Upload
others
View
1
Download
0
Embed Size (px)
Citation preview
THE VECTOR POTENTIAL OF THE
MOSQUITO AEDES KOREICUS
Silvia Ciocchetta
BVSc, Masters Animal Health, Animal Farming & Animal Production
Submitted in fulfilment of the requirements for the degree of
Doctor of Philosophy (PhD)
School of Biomedical Sciences
Faculty of Health
Queensland University of Technology
2018
The vector potential of the mosquito Aedes koreicus i
Keywords
Aedes koreicus, invasive mosquito species, laboratory colonisation, hatching
percentage, embryo dormancy, embryo development, fecundity index, pupae
differentiation, mosquito reproductive biology, mosquito mating biology, autogeny,
interspecific mating, mosquito sperm, competitive displacement, satyrization,
Wolbachia, fluctuating temperature, arbovirus, chikungunya, chikungunya virus
(CHIKV), vector competence, arthropod-borne disease, public health.
The vector potential of the mosquito Aedes koreicus ii
Abstract
The introduction and establishment of exotic mosquitoes have facilitated
outbreaks of arthropod-borne disease in new areas of the world. There is an urgent
need to understand the risk of disease outbreaks posed by invasive mosquitoes. Aedes
(Finlaya) koreicus [1] is an invasive mosquito species from South-East Asia recently
discovered in Europe. It has now colonised six European countries, including Italy
(Belluno province), where it was first reported in 2011. Between 2011 and 2012, Ae.
koreicus doubled its distribution in the Belluno province from 33.3% to 65.2% of
municipalities (n= 65) and increased its presence in the Treviso province from 2.1%
to 18.9 % of municipalities (n= 95). This invasive behaviour is similar to that of Aedes
albopictus, a major vector of chikungunya (CHIKV) and dengue (DENV) viruses, that
has become endemic in 22 European countries since introduction in 1991. Despite the
rapid spread and establishment of Ae. koreicus, the impact of this mosquito on native
ecosystems and public health remains unknown. This thesis provides the first detailed
insights into the biology of Ae. koreicus and its capacity to transmit CHIKV.
Field and laboratory work was conducted in Italy to evaluate trapping and
surveillance techniques for Ae. koreicus, along with the propensity of this species to
bite humans. None of the traps used returned high numbers of Ae. koreicus, either in
rural or urban settings. However, host-seeking Ae. koreicus were found to feed on
humans during late afternoon and evening.
Field-collected material was used to establish laboratory colonies of Ae.
koreicus, first in Italy, and then at QIMR Berghofer in Australia, and to confirm the
absence of the endosymbiont Wolbachia pipientis in specimens from field. Despite
few Ae. koreicus eggs (10.4 ± 2.1%) hatching and relatively long gonotrophic cycles
The vector potential of the mosquito Aedes koreicus iii
(blood-feeding to oviposition interval = 11.5 ± 3.5 days) the species proved suitable
for colonisation in the laboratory, providing an ideal opportunity to further study its
biology. Mosquitoes reared under artificial conditions were used to calculate a
fecundity-size relationship (Y = 88.51 * X – 239.6, P ˂ 0.0001, r2 = 0.6051; n=51) for
evaluating Ae. koreicus population fitness, to explore the species’ reproductive
behaviour and to determine the lack of autogeny in the colony.
The possibility of mating interference between Ae. albopictus and Ae. koreicus
was explored using a small-scale behavioural study. Ae. albopictus’ ability to disrupt
other mosquitos’ behaviours and to sterilise mosquito females of different species
through sperm transfer is well documented [2-6]. Repeated attempts of interspecific
mating of Ae. albopictus males with Ae. koreicus female were recorded, suggesting
that disruption/interference could occur in the field.
The Ae. koreicus colony proved highly suitable for laboratory-based vector
competence experiments, providing the first evidence to evaluate the risk of CHIKV
transmission by this species. The mosquitoes had high feeding rates on artificially
infected blood delivered via membranes (65.5%) and almost all (96.8%) of the colony
mosquitoes survived at day 14 post feeding. Infection rates post challenge with
CHIKV were low at two temperature regimes examined (13.8% at 23°C; 6.2% under
fluctuating temperature close to climatic conditions in the Ae. koreicus Italian range).
Dissemination of the virus to wings and legs occurred only in 6.1% mosquitoes and
only in those maintained at 23°C. Salivary infection occurred in just two of the blood
fed mosquitoes (n=129). No dissemination of the virus to the wings and legs or saliva
of mosquitoes occurred when they were maintained under fluctuating temperatures.
The vector potential of the mosquito Aedes koreicus iv
These findings deliver novel insights into the biology of Ae. koreicus and help
to elucidate the public health risk posed by this species in regards to the transmission
of arboviruses.
The vector potential of the mosquito Aedes koreicus vi
Table of Contents
Keywords .................................................................................................................................. i
Abstract .................................................................................................................................... ii
Table of Contents .................................................................................................................... vi
List of Figures ......................................................................................................................... ix
List of Tables ........................................................................................................................... xi
List of Abbreviations .............................................................................................................. xii
Statement of Original Authorship ......................................................................................... xiv
Acknowledgements ................................................................................................................ xv
Conference abstracts............................................................................................................. xvii
Publications arising from candidature .................................................................................. xvii
Publications included in this document ............................................................................... xviii
Chapter 1: Introduction ...................................................................................... 1
1.1 Background .................................................................................................................... 1
1.2 Context ........................................................................................................................... 7
1.3 Purposes ......................................................................................................................... 7
1.4 Significance, Scope and Definitions .............................................................................. 8
1.5 Thesis Outline ................................................................................................................ 9
Chapter 2: Literature review ............................................................................ 11
2.1 Introduction .................................................................................................................. 11
2.2 Major arboviruses and their public health impact ........................................................ 11
2.3 Major vectors of arboviruses and their invasive potential ........................................... 14
2.4 Invasive mosquito species in Europe ........................................................................... 16
2.5 Ae. koreicus: native range and biology ........................................................................ 20
2.6 Vector competence of Ae. koreicus .............................................................................. 20
2.7 Distinguishing Ae. koreicus from Ae. japonicus: morphological and genetic features 22
2.8 Ae. koreicus in Europe ................................................................................................. 26
2.9 Ae. koreicus monitoring: ECDC guidelines for invasive mosquito species ................. 27
2.10 Interspecies competition between invasive and native species: current knowledge .... 33
Chapter 3: Evaluation of mosquito traps for the field collection of adult Ae.
koreicus in a variety of physiological states ........................................................... 36
3.1 Introduction .................................................................................................................. 36
3.2 Methods ........................................................................................................................ 37 3.2.1 Evaluation of the field performance of four trapping methods .......................... 37 3.2.2 Human landing ................................................................................................... 44
3.3 Results .......................................................................................................................... 46
The vector potential of the mosquito Aedes koreicus vii
3.3.1 Evaluation of the field performance of four trapping methods ..........................46 3.3.2 Human landing ...................................................................................................48
3.4 Discussion and conclusion ............................................................................................51
Chapter 4: Laboratory colonisation of Ae. koreicus ....................................... 54
4.1 Introduction ..................................................................................................................54
4.2 Methods ........................................................................................................................55 4.2.1 Effect of temperature on egg hatching and development ...................................55 4.2.2 Establishment of an Ae. koreicus colony ............................................................56 4.2.3 Egg storage and embryo development ...............................................................59 4.2.4 Sexual dimorphism in pupae ..............................................................................60 4.2.5 Fecundity-size relationship evaluation ...............................................................60 4.2.6 Data analysis .......................................................................................................62
4.3 Results and discussion ..................................................................................................63 4.3.1 Effect of temperature on egg hatching and development ...................................63 4.3.2 Establishment of an Ae. koreicus colony ............................................................64 4.3.3 Egg storage and embryo development ...............................................................65 4.3.4 Sexual dimorphism in pupae ..............................................................................66 4.3.5 Fecundity-size relationship evaluation ...............................................................67
4.4 Conclusions ..................................................................................................................68
Chapter 5: Characterisation of key aspects of Ae. koreicus mating biology 72
5.1 Introduction ..................................................................................................................72
5.2 Methods ........................................................................................................................74 5.2.1 Determination of autogeny in Ae. koreicus ........................................................74 5.2.2 Observing Ae. koreicus mating behaviour ..........................................................77 5.2.3 Preliminary observations on Ae. albopictus and Ae. koreicus mating
interaction ...........................................................................................................79 5.2.4 Wolbachia presence in field-collected Ae. koreicus ...........................................80
5.3 Results ..........................................................................................................................82 5.3.1 Lack of autogeny in Ae. koreicus .......................................................................82 5.3.2 Observing Ae. koreicus mating behaviour ..........................................................82 5.3.3 Preliminary observations of Ae. albopictus and Ae. koreicus mating
interaction ...........................................................................................................83 5.3.4 Wolbachia absent in field-collected Ae. koreicus ...............................................85
5.4 Discussion and conclusion ............................................................................................87
Chapter 6: Vector competence of Ae. koreicus for chikungunya virus ......... 92
6.1 Introduction ..................................................................................................................92
6.2 Methods ........................................................................................................................94 6.2.1 Ae. koreicus feeding through a porcine intestinal membrane with
defibrinated sheep blood.....................................................................................94 6.2.2 Experimental infection of Ae. koreicus with CHIKV ‘La Reunion’ ..................95
6.3 Results ..........................................................................................................................98 6.3.1 Ae. koreicus feeding through a porcine intestinal membrane with
defibrinated sheep blood.....................................................................................98 6.3.2 Experimental infection of Ae. koreicus with CHIKV ‘La Reunion’ ..................98
6.4 Discussion and conclusion ..........................................................................................102
Chapter 7: Concluding discussion .................................................................. 105
The vector potential of the mosquito Aedes koreicus viii
References ............................................................................................................... 112
Appendices .............................................................................................................. 138
The vector potential of the mosquito Aedes koreicus ix
List of Figures
Figure 1.1 Spread of Ae. koreicus and Ae. albopictus in Italy between 2011 and
2014 [17]. ....................................................................................................... 4
Figure 1.2 Map of municipalities infested with Ae. koreicus and Ae. albopictus
in northern Italy, 2011–2015 [19]. ................................................................. 5
Figure 1.3 Municipalities infested with Ae. koreicus, Ae. albopictus and Ae.
japonicus in northern Italy, 2017 [20]. .......................................................... 6
Figure 2.1 Distribution of invasive Aedes mosquito species in Europe and
locations and magnitude of autochthonous dengue and chikungunya
outbreaks in Europe from 2007 [133]. ......................................................... 19
Figure 2.2 Drawings of the main characteristics considered for the
identification of female Culicinae mosquito. .............................................. 24
Figure 2.3 Differences in hindtarsomere 5 patterns. .................................................. 25
Figure 2.4 The components of a New Jersey light trap.............................................. 28
Figure 2.5 The components of a Mosquito Magnet Trap. ......................................... 29
Figure 3.1 Area in Belluno province in which the evaluation of field
performance of four different trapping methods (BG-Sentinel traps
with and without CO2, Gravid Aedes Traps, and Ovitraps) was
performed. .................................................................................................... 37
Figure 3.2 Location of traps in the urban site. ........................................................... 38
Figure 3.3 Location of traps in the rural site. ............................................................. 39
Figure 3.4 BG-Sentinel trap. ...................................................................................... 40
Figure 3.5 BG-Sentinel trap baited with BG-Lure and CO2. ..................................... 41
Figure 3.6 Ovitrap. ..................................................................................................... 42
Figure 3.7 Gravid Aedes Trap. ................................................................................... 43
Figure 3.8 Human landing collection site. ................................................................. 45
Figure 3.9 Human landing collections during the day and during the night. ............. 45
Figure 3.10 Number and species of mosquitoes captured at the urban site. .............. 47
Figure 3.11 Number and species of mosquitoes captured at the rural site. ................ 48
Figure 3.12 Total number of Ae. albopictus and Ae. koreicus sampled at
different time intervals ................................................................................. 50
Figure 3.13 Mosquito species sampled at different time intervals, temperature,
and relative humidity at the sampling site. .................................................. 50
Figure 3.14 Ae. koreicus feeding on a human. ........................................................... 51
Figure 4.1 Masonite® sticks partially submerged in rainwater (IZS Belluno). .......... 56
Figure 4.2 Environmental chambers at the QIMR Berghofer Quarantine
Insectary containing Ae. koreicus colonies. ................................................. 58
The vector potential of the mosquito Aedes koreicus x
Figure 4.3 Masonite® sticks with Ae. koreicus eggs submerged in rain water. ......... 59
Figure 4.4 Ae. koreicus pupae. ................................................................................... 60
Figure 4.5 Ae. koreicus wing ...................................................................................... 61
Figure 4.6 Egg follicle development in mosquitoes [242]. ........................................ 62
Figure 4.7 Effect of temperature on the emergence of adult mosquitoes after 17
days from eggs water submersion. ............................................................... 63
Figure 4.8 Pupal development measured over 80 days of submersion across
four different trays. ...................................................................................... 64
Figure 4.9 Fully formed embryo of Ae. koreicus after egg clearing. ......................... 66
Figure 4.10 Ae. koreicus male and female genital lobe. ............................................ 67
Figure 4.11 Relationship between wing length and fecundity of Ae. koreicus. ......... 68
Figure 5.1 BugDorm® cages in the environmental chamber ...................................... 76
Figure 5.2 Egg collection tray with rain water and Masonite® sticks. ....................... 77
Figure 5.3 The environmental chamber used for the Ae. koreicus mating
experiment .................................................................................................... 79
Figure 5.4 Ae. koreicus and Ae. albopictus (a) pupae and (b) adult individuals
in Falcon® tubes. .......................................................................................... 80
Figure 5.5 Ae. koreicus sperm visible after spermatechae rupture. ............................ 83
Figure 5.6 No evidence of Ae. albopictus sperm in Ae. koreicus spermathaecae
(a) before and (b) after rupture. .................................................................... 84
Figure 5.7 Difference in size between Ae. koreicus female (left) and Ae.
