Three dimensional cultures of rat liver cells using a natural self-assembling nanoscaffold in a clinically relevant bioreactor for bioartificial liver construction

Three Dimensional Cultures ofRat Liver Cells Using a NaturalSelf-Assembling Nanoscaffold ina Clinically Relevant Bioreactorfor Bioartificial Liver ConstructionSHIBASHISH GIRI,1* ALI ACIKGOZ,1 PRIYA PATHAK,2,3 SYLVIA GUTSCHKER,1

ANNE KURSTEN,4 KAREN NIEBER,4 AND AUGUSTINUS BADER1

1Department of Cell Techniques and Applied Stem Cell Biology, Centre for Biotechnology and Biomedicine, University of Leipzig,

Leipzig, Germany2Interdisciplinary Centre for Bioinformatics, University of Leipzig, Leipzig, Germany3Translational Centre for Regenerative Medicine (TRM) Leipzig, Leipzig, Germany4Department of Pharmacology for Natural Sciences, Institute of Pharmacy, University of Leipzig, Leipzig, Germany

Till date, no bioartificial liver (BAL) procedure has obtained FDA approval or widespread clinical acceptance, mainly because ofmultifactorial limitations such as the use of microscale or undefined biomaterials, indirect and lower oxygenation levels in liver cells,short-term undesirable functions, and a lack of 3D interaction of growth factor/cytokine signaling in liver cells. To overcome preclinicallimitations, primary rat liver cells were cultured on a naturally self-assembling peptide nanoscaffold (SAPN) in a clinically relevantbioreactor for up to 35 days, under 3D interaction with suitable growth factors and cytokine signaling agents, alone or combination(e.g., Group I: EPO, Group II: Activin A, Group III: IL-6, Group IV: BMP-4, Group V: BMP4þ EPO, Group VI: EPOþ IL-6, Group VII:BMP4þ IL-6, Group VIII: Activin Aþ EPO, Group IX: IL-6þActivin A, Group X: Activin AþBMP4, Group XI: EPOþActivin Aþ BMP-4þ IL-6þHGF, and Group XII: Control). Major liver specific functions such as albumin secretion, urea metabolism, ammoniadetoxification, phase contrast microscopy, immunofluorescence of liver specific markers (Albumin and CYP3A1), mitochondrial status,glutamic oxaloacetic transaminase (GOT) activity, glutamic pyruvic transaminase (GPT) activity, and cell membrane stability by the lactatedehydrogenase (LDH) test were also examined and compared with the control over time. In addition, we examined the drugbiotransformation potential of a diazepam drug in a two-compartment model (cell matrix phase and supernatant), which is clinicallyimportant. This present study demonstrates an optimized 3D signaling/scaffolding in a preclinical BAL model, as well as preclinical drugscreening for better drug development.J. Cell. Physiol. 227: 313–327, 2012. � 2011 Wiley Periodicals, Inc.

Worldwide, millions of liver failure patients are dying due to theextreme shortage of donor livers. Liver failure patients are alsomore susceptible to multi-organ failure due to sepsis (Howellet al., 2006) occurring during the waiting period for livertransplantation. Over the last two decades, many BALapproaches have been introduced and it remains promising as aclinical method to support a failing liver (van de Kerkhove et al.,2004; Millis and Losanoff, 2005; Carpentier et al., 2009). At thispoint in time, no BAL procedures have yet gained FDA approvalor widespread clinical acceptance (Lee et al., 2008). The mainlimitation of current BAL is the lack of a proper in vivo livermicroenvironment. The current construction of BAL results inindirect and low oxygenation to liver cells, microscalebiomaterials, short-term undesirable functions, and lack of 3Dinteraction of growth factors/cytokines signaling with cells.Enhanced oxygenation is important for the in vitro liver cellularmicroenvironment (Kidambi et al., 2009) and the BAL model(Poyck et al., 2008). Around half a century ago, Steven (Stevens,1965) reported that in vitro liver cells obtain 4% of their oxygenrequirement and degenerate rapidly. The oxygen supply to an invivo liver is over 2,000 nmol/ml of oxygen, while in vitro culturemedia offers less than 200 nmol/ml to the cells (Nahmias et al.,2006). In our construction, our bioreactor offers a maximaloxygen supply of 90mmol per 1.77 cm2 via direct delivery ofoxygen to the cells from the bottom of the device (Schmitmeier

et al., 2006). Our bioreactor also allows direct contact ofevery individual liver cell with the oxygen supply, for enhancedoxygenation that is closer to the in vivo liver (De Bartolo andBader, 2001; Maringka et al., 2010).

The selection of a nanoscaffold for the culture configurationin a bioreactor is a vital concept for a BAL since the in vivoliver cells adhere to extracellular matrices (ECM) that havean extremely complex 3D topography at the nanometerscale. Several existing bioreactors use conventional scaffoldssuch as collagen, matrigel, or chitosan, which are undefinedbiomaterials and which can harbor dangerous pathogens (Scottet al., 1999). In addition, xenogenic protein components may

Contract grant sponsor: Medicine Faculty of University of Leipzig.

*Correspondence to: Shibashish Giri, Department of CellTechniques and Applied Stem Cell Biology, Centre forBiotechnology and Biomedicine, University of Leipzig, DeutscherPlatz 5, D-04103 Leipzig, Germany.E-mail: [email protected]

Received 30 December 2010; Accepted 14 March 2011

Published online in Wiley Online Library(wileyonlinelibrary.com), 24 March 2011.DOI: 10.1002/jcp.22738

ORIGINAL RESEARCH ARTICLE 313J o u r n a l o fJ o u r n a l o f

CellularPhysiologyCellularPhysiology

� 2 0 1 1 W I L E Y P E R I O D I C A L S , I N C .

elicit immune responses upon implantation (Martin et al., 2005;Mallon et al., 2006), which would interfere with theexperimental outcome andwhich may vary from batch to batchdue to their endogenous signals (Cushing and Anseth, 2007).These materials also suffer from high lot variability (Xu et al.,2006) and high contamination potential (Xu et al., 2006);therefore, use of these animal-derived materials may run a riskof introducing undesirable contaminants (cell signaling motifs,prions, adventitious agents, etc.) and they lack any consistentquality control, thus complicating reproducibility, particularly inclinical settings.

Many biomaterials have been developed for liver cell culture(Janorkar et al., 2008; Khetani and Bhatia, 2008; Chen et al.,2009; Pavlica et al., 2009; Feng et al., 2010; Kim et al., 2010;Mehta et al., 2010), but these too are limited by short termculture (typically 5–15 days) so that cell culture also is still a longways from clinical application for BAL purposes. A number ofnanofabrication scaffolds have been used for liver cell culture(Feng et al., 2010), but the solvents used for nanofabrication canbe a toxic concern. For example, poly-L-lactic acid (PLLA) wasdissolved in dichloromethane/N,N-dimethyl-formamide toprepare a nanoscaffold for rat liver cell culture (Feng et al.,2010). Abnormal liver function associated with occupationalexposure to dimethylformamide has been reported (Luo et al.,2005).

To overcome these complications arising from traditionalmaterials, we have selected a naturally self-assembling peptidenanoscaffold (SAPN) that is composed of pure L amino acids(Zhang, 2003; Zhang, 2004; Yokoi et al., 2005). The peptidebuilding block, RADA 16, is biocompatible, amenable tomolecular design, nontoxic, and biodegradable as itscomposition of naturally occurring amino acids can be reusedby the body. In general, scaffold size should be smaller than thecell, so that the scaffold can bind three-dimensionally. Theaverage size of a liver cell is around 10–20mm. It is widelybelieved thatwhen the size of scaffold is larger than the cells, thecells cannot be surrounded by the biomaterials scaffold. Thismeans that upon attachment, the cells still exist in a 2Dtopography, which is very common in conventional cell culturesin BAL devices. It is actually a serious problem if the cells cannotbe attached in an in vivo 3D topology. In general, in aconventional scaffold, one side of the cell body will be in directcontact, and surface receptors clustering at the attachment sitemay be induced. On the other hand, the receptors for growthfactors, cytokines, nutrients, and signals will be on the otherside that is exposed directly to the culturemedia. Thus, cells in a2D conventional culture are partially polarized and do notaccurately represent cells in an authentic in vivo condition; thismay interferewith experimental outcomes. In contrast, on a 3Dnanorange microenvironment using the scaffold presentedhere, all functional motifs on the nanofiber scaffold surroundthe whole cell body in all dimensions, where all growth factors,cytokines, nutrients, and signals are able to interact threedimensionally (Fig. 8). Few investigations have yet examined thegrowth and function of primary liver cells along with suitablecombination of regenerative signal agents (cytokines andgrowth factors such as HGF, Activin A, BMP 4, IL-6, EPO) inlong-term culture up to 35 days in a natural nanorange scaffoldin a BAL configuration. In the present study, we report theculture of primary rat liver cells on a naturally self-assembledpeptide nanoscaffold (SAPN) in a clinically relevant bioreactorfor up to 35 days, under 3D interaction with suitable growthfactors or cytokine signaling agents, alone or in combinations, allof which are known to play vital roles in the in vivo regenerationof native liver (Taub, 2004). This approach should provide amore in-depth understanding of liver regeneration during liverinjury, as it allows a more accurate reflection of this complexand highly ordered process and its multiple intra- and extra-cellular pathways and signals (Taub, 2004).

Liver specific gene expressions were analyzed bysemiquantitative RT-PCR every 10 days. Major liver specificfunctions such as albumin secretion, ureametabolism, ammoniadetoxification, drug biotransformation in two compartmentmodel, phase construct microscopy, immunofluorescense ofliver specific markers (Albumin and CYP 3A1) and cellmembrane stability (measured by the lactate dehydrogenase(LDH) test)were also examined and comparedwith the controlover the time. The time required for native liver regenerationmay be as much as a few to several weeks, depending on thetype of patients. However, it is a desirable concept to make thisas long as possible, so we extended our experiment to 35 days.Powerhouse failure means liver failure (Schafer and Sorrell,1997), so we used confocal microscopy to determine thestructural status of the mitochondria. In addition, we analyzedactivities of glutamic oxaloacetic transaminase (GOT) andglutamic pyruvic transaminase (GPT), which are hallmark ofliver injury.

