromosomes34GTGCACCTGACTCCTGAGGAGCTCCACAGGAGTCAGGTGCAC
CTCCTCAGGAGTCAGGTGCAC
GTGCACCTGACTCCTGTGGAGDNA strands separate followed by new strand synthesisA closer look at the chromosomes35GTGCACCTGACTCCTGAGGAGCTCCTCAGGAGTCAGGTGCAC
GTGCACCTGACTCCTGTGGAGCTCCACAGGAGTCAGGTGCAC
GTGCACCTGACTCCTGTGGAGCTCCACAGGAGTCAGGTGCAC
Mitosis -- after replication 4 copiesHomologs unpaired sister chromatids joined by centromereGTGCACCTGACTCCTGAGGAGCTCCTCAGGAGTCAGGTGCAC
A closer look at the chromosomes36GTGCACCTGACTCCTGAGGAGCTCCTCAGGAGTCAGGTGCAC
GTGCACCTGACTCCTGTGGAGCTCCACAGGAGTCAGGTGCAC
GTGCACCTGACTCCTGTGGAGCTCCACAGGAGTCAGGTGCAC
Each daughter has a copy of each homologGTGCACCTGACTCCTGAGGAGCTCCTCAGGAGTCAGGTGCAC
A closer look at the chromosomes37Mitosis and the cell cycle
38Mitosis vs. Meiosis
- The goal of mitosis is to make more somatic cells:each daughter cell should have the same chromosome set as the parental cell
- The goal of meiosis is to make sperm and eggs:each daughter cell should have half the number of chromosome sets as the parental cell39Meiosis: the formation of gametesThe challenge:ensuring that homologues are partitioned to separate gametesThe solution:Hold homologous chromosomes together by crossing overtarget homologues to opposite poles of the cellthen separate the homologues
40Sheet1Protein Coding45,000,000Regulatory75,000,000????2,900,000,000Protein Coding45,000,000Regulatory75,000,000Transposable elements1305000000????1,595,000,0002,900,000,000
Sheet1Protein Coding45,000,000Regulatory75,000,000????2,900,000,000Protein Coding45,000,000Regulatory75,000,000Transposable elements1305000000????1,595,000,0002,900,000,000