albopictus male (right). ................................................................................ 84
Figure 5.8 PCR products produced by amplifying Ae. koreicus DNA with
oligonucleotide primers corresponding to Wolbachia gene wsp. ................ 85
Figure 5.9 PCR products produced by amplifying Ae. koreicus DNA with
oligonucleotide primers corresponding to Wolbachia gene 16S. ................. 86
Figure 5.10 PCR products produced by amplifying Ae. koreicus DNA with
oligonucleotide primers corresponding to the housekeeping gene
RsP17. .......................................................................................................... 87
Figure 5.11 Ae. koreicus male antennal hairs. ............................................................ 89
Figure 5.12 The reproductive system of female (in red) and male (in blue)
Aedes and the sperm transfer during copulation (represented by the
arrows) [297]. ............................................................................................... 90
Figure 6.1 Apparatus used to feed Ae. koreicus ......................................................... 95
Figure 6.2 Titres of CHIKV ‘La Reunion’ in Ae. koreicus measured three, 10,
and 14 days post-feeding in mosquitoes at 23°C and at fluctuating
temperature (75 ± 5% relative humidity, 12 hour light: 12 hour dark
cycle). ......................................................................................................... 101
The vector potential of the mosquito Aedes koreicus xi
List of Tables
Table 2.1 Comparison of adult morphological features in females of Ae.
koreicus from Belgium, Italy, the Korean peninsula and Jeju-do Island
with those of Ae. japonicus (Modified from Versteirt et al. [161]). ............ 26
Table 2.2 Efficacy of methods of collection of adult invasive mosquito species
and their eggs. .............................................................................................. 32
Table 3.1 Maximum, minimum, medium temperatures, precipitations
(measured in mm H20 per day) and wind speed (measured in m/s)
during the sampling period in Belluno ......................................................... 46
Table 3.2 Temperature measured at each time interval and the average
temperature during the five sampling days. ................................................. 49
Table 3.3 Precipitation levels (mm H20/day) and wind speed (measured in m/s)
during the sampling period in Belluno (Belluno airport meteorological
weather station, [216, 217]). ........................................................................ 49
Table 4.1 Development parameters for Ae. koreicus reared at a temperature of
23 ± 1°C ....................................................................................................... 64
Table 6.1 Daily fluctuating temperature regime under which Ae. koreicus was
maintained (75 ± 5% relative humidity, 12-hour light:12-hour dark
cycle). ........................................................................................................... 98
Table 6.2 CHIKV ‘La Reunion’ infection and dissemination to the wings/legs
and saliva in Ae. koreicus mosquitoes maintained at 23oC and
fluctuating temperature (75 ± 5% relative humidity, 12-hour light:12-
hour dark cycle). ........................................................................................ 100
The vector potential of the mosquito Aedes koreicus xii
List of Abbreviations
ARPAV Agenzia Regionale per la Prevenzione e Protezione Ambientale del
Veneto
BGS Biogents-Sentinel
CDC Centres for Disease Control and Prevention
CHIKV Chikungunya Virus
CO2 Carbon Dioxide
DENV Dengue Virus
ECDC European Centre for Disease Prevention and Control
ECSA West African, Asian and East/Central/South African
EFSA European Food Safety Authority
EIP Extrinsic Incubation Period
EtOH Ethanol
FBS Foetal Bovine Serum
GATs Gravid Aedes Traps
HCl Sodium Hypochlorite
HCL Human Landing Collection
IZSVe Istituto Zooprofilattico Sperimentale delle Venezie
JEV Japanese Encephalitis Virus
MALDI-TOF MS Matrix Assisted Laser Desorption Ionisation-time Of Flight Mass
Spectrometry
The vector potential of the mosquito Aedes koreicus xiii
MM Mosquito Magnet
PBS Phosphate-buffered Saline
PCR Polymerase Chain Reaction
PFA Paraformaldehyde
RH Relative Humidity
RRV Ross River Virus
TCID50 50% Tissue Culture Infective Dose
TMB 3,3′,5,5′-Tetramethylbenzidine Substrate System
YFV Yellow Fever Virus
ZIKV Zika Virus
The vector potential of the mosquito Aedes koreicus xiv
Statement of Original Authorship
The work contained in this thesis has not been previously submitted to meet
requirements for an award at this or any other higher education institution. To the best
of my knowledge and belief, the thesis contains no material previously published or
written by another person except where due reference is made.
Signature:
Date: 04/06/2018
QUT Verified Signature
The vector potential of the mosquito Aedes koreicus xv
Acknowledgements
First and foremost, I would like to express my sincere gratitude to my
supervisors, Professor John Aaskov, Associate Professor Greg Devine, Dr. Francesca
Frentiu, and Dr. Jonathan Darbro for their guidance and support during my PhD
journey, and for their valuable time, comments, and recommendations in reviewing
my works and my thesis.
Thanks also to Dr. Leon Hugo, and Elise Kho for their assistance during the
vector competence experiments, and to all of the members of the Mosquito Control
Laboratory at QIMR Berghofer.
A special thank-you goes to Dr Natalie Prow for her time and patience in helping
me with my research project, and to the QIMR Berghofer Inflammation Biology Group
for their precious collaboration. Thanks in particular to Dr Wayne Schroder for his
encouragement and advice during my PhD candidature.
I also wish to thank Dr Gioia Capelli, Dr Fabrizio Montarsi, and all of the
members of the Diagnostic Services, Histopathology and Parasitology laboratory at
IZSVe for their time, collaboration, and friendship, and to all the member of the IZSVe
– SCT2 Belluno for their hospitality and for providing support and access to structures
and materials during my fieldwork in northern Italy.
My thanks also to IZSVe, QUT, and QIMRB for allowing me to undertake this
project and for providing my travel and research funding.
I am also grateful to Dr. Andrea Drago, from Entostudio S.r.l., for his help in
early stages of my PhD during the design of my research proposal, and for his
unconditional help and friendship.
The vector potential of the mosquito Aedes koreicus xvi
I would like to express my special gratitude to Dr. Brian Kay, former Lab Head
of the Mosquito Control Laboratory at QIMR Berghofer, for his encouragement and
help to start my PhD studies in Australia. Without his support this research journey
would never have begun.
I also thank professional editor, Kylie Morris, who provided copyediting and
proofreading services, according to university-endorsed guidelines and the Australian
Standards for editing research theses.
Thanks to all of my Italian and Australian friends, for their friendship, advice,
and help, and for sharing with me all the good moments and never abandoning me in
the hardship encountered.
Sincere and deep thanks go to Terry, who was always by my side, providing
endless support, love, and encouragement, especially during the hard times, when
difficulties seemed impossible to overcome. With all my heart, thank you.
Finally, from my heart also comes a special and earnest thanks to my parents,
Laura and Roberto, to my brother Marco, and to my grandmother Flora, for all of their
love and support, and for teaching me the strength and resilience to get through any
difficulty that I encountered. Without you, and without the love and support of my
uncles, aunties, and cousins, none of this would have been possible.
The vector potential of the mosquito Aedes koreicus xvii
Conference abstracts
Ciocchetta S, Prow NA, Darbro JM, et al. Aedes koreicus vector potential for
chikungunya virus: a threat to Europe? Poster session presented at: American Society
of Tropical Medicine and Hygiene 66th Annual Meeting; 2017 Nov 5-9; Baltimore,
Maryland USA. –conference poster presentation–
Ciocchetta S, Prow NA, Darbro JM, et al. Aedes koreicus: a new European
invader and its potential for chikungunya virus. Paper presented at: The American
Mosquito Control Association 83th Annual Meeting; 2017 Feb 13-17, San Diego,
California, USA. –conference oral presentation–
Publications arising from candidature
Ciocchetta S, Darbro JM, Frentiu FD, et al. Laboratory colonization of the
European invasive mosquito Aedes (Finlaya) koreicus. Parasit Vectors. 2017;10(1):74.
Montarsi F, Ciocchetta S, Devine G, et al. Development of Dirofilaria immitis
within the mosquito Aedes (Finlaya) koreicus, a new invasive species for Europe.
Parasit Vectors. 2015;8(1):1-9.
Montarsi F, Drago A, Martini S, et al. Current distribution of the invasive
mosquito species, Aedes koreicus [Hulecoeteomyia koreica] in northern Italy. Parasit
Vectors. 2015;8(1):614.
The vector potential of the mosquito Aedes koreicus xviii
Publications included in this document
Ciocchetta S, Darbro JM, Frentiu FD, et al. Laboratory colonization of the
European invasive mosquito Aedes (Finlaya) koreicus. Parasit Vectors. 2017;10(1):74.
(Chapter 4) (Statement of Contribution of Co-Authors in Appendix II)
Ciocchetta S, Prow NA, Darbro JM, et al. The new European invader Aedes
(Finlaya) koreicus: A potential vector of chikungunya virus. Pathog Glob Health.
2018;112(3):107-114. (Results from Ae. koreicus vector competence experiment,
Chapter 6) * (Statement of Contribution of Co-Authors in Appendix II)
*The introductory part of Publication 2 is incorporated in the literature review.
Chapter 1: Introduction 1
Chapter 1: Introduction
This chapter presents the background (Section 1.1) and context (Section 1.2) of
the current research and describes its purpose (Section 1.3). Section 1.4 clarifies the
significance and scope of this work, and finally, Section 1.5 details the outline of the
thesis.
1.1 BACKGROUND
Globalisation of trade and travel has led to the introduction and establishment of
many invasive mosquito species into new territories [7-10]. The term “invasive” in
this instance refers to species that have spread from their original habitat with a
subsequent impact on newly colonised ecosystems or on human behaviour [11]. The
most infamous of these invaders, present in Europe since the 1990s, is the mosquito
Aedes albopictus. Among European countries, Italy has the biggest population of this
species, which is now established across the whole of the country. Since its
introduction, several entomological surveillance systems have been implemented to
monitor the expansion of this invader. In the Veneto region (north-eastern Italy)
monitoring activities sponsored by the public health service began in 1991, the year in
which the first established Ae. albopictus population was found in Padua.
A new mosquito invasion was discovered during routine surveys in areas free of
Ae. albopictus in the Belluno province in 2011 [12]. In May 2011, twelve larvae and
pupae were collected from a manhole in Sospirolo, in Belluno province (Veneto
region), at 447 m.a.s.l. [12]. Adults obtained from these samples were identified as
Aedes (Finlaya) koreicus [1], a species native to Southeast Asia. Following this initial
Chapter 1: Introduction 2
discovery, subsequent investigations confirmed the establishment of a population of
Ae. koreicus in the area [12].
The Belluno province has a sub-continental temperate climate, characterised by
cold winters and mild summers. For example, the average temperature in 2011 in
winter was 2.7°C and the average temperature in summer was 19.4°C (data obtained
from Agenzia Regionale per la Prevenzione e Protezione Ambientale del Veneto
(ARPAV) [13]). Between May 2011 and October 2012, Montarsi et al. [14] reported
that Ae. koreicus had spread over an area of 2,600 km2 in north-eastern Italy, between
the altitudes of 173 and 1,250 m. They also found that this mosquito had colonised
garden centres, urban areas (streets, squares, parking lots), and private gardens by
utilising a variety of man-made containers as oviposition sites. The most commonly
colonised areas were between altitudes of 400-600m, however, the species was also
well represented between 800-1,000m [14]. A subsequent study utilised temperature-
based models to determine whether areas up to 1,500m above sea level were suitable
for Ae. koreicus colonisation, with suitability peaking at approximately 400-500m
above sea level [15].
Although the first individuals were detected in 2011, the mosquito was likely
introduced earlier and seemed to have undergone limited establishment [12]. However,
between 2011 and 2012, Ae. koreicus increased its distribution rapidly in monitored
sites in Belluno (from 33.3% to 65.2%) and Treviso (from 2.1% to 18.9) [14]. This
rapid colonisation reflects the establishment patterns of Ae. albopictus, a major vector
of CHIKV and DENV, which was introduced into Italy in 1991 and is now endemic
in almost all Italian provinces [16].
Figure 1.1 illustrates the rapid spread of Ae. koreicus in the province of Trento
from east to west along the Valsugana valley over four consecutive years from 2011
Chapter 1: Introduction 3
to 2014 [17]. By July 2015, 73 municipalities in four regions out of 155 monitored
were positive for Ae. koreicus (47.1 %) (Figure 1.1) [18]. In only five years, this
species spread to 23 new municipalities (14.8 %), indicating the potential for this
species rapid dispersal (Figure 1.2). An unpublished map based on data collected by
the Istituto Zooprofilattico Sperimentale delle Venezie (IZSVe) (courtesy of Matteo
Mazzucato – GIS office database [14]) shows that Ae. koreicus continues to expand its
geographic range in north eastern Italy in the autonomous provinces of Trento and
Friuli-Venezia Giulia and in the Veneto province (Figure 1.3).
Chapter 1: Introduction 4
Figure 1.1 Spread of Ae. koreicus and Ae. albopictus in Italy between 2011 and 2014 [17].
Chapter 1: Introduction 5
Figure 1.2 Map of municipalities infested with Ae. koreicus and Ae. albopictus in northern Italy, 2011–2015 [19].
Chapter 1: Introduction 6
Figure 1.3 Municipalities infested with Ae. koreicus, Ae. albopictus and Ae. japonicus in northern Italy, 2017 [20].
Chapter 1: Introduction 7
1.2 CONTEXT
Despite the rapidity of the Ae. koreicus’ spread and establishment in Italy and
Europe [14, 18], its impact on native ecosystems and public health is unknown. The
study presented in this thesis arose from the need to clarify this impact: Ae. albopictus
has already provided a worrying example of how invasive mosquitoes can change
human recreational behaviours, affecting their ability to enjoy the outdoors [21] and
also leading to the spread of arboviruses in Europe [22].