Blood from patients with severe liver failure contains manytoxins that are harmful to living hepatocytes (Stefanovich et al.,1996) and others organs and their accumulation can lead tomultiorgan failure. We aimed to measure the ammoniumdetoxification efficiency and the ability of diazepam forbiotransformation. The major metabolites of diazepam weremeasured using HPLC analysis. Diazepam was detected inpatients suffering from acute liver failure with hepaticencephalopathy, yet these patients had no prior exposure todiazepam hepatic encephalopathy (Basile et al., 1991). Hepaticencephalopathy (HE) is a brain disorder that occurs mostfrequently in patients with liver disease (Goel et al., 2010;Moriwaki et al., 2010; Teperman and Peyregne, 2010), and iseven seen in patients after liver transplantation (Sotil et al.,2009). Various toxins, including ammonia, are not removed,because liver function is impaired. The exact mechanism of HEis unknown; however, ammonia toxicity is believed to beimportant in the pathogenesis of this disease. Gut-derivedammonia, normally removed by the liver, enters thebloodstream and builds up in the brain, where it damages braincells. Accumulated evidences prove that high-circulatingammonia levels have been reported in acute or chronic liverfailure patients (Kundra et al., 2005; Bhatia et al., 2006; Bernalet al., 2007; Pares et al., 2009). Ammonia detoxification isthought to play a major role in treating HE (Papadopouloset al., 2010).

We have chosen to study the ability of our bioreactor toclear waste that accumulates during liver failure, by measuringthe efficiency in removing ammonia, and the capacity of bio-transforming diazepam. It is well known that hepaticencephalopathy, typical of chronic liver diseases, and brainedema, typical of fulminant hepatic failure, are secondary to theaccumulation of many false neurotransmitters that we arecurrently unable to measure because of the unavailability ofassays. Therefore, we prefer to study the clearance of theammonia, and the biotransformation of diazepam gives anindication of how our bioreactor could potentially work in theclinical setting. Although our bioreactor is unable to meet theclinical setting, in the case of hepatic encephalopathy and brainedema, we aim to investigate whether liver-cell cultures in 3Dsignaling and scaffolding, possess a relatively-high potential forammonia detoxification, and for preventing ammoniaaccumulation in the SPAN-coated BAL model.

A two-compartmental model for drug metabolite detectionis clinically important (Giri et al., 2010) and safety testing of drugmetabolites is a growing concern to both the pharmaceuticalindustry and the regulatory agencies (Frederick and Obach,2010) because it has been reported that more than 20% of thetop classes of drugs have had warnings placed on their boxesafter a short period following clinical approval, due to toxicity ofmetabolites (Walgren et al., 2005; Fura, 2006). The authors

JOURNAL OF CELLULAR PHYSIOLOGY

314 G I R I E T A L .

hypothesized that covalent binding of the reactivemetabolite ofa drug, rather than the drug itself is, responsible for mostidiosyncratic drug reactions (Park et al., 1998; Knowles et al.,2000). In addition, most of these reactions are also associatedwith reactive metabolite syndromes. The reactive metabolitecovalently binds to the proteins and generates a covalentadduction of proteins, which provokes an immune response byan alternate immune system (Park et al., 1998). Drugmetabolites inside the cell are rarely investigated usingconventional methods, either in routine pharmacologicalresearch or in preclinical studies. In the present study, wehypothesize one compartment (the culture medium) ishypothetically comparable to human blood or plasma in theliver circulation while the other compartment (the cell matrixphase) compares the ability of the substance to bind inside thecell (Fig. 1). Taken together, our aim was to measure all majorcomplex functions of liver such as detoxification,biotransformation, excretion, and synthesis in a SAPN coatedpreclinically relevant bioreactor under effective functionalstimulation by suitable therapeutic agents such as EPO, IL-6,BMP4, and HGF, which is seldom, investigated using currentconventional BALs.

Materials and MethodsRat liver cells isolation and culture

Hepatocytes were isolated from male Sprague-Dawley rats(weighing 200–250 g) by the two-step collagenase perfusionmethod, as previously described (Bader et al., 1999). Cell viabilitywas assessed by trypan blue exclusion and hepatocytes with aviability of greater than 85–90% were used. Hepatocytes werecultured in Williams’ E medium supplemented with L-glutamine2mM, penicillin 100U/ml, streptomycin 100mg/ml,dexamethasone 1mM, insulin 0.2U/ml, glucagon 4 ng/ml, and5% (v/v) fetal bovine serum. The cells were seeded at a differentdensity (2.5� 105 cells/cm2 for all biochemical assays, and theimmunofluorescence analysis; and 3� 105 cells/cm2 in six-wellbioreactors for gene expression analysis) for different experiments(Group I–Group XI) in the SAPN coated bioreactor or onconventional 2Dimentional Collagen plates (control) withEPOþActivin Aþ BMP-4þ IL-6þHGF and were incubated at37 8C in a humidified atmosphere containing 5% CO2 and 20% O2

(v/v), The fundamental design of our flat membrane bioreactor(Maringka et al., 2010) and the minibioreactor (Schmitmeieret al., 2006) is similar. The concentration of above mentionedcytokines and factors are Group I: rHu-EPO (20U/ml), Group II:Activin A (100 ng/ml), Group III: IL-6 (20 ng/ml), Group IV: BMP-4(50 ng/ml), Group V: BMP4 (50 ng/ml)þ rHu-EPO (20U/ml),Group VI: rHu-EPO (20U/ml)þ IL6 (20 ng/ml), Group VII:BMP-4 (50 ng/ml)þ IL6 (20 ng/ml), Group VIII: ActivinA (100 ng/ml)þ EPO (20U/ml), Group IX: IL6 (20 ng/ml)þActivin

A (100 ng/ml), Group X: Activin (100 ng/ml)þ BMP-4 (50 ng/ml),Group XI: rHu-EPO (20U/ml)þActivin A (100 ng/ml)þBMP-4(50 ng/ml)þ IL-6 (20 ng/ml)þHGF (20 ng/ml) in SAPN coatedBioreactor, Group XII (Control): rHu-EPO (20U/ml)þActivinA (100 ng/ml)þBMP-4 (50 ng/ml)þ IL-6 (20 ng/ml)þHGF(20 ng/ml) in conventional 2D collagen plates. Human Activin A,Hepatocyte growth factors (HGF), IL-6, Human bonemorphogenetic protein 4 (BMP- 4) were puchased from sigma andobtained rHu-EPO from NeoRecormon, Roche Ltd, Mannheim,Germany.

Preparation of the natural nanoscaffold in the bioreactor

The SAPN was discovered from a segment in yeast protein byZuotin (Zhang et al., 1992) and now is commercially available underthe name PuraMatrixTM. We first decreased the viscosity of theSAPN stock solution of our aliquots (1.5ml microtube) byvortexing 30min in a bath sonicator. If air bubbleswere present, wecentrifuged the aliquots at high speed for a few seconds. Weprepared a 0.5% solution of SAPN by diluting with sterile water. Inorder to create the nanoscaffold in the six-well bioreactor, 1.2mlof 0.5% (v\v) SAPN (300ml for a 24 well bioreactor) was uniformlydistributed over each well and then 2.4ml of W.E. medium wasadded very carefully in to each well of the six-well bioreactor. Topromote the gelation, we put the bioreactor in an incubator for 1 h.After the nanostructure hydrogel was assembled, we carefullychanged the medium using a wide top micropipette. We avoidedusing an aspirator because of the risk of destroying thenanostructured hydrogel. We changed the medium (300ml perwell for 24 wells) twice over a period of 1 h to equilibrate the gel atphysiological pH and finally put the bioreactor in an incubatorovernight with the medium. After that we seeded the desired celldensity. The culture medium (250ml) was replaced with freshmedium every 78 h and the supernatant was stored at �20 8C forLDH, albumin, and urea tests.

Semiquantitative RT-PCR

Total RNA was isolated from cultured cells using a RNeasyMinElute Cleanup Kit and then 8mg of the RNA was reversetranscribed into cDNA from cultured rat primary liver cellsprepared using the Fastlane Cell cDNA kit (Qiagen, Hilden,Germany) according to manufacturer’s instructions. Quantitativereal-time PCR was performed using SYBR Green PCR Master Mix(Applied Biosystems). Primers for rat albumin and CYPA31 andGAPDH genes were selected (Rat CYP3A1-specific primer set:forward, 50 GCCATCACGGACACAGAAATA 30; reverse, 50GAACGTGGGTGACAGTAAGGCT 30; rat albumin forward, 50ATACACCCAGAAAGCACCTC 30; reverse, 50CACGAATTGTGCGAATGTCAC 30; Rat housekeeping geneforward 50 CAG TTC CAC CCA CCT CAG AT 30 and reverse 50TTT TGG GCT CCT TCA GAG TG 30). Primer (Sigma Genosys)concentrations were optimized before use. SYBR Green Master

Fig. 1. A hypothetical in vitro two compartment model to compare the in vivo situation with special reference to drug metabolites detectionduring biotransformation. (a) Cell matrix phase (cellsRnanosaffold: Compartment I) compare to the in vivo liver cells and (b) supernatant(CompartmentII)comparetobloodplasmasinceinvivolivercells(hepatocytes)hasdirectcontactofhumanplasmawherehepatocytecanextractoxygen and nutrients and detoxify chemicals in the plasma and their metabolites pass into the plasma.


3 D S I G N A L I N G / S C A F F O L D I N G B A S E D B A L D E V E L O P M E N T 315

Mix (1�) was used with 1mM of forward and reverse primers in atotal volume of 12ml that also included 1ml cDNA. All PCRreactions were performed in duplicate. PCR amplification wasperformed as follows: 95 8C for 10min, 40 cycles of 95 8C for15 sec, 60 8C for 10 sec and 68 8C for 1min on a MastercyclerRealplex (Eppendorf). The PCR products were then analyzed usingthe electrophoresis of 2% agarose gels stained with ethidiumbromide for visualization. The gel images were captured using aMolecular Imager FX (Bio-Rad Laboratories, Hercules, CA). Thehousekeeping gene (GAPDH) was used as an internal standard todetermine relative levels of albumin, albumin and CYP3A1 geneexpression.

Biochemical assays

Albumin and ureaweremeasured by ELISA as previously described(Bader et al., 1999). GOT and GPT activities were quantified viakinetic spectrophotometry. The main reaction (pyridoxalphosphate activation, standard method 94, Roche, Mannheim,Germany) was coupled with a photometrically quantifiable NADHreduction (HiCo GOT/GPT IFCC, Human Gesellschaft furBiochemica und Diagnostica GmbH, Germany). LDH activity wasdetermined in a colorimetric enzymatic assay (CytotoxicityDetection Kit, Cat. No. 1644793, Roche, Mannheim, Germany).For induction of CYP3A1 expression, dexamethasone (as a 10-mMsolution in DMSO; final concentration: 10mM) was added to thereplacing medium at various day 5, day 15, day 25, day 35.