1.3 PURPOSES
The biology and vectorial capacity of Ae. koreicus for arboviruses pose a risk to
public health. To test this hypothesis, this thesis aims to:
1. Evaluate the protocols for field collection of larval and adult Ae. koreicus in a
variety of physiological states (gravid, blood-fed, host-seeking). This will
identify suitable tools for surveillance, facilitate collections and contribute to
investigations on Ae. koreicus biology and behaviour.
2. Establish a colony of Ae. koreicus at the quarantine insectary facilities at QIMR
Berghofer and define the key conditions and parameters of Ae. koreicus
survival under laboratory conditions (e.g., development times, longevity,
fecundity, and egg hatching rates).
3. Examine biological factors relevant to Ae. koreicus establishment (rearing
temperature, gonotrophic cycle, hatching percentage, eggs viability, and
fecundity-size relationship) and characterise the key aspects of Ae. koreicus
biology, such as reproduction and competition with sympatric species (Ae.
albopictus).
Chapter 1: Introduction 8
4. Asses the vector competence of Ae. koreicus for arboviruses, evaluating the
effect of temperature on the species’ ability to transmit CHIKV.
1.4 SIGNIFICANCE, SCOPE AND DEFINITIONS
The absence of literature on Ae. koreicus biology and its ability to transmit
pathogens is a considerable barrier to evaluating the public health risk that it poses,
predicting the likelihood of its spread and designing suitable surveillance programmes.
This thesis combines field studies and laboratory-derived data to create a
comprehensive picture of the risks associated with Ae. koreicus in Europe. In
particular, this thesis assesses the vectorial capacity (the ability of a vector to transmit
a virus is determined by host, virus and vector interactions, the ecology and behaviour
of the vector and its innate vector competence [23]) of Ae. koreicus for chikungunya
virus (CHIKV). This research considers major aspects of Ae. koreicus biology, such
as the insect’s potential for human interaction, the length of its gonotrophic cycle, its
reproductive behaviour, and an evaluation of the vector competence of this mosquito
under temperature regimes similar to those representatives of its colonized areas in
Italy. Vector competence is described as the intrinsic susceptibility of a vector to
infection, replication, and transmission of a virus [24]. The choice of CHIKV for this
study is justified by the fact that this virus has been responsible for some of the largest
outbreaks of invasive arboviruses in Europe, and therefore presents a major public
health threat [25-29].
Chapter 1: Introduction 9
1.5 THESIS OUTLINE
This outline provides an overview of the study’s structure and corresponding
research activities.
Chapter 1 - Introduction: described the background, purposes, aims,
context and thesis outline.
Chapter 2 - Literature review: defines, in its first part, the impact on public
health of arboviruses, their main mosquito vectors, and the presence of these vectors
in Europe. The focus is then narrowed to a review of Ae. koreicus and what is known
about its native range and biology, introduction and spread in Europe, vectorial
capacity and interaction with other mosquito species.
Chapter 3 - Evaluation of mosquito traps for the field collection of adult
Ae. koreicus in a variety of physiological states: discusses the protocols for Ae.
koreicus field collection and the field performance of the most commonly used
trapping methods for collecting Aedes mosquito species in different physiological
states. Moreover, it presents an evaluation of the potential for Ae. koreicus / human
interactions.
Chapter 4 - Laboratory colonisation of Ae. koreicus: discusses the
establishment and characterisation of a colony of Ae. koreicus at QIMR Berghofer
Medical Research Institute. Data from Chapter 4 were published as: ‘Laboratory
colonization of the European invasive mosquito Aedes (Finlaya) koreicus’ in Parasites
& Vectors, 2017. 10(1): p. 74.
Chapter 5 - Characterisation of key aspects of Ae. koreicus mating
biology: evaluates key reproductive aspects of Ae. koreicus biology such as the display
of an autogenic phenotype, observations on mating behaviour and preliminary insights
Chapter 1: Introduction 10
on Ae. koreicus interactions with the invasive species Ae. albopictus. Finally, this
chapter describes the absence of Wolbachia pipientis in field-collected Ae. koreicus.
Chapter 6 - Vector competence of Ae. koreicus for chikungunya virus:
explores the capacity of Ae. koreicus to transmit CHIKV under laboratory conditions
at two temperatures: 23°C and a fluctuating temperature close to climatic conditions
of Belluno, Italy, where Ae. koreicus has recently established. Data from Chapter 6
were published as: ‘The new European invader Aedes (Finlaya) koreicus: A potential
vector of Chikungunya virus’, Pathogens and Global Health, 2018;112(3):107-114.
Chapter 7 - Concluding discussion: this chapter contains a discussion of
the results obtained in this study.
Chapter 2: Literature review 11
Chapter 2: Literature review
2.1 INTRODUCTION
During the past decades, several mosquito species have invaded and colonised
new areas, frequently with impacts on native mosquitoes, such as population decline
and range reduction [30]. For instance, the mosquito Ae. albopictus has expanded its
geographic range dramatically over the last 30 years, and although it originated in
Asia, is now present in Europe, the Middle East, Australasia, the Americas, and Africa
[31-33]. Ae. albopictus is considered one of the most invasive mosquitoes in the world
[31]. Aedes aegypti, another species of mosquito considered to be invasive, was
introduced from Africa into Europe and the Americas and has extended its presence to
tropical and sub-tropical regions worldwide [34, 35]. Its geographic range continues
to expand, and the mosquito has now colonised most of the southern United States
[36]. Invasive mosquitoes cause public health concerns due to their propensity to
transmit pathogenic viruses.
2.2 MAJOR ARBOVIRUSES AND THEIR PUBLIC HEALTH IMPACT
Arthropod-borne viruses (arboviruses) are ubiquitous pathogens that can affect
plants and animals, including humans. They require a host to replicate in and a vector,
such as mosquitoes, for transmission. With a few exceptions (e.g., African Swine
Fever virus), all arboviruses contain an RNA genome [37]. Some of the mosquito-
borne arboviruses that cause concern for humans belong to the Flaviviridae family,
genus Flavivirus, (dengue, West Nile, and Zika viruses) and to the Togaviridae family,
genus Alphavirus (chikungunya and Ross River viruses and Venezuelan Equine
Encephalitis virus) [37-44].
Chapter 2: Literature review 12
Most arboviral infections in humans are asymptomatic (inapparent) or present
with an influenza-like illness; however, a small proportion result in more severe
symptoms, and sometimes death [37]. Thus, arboviruses can cause a large number of
clinical cases worldwide every year, with a significant impact on public health and the
economy. A lack of effective vaccines [45, 46] for many of these viruses and the
inadequacy of current vector control methods [47] have exacerbated the situation. The
burden of dengue has increased dramatically in the past 50 years, while previously rare
diseases, such as Zika and chikungunya, have caused global pandemics in recent years.
Dengue, reported for the first time in 1779, is now a major threat to public health
globally [48]. Dengue virus (DENV) comprises four different serotypes (DENV-1 to
DENV-4) and is estimated to cause up to 96 million apparent dengue infections each
year, worldwide [38]. Bhatt et al. [38] also hypothesised that in the same year an
additional 294 (217–392) million inapparent dengue infections occurred globally,
although these cases were likely to not be detected by the public health surveillance
systems as they were ‘mild ambulatory or asymptomatic infections’. A study published
in The Lancet in 2017 reported that the number of dengue infections had increased by
50% in the decade prior to 2016 [49]. Dengue can lead to an estimated 21,000 deaths
per year, especially in underdeveloped countries, where resources to treat this illness
are scarce [38, 48]. Symptoms range from mild sickness to haemorrhagic fever, and in
some cases dengue shock syndrome, and the virus is now widespread in Asia, South
America, and the Caribbean. [48]. In Europe, the largest recent outbreak occurred in
2012 in Madeira (Portugal), with more than 2,000 cases [50]. Other minor outbreaks
were reported in 2010 in France and Croatia and in 2014 in France [26, 51] (Figure
2.1).
Chapter 2: Literature review 13
Zika virus (ZIKV) was first isolated from a sentinel rhesus macaque caged in the
canopy as part of a virus surveillance study in the Zika Forest, Uganda, in 1947 [52].
It is transmitted by arboreal mosquito species (Aedes africanus). Human infection was
sporadic until 2007 (only 14 cases reported [53]). The first major outbreak occurred
when the virus reached Micronesia (Yap Island) in 2007. The virus was most likely
introduced by an infected mosquito or a viremic traveller with asymptomatic infection
from Asia, where Zika human infection has previously been reported [54]. It is
hypothesised that the ancestral Asian virus lineage evolved to become better adapted
to humans [40, 55, 56], infecting approximately 73% of the population and leading to
approximately 18% of cases displaying symptomatic disease [54]. Symptoms are
similar to dengue, with rash, fever, and arthralgia, and the disease generally resolves
within a few weeks without sequelae. However, Zika infections can affect the nervous
system in adults and cause meningitis, meningoencephalitis, and Guillain-Barre
syndrome [57]. In human foetuses, it can cause congenital Zika virus syndrome, a
broad range of foetal neurologic damage when maternal infection occurs during
pregnancy [58].
Zika spread rapidly through the islands of the Pacific between 2012 and 2014
[59] and finally reached the Americas in 2015, where it caused a major epidemic, and
due to its potential association with microcephaly, the announcement of a public health
emergency by the World Health Organization in early 2016 [60]. Serosurveillance
studies in humans suggest that ZIKV is now widespread throughout Africa, Asia, and
Oceania [61].
Chikungunya is an arboviral disease caused by an alphavirus of the family
Togaviridae. Chikungunya virus (CHIKV) is characterised by acute febrile arthralgia
in symptomatic human patients [62]. Phylogenetic analysis has identified three
Chapter 2: Literature review 14
different genotypes of the virus: West African, Asian, and East/Central/South African
(ECSA) [63]. The virus was first isolated in 1953 in Tanzania [64] from the serum of
a patient initially suspected as having dengue fever due to clinical similarities between
the two diseases [65]. The virus was then isolated from sporadic human cases in
Central and Southern Africa and in South East Asia [66], and from urban areas of
Thailand and India during the 1960s [67-69].
Major outbreaks of CHIKV, involving millions of cases, began in Kenya in 2004
[70] and had spread to the Comoros, South Asia, and islands in the Indian Ocean by
2005. A new virus strain was detected on La Reunion in 2005–2006 (CHIKV ‘La
Reunion’), which belonged to the ECSA genotype and carried two mutations: a
mutation (A226V) in the E1 envelope protein gene and a mutation (I211T) in the E2
envelope protein gene. The synergic action of these two new mutations increased the
infectivity of the virus for Ae. albopictus [41, 71, 72] and facilitated the occurrence of
chikungunya outbreaks in the Indian Ocean [73, 74] and in Europe, France, and Italy
(Figure 2.1) [25-27, 75-78].
2.3 MAJOR VECTORS OF ARBOVIRUSES AND THEIR INVASIVE
POTENTIAL
The emergence and re-emergence of these arboviruses is partly a consequence
of the spread and establishment of their principal vectors [72, 79-81].
The principal vector of DENV is Ae. aegypti [82]. In Europe, the virus
disappeared for over 80 years after an outbreak in Athens in 1927-1928 (approximately
650,000 cases) [83]. This disappearance is undoubtedly linked to the fact that the
principal mosquito vector, Ae. aegypti, also began to vanish after 1935 [26], possibly
as a consequence of improvements in the hygiene of water supplies and the large scale
use of residual insecticide, especially DDT, to control malaria [84]. In more recent
Chapter 2: Literature review 15
decades, Ae. aegypti and a second competent vector for DENV, Ae albopictus, have
begun to invade or re-establish in Europe, partly driven by increasing global movement
and optimal urban habitats. Ae aegypti re-established in Madeira in 2005 [32] and in
2012 initiated the largest outbreak of dengue in Europe since the epidemic in Greece
during the 1920’s, where more than 2,000 cases were recorded [50] (Figure 2.1).
Globally, although the main vector of dengue remains Ae. aegypti, the invasive Ae.
albopictus also plays an increasing role [85]. Ae. albopictus was indicated as the vector
for dengue epidemics in Japan, Taipei, and Taiwan during World War II [86].
Subsequently, in 1977-78 the species was responsible for dengue outbreaks in La
Reunion Island and the Seychelles Islands [87, 88], for an epidemic in China in 1978
[89], Macao in 2001 [90], the Maldives Islands in 1981 [91], Hawaii in 2001 [92], and
more recently for an outbreak in Gabon in 2007 [93]. Ae. albopictus was responsible
for the re-emergence of dengue in Mauritius in 2009 [94]. Furthermore, the continued
expansion of Ae. albopictus across southern Europe led to autochthonous outbreaks of
dengue in France in 2010 and 2014 [26] (Figure 2.1).
The major vector of ZIKV in Asia [95] and French Polynesia [57] is Ae. aegypti.
Ae. albopictus is not thought to play a role in the transmission of ZIKV; with the
exception of the 2007 Gabon outbreak [96]. The continuing expansion of Ae.
albopictus and Ae. aegypti across the Americas [85, 97, 98] could cause further
outbreaks of ZIKV through South and Central America and the Caribbean [60]. ZIKV
has not yet been autochthonously transmitted in Europe and the role of Europe's most
wide-spread potential vector, Ae. albopictus, in maintaining circulation of this virus
among humans is unclear [99].