Ammonia removal efficiency

The ammonia detoxification functions of cells in the bioreactorwere estimated by assessing the ability of cells to eliminateammonia and to synthesize urea in the presence of 1mM ofammonia in the culture medium. The supernatants were collectedafter different periods of culture (day 5, day 15, day 25, day 35) andkept at�80 8C until the enzymatic determination. Ammoniumwasdetermined enzymatically according to the method by van Ankenand Schiphorst (1974). Ammonium removal efficiency (ARE) wascalculated from the measured values of ammonium concentrationas follows: ARED ((C0�Ct)/C0)� 100, where C0 is theammonium concentration of the medium at tD0, and Ct is theammonium concentration of the medium after 60min ofincubation. A value of 100 represents the total load ammoniumremoval efficiency (Calligaris et al., 2002).

Two-compartmental model of drug biotransformation

Diazepam (20mgml/L) was added to both conditions (control andGroup XI) at day 5, day 15, day 25, and day 35. After incubation for2 h, the culture supernatants and cell matrix phase(cellsþ nanoscaffold)were frozen separately at�20 8Cuntil HPLCanalysis for measurement of diazepam, oxazepam, temazepam, anddesmethyldiazepam content. For all respective time points,experiments were run in duplicate. All experiments were repeatedthree times using cells from five individual isolations. Analysis ofdiazepam and its metabolites by HPLC was described in ourprevious report (Acikgoz et al., 2009).

Analysis of mitochondrial structural status by confocalmicroscopy

We analyzed mitochondrial structural status by confocalmicroscopy by using MitoTracker, a dye used for fluorescentmitochondrial markers. Rat liver cell cultures in different groupsare simply incubated in submicromolar concentrations (dilutionwith culture medium—1:1,000) of the MitoTracker probe anddirectly observed with the fluorescent microscope. In general,MitoTracker probes are cell-permeant mitochondrion-selectivedyes that diffuse passively across the plasma membrane andaccumulate in active mitochondria. The dye remains associatedwith the mitochondria after fixation.

Immunocytochemistry

Cellswere fixed at different day of culture day in bothGroupXI andcontrol as described elsewhere (Li et al., 2010). Briefly, afterblocking with 1% BSA in PBS, cells were incubated at 4 8C withprimary antibodies (CK 18, Albumin, CYP3A1) overnight. Theprimary antibodies (abcam) against CK 18 (1:200), albumin (1:200),CYP3A1 (1:500) were used. Following washing, they wereincubated with the secondary species-specific fluorescenceconjugated antibodies (Alexa Fluor 555) 1:400, 1 h at RT, including1ml/ml DAPI and observed fluorescence microscopy analysis wasperformed using a Zeiss Zeta microscope.

ResultsGene expression in primary rat liver cells cultured ondifferent combinations of factors/cytokines

The liver-specific genes coding were analyzed for albumin andCYP3A1 at various days (day 5, day 15, day 25, day 35). It wasobserved that addition of growth factors and cytokines to thecell culture medium in a SAPN coated bioreactor significantlyincreased the rate of gene expression of albumin and CYP3A1and down regulated in control group. This implied that theseinduction factors/cytokines interacted well and that matureliver specific gene expression had beenmaintained. It was foundthat these abovemarkersweremore stably expressed inGroupI–XI than in the control (Fig. 2). Suitable combinations of growthfactors and cytokines, such as inGroup IX, X,XI, enhanced livergene expression to levels much higher than seen in the othergroups or in the control. A much lower expression of thesegene expression was also seen in Group control group. Theseresults showed that all growth factors/cytokines synergisticallystimulated high levels of liver gene expression (Fig. 2). Incontrast, the controls, where rat liver cells were culturedwithout nanoscaffolds, showed much lower levels of geneexpression than Group XI. Therefore, it is concluded thatgrowth factors/cytokines were more efficiently sensed in thethree-dimensional culture provided by the nanoscaffold coatedbioreactor.

Albumin secretion

The albumin concentrations were measured in supernatants ofall groups including the control (Fig. 3). The albuminconcentrations were measured in supernatants of all groups,including the control (Fig. 3). On day 5, the highest albuminconcentrations were recorded for Group XI (110.0� 4.3mg/L), Group X (86� 8.5mg/L), and Group IX (85� 13.4mg/L).There were less-significant differences in albuminconcentration among these groups (P< 0.05). The lowestconcentrations were measured in Group VIII (72.9� 18.1mg/L), Group VII (63.9� 08.1mg/L), Group VI (61.9� 05.1mg/L),Group I (36.9� 21.1mg/L), Group II (38.9� 03.1mg/L), GroupIII (28.9� 19.1mg/L), Group IV (51.9� 08.1mg/L), Group V(57.9� 12.1mg/L), and Control (31.9� 23.1mg/L). Theselowest concentrations were significantly lower than theconcentrations measured in Group XI (110.0� 4.3mg/L),(P< 0.05). Interestingly, the rise of albumin secretion in GroupXI (110.0� 4.3mg/L) was significantly different (P< 0.05), andfourfold higher than the control group; Control(31.9� 23.1mg/L).

On day 15, the maximum albumin concentrations weremeasured in Group XI (130.4� 3.5mg/L), Group IX(91.4� 4.3mg/L), and Group VIII (78.4� 7.3mg/L). The lowestconcentrations were measured in Group VII (71.9� 11.1mg/L), Group VI (51.9� 8.1mg/L), Group V (28.9� 09.1mg/L),Group IV (31.9� 18.1mg/L), Group III (45.9� 23.1mg/L),Group II (31.6� 0.7mg/L), Group I (29.9� 21.1mg/L), andControl (25.9� 13.1mg/L). The difference between Group XI(130.4� 3.5mg/L) and Control (25.9� 13.1mg/L), including


316 G I R I E T A L .

groups (Group II, Group I, Group III, Group IV, Group V) issignificant (P< 0.05).

On day 25, the maximum albumin concentrations weremeasured in Group XI (122.4� 3.5mg/L), Group IX(93.4� 5.3mg/L), Group X (71.4� 7.3mg/L), and Group VIII(79.2� 16.1mg/L). The lowest concentrations weremeasured in Group VII (64.9� 8.1mg/L), Group VI

(30.3� 5.1mg/L), Group V (20.9� 7.1mg/L), Group IV(22.1� 11.1mg/L), Group III (24.6� 12.1mg/L), Group II(27.4� 3.1mg/L), Group I (21.9� 18.1mg/L), and Control(17.9� 23.1mg/L). The difference between the lowestconcentrations groups and the highest concentrations groups,over the 25-day culture period, was statistically significant(P< 0.05).

Fig. 2. (a) and (b) In vitro expressionof liver genes and analysis byRT-PCR in rat liver cells culturedon aSAPNcoatedbioreactor.Weexaminedgene activity ofmature adult livermarker (albumin and CYP3A1). The value are presented as relative to expression by rat liver cells in differentgroups(GroupsI, II, III, IV,V,VI,VII,VIII, IX,X,X,XI,XII)onSAPNcoatedbioreactor,andnormalizedagainsttheHousekeepinggene(GAPDH)asan internal standard. Results are presented as themeanWSD from three independent experiments. Statistically significant difference comparedwith controls (P<0.05).

Fig. 3. Albuminproductionbyratprimaryhepatocytescultured inthepresenceofcytokinesandgrowth factorsonaSAPNcoatedbioreactor fora 35-day culture period. Data represent meanWSD from at least three cultures from three different isolations (P<0.05).



On day 35, the maximum albumin concentrations weremeasured in Group XI (121.4� 13.5mg/L), Group IX(90.4� 12.3mg/L), Group X (69.4� 11.5mg/L), and Group VI(61.9� 9.1mg/L). The lowest concentrations were measuredin Group VII (71.5� 3.1mg/L), Group VIII (69.4� 7.3mg/L),Group I (19.9� 8.1mg/L), Group II (18.5� 13.1mg/L), GroupIII (19.5� 3.1mg/L), Group IV (18.2� 5.1mg/L), Group V(31.5� 7.1mg/L), and Control (13.9� 21.1mg/L). Highconcentrations of albumin in the rat liver-cell cultures was onlymeasured in Group XI>Group X, and Group IX (Fig. 3). Thehigher albumin production in Group XI, compared with bothother high concentration groups (and low concentrationgroups including control), was statistically, significantly different(P< 0.05). High concentration of albumin in the rat cell cultureswas only measured in Group XI>Group X, Group IX (Fig. 3).We observed stable albumin concretion in these groups. Theseconcentrations were, in most case, significantly higher thanconcentrations measured in the other groups (P< 0.05).

Urea synthesis

Urea synthesis is an important parameter of BAL. Insufficiencyin urea synthesis leads to multiorgan failure, including hepaticencephalopathy, due to accumulation of nitrogen waste, mainlyammonia. Therefore, Urea synthesis were evaluated theefficacy of the SAPN coated bioreactor for long-termmaintenance in all groups throughout the 35-day cultureperiod: it was specifically described the comparison betweenGroup XI particularly with the control to determine thedifference between three dimensional interactions of growthfactors and cytokines with two dimensional culture, in thepresence of all possible growth factors or cytokines. Duringearly culture, up to day 5, both the Groups IX, X and Group XIproduced urea at high rates (Fig. 4), indicating a high catabolicactivity of freshly isolated hepatocytes. However, by day 15,distinguishing differences between the control and Groups IX,X were measured. The highest urea concentrations weremeasured in the control between days 5 to 15; thereafter, therewas a gradual decline in the rate of urea production and verylittle on day 35. In contrast, the other groups of cultivated ratliver cells in the bioreactor had higher levels than the control,and urea synthesis of Groups I, II, IV, IV,V, VI was much lowerthan Groups VII or VII and highest in Group XI. The controlshowedmaximum urea synthesis (mg per ml) on the fifth day. Inthe Group XI, we also observed stable urea production, with aplateau at 17mg/ml. Urea synthesis, which represents the liverfunction of detoxification, was evaluated in all groups, in

addition to these two groups (control and Group XI) (Fig. 4).However, the ability of hepatocytes to metabolize ammonia tourea also strengthens the claim that primary rat liver cellscultured in a SAPN coated bioreactor maintained metabolicfunction and detectable urea concentrations were measuredthroughout the 35-day culture period in all conditions; thesewere highest in the 3D interaction in the presence of all possiblegrowth factors/cytokines.