The primary vector of CHIKV in urban areas for most of the 20th century has
been Ae. aegypti. However, the importance of Ae. albopictus in the transmission of
Chapter 2: Literature review 16
CHIKV increased considerably during and after the outbreak of the CHIKV infection
on La Reunion Island in 2005–2006 [41, 71, 72, 100]. The first outbreak of CHIKV in
Europe occurred in 2007 in Italy and was mediated by this invasive vector, and the
introduction of CHIKV ‘La Reunion’ strain by a viraemic traveller from India going
to Italy to visit relatives. The high density of Ae. albopictus in the outbreak area
facilitated an epidemic involving more than 200 symptomatic human cases [72]. Three
years later, autochthonous transmission of CHIKV occurred in Fréjus in South-Eastern
France, and involved two people and a CHIKV strain of the Asian genotype without
the adaptive mutation for Ae. albopictus. Ae. albopictus was the only vector in the area
[101]. In 2014, Ae albopictus was responsible for transmitting CHIKV (E1-226V),
which resulted in 11 cases in Montpellier, Southern France [77]. In August 2017 eight
autochthonous cases of chikungunya were diagnosed in the Var department in the
Provence-Alpes-Côte d'Azur region, South-Eastern France, an area where Ae.
albopictus is established [102]. In the same month, an outbreak of CHIKV belonging
to the ECSA genotype, but lacking the adaptative mutations for Ae. albopictus, caused
more than 300 cases in the Lazio and Calabria regions of Italy (Figure 2.1). Ae.
albopictus is the only potential vector in these areas [27, 29, 103] (Figure 2.1). This
suggests that other unidentified mutations might be involved in enhancing the
infectivity of CHIKV virus for this mosquito species, as hypothesised by Tsetsarkin et
al. [100].
2.4 INVASIVE MOSQUITO SPECIES IN EUROPE
Colonisation and geographic spread of exotic mosquitoes in Europe has
increased significantly from 1990. Ae. albopictus is currently the most widespread
invasive mosquito species in Europe [104] (Figure 2.1). The first report of Ae.
albopictus in Europe was in 1979 in Albania [105]. It was then detected at the Genoa
Chapter 2: Literature review 17
docks in Italy in 1990, and one year later, had become established in Padua. Ae.
albopictus is presumed to have been introduced into Europe in used tires imported
from the United States [106, 107]. It is now established in almost all of the Italian
peninsula, with the exception of mountainous areas [108] and in 22 other European
countries [109] (Figure 2.1). The impact of invasive mosquito species on public health
is not only associated with pathogens transmission, but is also economic, as
demonstrated by the costs involved in the arbovirus outbreaks prevention following
the CHIKV epidemic caused by Ae. albopictus in Italy in 2007 [110]. Furthermore,
invasive mosquito species can become a nuisance for the population due to their
feeding habits. Ae. albopictus is known for its aggressive biting behaviour, with a
detrimental effect on outdoor human activities [111]. This mosquito has also been
captured inside human habitations, suggesting that its nuisance could potentially be
extended to indoors [111].
Ae. aegypti, the most important vector of arboviruses infecting humans [112],
was present in many southern European countries from the late 1700s to early 1900s.
The reasons for its subsequent disappearance from the region during the 1900s are
unclear, but it has since re-invaded Madeira (Portugal), European Russia, Georgia, and
North-East Turkey [113, 114] (Figure 2.1). Its presence in Europe is actively
monitored by European Centre for Disease Prevention and Control (ECDC) in
conjunction with European Food Safety Authority (EFSA) through the European-wide
monitoring and mapping for invasive mosquito species and potential mosquito vectors
[115].
Commercial trade in tires was also the most likely source of Aedes japonicus,
a mosquito originating in Asia that has become established in Europe [116]. These
mosquitoes have colonised almost all of Switzerland, large regions of Austria and
Chapter 2: Literature review 18
Germany, and are also present in Belgium, France, the Netherlands, Hungary,
Slovenia, Croatia, and Lichtenstein [117-119]. In 2016, it was found to have spread to
Italy [120] (Figure 2.1, 1.3) [121]. Ae. japonicus has an aggressive anthropophilic
behaviour [122], and although it is not an important vector of pathogens in Japan and
Korea [123], this species has shown vector competence for Japanese encephalitis virus
JEV [123], West Nile virus [124], DENV, and CHIKV [125] in laboratory.
Nonetheless, there is no field evidence it is an important vector of these viruses.
A new mosquito species, Ae. koreicus, has become established in Europe in
recent years (Figure 2.1), with the largest populations being found in Italy. More
recently, inhabitants have complained about mosquito bites during the daytime in areas
where Ae. koreicus was the only diurnal biting species [14], indicating that this species
could be a source of discomfort for the population living in its range of establishment.
Despite the rapid spread and anthropophilic habits of this mosquito [126, 127], the risk
that it poses as a vector of arboviruses infecting humans is unknown.
Chapter 2: Literature review 19
Figure 2.1 Distribution of invasive Aedes mosquito species in Europe and locations and magnitude of autochthonous dengue and chikungunya
outbreaks in Europe from 2007 [133].
Data collated from ECDC maps [128] and [29, 51, 72, 77, 78, 101-103, 129-132].
Chapter 2: Literature review 20
2.5 AE. KOREICUS: NATIVE RANGE AND BIOLOGY
Ae. (Finlaya) koreicus is native to the Korean peninsula and Jeju-do Island [134],
Japan, China, and Eastern Russia. This species is well adapted to urban settlements
[14, 134, 135]; however, little is known about its biology. It has been described as one
of the most common species of mosquito in Beijing, emerging in late spring [136] and
reaching peak activity in summer [137-139]. Known breeding sites include artificial
and natural containers close to human inhabited areas [134, 135], although larvae have
been reported to develop in coastal brackish pools [140] and rock pools on hillsides
[141]. Depending on the breeding site location, Ae. koreicus feed opportunistically on
humans, domestic mammals, and both domestic and sea birds [134, 135, 140] during
the day and night [135]. Overwintering occurs during the egg stage [135]. Colonisation
of urban areas, daytime biting, and human feeding increases the potential of this
species to be a public health risk [14].
2.6 VECTOR COMPETENCE OF AE. KOREICUS
Vector competence is defined as the ability of a vector to transmit a pathogen to
another susceptible host [23]. Members of the genus Aedes are known to transmit a
large number of viruses to humans (e.g., Yellow Fever virus (YFV), DENV, CHIKV
and ZIKV) [43, 72, 124, 142-145]; however, the role of Ae. koreicus as a vector of
arboviruses is still largely unknown.
Miles et al. (1964) [140] reported that JEV was isolated in wild-caught Ae.
koreicus mosquitoes breeding in the fishing villages on the seaside of the Far-Eastern
USSR in the 1960s. No empirical references were included [146] and presence of
virus, without evidence of transmission, is not sufficient to define the species as true
vector. JEV was not detected in Ae. koreicus during more recent monitoring activities
Chapter 2: Literature review 21
in Korea, although Ae. koreicus represented less than 0.1% of the total number of
mosquitoes examined [147-149]. These reports should therefore be viewed with
caution, as misidentification of this species as Ae. japonicus, a known vector of JEV
[104, 117, 123, 150, 151] can occur [135]. Few reports mention Ae. koreicus’ ability
to transmit JEV in laboratory and in the field [123, 140, 152]. A study in 1927 found
that Ae. koreicus could become infected with Wuchereria bancrofti microfilariae but
that the microfilariae did not develop [153]. Ae. koreicus is a vector for dog heartworm
Dirofilaria immitis [154, 155] in the laboratory; however, this parasite has not been
recovered from mosquitoes collected in the field [156]. It is unclear whether the
absence of Dirofilaria is due to insufficient sampling rather than lack of infection. A
more recent report has suggested that Ae. koreicus can act as an intermediate host (an
organism harbouring developmental stages of a parasites [157]) for Brugia malayi to
infect humans [158].
A key factor in assessing the risks of arbovirus transmission is the vector’s host
feeding preference. Humans, domestic mammals, and seabirds have been observed in
the field as hosts for Ae. koreicus [140]. More recently, an investigation of the feeding
preference and the host range of Ae. koreicus in laboratory and field conditions found
that it could be reared using blood from chickens, turkeys, sheep, or humans under
artificial conditions (a Hemotek® feeding system) or by directly feeding on blood from
human volunteers [126, 159]. The highest rates of mosquito engorgement were
observed when mosquitoes were fed on blood provided by human volunteers through
an artificial system (76.5% of mosquitoes fed), followed by chicken blood (65.4% of
mosquitoes fed). Mosquitoes engorged with any of the evaluated blood types
subsequently laid fertile eggs. Ninety-five percent of blood meals in wild-caught
mosquitoes were from humans and one mosquito contained bovine blood [126]. The
Chapter 2: Literature review 22
opportunistic or anthropophilic nature of this behaviour may depend on the relative
size and abundance of hosts and has not yet been examined. None the less, it clearly
shows that Ae. koreicus will readily feed on humans.
2.7 DISTINGUISHING AE. KOREICUS FROM AE. JAPONICUS:
MORPHOLOGICAL AND GENETIC FEATURES
The ecology and behaviour of Ae. koreicus, and the risk it poses for transmission
of arboviruses, are complicated by this species often being confused with its close
relative Ae. japonicus [12, 155, 160]. Ae. koreicus is a large mosquito (wing length
2.7-4.9 mm, [134]) and is characterised by a black and white pattern on the thorax and
abdomen common to other Aedes species. Colour patterns strongly resemble Ae.
japonicus (Table 2.1) [135]. Tanaka [134] stated that the two species show a range of
characteristic variations that overlap. Nevertheless, there are differences, for example,
pedicel (Figure 2.2) with usually more pale scales than dark scales in koreicus, while
usually more dark scales than pale scales in japonicus; posterior pronotal lobe (Figure
2.2) usually with dark scales in koreicus, but typically without them in japonicus;
postpiracular (Figure 2.2) area usually with a distinct patch of pale scales in koreicus,
but lacking these scales in japonicus samples; hindfemur (Figure 2.2) almost always
entirely pale basally in koreicus, and almost always with a complete or incomplete
dark subbasal band in japonicus; hind tarsomere 4 always with a distinct pale basal
band in koreicus, and usually entirely dark in Ae. japonicus (Figure 2.2; Table 2.1).
However, markings on the hind tarsi (Figure 2.2) and scaling of the postspiracular area
(Figure 2.2) are significant in distinguishing between the species [135, 160] (Table
2.2). The morphological similarity between the two species is supported by genetic
analyses of the ND4, COII, and D2 regions of mitochondrial DNA [161, 162].
Chapter 2: Literature review 23
Mosquitoes found in Belgium were morphologically distinct to specimens from
the Korean peninsula (reference material provided from the Smithsonian Institute
[163]) but not to those from Jeju-do Island. Following a detailed morphological
comparison, the pattern on hind tarsomere 5 led scientists to conclude that the Belgian
population originated from Jeju-do Island. Belgian specimens have a basal pale band
on the hind tarsomere similar to specimens from Jeju-do Island: the hind tarsomere 5
on specimens from the Korean peninsula is entirely dark, sometimes with a few pale
scales [160] (Figure 2.3).
Chapter 2: Literature review 24
Figure 2.2 Drawings of the main characteristics considered for the identification of
female Culicinae mosquito.
Note: a) general aspect of a female mosquito; b) dorsal and lateral view of thorax. The arrows point
only to the characteristics useful for the identification of Ae. koreicus and Ae. albopictus [164].
Chapter 2: Literature review 25
Figure 2.3 Differences in hindtarsomere 5 patterns.
Note: (a) Ae. koreicus from Belgium, (b) Ae. koreicus from peninsular Korea and (c) Ae. japonicus
from Belgium (Photo by Walter Reed Biosystematics Unit). The basal band is pale on Ae. koreicus
hindtarsomere 5 of specimens from Belgium while it is dark in other specimens [165].
Chapter 2: Literature review 26
Table 2.1 Comparison of adult morphological features in females of Ae. koreicus
from Belgium, Italy, the Korean peninsula and Jeju-do Island with those of Ae.
japonicus (Modified from Versteirt et al. [160]).
Characteristics Aedes koreicus Aedes japonicus
Belgium/Italy Korean
Peninsula
Jeju-do Island
Head/vertex With pale erected
forked scales
Erect forked
scales frequently
entirely dark, if
pale scale than
between 1-4
Erect forked
scales almost
always pale: 1-10
Numerous erect
forked scales, often
entirely dark,
otherwise with
variable numbers
of pale scales
Thorax/postpronotum Numerous pale
falcate scales
Covered with
broad pale
scales,
occasionally
falcate scales
present
Numerous pale
falcate scales
present, scales
narrower
Covered with
broad pale scales,
almost no dark
scales present
Abdomen Basomedian and
basolateral pale
areas; variation:
only basomedian or
only basolateral
pale areas present
Very thin
basomedian pale
band and always
basolateral pale
spots
Very thin
basomedian pale
band and white
basolateral spots
on anterior terga
Always
basomedian and
basolateral pale
areas
Hindtarsomere 4 Basal pale band Basal pale band Basal pale band Dark, sometimes
with some pale
scales*
Hindtarsomere 5 Basal pale band Entirely dark;
sometimes with
a few pale scales
Basal pale band Entirely dark*
Postbasal pale band of
hindfemur
Missing Missing Missing Present and mostly
complete*
Postspicular area 20-30 broad pale
scales
20-30 broad pale
scales
20-30 broad pale
scales
No pale scales*
*Main distinguishing features between Ae. japonicus and Ae. koreicus
2.8 AE. KOREICUS IN EUROPE
Ae. koreicus was found for the first time in Europe in 2008, near an industrial
area in Belgium. During the national mosquito survey campaign MODIRISK
(Monitoring of Mosquito Vectors of Disease: Project of Institute of Tropical Medicine,
Foundation of Public Utility, Belgium, [166]). In 2009, Ae. koreicus adults and larvae
were again detected in the same 6 km2 area, and in 2014, this species had become
established in Belgium [167, 168]. Following the first report in Belgium, this species
has been identified in five additional European countries: in north-eastern Italy,
Chapter 2: Literature review 27
Belluno province, in 2011 [12, 14]; in Sochi, Russia [169]; in the southernmost part of
the Ticino region, Switzerland; close to the Swiss border in Como province, Italy, in
2013 [170]; in Augsburg, Bavaria, Germany, in 2015 [171]; and in Pécs, southwest
Hungary, in 2016 [172] (Figure 2.1).
Specimens of Ae. koreicus were found in Mamaika, Sochi city, in Russia in early
July 2013. Samples were collected 400 m from the Black Sea coast, in water tanks
used for the collection of rain water. Morphological identification was confirmed by
sequencing the Internal Transcribed Spacer 2 (ITS2) region [169]. Swiss specimens
were morphologically identified by Francis Schaffner, and eggs were identified by
matrix assisted laser desorption ionisation-time of flight mass spectrometry (MALDI-
TOF MS) [173]. The only specimen of Ae. koreicus from Germany was found in mid-
June 2015 in an urban area; however, the nearby surroundings were negative for adults
or immature stages [171]. Three females Ae. koreicus were captured in early July 2016
in Hungary, again in an urban area [172].
2.9 AE. KOREICUS MONITORING: ECDC GUIDELINES FOR INVASIVE
MOSQUITO SPECIES
Monitoring of Ae. koreicus has been complicated by insufficient information
about the efficacy of trapping methods for capturing the species. Mosquito collections
undertaken in Korea between 1999 and 2004 yielded a small number of Ae. koreicus
(not the major target of the collections): this species made up less than 0.1% of
mosquitoes collected with New Jersey light traps (unbaited or baited with dry ice)
(Figure 2.4). Mosquito Magnet Traps (Figure 2.5) and CDC-type light traps (baited
with dry ice) (CDC traps are described in Chapter 3) [137, 138, 174-176].
Chapter 2: Literature review 28
Figure 2.4 The components of a New Jersey light trap.
Note: The New Jersey light trap is a metal cylinder, covered by a rain shroud to protect the collection
chamber from water. Under the shroud is a light bulb to attract mosquitoes. Once attracted by the
light, a fan located in the bottom of the device over the collection chamber draws the mosquito into
the collection chamber [177].
Chapter 2: Literature review 29
Figure 2.5 The components of a Mosquito Magnet Trap.
Note: Mosquito magnet traps convert propane into carbon dioxide (CO2) and then emit a precise
combination of heat, moisture, and a secondary attractant to draw mosquitoes into a vacuum [178].
In 2012, a panel of experts from the European Union (ECDC) outlined the
principal guidelines to be applied in surveillance programmes for invasive mosquito
species, including Ae. koreicus, with special reference to the geographic area of Europe
[179]. A clear assessment of the biology and vector competence of invasive mosquito
species is critical to evaluating their potential social and economic impacts on public
health. The guidelines identified the steps required to organise and manage a
surveillance program depending on its scope. Three different scenarios were
identified:
Scenario 1 – no established invasive mosquito species are detected;
however, the risk of introduction is present. In this case, there are no reports
of the presence of a species or initial findings are not confirmed over time,
propane
carbon dioxide
heat
moisture
secondary attractant
vacuum system
Chapter 2: Literature review 30
but commercial trade and models show a risk of introduction. One example
is Ae. japonicus, which has not yet been detected in Italy, but is present in
nearby countries, such as Austria and Slovenia [180].
Scenario 2 – locally established invasive mosquito species. This scenario is
defined by the presence of the invasive species in a maximum area of 25
km2. This is the case of Ae. japonicus in Belgium [168].
Scenario 3 – widely established invasive mosquito species. In such a
scenario, the invasive mosquito species is found over an area of more than
25 km2. Ae. koreicus is placed in the third scenario of the colonisation
process [14].
These guidelines are essential to assessing the spread and establishment of
invasive mosquitoes, and potentially, the risks to public health [181]; however, no
specific tools have been validated for Ae. koreicus surveillance. From previous surveys
conducted in the provinces of Belluno, Vicenza, and Trento, northern Italy, following
the ECDC guidelines for the surveillance of invasive mosquitoes in Europe [179],
Ovitraps (described in Chapter 3) were found to be attractive for Ae. koreicus gravid
females, and effective for the collection of eggs. However, Biogents-Sentinel (BGS)
traps (recommended as a standard tool for the surveillance of invasive mosquitoes by
the ECDC [179], described in Chapter 3) baited only with BG-lure or with a
combination of CO2 and BG-lure (releasing lactic acid, ammonia, and fatty acids to
mimic human skin scents), caught only a few Ae. koreicus specimens [127] and the
optimal survey trap for Ae. koreicus was not defined. In a study with an experimental
design similar to the one used in this thesis, Baldacchino et al. [182] evaluated the
effectiveness of three trapping devices: a CO2-baited BGS trap, a CO2-baited Centres
for Disease Control and Prevention light trap (CDC trap), and a grass infusion-baited
Chapter 2: Literature review 31
gravid trap in an urban and a forested settlement. Over a total of 81 trapping nights,
only 303 Ae. koreicus were captured from all of the traps in both urban and rural sites.
The surveillance tools recommended by the ECDC [179] include BG-Sentinel
traps, Mosquito Magnets, and Ovitraps; however, their specific abilities to detect Ae.
koreicus are unknown (Table 2.2). The design of surveillance programs is also
informed by additional biological information, such as peak time of flying and host
seeking activity, anthropophilic behaviour, and optimum temperature for egg and
larval development and adult emergence. All of this information assists with
identifying the best surveillance protocols for this species.
Chapter 2: Literature review 32
Table 2.2 Efficacy of methods of collection of adult invasive mosquito species and their eggs.
Trap Models
Host-seeking females Oviposition-seeking females
Targeted species HLC CO2 traps MM (CO2) Light traps BG-Sentinel Gravid traps Sticky traps Ovitraps
Ae. aegypti +++ +/- + - ++ +/- ++ ++
Ae. albopictus +++ +/- + - ++ +/- ++ ++
Ae. atropalpus ++ + + - +/- - ? +
Ae. japonicus + +/- + + +/- ++ + +/-
Ae. koreicus ? ? ? ? ? - ? +
Ae. triseriatus +++ ++ ++ ? ++ + + ++
(HLC = human landing collection; CO2 traps = CO2-baited suction traps; MM = Mosquito Magnet, CO2-baited suction traps with chemical attractant; light traps = light-baited
suction traps; BG-Sentinel or Mosquitaire = odor-baited suction traps; gravid traps = infusion-baited suction traps; sticky traps = water/infusion-baited oviposition trap with
sticky element; Ovitraps = water/infusion-baited oviposition traps (only eggs are collected); - low efficacy; + fair efficacy in some situations; ++ good efficacy; +++ excellent
performance; ? not known ) [183].
Chapter 2: Literature review 33
2.10 INTERSPECIES COMPETITION BETWEEN INVASIVE AND
NATIVE SPECIES: CURRENT KNOWLEDGE
A major factor that drives the spread of an invasive species in a new territory is
their competitive interactions with native or pre-existing species that share the same
breeding sites and biological niches [184]. Interspecific cross-insemination
(satyrization) and larval competition are some of the most important interactions that
can help displace or retain native mosquito populations [185, 186].
In the case of satyrization (defined by Ribeiro & Spielman in 1986 [187]) the
males of one species can interfere with the reproductive fitness of females from a
different species by successfully mating with and sterilising them or decreasing their
receptivity to conspecific males. This effect is caused by the transfer of male accessory
gland proteins with sperm [188-190]. Satyrization can cause the displacement of one
population by another, as demonstrated with Ae. albopictus and Ae. aegypti [4, 5, 191-
195]. However, resistance to satyrization may evolve rapidly, although at a potential
cost [4]. Females of Ae. aegypti experimentally exposed to Ae. albopictus males
rapidly developed resistance to satyrization, although satyrization-resistant females
employed longer times to mate with conspecific partners [3]. More recent studies have
demonstrated how the transfer of males’ accessory gland proteins alone, without
depletion of females’ spermathecae with sperm from interspecific males, is sufficient
to induce mating interference [2]. Evidence of interference with mating activities by
male Ae. albopictus against females belonging to at least three other Stegomyia species
(Aedes polynesiensis, Aedes guamensis, and Aedes cretinus) was reviewed in
Bargielowski and Lounibos (2016) [3]. Laboratory experiments and field evidence
suggest that satyrisation by Ae. albopictus males could lead to the competitive
displacement and local extinction of endemic mosquitoes, especially on island settings
Chapter 2: Literature review 34
[3]. However, reproductive interference in the field seems to occur at very low rates
(1.12 - 3.73%) [196].
Ae. koreicus and Ae. albopictus are sympatric in many areas of Italy; however,
possible mating interference between the two species has never been investigated.
Moreover, no studies examining the mating interactions of Ae. koreicus or mating
biology are described in the literature. Competition between the larvae of different
species may also be important. Several studies have examined the mechanism of
displacement of different Aedine species (Ae. albopictus, Ae. notoscriptus, and Ae.
aegypti) that colonised the same ecological niche through larval competition. At
different larval densities and resource availability (food substrates) the species that
maintained a positive trend of population growth and higher chance of survival to
adulthood was considered able to displace other species [197-199]. Ae. albopictus
demonstrated a high competitiveness, but only in certain cases, and different species
had different grades of advantage in different conditions. Ae. aegypti was more
competitive towards Ae. notoscriptus when these larvae were reared in the laboratory
at lower temperatures. Moreover, Ae. albopictus and Ae. aegypti competition varied
for different experimental densities and resources availability. This result suggests
that, in nature, Ae. aegypti persists only at sites with less intense competition [197-
199].
Larval competition can also influence mosquito-virus interactions, leading to
relative enhancement of virus susceptibility and dissemination. Ae. albopictus larvae
developed in highly competitive conditions with Ae. aegypti resulted in smaller Ae.
albopictus adults. Smaller body sizes enhanced body titres and dissemination rate of
Sindbis virus [200]. Other evidence shows that competition with Ae. aegypti increases
susceptibility of Ae. albopictus to DENV infection [201]. The presence of Ae.
Chapter 2: Literature review 35
albopictus larvae in the same breeding site decreased the survival of Ochlerotatus
triseriatus larvae; however, in this case the survivors were larger and more likely to
develop midgut and disseminated infection with La Crosse virus [202].
To date, the only available information about Ae koreicus showed that, under
laboratory conditions, the species larval competition with Ae. albopictus from the same
geographical area was weak when the two larvae species were reared together, with a
small advantage of Ae. albopictus (significant reduction of Ae. koreicus survivorship
when 10 Ae. koreicus larvae were reared in presence of 20 Ae. albopictus larvae)
partially counterbalanced by the emergence of bigger Ae. koreicus females [203].
Chapter 3: Evaluation of mosquito traps for the field collection of adult Ae. koreicus in a variety of physiological
states 36
Chapter 3: Evaluation of mosquito traps for
the field collection of adult Ae.
koreicus in a variety of
physiological states
3.1 INTRODUCTION
Mosquito traps are essential tools for field collection and surveillance programs
[181]. The collection of Ae. koreicus in a variety of physiological states (gravid, blood-
fed, host-seeking) is critical to determining the mosquitoes’ presence, abundance,
ecology, and behaviour [204]. Trapped mosquitoes can be further characterised for the
presence of virus or host blood meal [205]. Information about the efficacy of trapping
methods for capturing Ae. koreicus is currently insufficient, and with the exception of
a ‘fair efficacy in some situations’ of Ovitraps reported by ECDC [182], the optimal
survey trap for Ae. koreicus has not yet been defined.
This thesis evaluates the performance of five different mosquito collection
methods commonly employed in mosquito surveillance programmes for trapping Ae.
koreicus. Ae. koreicus was collected from the field in northern Italy using protocols
described in Krökel et al. [206], to compare mosquito abundance between different
sites (e.g., urban or rural areas). The experiment was designed to identify the most
effective trapping method for non-gravid, gravid, and blood-fed Ae. koreicus by testing
BG-Sentinel (BG) traps with and without CO2, gravid Aedes traps (GATs) and
Ovitraps. Moreover, as part of the investigations into Ae. koreicus biology, human
landing catches with aspirators were used to quantify the mosquito-human contact
[204].
Chapter 3: Evaluation of mosquito traps for the field collection of adult Ae. koreicus in a variety of physiological
states 37
3.2 METHODS
3.2.1 Evaluation of the field performance of four trapping methods
Two different trials were conducted in two different sites in the Belluno
province, Italy, which were approximately five kilometres apart (Figure 3.1). One site
was considered ‘urban’ and was located in the city centre of Belluno (Figure 3.2). The
other site was considered ‘rural’ and was located in farmland (Figure 3.3). At each
location, a BG-Sentinel trap baited with BG-Lure (BioGents GmbH), a BG-Sentinel
trap baited with BG-Lure and CO2, a GAT trap, and an Ovitrap were separated by
approximately 50 m in a Latin square design. The traps were positioned at distances
three time greater than those applied in a study evaluating the performance of BG-
Sentinel traps in comparison to CO2 and Fay-Prince traps [206]. This was done to
reduce any potential interference between traps.
Figure 3.1 Area in Belluno province in which the evaluation of field performance of
four different trapping methods (BG-Sentinel traps with and without CO2, Gravid
Aedes Traps, and Ovitraps) was performed.
Chapter 3: Evaluation of mosquito traps for the field collection of adult Ae. koreicus in a variety of physiological
states 38
Note: The blue spot is the urban site and the red spot is the rural site (Image courtesy of Matteo
Mazzucato – GIS office database, IZSVe).
Figure 3.2 Location of traps in the urban site.