GPT

The GPT test is commonly measured clinically as a part of adiagnostic liver function test, to determine liver health.Significantly elevated levels of ALT appear in conjunction withliver problems (e.g., viral hepatitis, liver damage, biliary ductdisruption). It is almost alwaysmeasured in units/liter (U/L). Thecontrol yielded very high GPT activity on day 6, 20.0� 1.2U/Land on day 14, 40.5� 1.1U/L, and day 35, 10.0� 1.9U/L incomparison with Group XI (day 6, 6.7� 1.3U/L; day 13,8� 0.3U/L; and day 35, 1.1� 1.2U/L). Therefore, the GPTvalues at day 35 were 60% greater in the control than in GroupXI. Much lower concentrations were measured in Group V(9.8� 0.8U/L), Group VI (9.7� 0.5U/L), Group IX(9.2� 0.6U/L), and Group X (10.2� 0.3U/L) on day 6, andGroup VI (9.29� 1.5U/L), Group VIII (10.29� 2.5U/L), GroupIX (11.27� 0.6U/L), and Group X (10.9� 1.3U/L) on day 15.The GPT value is very much high in control group than othersgroups. Over the course of the culture, it was observed that asignificant increase in GPT distribution in other groups (GroupI, 31.32� 2.2U/L; Group II, 28.62� 3.2 U/L; Group III,29.88� 1.4U/L; Group IV, 30.89� 2.1U/L; Group V,27.31� 3.2U/L) at day 25 and day 35 (Fig. 5).

GOT

Glutamic pyruvic transaminase (also called alanineaminotransferase) is an enzyme that is normally present in liverand released into bloodwhen the liver is damaged. It is themostfrequently used biomarker to detect hepatocellular injury inclinical trials and is more liver specific than aspartateaminotransferase (Green and Flamm, 2002). On day 5, theconcentration in the control (81.0� 3.2U/L) was also higherthan in Group XI including (Group I, Group II, Group III, GroupIV,GroupV).On day 15, the concentrations increased inGroupI (40.42� 3.3U/L), Group III (41.39� 2.1U/L), Group V(46.56� 2.5 U/L), Group VIII (52.52� 3.7U/L), control(62.1� 3.3U/L) and almost much lower in Group VIII, IX, XI.

Fig. 4. Urea synthesis of primary rat liver cells cultured on a SAPN coated bioreactor. Data represent meanWSD from at least three culturesfrom three different isolations, P<0.001.


318 G I R I E T A L .

Fig. 5. (a–d)Activitiesof (a)GOT, (b)GST, (c)LDH, (d)AREtest in livercells culturedonaSAPNcoatedbioreactor.Resultsarepresentedas themeanWSD from three independent experiments. Statistically significant difference compared with controls (P<0.05).



GPT was negligible in Group IX, X, XI and much higher incontrol on day 35 (Fig. 5). The maximum GPT levels in othergroupswereGroup I, 41.61� 4.2U/L; Group III, 39.32� 3.3 U/L; Group V, 40.23� 2.2U/L; Group VI, 39.58� 4.1U/L; GroupVIII, 40.51� 3.5U/L at day 35.

LDH

The LDH test is most often used to check for tissue damage aselevated levels of LDH may indicate liver damage. On the fifthday, the LDH values were negligible in all groups including thecontrols. By the 15th day, the LDH release was Group 1(38.2� 5.6U/L), Group II (51.61� 2.2U/L), Group III(53.52� 4.1U/L), Group IV (62.39� 4.5U/L), and Group VI(51.0� 6.1U/L). On Day 35, LDH reached its highest level(80.32� 12.52U/L) in the control. The Group XI(10.78� 2.5U/L) had their lowest levels at day 35. Lactateformation by rat liver cells cultured in the control increasedmarkedly over the cultivation period, in long-term culture onday 35 (80.32� 12.52U/L), while a minimal increase in wasfound in lactate concentration (50.21� 8.2U/L). The combinedinfluence of growth factors and cytokines had a impact onmembrane stability. Although there was little difference in theLDH activity among Group I, Group II, Group III, Group IV,Group V, Group VI, Group VII, Group VIII, Group IX, GroupX,GroupXI,GroupXI showed the lowest LDHactivity comparedwith any other group (Fig. 5).

Ammonia detoxification

Initially, at day 5, all groups (except control) had approximatelythe same ARE rate but the rate had decreased by 25% at day 15and by 35% at day 35 as compared to day 5. Group XI removed65–88% of applied dose of ammonia in early, middle, and laterculture day and maintained a stable efficiency (Fig. 5). The ARErate in other groups was (Group IX: ARE¼ 62.61� 4.8%;Group X: ARE¼ 65.56� 6.6%; Control: ARE¼ 25.2� 4.5%)on day 15. TheARE ratewas 88.89� 5.02% in theGroupXI and19.47� 2.99% in the control on day 5. The ARE potential of theother groups (Group I, Group II, Group III, Group IV, Group V)fluctuated between a maximum of 70.05� 1.13% on the fifthday and a minimum of 54.82� 5% on day 15. Thereafter, theARE rate declined slowly to 45.05� 2.5% (maximum),19.05� 5.2% (minimum) in these groups (Group I, Group II,Group III, Group IV, Group V) on day 25 and 35. These resultsshow that with our SAPN coated bioreactor under theinfluence of all essential growth factors and cytokinesconditions (GroupXI), the rat liver cellsmaintained the capacityto detoxify ammonia, as compared with control.

Diazepam and its metabolites (Desmethyldiazepam,Temazepam, and Oxazepam) day 5, day 15, day 35

Diazepam content was investigated in both conditions at day 5,day 15, and day 35. On the basis of supernatant analysis of ratliver, initially at day 5, the diazepam content rate was3521� 231 ng/ml in the control group and 800� 112 ng/ml inGroup XI. In the cell matrix phase, the diazepam content washigher in (2626� 181 ng/ml) in control group than Group XI(1458� 133 ng/ml), indicating the conditions of Group XI werea better microenvironment than the control Group fordiazepam clearance.On the fifteenth day, the diazepam contentof the supernatant was 191� 046 ng/ml in the control groupand 78� 27 ng/ml in the Group XI. Finally, efficiency ofdiazepam clearance was examined in later period of culture at35 day where diazepam content of supernatant is1232� 231 ng/ml in the control group and 665� 125 ng/ml inGroup XI. The Diazepam content of cell matrix phase on bothcontrol and Group XI has much difference (Table 1). Based thediazepam clearance, the SAPN coated bioreactor provide good3D microenvironment than 2D culture in control. T

ABLE

1.Twocompartm

entmodelfordrugbiotransform

ation

Diazepam

anditsmetabolites

GroupXIC

ompartm

entI(cellmatrixphase)

ControlCompartm

entI(cellmatrixphase)

GroupXICompartm

entII(Supernatant)

ControlCompartm

entII(Supernatant)

5d

15d

35d

5d

15d

35d

5d

15d

35d

5d

15d

35d

Diazepam

(ng/ml)

1458�288

926�282

1132�231

2626�181

9021�879

9256�499

800�112

78�27

665�125

3521�231

191�046

1232�231

Desmethyldiazepam

(ng/ml)

3236�381

2832�468

2612�116

1213�486

921�332

680�381

3256�668

2315�452

2165�436

835�331

1132�431

632�288

Tam

azapam

(ng/ml)

1521�542

1052�321

951�211

421�178

353�098

201�87

1358�342

1152�346

905�273

605�114

512�225

352�103

Oxyzepam

(ng/ml)

425�112

532�103

327�099

218�102

174�101

95�45

672�230

428�188

280�115

224�097

113�087

115�078


320 G I R I E T A L .

Desmethyldiazepam

Desmethyldiazepam is also a major metabolite of diazepam.Desmethyldiazepam concentration was measured in thecontrol (835� 331 ng/ml in the supernatant and 1213� 486 ng/ml in cell matrix phase) and Group XI (supernatant:3256� 381 ng/ml; matrix: 3236� 668 ng/ml) on the fifth day.On day 14, the Desmethyldiazepam concentrations weremeasured in the control (supernatant: 1132� 431 ng/ml;matrix: 921� 332 ng/ml; difference: 211 ng/ml) and Group XI(supernatant: 2315� 452 ng/ml; matrix: 2832� 468 ng/ml;difference: 517 ng/ml). The desmethyldiazepam content wasmeasured for the supernatant (632� 288 ng/ml in thecontrol group and 2165� 436 ng/ml in Group XI) and the cellmatrix (680� 381 ng/ml in the control group and2612� 116 ng/ml in Group XI) at day 35. A significant decreasein the drug biotransformation potential occurred in thecontrol compared to Group XI in middle and later cultureperiods (Table 1).

Temazepam

This is also one of themajor metabolites of diazepam.On day 5,temazepam concentrations were measured in the control(supernatant: 605� 114 ng/ml; matrix: 421� 178 ng/ml;difference: 200 ng/ml) and Group XI (supernatant:1521� 542 ng/ml;matrix: 1358� 342 ng/ml; difference: 163 ng/ml). Temazepam concentrations were measured in the control(supernatant: 512� 225 ng/ml; matrix: 353� 098 ng/ml;difference: 159 ng/ml) and Group XI (supernatant:1152� 346 ng/ml;matrix: 1052� 321 ng/ml; difference: 100 ng/ml) on day 15 (Table 1). On day 35, temazepam concentrationswere measured in the control (supernatant: 352� 103 ng/ml;matrix: 201� 87 ng/ml; difference: 151 ng/ml) and Group XI(supernatant: 905� 273 ng/ml; matrix: 951� 211 ng/ml;difference: 46 ng/ml).

Oxazepam

Oxazepam is also a major metabolite of diazepam. On day 5,Oxazepam concentrations were measured in the control(supernatant: 224� 097 ng/ml; matrix: 218� 102 ng/ml;difference: 6 ng/ml) and Group XI (supernatant: 672� 230 ng/ml; matrix: 425� 112 ng/ml; difference 24 ng/ml). Oxazepamconcentrations were measured in the control (supernatant:113� 087 ng/ml; matrix: 174� 101 ng/ml; difference: 61 ng/ml)and Group XI (supernatant: 428� 188 ng/ml; matrix:532� 103 ng/ml; difference: 104 ng/ml) on day 15 (Table 1). Onday 35, Oxazepam concentrations were measured in thecontrol (supernatant: 115� 078 ng/ml; matrix: 85� 45 ng/ml;difference: 35 ng/ml) and Group XI (supernatant: 327� 099 ng/ml; matrix: 280� 115 ng/ml; difference: 47 ng/ml).