(Image courtesy of Matteo Mazzucato – GIS office database, IZSVe)
Chapter 3: Evaluation of mosquito traps for the field collection of adult Ae. koreicus in a variety of physiological
states 39
Figure 3.3 Location of traps in the rural site.
(Image courtesy of Matteo Mazzucato – GIS office database, IZSVe)
Chapter 3: Evaluation of mosquito traps for the field collection of adult Ae. koreicus in a variety of physiological
states 40
The BG-Sentinel trap consists of a white collapsible bucket capped by a white
gauze top. In the middle of the white gauze, a round hole connects to a black tube, a
black catch bag, and a 12-V DC fan. The fan creates a downward flow that causes any
mosquitoes in the vicinity of the opening to be sucked into one catch bag (Figure 3.4).
An attractant (the BG-Lure, BioGents GmbH) is added to the trap and releases a
combination of lactic acid, ammonia, and caproic acid, common components of human
skin exudates [206].
Figure 3.4 BG-Sentinel trap.
Chapter 3: Evaluation of mosquito traps for the field collection of adult Ae. koreicus in a variety of physiological
states 41
The BG-Sentinel trap baited with BG-Lure and CO2 is identical to the previous
design, except for a bucket containing dry ice, which is suspended above the trap, and
through sublimation, leads to the production of CO2, to resemble animal breath
(Figure3.5) [207].
Figure 3.5 BG-Sentinel trap baited with BG-Lure and CO2.
Chapter 3: Evaluation of mosquito traps for the field collection of adult Ae. koreicus in a variety of physiological
states 42
The Ovitrap consists of a black bucket filled at the bottom with rain water. For
this study, a Masonite® wooden stick (oviposition substrate) was fitted to the inside
wall of the upper half of the container (Figure 3.6) [208].
Figure 3.6 Ovitrap.
Chapter 3: Evaluation of mosquito traps for the field collection of adult Ae. koreicus in a variety of physiological
states 43
The gravid Aedes trap (GATs) was built following the design of Ritchie et al.
[209]. The standard GAT has a 10-liter black bucket filled with approximately three
litres of rain water, with a 5.1-liter translucent plastic top. The translucent top has an
opening into which a black matte funnel is inserted, with 7cm exposed above the top
of the translucent chamber. The bottom of the translucent plastic top and the water are
separated by a piece of insecticide-treated net (Olyset® Plus) (Figure 3.7).
Figure 3.7 Gravid Aedes Trap.
Chapter 3: Evaluation of mosquito traps for the field collection of adult Ae. koreicus in a variety of physiological
states 44
Mosquitoes were sampled every 24 hours at 6.00 pm. The position of the four
traps was rotated at the end of every 24-hour period. Twelve sampling days were
completed at both the rural and urban sites (August 5-9, 19-23, 26, 27, 2014).
Mosquitoes were identified using taxonomic keys [134, 210-214]. All of the trap
positions were geo-referenced using a GPS.
3.2.2 Human landing
Human landing collections were performed in the grounds of the Istituto
Zooprofilattico Sperimentale in Belluno (46.1477339° N 12.2046886° E) (Figure 3.8).
The investigator sat with her legs exposed (Figure 3.9). Host seeking mosquitoes
landing on the investigator’s legs were collected using a handheld aspirator (Hausherr's
Machine Works, Toms River, NJ) and identified [134, 210-214].
Five human landing collections were carried out at each site. Each collection
lasted 21 hours between 8.00am and 5.00am of the following day, except on September
16 and 17 when the collection lasted only until 1.00 am (Figure 3.9). Mosquitoes were
collected for one hour in every four-hour period (i.e., 08.00, 12.00, 16.00, 20.00, 00.00,
and 04.00). The collections were performed on July 22, 23, August 21, 22, August 26,
27, September 11, 12 and September 16, 17, 2014. Temperature and relative humidity
(RH) were recorded during each collection.
Chapter 3: Evaluation of mosquito traps for the field collection of adult Ae. koreicus in a variety of physiological
states 45
Figure 3.8 Human landing collection site.
Figure 3.9 Human landing collections during the day and during the night.
Chapter 3: Evaluation of mosquito traps for the field collection of adult Ae. koreicus in a variety of physiological
states 46
3.3 RESULTS
3.3.1 Evaluation of the field performance of four trapping methods
During the sampling period, minimum and maximum temperatures ranged
between 10.8-16.4°C and 17.2-28°C. Rain was registered on nine out of 12 sampling
days, with wind speeds between 0.5 and 1.3 m/s (Table 3.1).
Table 3.1 Maximum, minimum, medium temperatures, precipitations (measured in
mm H20 per day) and wind speed (measured in m/s) during the sampling period in
Belluno
Day T min (°C) T med (°C) T max (°C) mm H20 Wind speed
5 15.6 °C 19.6 °C 25.2 °C - 1.1
6 12 °C 19.8 °C 28 °C - 1.1
7 15.1 °C 19 °C 26.4 °C 15 1.3
8 12.7 °C 20 °C 27.6 °C 0.6 1
9 16.4 °C 20.5 °C 27.2 °C 2.6 1.1
19 13.4 °C 15.8 °C 18.6 °C 6 0.5
20 11.2 °C 16.6 °C 22.1 °C 12.8 0.9
21 13.6 °C 17.8 °C 23.3 °C 2.2 1.2
22 12.5 °C 17.3 C° 22.3 °C 1.4 0.6
23 10.8 °C 14.6 °C 17.2 °C ° 26.2 0.8
26 13.2 °C 15.8 °C 19.4 °C - 0.7
27 15.6 °C 19.8 °C 26.8 °C 0.2 1
Source: Belluno airport meteorological weather station, [215].
None of the trapping methods utilised in this assay yielded a consistent number
of target mosquitoes; thus, statistically robust analyses could not be performed. GAT
Chapter 3: Evaluation of mosquito traps for the field collection of adult Ae. koreicus in a variety of physiological
states 47
traps and Ovitraps were always negative. At the urban site, the BG-Sentinel CO2 trap
tended to capture more mosquitoes than the BG-Sentinel trap. In particular, Ae.
albopictus and Culex pipiens were captured in greater numbers than other species
(Figure 3.10). The number of mosquitoes captured at the rural site was generally lower
in comparison to the urban site (Figure 3.11). Consistent with the urban site, the BG-
Sentinel CO2 trap tended to attract more mosquitoes than BG-Sentinel trap. Cx. pipiens
was captured in greater numbers than other species (Figure 3.11). Statistical analysis
was not performed due to the small sample size of Ae. koreicus captured in both rural
(n= 1) and urban (n= 13) sites.
Figure 3.10 Number and species of mosquitoes captured at the urban site.
0
50
100
150
200
250
BG-Sentinel
BG-Sentinel CO₂
Mo
squ
ito
nu
mb
er
Species
Chapter 3: Evaluation of mosquito traps for the field collection of adult Ae. koreicus in a variety of physiological
states 48
Figure 3.11 Number and species of mosquitoes captured at the rural site.
3.3.2 Human landing
During the five-day sampling period, the temperature ranged between 14.1°C-
22.2°C (Table 3.2). Precipitation levels and wind speed recorded for the sampling
period are shown in Table 3.3. Relative humidity levels ranged between 51-74%. The
species caught most frequently in this survey was Ae. albopictus, which was active
throughout the day, with a peak of activity in the central hours of the day (12.00-13.00,
n= 19 and 16.00-17.00, n=17). Only three Ae. koreicus were caught during the evening
(time intervals 16.00-17.00, n=1 and 20.00-21.00, n=2) (Figures 3.12 and 3.13). Very
few other mosquito species (Anopheles plumbeus, Culex pipiens, Aedes vexans) were
captured (Figure 3.14).
0
5
10
15
20
25
30
BG-Sentinel
BG-Sentinel CO₂
Mo
squ
ito
nu
mb
er
Species
Chapter 3: Evaluation of mosquito traps for the field collection of adult Ae. koreicus in a variety of physiological
states 49
Table 3.2 Temperature measured at each time interval and the average temperature
during the five sampling days.
Time Temperature (°C) Average
22/07/2014 21/08/2014 26/08/2014 11/09/2014 16/09/2014
8.00-9.00 19.4°C
16.5°C 15.4°C 17.4°C 15.8°C
16.9 ±
0.6
12.00-
13.00
19.4°C
19.5°C 18°C 19°C 17.4°C
19.9 ±
1.2
16.00-
17.00
22.2°C
20.5°C 18.5°C 18.8°C 19.5°C
19.9 ±
0.5
20.00-
21.00
19.8°C
17°C 16.5°C 16°C 16.2°C
17.1 ±
0.6
00.00-
01.00
19°C
15.5°C 16.3°C 14.1°C 15.6°C
16.1 ±
0.6
4.00-5.00 18.4°C 15.2°C 16.3°C 14.1°C 16 ± 0.7
Table 3.3 Precipitation levels (mm H20/day) and wind speed (measured in m/s)
during the sampling period in Belluno (Belluno airport meteorological weather
station, [216, 217]).
Day mm H20 Wind speed
22-Jul 3.4 N/A*
21-Aug 2.2 1.2
26-Aug - 0.7
11-Sep 10.8 0.9
16-Sep 2.8 0.5
*= not available
Chapter 3: Evaluation of mosquito traps for the field collection of adult Ae. koreicus in a variety of physiological
states 50
Figure 3.12 Total number of Ae. albopictus and Ae. koreicus sampled at different
time intervals
Note: the shaded area represents the hours after sunset.
Figure 3.13 Mosquito species sampled at different time intervals, temperature, and
relative humidity at the sampling site.
Note: the shaded area represents the hours after sunset.
Chapter 3: Evaluation of mosquito traps for the field collection of adult Ae. koreicus in a variety of physiological
states 51
Figure 3.14 Ae. koreicus feeding on a human.
Very few Ae. koreicus were captured; thus, statistical tests were unable to be
performed to determine the correlations between abundance and environmental
variables.
3.4 DISCUSSION AND CONCLUSION
In this experiment, only the BG-Sentinel traps, already indicated as effective for
Aedes monitoring [218] and recommended as a standard device by the European
Centre for Disease Prevention and Control [179], were successful in trapping Ae.
koreicus. Mosquitoes were captured in very low numbers (Ae. koreicus captured at the
rural site = 1; Ae. koreicus captured at the urban site = 13). BG-Sentinels baited with
lure and CO2 captured the majority of mosquitoes at both sites (302/333). This trap
also collected the largest number of Ae. koreicus (13/14), suggesting that Ae. koreicus
might not display a strict anthropophilic behaviour (the combination of BG-lure and
CO2 baits attracts a variety of species, not only anthropophilic mosquitoes), or that the
Chapter 3: Evaluation of mosquito traps for the field collection of adult Ae. koreicus in a variety of physiological
states 52
species is more attracted to CO2 than other Aedes. The experiment was challenged by
the difficult meteorological conditions in the study area in 2014. Belluno is located in
a mountainous area at approximately 400 m. above sea level. Even during summer,
heavy precipitation and variable temperatures can significantly impact mosquito
activity.
The human landing evaluations performed over five days and nights were
affected by the same climatic conditions. The numbers of host seeking Ae. koreicus
captured (three samples collected over five trapping periods) were consistent with data
from a parallel study conducted by the IZSVe from 5.00 pm to 8.30 pm (a total of
twenty-one Ae. koreicus collected per night over twenty-six nights of trapping) in five
nearby municipalities [219]. The evaluation of a 24-hour timeframe as opposed as an
a priori selected one indicated that the preferred period of activity for Ae. koreicus was
late afternoon/evening.
Despite suboptimal conditions, the Ae. albopictus: Ae. koreicus ratio was 44:3
during five human landing collections in an urban area, and 36:13 during 12 BG-lure
and CO2 trap collections at the urban site. These data suggests that the two trapping
methods were effective in collecting both species, even when their presence was low,
and may provide indications about these species’ relative abundance. As Ae. koreicus
is a recently introduced mosquito in Italy, even though the population has been
established [12], mosquito density in the territory may not be high. When the study
was repeated one year later by Baldacchino et al. [182] with more favourable weather
conditions and more resources available, only 303 Ae. koreicus were captured in total
of 81 trapping nights. That study insisted that the low efficacy of the trapping methods
might be ascribed to a low mosquito density. The same study, comparing Ae. koreicus
and Ae. albopictus adult collections in 2014 and 2015, found that the number of
Chapter 3: Evaluation of mosquito traps for the field collection of adult Ae. koreicus in a variety of physiological
states 53
mosquitoes captured in 2015 was higher than in 2014, and that this increased
abundance may have been due to an increase in the mean temperature and/or a decrease
in precipitation during the sampling periods. In that study, a Latin square design
similar to the one described in this thesis chapter was used to evaluate the efficacy of
different traps (a modified version of the BG-Sentinel trap CO2-baited, a CO2-baited
CDC trap, and a grass infusion-baited gravid trap). Although the authors suggested
that these traps were effective for Ae. koreicus sampling, only 303 Ae. koreicus were
captured over a total of 81 trapping nights. Overall, 219 Ae. koreicus were sampled at
the forested site and 84 at the urban site. The BG-Sentinel trap CO2-baited yielded 59
and 30 Ae. koreicus for the two sites, respectively. The CO2-baited CDC trap collected
80 Ae. koreicus at the forested site but only four at the urban site. Finally, the grass
infusion-baited gravid trap collected the higher number of Ae. koreicus in total, with
80 sampled at the forested site and 50 at the urban site. The results suggest that there
is still a lack of tools for intensive monitoring of this species [182].