Mitochondria structural status analysis by confocalmicroscopy and Phase contrast microscopy

Many liver failure syndromes are associated with the commonpathway of mitochondrial injury Schafer et al. 1997. Theybeautifully explained that power failure led to liver failure.Therefore, abnormal mitochondrial status is a pathologicalhallmark of liver failure. However, therewas no apparent loss ofmitochondrial structure, as there was a good level offluorescence intensity but greatly reduced staining intensity incells on day 35 in the control (Fig. 6B). In contrast, thefluorescence intensity in Group XI was greater than in thecontrol. The mitochondrial status confirmed at various days ofculture (day 5, day 15, day 25, day 35). It was found that bettermitochondrial status in Group XI than in the control. Phasecontrast microscopy: It was observed that more polygonalshaped cells in GroupXI than in the control in the early, middle,late period of culture. Liver cells cultured in the SAPN coated

bioreactor (Group XI) adopt an in vivo like polygonal shapethan control and established extensive cell-to-cell contactswitha reorganization of bile canaliculi-like structures (Fig. 6A) atvarious days of culture period (day 5, day 25, day 35).

Immunofluorescence of liver specific markers(albumin, CK 18 and CYP3A1)

High numbers of albumin stained cells also appeared in GroupXI compared to the control, indicating that three dimensionalinteractions in growth factors/cytokines allowed the rat livercells to produce albumin or enhanced its secretion from thecells. CK19 expression in the liver is a marker of biliarydifferentiation. The CK19 expression in Group XI was greaterthan in the control at all days (day 5, day 15, day 25, day 35). Theother markers (CK 19, CYP3A1) were also expressed atsignificantly higher levels than in the control throughout theculture period (Fig. 7).

Discussion

The enormous population of acute liver failure liver failurepatients worldwide has resulted in a great demand for BAL.However, the functional clinical demands of a BAL cannot belimited only to performance of biochemical activities likealbumin synthesis and urea metabolism in the short term, butmust also encompass metabolic removal of potentially toxicsubstances and allow processes such as detoxification, drugbiotransformation, hepatic organoid formation, andbiotransporting activities, with functional maintenance ofsufficiently long duration to meet the native liver regenerationtime of liver failure patients (a few days to a few weeks,depending on the type of patients). In cases of acute liver failure,it may take a couple of weeks for native regeneration (Taub,2004; Quaglia et al., 2008; Chen et al., 2010). In cases of acuteliver failure, native regeneration can take 3weeks (Claudia et al.,1997). Nagino et al. (2001) reported that the liver regeneratesrapidly in the first 2 weeks following major hepatectomy forbiliary cancer. However, they also reported that regeneration isa slowprocess that can take between 6 and 12months followinghepatectomy for the liver to attain 75% of its original volume. Ithas been shown that complete liver regeneration takes about 1year and that non-cirrhotic livers regenerate better thancirrhotic livers (Chen et al., 1991). Other studies have alsoreported that functional metabolic restoration can be detectedin the human liver within 2–3 weeks after major hepatectomy(Pack et al., 1962; McDermott et al., 1963).

This study aimed to achieve at least 35 days of functionalhepatocyte culture to coincide with the average regenerationtime. Previous bench studies have demonstrated stable viabilityand stable metabolic activity for up to 2 weeks in primaryhepatocytes isolated from rat and pig within a spheroidreservoir (Brophy et al., 2009; Brophy et al., 2010). In contrast,our FMB is able tomaintain stable functions for up tomore than4 weeks and in the present study; primary liver cells werecultured to evaluate the liver functions for up to more than 4weeks. This has not been previously investigated with thecombination of cytokines and growth factors used here or witha purely defined SAPN with enhance direct oxygenation thatmore closely approximates an in vivo liver microenvironment(Fig. 8). We plan to make our BAL model more efficient, tomaintain long-term functionality, as well as survivability, over 35days, by optimizing the chemically-defined cytokines andgrowth-factor stimulation, based on the in vivo livermicroenvironment. We are in the process of furtheroptimization to make our BAL model for long-term culture, upto at least 90 days to meet the FDA guidelines (FDA, 2005),which recommend that the duration of a toxicity assay of a drugshould be a minimum of 14 days, to a maximum of 90 days.



Fig. 6. (A):Phaseconstructmicroscopic studiesonshapeandadoptan invivo likepolygonal shape thancontrol andestablishedextensivecell-to-cell contacts with a reorganization of bile canaliculi-like structures in control and Group XI at various day of culture (day 5, day 25, day 35). Thepercentageofpolygonalshapecellofphaseconstructareshown(Controlgroup: (day5,65.5W 12%;day15,38.5W11%;day35,25.6W 09%;P<0.001,student’s test),GroupXI: (day 5, 95.5W 02%; day15, 88.5W 07%; day35, 78.6W 11%;P<0.001, student’s test). (B):Confocalmicroscopic studies onmitochondrialmembranepotential andmorphologicchanges (MitoTracker staining) in rat livercell culture incontrolandGroupXIatvariousdayof culture (day 5, day 15, day 25, day 35). The image of mitochondria’s status were confirmed by confocal microscopy (Control group: (day 5,45.5W 12%; day 15, 28.5W 11%; day 35, 21.6W 09%; P<0.001, student’s test), Group XI: (day 5, 85.5W 02%; day 15, 78.5W 07%; day 35, 70.6W 11%;P<0.001, student’s test).

Fig. 7. (A–C) Confocal images by immunofluorescence staining ofliver specific markers (albumin, CYP3A1, CK 18) in rat liver cells culture inpositive control group and Group XI at day 5, day 15, day 25, day 35. (A) albumin, (B) CYP3A1, (C)CK 18. Culture cells in group XI conditioncontained more albumin positive cells than control group (Control group : (day 5: 35.5W 11%, day 15: 21.5W 12%, Day 35: 15.6W09%, P<0.005,student’s test),GroupXI (day 5: 75.5W 08%, day 15: 68.5W 08%,Day 35: 65.6W 13%,P<0.005, student’s test). TheCYP3A1positive cells aremorein group XI than control group (Control group: (day 5: 35.5W 07%, day 15: 18.5W 09%, Day 35: 11.6W 04%, P<0.005, student’s test), Group XI(day 5: 71.5W 02%, day 15: 61.5W 07%,Day 35: 70.6W 11%, P<0.005, student’s test). TheCK18 cells alsomore expressed in groupXI than control.(Control group: (day 5: day 5: 28.5W 12%, day 15: 21.5W 05%, Day 35 : 14.6W 07%, P<0.005, student’s test), GroupXI (day 5, 075.5W 06%, day 15:68.5W 08%, Day 35: 61.6W 09% P<0.005, student’s test). All scale bars is 50mm.


322 G I R I E T A L .

Fig. 7.



Several types of BALs are being developed and introduced inpreclinical setting or clinical setting by other groups, including aflat membrane sheet system introduced by our group (Fruhaufet al., 2004; Maringka et al., 2010). Unlike other existingbioreactors, the bioreactor described heremaintains increasingintracranial pressure (Fruhauf et al., 2004). Most of the animalmodels do not address the increasing intracranial pressure(Rozga et al., 1993), which seems to be the leading clinicalproblem in a number of patients because there is no treatmentexisting today. Taken together, our FMB is particularly welldesigned for BAL construction, as detailed in our previousreport (De Bartolo and Bader, 2001; Maringka et al., 2010).

In general, an ideal BAL is a bioreactor, with seeded cells on asuitable extracellular matrix/scaffold. This creates an in vivomicroenvironment that performs the functions of a normalliver. It is a growing concern that the preclinical or clinicalsuccess of BALs rely on its microenvironment. However, just ascaffold and cells do not match the complete profile of the invivo microenvironment. The actual microenvironment iscomprised of a collection of cells, the extracellular matrix/scaffold, cytokines, and growth factors and that forms the basis

of normal tissue architecture and function. The in vivomicroenvironments of normal liver and diseased liver arealso significantly different, particularly with respect tosecretion of cytokines and growth factors. High levels ofhepatocyte growth factors and other regenerative factors,including pro-inflammatory cytokines (e.g., TNFa, IL1 b, andIL6) are released into the bloodstream, both from the liver andfromdistal sites, during hepatic toxic injury (Lacour et al., 2005).Exogenous interleukin-6 enhances liver regeneration aftermajor and extreme liver resection (Jin et al., 2007; Tiberio et al.,2008).

Studies of liver regeneration in humans are difficult becauseof the diverse etiology of liver injury that paves the wayregeneration (Palmes and Spiegel, 2004). HGF has been cited asthe most potent factor for liver regeneration and may haveapplication in treatment of liver fibrosis (Ueki et al., 1999). Theliver activinA, likeTGF-b1, is a negative regulator of growth andcontributes to the adjustment of liver size according tophysiological requirements. However, highly efficientdifferentiation of hESCs into functional hepatic endodermrequires ActivinA and Wnt3a signaling (Hay et al., 2008;Sulzbacher et al., 2009). BMP-4 is required for hepaticspecification of mouse embryonic stem cell-derived definitiveendoderm (Gouon-Evans et al., 2006). Portalvenousadministration of EPO has been demonstrated to increase liverregeneration in rats after 70% liver resection (Schmeding et al.,2008).

Based on these above findings, we aimed to examine theeffects of these types of factors (e.g., HGF, BMP-4, Activin A, IL-6, and EPO, alone or in combination) in a 3D culture of primaryrat liver cells in a BAL model and then analyzed liver specificgene expression by RT-PCR and other biochemical tests every5 days of interval up to 8 weeks. Based on our results, wehypothesized that a liver failure patient not only secreted HGFbut also secreted other factors and cytokines. Interleukin (IL) 6is one of the important components of the early signalingpathways that lead to liver regeneration (Jin et al., 2007; Tiberioet al., 2008). Cytokines and growth factors have been identifiedas serving as important signals that control initiation andprogression of hepatocyte replication aswell as the terminationof this process once the liver organ has reached a certain level ofgrowth. The clinical significance of the understanding of thisprocess has led to enormous advances in therapeutic optionsavailable for the treatment of hepatic damage. Again,theoretically, cytokines may be introduced into the body/livereither by BAL to stimulate a more rapid liver regeneration andto retain good liver function. The present study found thatenhanced biochemical functions as well as greater geneexpression was a combined effect of these selected factors/cytokines in 3D interaction, rather than a single effect. Cells invivo exist in and react to a complex set of nutritional, hormonal,and stromal influences from their environment rather thansingle components.

There are many other factors that may have positive effectson liver regeneration. For example, BMP-7 circulates in theblood at a concentration range of 100–300 pg/m (Vukicevicet al., 1994). Therefore, Sugimoto et al. (2007) hypothesizedthat BMP-7 might function as an endogenous regulator of liverhealth and found BMP-7 functions as a novel hormone tofacilitate liver regeneration. In present study, a modular novelbioartificial liver support system was designed and constructedin BAL configuration with special influence of 3D interaction ofgrowth factors and cytokine signaling in order to simplify thetedious operation of a bioartificial liver treatment and toimprove the long-term functional applicability of the system.The 3D interaction of these growth factors and cytokines wascritical for BAL function since each cytokine or growth factorhas its own matching cell-surface receptor. In the 3Dinteraction, these cytokines or growth factors freely search out

Fig. 8. A hypothetical model 2D and 3D growth factor/cytokinessignaling interactionwith rat liver culture cells in conventional cultureand 3D culture in clinically relevant bioreactor which is particularlydesigned for in vivo livermicroenvironment. In vivo, liver cells exist inand react to a complex set of nutrients, cytokines, growth factors, andhormones that vary with healthy and diseased conditions. We intendto show limitation of 2D culture for enhanced function underinfluence of these complex plural agents where signaling and diffusionof growth factors/cytokines are inherently asymmetric. In contrast,3D culture provides an authentic in vivo microenvironment wherecytokines, growth factors, and hormones are able to bind to theirreceptors in 3Dto initiate intracellular cascades,which influencegeneexpression.


324 G I R I E T A L .

their receptors three dimensionally, rather than twodimensionally (Fig. 8). The signaling and diffusion is inherentlyasymmetric in traditional 2D culture (Saha et al., 2007).

Drug biotransformation is one of the most importantparameters of preclinical screening tests for the registration ofnewdrug candidates. Although, during the past 20 years, a rangeof test systems has been developed in academia and industry toexplore and detect in vivo and in vitro metabolites, our two-compartmental in vitro approach provides simple and rapiddetection of metabolites, which is extremely important in aclinical context, and may reduce the need for animalexperiments before the clinical trial stage. This may be avaluable approach for the pharmaceutical research. Althoughlittle data is available on clinical efficacy, the use of a three-dimensional signaling- and scaffolding-based BAL device mightbe valuable for preclinical drug screening tests to facilitate thesafe registration of new drug candidates and accelerate drugdiscovery and development by providing better predictability ofhepatotoxicity.

Nearly half of all drugs fail in the post-marketing phase due tounexpected toxicity or metabolism issues, and, hepatotoxicitywas ranked first in terms of adverse events and it remains themost common reason for restriction or withdrawal of a drugfrom themarket by the FDA, according to a 2006 survey reportof pharmaceutical companies (Temple, 2006; Holden, 2008).Drug-induced hepatotoxicity is a growing concern forclinicians, pharmaceutical companies, regulatory agencies andpatients worldwide, with more than 1,000 drugs now linked toliver injury (Shi et al., 2010). Many drugs are not well cleared bythe liver and accumulate inside liver cells, and there are few orno data about this accumulation based on in vitro study. Toxicmetabolites may accumulate inside the cell without any toxiceffect on the liver, but they may create a toxic effect byinteraction with metabolites of another drug. Therefore, westrongly support the hypothesis that it is mandatory to analyzedrug metabolites inside the cell in a two compartment model(cellmatrix phase and supernatant), as this is clinically importantfor drug discovery and preclinical development programs orclinical medication. Our BAL model may be of use inpharmacology as an alternative to animal experiments.

We used a self-assembling peptide nanoscaffold built from apeptide that was discovered from a segment of the yeastprotein, Zuotin (Zhang et al., 1992). Zuotin is a member of anew class of peptides that preferentially bind to the left handedZ-DNAbinding protein in Saccharomyces cerevisiae (Zhang et al.,1992). The world’s most important yeast, Saccharomycescerevisiae, has been a very useful fungus for humans for manymillennia. Saccharomyces cerevisiae is a yeast commonly used inbaking and brewing and as a biotherapeutic agent.Saccharomyces cerevisiae is completely harmless for healthypeople. Since this peptide is a putatative ZNAbinding peptide, itwill be interesting to see if these self-assembling peptides canalso be used for carrying DNA or RNA in gene delivery or drugdelivery, which is also an important therapy today. Theapplication of DNA delivery using copolymer nanoparticles andother self assembling peptides has been reported (Vonarbourget al., 2009; Chhabra et al., 2010; Liu et al., 2010; Lee et al., 2010;Zhong et al., 2010).

There are a number of good features about SAPN, such as itsß-sheet structure that is very stable (Zhang et al., 1993; Zhanget al., 1994) and the fact that it is possible to readily modify thedesigner peptide at the single amino acid level at will,inexpensively and quickly, to study cell signal pathways in aselective way that is not possible with substrates includingmatrigel and collagen gels. The latter in fact can often causeconfused cell signaling activation. Collagen gelation occursthrough a change in temperature that can sometimes induceunknown biological process including cold or heat shocks butthis is not required with SAPN. Cells constantly interact with

each other and with their surrounding local microenvironmentand this communication serves to integrate and coordinate thevarious gene expression patterns and is crucial for tissuefunctions and homeostasis. In the present study, the SAPNsurrounds each liver cell and may allow cell-to-cellcommunication.

That a static condition may be an insufficient tool for BAL isthe main disadvantage of the present study conditions, but wewere able to stimulate liver stem cells to differentiate intofunctional and efficient hepatocyte cells in our in vivo livermicroenvironment in this bioreactor, in both static andperfusion modes (data not shown). Another disadvantage ofthis article is use of culture medium instead of human plasma.However, we have previously evaluated the performance usinghuman plasma (Maringka et al., 2010). Although this study didnot measure all the major protein contents (transferrin,fibrinogen, hemopexin, and ceruloplasmin) of the supernatant,it did measure albumin, a major protein secreted byhepatocytes that represents 50% of the total secreted protein.Albumin secretion is a major physiological function of the liver.Although these enzymes (AST, ALT, and GGT) are elevatedduring fulminant hepatic failure, these biomarkers are not themost important parameters that clinicians follow to determinethe outcome in the case of patients diagnosed with fulminanthepatic failure. International normalized ratio (INR),phrotrombin time and mental status are the most importantthree signs and symptoms in a clinical setting that help a clinicianunderstand whether a patient is getting better or worse. Acuteliver failure is associated with increased intracranial pressure(ICP) and causes unacceptably highmortality (Rozga et al., 1993;Detry et al., 2006). Despite an increased understanding of thepathophysiological basis of ICP, treatment strategies arelimited. Although we had evaluated our BAL in a clinical setting,in our previous new porcine hepatectomy model study, wehave investigated the reduction of ICP in BAL treated modeland high clearance of the circulating ammonia level, and theincrease in ICP and low clearance of the circulating ammonialevel in an untreated group (Fruhauf et al., 2004). We haveenvisaged a future about clinical use of our bioreactor for acuteliver failure patients, by using the most challenging, viral-freeinduced pluripotent stem cell (iPS) derived hepatocytes.However, we are still in a very initial stage.

BAL systems aremost commonly used as a supportive devicefor patients diagnosed with fulminant hepatic failure in order toallow these patients to either receive a liver transplant orspontaneously recover.However, several limitationswith BALsexist, and significant technical challenges remain when BAL isused in the clinical setting. Bioreactors are a key part of BALdevices, and each configuration has specific advantages anddisadvantages. Over the past 50 years, many BALs have beendeveloped and tested in controlled clinical trials, but nosignificant effect on survival was observed. This may be becauseit is quite difficult to figure out the exact survival benefit as acuteliver failure patients not only use these devices, but alsoundergo several other forms of standard therapy followingintensive care to provide metabolic, respiratory, andhemodynamic support. The mechanism of the currentlyavailable BAL devices remains unclear and till date, there havebeen no appropriately randomized controlled studies thatreport true survival outcomes. To ultimately establish thesurvival advantage from using BALs, a controlled, double-blinded, randomized clinical study with large patient groups isrequired to yield statistically significant outcomes. The problemwith such a study is that no center in the world admits asufficient number of patients diagnosed with fulminant hepaticfailure to obtain statistically significant results. Also, if webelieve that any of these devices can truly impact the survival ofthese patients, it would be unethical to randomize patients intotreated and untreated groups.



Cell shape is reported to be closely associatedwith functions(Singhvi et al., 1994).Cuboidal cell shape is important for in vitroreconstituting of functional liver tissue. We found a desirablecell shape under certain conditions, such as those of Groups XI,X, and IX. Cells that make up tissues in the body possess acomplex three-dimensional (3D) architecture, which ismarkedly different from that seen on the two-dimensional (2D)surface of tissue culture plastic. The 3D structure of cells andinteractions with their neighbors significantly influences theirability to grow and function. Evidence for the functionalsuperiority of cells cultured on 3D supports compared to 2Dmonolayer cultures has been reported in present study and it isof much interest in the present decades to promote the growthand function of cells in a more realistic manner. Cells acquirecomplex 3D geometries and form intricate interactions withadjacent cells, cytokines, and growth factors. This nanoscale(10 nm) SAPN surrounds each three-dimensionally microsizedliver cell (10–20mm) and facilitates each cell to have its ownposition in direct contact with themedia (in vivo plasma) so thateach liver cell can extract oxygen, nutrients, and detoxify toxinsin themedium (in vivo plasma) and pass their metabolites out tothe medium (plasma).

Bioreactor configurations are indispensable for thedevelopment of BALs used for liver failure. The present studyinvestigated the 3D interaction of appropriate growth factorsor cytokines signaling agents (which either appear in blood ofliver failure patients or have significant roles in native liverregeneration), alone or in combinations, in liver cells. Enhanceddesirable functions over the long-term that could mimic nativeliver regeneration times (up to 35 days) in a SAPN coatedbioreactor with direct enhanced oxygenation were comparedwith traditional 2D culture models (where signaling anddiffusion of growth factors/cytokines are inherentlyasymmetric). We found desirable stable liver gene expressionas well as essential biochemical liver functions includingdetoxification, and biotransformation were significantly betterthan the 2D model. This approach will allow a greaterunderstanding of 3D cell signaling in a BAL model with suitableregenerative agents in a purely defined SAPN coatedbioreactor. This reactormay potentially be applied in preclinicalor clinical situations to supplement other existing bioreactorsbased on BALs, to improve the treatment of liver disease inanimal or human models. In parallel, a SAPN coated bioreactorallows a three-dimensional surface for cell growth factors orcytokine induction unlike in 2D. Therefore, the modifiednanorange scaffold material is essential for bioreactors basedon BAL in order allow construction of an effective BAL that canmimic the in vivo liver microenvironment. In addition, our invitro two compartment concept is clinically important fordetection of metabolites inside the cells (cell matrix phase)and outside the cells (supernatant) in this SAPN coatedbioreactor. This concept may be useful as an alternative toanimal experiments related to metabolite detection in thepharmaceutical research, and academia, since metaboliteanalysis is a critical requirement for the development of newdrugs.