Chapter 4: Laboratory colonisation of Ae. koreicus 54
Chapter 4: Laboratory colonisation of Ae.
koreicus
4.1 INTRODUCTION
The establishment of a stable, healthy colony is a critical first step for subsequent
laboratory studies on mosquito ecology, behaviour, and virus-vector interactions. This
chapter describes the key conditions and parameters for rearing Ae. koreicus under
laboratory conditions and subsequent development times, survival, fecundity, and egg
hatching rates. Although colonies of other Aedes species are commonly maintained
under laboratory conditions [220-223], no Ae. koreicus colonies were reported in the
literature; and thus, no satisfactory method of rearing this species has yet been
described. The capacity to obtain virgin cohorts is of considerable utility when
designing experiments that investigate the competitive mating interference behaviours
between invasive and native mosquitoes [2, 4, 5, 191].
Wing length is often an accurate indicator of fecundity in mosquitoes [224-228],
and numerous studies have utilised this relationship to investigate mosquito ecology
and behaviour. For example, wing length has been used as one parameter in equations
that estimate population growth in cases of larval competition and competitive
displacement between different species [200, 201, 229, 230] or to evaluate the effect
of food substrates and larval density on mosquito population fitness [231, 232]. To
facilitate similar studies on Ae. koreicus, this chapter describes the fecundity-size
relationship of the colony established for this study.
Chapter 4: Laboratory colonisation of Ae. koreicus 55
4.2 METHODS
4.2.1 Effect of temperature on egg hatching and development
In an initial attempt to colonise Ae. koreicus at IZSVe, Italy, mosquitoes were
reared following the protocol of Williges et al. [233] due to the phylogenetic proximity
of this species to Ae. japonicus [161, 234]. The rearing conditions were as follows: 26
± 1°C temperature, 65 ± 5% relative humidity and a 16-hour light:8-hour dark cycle,
without crepuscular periods.
There were considerable rearing problems under these conditions (a lack of
oviposition and colony decline), and it was hypothesised that temperature was
affecting the colonisation success. Ae. koreicus egg development was then compared,
from hatching to adult, at two different rearing temperatures (23 ± 1°C and 26 ± 1°C).
The temperature choice of 23 ± 1°C was based on average summer temperatures in the
native range of Ae. koreicus in South Korea and in the mountainous area of Belluno,
Italy [14].
The effect of temperature on egg hatching was tested on eggs collected from the
field (IZS Belluno) (46.1477339° N 12.2046886° E) using Masonite® sticks (as
oviposition substrates) partially submerged in rainwater in 60L black bins (ABM Italia
S. p. A.) (Figure 4.1). Once collected, the eggs were hatched in rainwater in the
laboratory over 17 days (8th of July to 25th July, 2014). During hatching, 204 eggs were
held at the higher temperature range (26 ± 1°C), while 233 eggs were exposed to the
lower temperature range (23 ± 1°C). Hatched larvae were fed on an aqueous solution
of ground Tetramin® fish food (0.125 g/ml) ad libitum (dry Tetramin® fish food powder
directly added to the trays was observed to cause excessive bacterial scum and larval
death). Based on the results of this experiment, the Ae. koreicus colony was reared at
23 ± 1°C.
Chapter 4: Laboratory colonisation of Ae. koreicus 56
Figure 4.1 Masonite® sticks partially submerged in rainwater (IZS Belluno).
4.2.2 Establishment of an Ae. koreicus colony
Eggs from the Italian colony reared in the laboratory at IZSVe were used to
establish a new colony of Ae. koreicus at QIMR Berghofer Medical Research Institute
under import permit IP 14001574. Rearing conditions for the new colony of Ae.
koreicus were: 23 ± 1°C temperature, 75 ± 5% relative humidity and a 12-hour light:
12-hour dark cycle, with crepuscular periods (Figure 4.2). Larvae were reared in 45 x
40 x 5 cm white plastic trays that contained approximately 5 L of rain water or de-
chlorinated tap water and never exceeding a density of 500 larvae per tray (Figure 3.3).
They were fed on an aqueous solution (0.125 g/ml) of ground Tetramin® fish food
added to the trays, never exceeding the following amounts: 0.5 ml of Tetramin® fish
Chapter 4: Laboratory colonisation of Ae. koreicus 57
food solution for first and second instar larvae, 1 to 2 ml for third instar larvae, and 2
ml for fourth instar larvae. In the first stages of larval development (L1 and L2), the
aqueous food solution was provided every two days. Food was supplied daily during
the subsequent development stages (L3 and L4). Water levels were maintained by
adding fresh rain water or de-chlorinated tap water to the trays. Pupae were
individually ‘picked’ from larval trays using a 1.5 ml pipette and transferred to the egg
collection trays (© 2014 Genfac Plastics Pty Ltd, 18.3 x 15.2 x 6.5 cm). These trays
contained rain water and Masonite® sticks as oviposition substrates for the emerging
adults. Pupae density did not exceed 250 pupae per tray. Trays were placed inside adult
colony cages (BugDorm® Insect Rearing Cage, 30 x 30 x 30 cm) in preparation for
adult emergence, mating, and oviposition.
Once emerged, adult mosquitoes were provided with a 10% w/v sucrose solution
ad libitum and allowed to feed on the arm of a human volunteer (QIMR Berghofer
Human Research Ethics Committee permit QIMR HREC361) or defibrinated sheep
blood (Thermo Fisher Scientific® Aust Pty Ltd) supplied through glass membrane
feeders covered by a porcine intestinal membrane [235]. No forced mating was
required. Following oviposition, Masonite® sticks with Ae. koreicus eggs were
routinely placed on dry paper towels to absorb excess water for no longer than 10
minutes. The sticks were then stored in anti-leak plastic bags that were sealed to
prevent desiccation, as suggested by Crampton et al [236] and maintained at 23 ± 1°C.
Chapter 4: Laboratory colonisation of Ae. koreicus 58
Figure 4.2 Environmental chambers at the QIMR Berghofer Quarantine Insectary
containing Ae. koreicus colonies.
Chapter 4: Laboratory colonisation of Ae. koreicus 59
Figure 4.3 Masonite® sticks with Ae. koreicus eggs submerged in rain water.
4.2.3 Egg storage and embryo development
Unusually low hatch rates were observed during the process of building the
colony. It was unclear whether this was typical of Ae. koreicus populations or the result
of pre-hatch death caused by artificial rearing conditions. Embryo development and
viability in stored eggs was therefore examined. After 14 days of storage in a sealed
anti-leak plastic bag, one Masonite® stick holding 1,189 eggs was observed under a
stereoscope to assess damage or contamination by mould that could produce
mycotoxins and affect egg viability [237]. Following the evaluation of egg integrity
under a stereoscope, a segment of the Masonite® stick holding a total of 95 undamaged
eggs was then cleared for 30 minutes in a 50% v/v HCl solution modifying the method
used by Trpiš [238] and observed under a stereoscope to confirm the presence of an
intact embryo. The remaining 1,094 eggs were submerged in a hatching tray with 5 L
Chapter 4: Laboratory colonisation of Ae. koreicus 60
of rain water. Larvae were fed with the typical colony rearing food regimen and the
number of adults obtained was recorded.
4.2.4 Sexual dimorphism in pupae
Morphological features of the 10th abdominal segment (genital lobe) of Ae.
koreicus pupae were investigated as a means of distinguishing males from females.
Pupae were inspected in a water droplet on a slide under 20x magnification. Cover
slides were not used, as they damaged the pupae (Figure 4.4).
Figure 4.4 Ae. koreicus pupae.
4.2.5 Fecundity-size relationship evaluation
To determine whether wing length could be used as an indicator of fecundity in
Ae. koreicus, a batch of larvae was divided between four trays of 100 larvae each, three
days after hatching. The volume of water per tray was 5 L. Different feeding regimes
were applied in order to create mosquito cohorts of different sizes. One group was
provided with an aqueous solution of ground Tetramin® fish food (0.125 g/ml) ad
libitum, larvae from three other groups were fed with the same solution at various
ratios: first instar larvae were given respectively 0.05, 0.1, and 0.2 ml fish food solution
1 cm
Chapter 4: Laboratory colonisation of Ae. koreicus 61
per tray; second instar larvae were fed 0.1, 0.2, and 0.4 ml of food per tray; third instar
larvae were fed 0.15, 0.3, and 0.6 ml of food per tray, and fourth instar larvae were fed
0.2, 0.4, and 0.8 ml of food per tray daily.
Adults that emerged from these rearing trays were maintained at the colony
rearing conditions and blood-fed to repletion on a human host (QIMR Berghofer
Human Research Ethics Committee permit QIMR HREC361) approximately five days
after eclosion. Five days after blood feeding, female mosquitoes were removed from
the cage and killed (using CO2). The length from the arculus to the wing tip, excluding
the fringe scales, was measured as a proxy of body size (Figure 4.5). Both wings were
removed and dry mounted on a glass microscope slide, with a mean length calculated
in cases where the right and left wings differed in size [224-228].
Figure 4.5 Ae. koreicus wing
Ovaries were dissected in a drop of phosphate-buffered saline (PBS) on a glass
microscope slide under a stereoscope at a magnification of 10x, and the number of
mature follicles (stages IVb and V) were counted [224, 226]. Ovary development
Arculus Wing tip
Chapter 4: Laboratory colonisation of Ae. koreicus 62
stages were classified according to Clements and Boocock [239], modified from
Christophers [224, 226, 240, 241] (Figure 4.6).
Figure 4.6 Egg follicle development in mosquitoes [242].
4.2.6 Data analysis
Ae. koreicus egg development was compared at two different rearing
temperatures (23 ± 1°C and 26 ± 1°C) using the 𝜒2 test (GraphPad Prism Program,
GraphPad Software, San Diego, CA, USA). To determine the fecundity-size
correlation, a linear regression analysis (GraphPad Prism Program, GraphPad
Software, San Diego, CA, USA) was performed using the number of mature follicles
and wing length.
Chapter 4: Laboratory colonisation of Ae. koreicus 63
4.3 RESULTS AND DISCUSSION
4.3.1 Effect of temperature on egg hatching and development
From a total of 233 eggs reared at IZSVe laboratory in Italy at 23 ± 1°C, 39.4%
reached the adult stage (n=93: 37 males, 56 females). By contrast, the percentage of
adults obtained from the 204 eggs reared at 26 ± 1°C was just 3.4% (n=7: 3 males, 4
females), showing that significantly more Ae. koreicus adults developed at the lower
temperature than at the higher temperature (p<0.0001, 𝜒2= 82.04). These egg cohorts
emerged slowly, with a great deal of variation in emergence times (Figure 4.7).
Following this finding, the rearing temperature of the Ae. koreicus colony in Italy was
adjusted to 23 ± 1°C. After three months, 8,860 eggs had been collected, which were
then sent to QIMR Berghofer Medical Research Institute to start a new Ae. koreicus
colony for vector competence and behavioural studies.
Figure 4.7 Effect of temperature on the emergence of adult mosquitoes after 17 days
from eggs water submersion.
Chapter 4: Laboratory colonisation of Ae. koreicus 64
4.3.2 Establishment of an Ae. koreicus colony
The development times and hatching rates of the QIMR Berghofer colony at 23
± 1°C are reported in Table 4.1.
Table 4.1 Development parameters for Ae. koreicus reared at a temperature of 23 ±
1°C
Time to
pupation
(Days ± SE)
Time to pupae
eclosion
(Days ± SE)
Interval between blood
meal and oviposition
(Days ± SE)
Hatching
percentage
(%± SE)
9.29 ± 0.18 3.43 ± 0.3 11.5 ± 3.5 10.39 ± 2.09
This species showed a low percentage of hatching derived from the number of
pupae obtained after nine days of egg submersion in water. Subsequent observations
demonstrated that the eggs could remain submerged but viable for very long periods.
The cumulative proportion of pupae obtained from submerged eggs over a period of
80 days is shown in Figure 4.8.
Figure 4.8 Pupal development measured over 80 days of submersion across four
different trays.
Chapter 4: Laboratory colonisation of Ae. koreicus 65
The long viability of submerged eggs could be due to embryo dormancy, a
demonstrated survival strategy in other mosquitoes [243]. The emergence of adults
over a long period after water submersion could represent a mechanism that permits
coexistence with competing species. Another potential competitive advantage is
earlier hatching during the spring season, as observed when Ae. koreicus shares the
same breeding sites with Ae. albopictus [14].
4.3.3 Egg storage and embryo development
From the observation of 1,189 eggs at 14 days post storage, a total of five eggs
were found to be desiccated and three eggs were hatched. All of the other eggs
appeared normal. After clearing a portion of the eggs (n= 95) to determine the embryo
development status, a total of 83 mature intact embryos were observed under the
stereoscope (87.4%, n= 95). Each embryo was considered mature when eye spots and
thoracic and abdominal hair tufts were clearly visible, which is typical of a fully
developed embryo [244] (Figure 4.9). Twelve eggs were lost in the media during the
clearing process and were not evaluated. Although embryonation was confirmed, only
25 first instar larvae were observed after 36 hours of water submersion of the
remaining eggs (2.3%, n=1094). Pupation was observed from day nine onwards. After
14 days, only 20 of the 25 original larvae had reached adult stage. This study confirmed
that a low hatching rate does not appear to result from inadequate storage of eggs.
Chapter 4: Laboratory colonisation of Ae. koreicus 66
Figure 4.9 Fully formed embryo of Ae. koreicus after egg clearing.
4.3.4 Sexual dimorphism in pupae
The characteristic conformation of the 10th abdominal segment after dissection
and in live pupae allows for distinguishing of sex using the features shown in Figure
4.10. Following examination, pupae were individually placed in water containers and
the sex of the emerging adults was confirmed. Observation of the genital lobe in pupae
allowed for 100% successful separation between male and female Ae. koreicus. The
genital lobe is shield-shaped and bifurcate in both sexes. In males though, it is
obviously bigger and less pointed on its ends, compared to females.
Chapter 4: Laboratory colonisation of Ae. koreicus 67
Figure 4.10 Ae. koreicus male and female genital lobe.