Acknowledgments

The authors wish to thank Angela Henning and Sabine Ebert fortheir excellent technical support and Frank Struck for supply ofprimary hepatocytes. Funding of this project was provided byMedicine faculty of University of Leipzig.

Literature Cited

Acikgoz A, Karim N, Giri S, Schmidt-Heck W, Bader A. 2009. Two compartment model ofdiazepam biotransformation in an organotypical culture of primary human hepatocytes.Toxicol Appl Pharmacol 234:179–191.

Bader A, FruhaufN, TiedgeM,DrinkgernM,DeBartolo L, Borlak JT, SteinhoffG, HaverichA.1999. Enhanced oxygen delivery reverses anaerobic metabolic states in prolongedsandwich rat hepatocyte culture. Exp Cell Res 246:221–232.

Basile AS, Hughes RD, Harrison PM, Murata Y, Pannell L, Jones EA, Williams R, Skolnick P.1991. Elevated brain concentrations of 1,4-benzodiazepines in fulminant hepatic failure. NEngl J Med 325:473–478.

Bernal W, Hall C, Karvellas CJ, Auzinger G, Sizer E, Wendon J. 2007. Arterial ammonia andclinical risk factors for encephalopathy and intracranial hypertension in acute liver failure.Hepatology 46:1844–1852.

Bhatia V, Singh R, Acharya SK. 2006. Predictive value of arterial ammonia for complicationsand outcome in acute liver failure. Gut 55:98–104.

BrophyCM, Luebke-Wheeler JL, Amiot BP, KhanH, Remmel RP, Rinaldo P, Nyberg SL. 2009.Rat hepatocyte spheroids formed by rocked technique maintain differentiated hepatocytegene expression and function. Hepatology 49:578–586.

Brophy CM, Luebke-Wheeler JL, Amiot BP, Remmel RP, Rinaldo P, Nyberg SL. 2010. Geneexpression and functional analyses of primary rat hepatocytes on nanofibermatrices. CellsTissues Organs 191:129–140.

Calligaris SD, Almada LL, Guibert EE, Tiribelli C, Rodriguez JV. 2002. Ammonium detoxifyingactivity is maintained after 72hours of cold preservation of rat hepatocytes in University ofWisconsin (UW) solution. Cryo Lett 23:245–254.

Carpentier B, Gautier A, Legallais C. 2009. Artificial and bioartificial liver devices: present andfuture. Gut 58:1690–1702.

Chen HL, Chen CL, Huang TL, Chen TY, Tsang LL, Ou HY, Yu CY, Cheng YF. 2010.Regeneration rate of left liver grafts in adult living donor liver transplant. Transplant Proc42:699–700.

Chen MF, Hwang TL, Hung CF. 1991. Human liver regeneration after major hepatectomy. Astudy of liver volume by computed tomography. Ann Surg 213:227–229.

Chen AA, Khetani SR, Lee S, Bhatia SN, Van Vliet KJ. 2009. Modulation of hepatocytephenotype in vitro via chemomechanical tuning of polyelectrolytemultilayers. Biomaterials30:1113–1120.

ChhabraR, Sharma J, LiuY, Rinker S, YanH. 2010.DNASelf-assembly forNanomedicine.AdvDrug Deliv Rev 62:617–625.

Claudia R, Ballauff A, Lange R, Erhard J. 1997. Heterotopic auxiliary liver transplantation in a 3year old boy with acute liver failure and aplastic anemia. Transplantation 64:658–660.

Cushing MC, Anseth KS. 2007. Materials science. Hydrogel cell cultures. Science 316:1133–1134.

De Bartolo L, Bader A. 2001. Reviewof a flatmembrane bioreactor as a bioartificial liver. AnnTransplant 6:40–46.

Detry O, De Roover A, Honore P, Meurisse M. 2006. Brain edema and intracranialhypertension in fulminant hepatic failure: pathophysiology and manageme. World JGastroenterol 12:7405–7412.

FDA (Food and Drug Administration), Center for Drug Evaluation and Research. August2005. Guidance for Industry, Impurities in Drug Product. Revision I, http://www.fda.gov/Cder/Guidance/6423dftrev1.html

Feng ZQ, Chu XH, Huang NP, Leach MK, Wang G, Wang YC, Ding YT, Gu ZZ. 2010. Rathepatocyte aggregate formation on discrete aligned nanofibers of type-I collagen-coatedpoly(L-lactic acid). Biomaterials 31:3604–3612.

Frederick CB, Obach RS. 2010. Metabolites in safety testing: ‘‘MIST’’ for the clinicalpharmacologist. Clin Pharmacol Ther 87:345–350.

Fruhauf NR, Oldhafer KJ, Holtje M, Kaiser GM, Fruhauf JH, Stavrou GA, Bader A, BroelschCE. 2004. A bioartificial liver support system using primary hepatocytes: a preclinical studyin a new porcine hepatectomy model. Surgery 136:47–56.

Fura A. 2006. Role of pharmacologically active metabolites in drug discovery anddevelopment. Drug Discov Today 11:133–142.

Giri S, Nieber K, Bader A. 2010. Hepatotoxicity and hepatic metabolism of available drugs:current problems and possible solutions in preclinical stages. Expert Opin Drug MetabToxicol 6:895–917.

Green RM, Flamm S. 2002. AGA technical review on the evaluation of liver chemistry tests.Gastroenterology 123:1367–1384.

Goel A, Yadav S, Saraswat V, Srivastava A, Thomas MA, Pandey CM, Rathore R, Gupta R.2010. Cerebral oedema in minimal hepatic encephalopathy due to extrahepatic portalvenous obstruction. Liver Int 30:1143–1151.

Gouon-Evans V, Boussemart L, Gadue P,Nierhoff D, Koehler CI, KuboA, ShafritzDA, KellerG. 2006. BMP-4 is required for hepatic specification ofmouse embryonic stem cell-deriveddefinitive endoderm. Nat Biotechnol 24:1402–1411.

Hay DC, Fletcher J, Payne C, Terrace JD, Gallagher RC, Snoeys J, Black JR, Wojtacha D,Samuel K, Hannoun Z, Pryde A, Filippi C, Currie IS, Forbes SJ, Ross JA, Newsome PN,Iredale JP. 2008. Highly efficient differentiation of hESCs to functional hepatic endodermrequires ActivinA and Wnt3a signaling. Proc Natl Acad Sci USA 105:12301–12306.

Holden A. Detecting and investigating drug-induced adverse events: the international seriousAdverse event consortium’s experience. 2008. www.fda.gov/cder/livertox

Howell CA, Sandeman SR, Phillips GJ, Lloyd AW, Davies JG, Mikhalovsky SV, Tennison SR,RawlinsonAP,KozynchenkoOP,OwenHL,Gaylor JD,Rouse JJ, Courtney JM. 2006. The invitro adsorption of cytokines by polymer-pyrolysed carbon. Biomaterials 27:5286–5291.

Janorkar AV, Rajagopalan P, Yarmush ML, Megeed Z. 2008. The use of elastin-likepolypeptide-polyelectrolyte complexes to control hepatocytemorphology and function invitro. Biomaterials 29:625–632.

Jin X, Zhang Z, Beer-StolzD, Zimmers TA, Koniaris LG. 2007. Interleukin-6 inhibits oxidativeinjury and necrosis after extreme liver resection. Hepatology 46:802–812.

Khetani SR, Bhatia SN. 2008. Microscale culture of human liver cells for drug development.Nat Biotechnol 26:120–126.

Kidambi S, Yarmush RS, Novik E, Chao P, Yarmush ML, Nahmias Y. 2009. Oxygen-mediatedenhancement of primary hepatocytemetabolism, functional polarization, gene expression,and drug clearance. Proc Natl Acad Sci USA 106:15714–15719.

Kim M, Lee JY, Jones CN, Revzin A, Tae G. 2010. Heparin-based hydrogel as a matrix forencapsulation and cultivation of primary hepatocytes. Biomaterials 31:3596–3603.

Knowles SR, Uetrecht J, Shear NH. 2000. Shear, Idiosyncratic drug reactions: the reactivemetabolite syndrome. Lancet 356:1587–1591.

Kundra A, Jain A, Banga A, Bajaj G, Kar P. 2005. Evaluation of plasma ammonia levels inpatients with acute liver failure and chronic liver disease and its correlation with theseverity of hepatic encephalopathy and clinical features of raised intracranial tension. ClinBiochem 38:696–699.

Lacour S, Gautier JC, Pallardy M, Roberts R. 2005. Cytokines as potential biomarkers of livertoxicity. Cancer Biomark 1:29–39.

LeeWM, Squires RH Jr, Nyberg SL, Doo E, Hoofnagle JH. 2008. Acute liver failure: summaryof a workshop. Hepatology 47:1401–1415.

Lee JH, Choi YJ, Lim YB. 2010. Self-assembled filamentous nanostructures for drug/genedelivery applications. Expert Opin Drug Deliv 7:341–351.


326 G I R I E T A L .

Li Z, Leung M, Hopper R, Ellenbogen R, Zhang M. 2010. Feeder-free self-renewal ofhuman embryonic stem cells in 3D porous natural polymer scaffolds. Biomaterials31:404–412.

Liu J, Huang W, Pang Y, Zhu X, Zhou Y, Yan D. 2010. Self-assembled micelles from anamphiphilic hyperbranched copolymer with polyphosphate arms for drug delivery.Langmuir 26:10585–10592.

Luo JC, Cheng TJ, Kuo HW, Chang MJ. 2005. Abnormal liver function associated withoccupational exposure to dimethylformamide and glutathione S-transferasepolymorphisms. Biomarkers 10:464–474.

Maringka M, Giri S, Bader A. 2010. Preclinical characterization of primary porcinehepatocytes in a clinically relevant flat membrane bioreactor. Biomaterials 31:156–172.

Mallon BS, Park KY, Chen KG, Hamilton RS, McKay RD. 2006. Toward xeno-free culture ofhuman embryonic stem cells. Int J Biochem Cell Biol 38:1063–1075.

Martin MJ, Muotri A, Gage F, Varki A. 2005. Human embryonic stem cells express animmunogenic nonhuman sialic acid. Nat Med 11:228–232.

McDermott WV Jr, Greenberger NJ, Isselbacher KJ, Weber AL. 1963. Major hepaticresection: diagnostic techniques and metabolic problems. Surgery 54:56–66.

Mehta G, Williams CM, Alvarez L, Lesniewski M, Kamm RD, Griffith LG. 2010. Synergisticeffects of tethered growth factors and adhesion ligands on DNA synthesis andfunction of primary hepatocytes cultured on soft synthetic hydrogels. Biomaterials31:4657–4671.

Millis JM, Losanoff JE. 2005. Technology insight: liver support systems. Nat Clin PractGastroenterol Hepatol 2:398–405, quiz 434.

Moriwaki H, Shiraki M, Iwasa J, Terakura Y. 2010. Hepatic encephalopathy as a complicationof liver cirrhosis: an Asian perspective. J Gastroenterol Hepatol 25:858–863.

Nagino M, Ando M, Kamiya J, Uesaka K, Sano T, Nimura Y. 2001. Liver regeneration aftermajor hepatectomy for biliary cancer. Br J Surg 88:1084–1091.

Nahmias Y, Kramvis Y, Barbe L, Casali M, Berthiaume F, Yarmush ML. 2006. A novelformulation of oxygen-carrying matrix enhances liver-specific function of culturedhepatocytes. FASEB J 20:2531–2533.

Papadopoulos N, Soultati A, Goritsas C, Lazaropoulou C, Achimastos A, Adamopoulos A,Dourakis SP. 2010.Nitric oxide, ammonia, andCRP levels in cirrhotic patientswith hepaticencephalopathy: is there a connection? J Clin Gastroenterol 44:713–719.

Park B, Pirmohamed M, Kitteringham N. 1998. Role of drug disposition in drughypersensitivity: a chemical,molecular, and clinical perspective.ChemResToxicol 11:969–988.

PackGT, Islami AH,Hubbard JC, Brasfield RD. 1962. Regeneration of human liver aftermajorhepatectomy. Surgery 52:617–623.

Palmes D, Spiegel HU. 2004. Animal models of liver regeneration. Biomaterials 25:1601–1611.

Pares A, Deulofeu R, Cisneros L, Escorsell A, Salmeron JM, Caballerıa J, Mas A. 2009.Albumin dialysis improves hepatic encephalopathy and decreases circulating phenolicaromatic amino acids in patients with alcoholic hepatitis and severe liver failure. Crit Care13:R8.

Pavlica S, Piscioneri A, Peinemann F, Keller M, Milosevic J, Staeudte A, Heilmann A, Schulz-Siegmund M, Laera S, Favia P, De Bartolo L, Bader A. 2009. Rat embryonic liver cellexpansion and differentiation on NH3 plasma-grafted PEEK-WC-PU membranes.Biomaterials 30:6514–6521.

Poyck PP, Mareels G, Hoekstra R, vanWijk AC, van derHoeven TV, vanGulik TM, VerdonckPR, Chamuleau RA. 2008. Enhanced oxygen availability improves liver-specific functions ofthe AMC bioartificial liver. Artif Organs 32:116–126.

Quaglia A, Portmann BC, Knisely AS, Srinivasan P, Muiesan P, Wendon J, Heneghan MA,O’Grady JG, Samyn M, Hadzic D, Dhawan A, Mieli-Vergani G, Heaton N, Rela M. 2008.Auxiliary transplantation for acute liver failure: histopathological study of native liverregeneration. Liver Transpl 14:1437–1448.

Rozga J, Podesta L, LePage E, Hoffman A, Morsiani E, Sher L, Woolf GM, Makowka L,Demetriou AA. 1993. Control of cerebral oedema by total hepatectomy andextracorporeal liver support in fulminant hepatic failure. Lancet 342:898–899.

SahaK, Pollock JF, SchafferDV,HealyKE. 2007.Designing syntheticmaterials to control stemcell phenotype. Curr Opin Chem Biol 11:381–387.

Schafer DF, Sorrell MF. 1997. Power failure, liver failure. N Engl J Med 336:1173–1174.

Schmeding M, Boas-Knoop S, Lippert S, Ruehl M, Somasundaram R, Dagdelen T, Neuhaus P,Neumann UP. 2008. Erythropoietin promotes hepatic regeneration after extended liverresection in rats. J Gastroenterol Hepatol 23:1125–1131.

Schmitmeier S, Langsch A, Jasmund I, Bader A. 2006. Development and characterization of asmall-scale bioreactor based on a bioartificial hepatic culture model for predictivepharmacological in vitro screenings. Biotechnol Bioeng 95:1198–1206.

Scott MR, Will R, Ironside J, Nguyen HO, Tremblay P, DeArmond SJ, Prusiner SB. 1999.Compelling transgenetic evidence for transmission of bovine spongiform encephalopathyprions to humans. Proc Natl Acad Sci USA 96:15137–15142.

Shi Q, Hong H, Senior J, TongW. 2010. Biomarkers for drug-induced liver injury. Expert RevGastroenterol Hepatol 4:225–234.

Singhvi R, Kumar A, Lopez GP, Stephanopoulos GN, Wang DI, Whitesides GM, Ingber DE.1994. Engineering cell shape and function. Science 264:696–698.

Sotil EU,Gottstein J, Ayala E, RandolphC, Blei AT. 2009. Impact of preoperativeovert hepaticencephalopathy on neurocognitive function after liver transplantation. Liver Transpl15:184–192.

Stevens KM. 1965. Oxygen requirements for liver cells in vitro. Nature 206:199.Stefanovich P, Matthew HW, Toner M, Tompkins RG, Yarmush ML. 1996. Extracorporealplasma perfusion of cultured hepatocytes: effect of intermittent perfusion on hepatocytefunction and morphology. J Surg Res 66:57–563.

Sugimoto H, Yang C, LeBleu VS, Soubasakos MA, Giraldo M, Zeisberg M, Kalluri R. 2007.BMP-7 functions as a novel hormone to facilitate liver regeneration. FASEB J 21:256–264.

Sulzbacher S, Schroeder IS, Truong TT, Wobus AM. 2009. Activin A-induced differentiationof embryonic stem cells into endoderm and pancreatic progenitors-the influence ofdifferentiation factors and culture conditions. Stem Cell Rev 5:159–173.

TaubR. 2004. Liver regeneration: frommyth tomechanism.Nat RevMolCell Biol 5:836–847.Teperman LW, Peyregne VP. 2010. Considerations on the impact of hepatic encephalopathytreatments in the pretransplant setting. Transplantation 89:771–778.

Temple RJ. Hepatoxicity through the years: impact on the FDA. (Accessed January 20, 2006,at http://www.fda.gov/cder/livertox/presentations/im1389/sld001.htm

Tiberio GA, Tiberio L, Benetti A, Cervi E, Montani N, Dreano M, Garotta G, Cerea K,Steimberg N, Pandolfo G, Ferrari-Bravo A, Mazzoleni G, Giulini SM, Schiaffonati L. 2008.IL-6 Promotes compensatory liver regeneration in cirrhotic rat after partial hepatectomy.Cytokine 42:372–378.

Ueki T, Kaneda Y, Tsutsui H, Nakanishi K, Sawa Y, Morishita R, Matsumoto K, Nakamura T,TakahashiH,Okamoto E, Fujimoto J. 1999.Hepatocyte growth factor gene therapy of livercirrhosis in rats. Nat Med 5:226–230.

van Anken HC, Schiphorst ME. 1974. A kinetic determination of ammonia in plasma. ClinChim Acta 56:151–157.

van de Kerkhove MP, Hoekstra R, Chamuleau RA, van Gulik TM. 2004. Clinical application ofbioartificial liver support systems. Ann Surg 240:216–230.

Vonarbourg A, Passirani C, Desigaux L, Allard E, Saulnier P, Lambert O, Benoit JP, Pitard B.2009. The encapsulation of DNA molecules within biomimetic lipid nanocapsules.Biomaterials 30:3197–3204.

Vukicevic S, Latin V, Chen P, Batorsky R, Reddi AH, Sampath TK. 1994. Localization ofosteogenic protein-1 (bone morphogenetic protein-7) during human embryonicdevelopment: high affinity binding to basement membranes. Biochem Biophys ResCommun 198:693–700.

Walgren JL, Mitchell MD, Thompson DC. 2005. Role of metabolism in drug-inducedidiosyncratic hepatotoxicity. Crit Rev Toxicol 35:325–361.

Xu C, He JQ, Kamp TJ, Police S, Hao X, O’Sullivan C, Carpenter MK, Lebkowski J, Gold JD.2006. Human embryonic stem cell-derived cardiomyocytes can be maintained in definedmedium without serum. Stem Cells Dev 15:931–941.

Yokoi H, Kinoshita T, Zhang S. 2005. Dynamic reassembly of peptide RADA16 nanofiberscaffold. Proc Natl Acad Sci USA 102:8414–8419.

Zhang S. 2003. Fabrication of novel biomaterials through molecular self-assembly. NatBiotechnol 21:1171–1178.

Zhang S. 2004. Beyond the Petri dish. Nat Biotechnol 22:151–152.Zhang S, Lockshin C, Herbert A, Winter E, Rich A. 1992. Zuotin, a putative Z-DNA bindingprotein in Saccharomyces cerevisiae. EMBO J 11:3787–3796.

Zhang S, HolmesT, LockshinC, RichA. 1993. Spontaneous assembly of a self-complementaryoligopeptide to form a stable macroscopic membrane. Proc Natl Acad Sci USA 90:3334–3338.

Zhang S, Lockshin C, Cook R, Rich A. 1994. Unusually stable beta-sheet formation in an ionicself-complementary oligopeptide. Biopolymers 34:663–672.

ZhongQ, Chinta DM, Pamujula S,Wang H, Yao X, Mandal TK, Luftig RB. 2010. Optimizationof DNA delivery by three classes of hybrid nanoparticle/DNA complexes. JNanobiotechnol 8:6.



Documents

Three dimensional cultures of rat liver cells using a natural self-assembling nanoscaffold in a clinically relevant bioreactor for bioartificial liver construction