(a) male genital lobe after dissection, (b) male pupae alive in a water drop. (c) female genital lobe
after dissection, (d) female pupae alive in a water drop.
4.3.5 Fecundity-size relationship evaluation
A strong relationship was detected between fecundity (number of eggs) and
female size (with wing length as a proxy) (Figure 4.11; P ˂ 0.0001, r2 = 0.6051; n=51):
the larger the female, the more likely it was to have more eggs. This indicates that the
size of the individuals collected from the field could be related to fecundity.
a
b
c d
Chapter 4: Laboratory colonisation of Ae. koreicus 68
2 .5 3 .0 3 .5 4 .0 4 .5 5 .0
0
5 0
1 0 0
1 5 0
2 0 0
2 5 0
W in g le n g th ( m m )
Fe
cu
nd
ity
(e
gg
s)
Figure 4.11 Relationship between wing length and fecundity of Ae. koreicus.
4.4 CONCLUSIONS
The establishment of a laboratory colony of Ae. koreicus was challenging. The
first attempts to establish Ae. koreicus in the laboratory were unsuccessful and required
significant adaptation. In particular, the temperature of 26°C suggested in Williges et
al. [233] had to be lowered to 23°C before Ae. koreicus developmental rates were
sufficient to create a stable colony.
The relatively low rearing temperature of this species may affect important
biological characteristics, such as development times and the length of the gonotrophic
cycle [245]. The length of this cycle in Ae. koreicus is indeed three to four times greater
than that in Ae. albopictus reared in the laboratory at 27°C [246]. This may be
advantageous for colony maintenance, as Ae. koreicus’ long development times permit
Y = 88.51*X - 239.6
R2 = 0.6051
Chapter 4: Laboratory colonisation of Ae. koreicus 69
more flexibility in routine rearing procedures. Moreover, it is a factor to be carefully
considered when designing experiments. An additional limitation when designing
experiments is the low hatching percentage in the laboratory (10.4 ± 2.1). Vector
competence experiments require a high number of mosquito females to be
synchronised in their development to standardise feeding and remove age-related bias
in infection or survival. As low numbers of pupae were obtained after nine days of
water submersion, it could be difficult to create cohorts for large scale experiments.
The low hatching rate after initial submersion and long viability of eggs
submerged in water may have been due to a phenomenon called ‘embryo dormancy’,
a demonstrated survival strategy for Anopheles gambiae to survive the dry season in
Kenya to resist adverse climatic conditions [243]. In the case of Ae. koreicus, this
species may utilise embryo dormancy to survive temperature drops typical of
mountainous areas during the summer season. Further studies will assist to clarify this
hypothesis.
The length of the gonotrophic cycle, limiting the number of new offspring
obtainable in a short time period, together with the low hatching percentage of Ae.
koreicus, emphasises the need to develop a method of sexing pupae. As part of this
investigation, a technique described by Moorefield [247] was adapted to successfully
differentiate Ae. koreicus males and females at the pupal stage, with the goal of being
able to separate the sexes prior to adult emergence, and therefore ensure the creation
of cohorts of virgin mosquitoes. The ability to separate the sexes at this stage provided
a far more efficient means of creating virgin cohorts for reproductive studies than
relying on size differences. Indeed, although differentiation of males and females
could be based on the pupae dimensions and development time (males of some species
are smaller and typically also develop before females [248-250]), these differences are
Chapter 4: Laboratory colonisation of Ae. koreicus 70
not applicable to all mosquito species [247]. With such a low hatching rate, a method
based on these differences was not appropriate for Ae. koreicus. Nevertheless, in cases
of high numbers of individuals available, differentiation based on pupal dimensions
and age rather than genital characteristics could be faster. In cohorts created using
pupal dimensions and age, male and female accidental mixes could easily occur, with
the entire cohort being discharged. Due to the low number of Ae. koreicus obtainable,
a more accurate differentiation method based on the observation of pupal genital lobe
conformation in live pupae allowed for the evaluation of the fecundity-size
relationship, to the demine presence of autogeny (Chapter 5) and to observe the mating
behaviour of this species (Chapter 5). This approach has been used in studies on Ae.
albopictus and Ae. aegypti, which can also be sexed by examining the genital lobe
differences under a dissecting microscope [5, 191].
The strong fecundity size relationship observed in this colony (Y = 88.51 * X –
239.6, P ˂ 0.0001, r2 = 0.6051; n=51) has previously been described in other mosquito
species [225, 251]. It is an important indication that the size of the individual collected
in the field relates to fecundity and can be used to assess population density and
identify whether a population is growing or decreasing. For instance, in Ae. albopictus
and Ae. aegypti, when the size of female mosquitoes in a population declines, the
number of eggs laid (fecundity) is also thought to decline in a linear regression
correlation [225, 251]. This has been shown to negatively impact the population
performance (e.g., decline of the population) [230]. Moreover, the equation calculated
for the Ae. koreicus laboratory colony is critical information when evaluating the
interactions of different larval populations. The effect of larval competition on body
size could be related to mosquito fecundity, and therefore population fitness. An initial
investigation recently published by Baldacchino et al. [203] on larval competition
Chapter 4: Laboratory colonisation of Ae. koreicus 71
between Ae. koreicus and Ae. albopictus used wing length as a proxy for fecundity
when estimating population growth. Baldacchino et al. [203] made no empirical
investigation of this relationship in Ae koreicus, instead basing their assumptions on a
previous study by Farjana et al. [252] on Ae. albopictus and Ae. aegypti. This thesis
proves the relationship between fecundity and wing length in Ae koreicus for the first
time and confirms the applicability of this correlation in evaluating the population
dynamics of the performance of Ae. koreicus.
Chapter 5: Characterisation of key aspects of Ae. koreicus mating biology 72
Chapter 5: Characterisation of key aspects
of Ae. koreicus mating biology
5.1 INTRODUCTION
The mating biology of Ae. koreicus is mostly unknown, yet reproductive success
plays a fundamental role in mosquito establishment and population growth [11, 253,
254]. Many aspects may influence the mating biology and reproductive success of
mosquitoes, including autogeny, competitive mating between introduced and
autochthonous individuals, and the presence of the endosymbiont Wolbachia pipientis.
In hematophagous insects, such as mosquitoes, completion of an ovarian cycle
and the production of viable offspring can occasionally occur in the absence of a blood
meal (‘autogeny’: Roubaud 1929 [255]). Autogeny is hypothesised to allow the
persistence of a population when the presence of vertebrate hosts is low, or to allow
for rapid growth of a mosquito population at the start of a season [2, 3]. This allows
mosquitoes to persist in uncertain environments and rapidly exploit optimal
conditions; however, the number of eggs laid is considerably lower compared to eggs
laid after a blood meal [256, 257]. Furthermore, this behaviour may delay contact with
infected hosts, and could therefore impact virus transmission and human infections
early in the season [258, 259]. Autogeny may be facultative or obligate depending on
the species and environmental conditions [260].
The autogeny phenotype has been demonstrated in the Culicinae and
Anophelinae mosquitoes [261, 262]. Within these groups, autogeny is commonly
reported in the genus Culex [263-265], but it is rare in Anopheles [266] and Aedes
mosquitoes [256, 267, 268]. However, one of the main mosquito threats of this century,
the invasive Ae. albopictus, displays autogeny in some populations [268]. Autogeny
Chapter 5: Characterisation of key aspects of Ae. koreicus mating biology 73
could be stimulated by a series of factors, such as environmental temperatures [269],
or selective pressure, such as lack of available hosts for blood feeding [270]. Another
important component of autogeny is the female mating status: egg development in
certain mosquito species does not initiate unless mating occurs, and male accessory
gland products can play a central role for oogenesis [271, 272].
The ability to identify sperm in the Ae. koreicus female reproductive tract not
only rules out the possible lack of autogeny due to the absence of male stimuli, but is
also a fundamental step in the evaluation of mating behaviour and its potential role in
the spread of invasive species in a new territory. The establishment of an exotic species
may be facilitated by the disruption of conspecific mating by the aggressive mating
behaviour of invading males of different species [5]. It may also be facilitated by
interspecific cross-insemination (satyrization) [185, 186]. Satyrization (Ribeiro 1986
[187]) is a form of sterility caused by interspecific mating. For example, the transfer
of Ae. albopictus male accessory gland product to Ae. aegypti females causes them to
become refractory to further mating (including with conspecific males) [5, 192-195].
In nature this can lead to the development of Ae. aegypti resistance to satyrization in
populations sympatric with Ae. albopictus [4, 191]. Although Ae albopictus males are
particularly efficient in satyrizing Ae. aegypti females, these behaviours are not a
peculiar characteristic of Ae. albopictus/Ae. aegypti interactions, but are also common
to other mosquito species [188-190].
Aspects of mosquito reproductive behaviour can also be influenced by the
presence of the endosymbiotic bacteria Wolbachia pipientis. Wolbachia are small
(0.5–1μm), intracellular, α‐proteobacteria originally identified from the ovaries of
Culex mosquitoes in 1924 [273] and known to infect the reproductive organs of 40-
60% of insect species [274, 275]. They can affect host reproduction by increasing the
Chapter 5: Characterisation of key aspects of Ae. koreicus mating biology 74
reproductive success of infected females; thus, enhancing the bacteria’s maternal
transmission and changing male sperm structure such that only mating with a male
infected by the same bacterial strain will lead to progeny (a mechanism called
cytoplasmic incompatibility) [276]. In some cases, Wolbachia can induce
parthenogenesis [277], influence fecundity [278], or oogenesis [279, 280].
The following experiments investigated factors potentially involved with
reproductive biology of Ae. koriecus that have not previously been explored. In parallel
to the study to explore the presence of autogeny in Ae. koreicus, the mating behaviour
of mosquitoes was also observed to prove that insemination in artificial conditions
occurred and to detect the presence of sperm in the female mosquito spermathaecae.
Moreover, the potential for satyrization and disruption of Ae. koreicus mating by the
sympatric species Ae. albopictus, whose male aggressive mating behaviour towards
other interspecific females has been observed before [6], was also examined. To
complete the initial investigations into Ae. koreicus reproduction behaviour, testing
was performed for the presence of the endosymbiotic bacteria Wolbachia pipientis in
samples collected from the field in an area where Ae. koreicus is known to be endemic.
5.2 METHODS
5.2.1 Determination of autogeny in Ae. koreicus
Ae. koreicus larvae were obtained from colony eggs laid on Masonite® sticks on
the 3rd and 16th of May 2016 and 17th of June 2016 and submerged in rain water.
Collections were pooled to create a suitable number of individuals for the experiment,
due to the low hatching rate of this species [281]. Pupae developed after nine days and
were sexed using the method previously described in Ciocchetta et al. [281]. Male and
Chapter 5: Characterisation of key aspects of Ae. koreicus mating biology 75
female pupae were confined together in three different cages (BugDorm® Insect
Rearing Cage, 30 x 30 x 30 cm) at the following initial numbers: cage 1, 161 males,
163 females; cage 2: 161 males, 174 females; cage 3: 161 males, 170 females.
The cages were maintained at the rearing colony conditions [281] in
environmental chambers (Panasonic, Osaka, Japan) (Figure 5.1). A 10% w/v sucrose
solution was provided ad libitum and each cage was equipped with one egg collection
tray (© 2014 Genfac Plastics Pty Ltd, 18.3 x 15.2 x 6.5 cm) with rain water and
Masonite® sticks as oviposition substrates (Figure 5.2). The position of the cages
within each environmental chamber was changed twice per week to minimise
positional bias. The number of adults obtained from pupae was counted. The cages
were checked daily for evidence of oviposition. After three weeks of caging, cage 2
was randomly chosen to proceed to blood feeding on human volunteers (QIMR
Berghofer Human Research Ethics Committee permit QIMR HREC361). The
percentage of fed mosquitoes was recorded. Two weeks after blood feeding, (seven
days from the start of oviposition in cage 2), eggs were collected, counted, and stored
in an anti-leak plastic bag. Additionally, five female mosquitoes from cage 2 and 10
female mosquitoes from cages 1 and 3 were killed (using CO2), and their ovaries were
dissected in a drop of phosphate-buffered saline (PBS) on a glass microscope slide
under a stereoscope at a magnification of 10x to observe for the presence of mature
follicle development (stage IVb and V) [224, 226, 239-241] (Figure 4.6). The number
of dead mosquitoes per cage was also recorded. The viability of a subsample of eggs
collected from cage 2 (n= 1189) was measured after 14 days of storage (refer to Section
4.2.3 Ae. koreicus egg storage and embryo development) to ensure the successful
completion of the gonotrophic cycle in cage 2. Observation of Masonite® sticks for
Chapter 5: Characterisation of key aspects of Ae. koreicus mating biology 76
production of eggs in cages 1 and 3 continued until all adult mosquitoes had died to
ensure that no latent autogeny was displayed.
Figure 5.1 BugDorm® cages in the environmental chamber
Chapter 5: Characterisation of key aspects of Ae. koreicus mating biology 77
Figure 5.2 Egg collection tray with rain water and Masonite® sticks.
5.2.2 Observing Ae. koreicus mating behaviour
Ae. koreicus pupae were derived from mosquito eggs laid on Masonite® sticks
(see Section 5.2.1). Pupae were sexed according to Ciocchetta et al. [281] and 190
males and 240 females were separated into two different BugDorm® cages (BugDorm®
Insect Rearing Cage, 30 x 30 x 30 cm) placed in an environmental chamber (Panasonic,
Osaka, Japan) for emergence, at the previously described colony rearing temperature
and relative humidity [281]. The light/dark cycle was reversed to observe mosquito
behaviour during the crepuscular period and at night in the course of the operator
daytime: Ae. koreicus have been observed to mate in the dark (Silvia Ciocchetta,
personal observation). The environmental chamber used for the experiment was
equipped with a video camera (Samsung SHC-735 1/3" High Resolution, Wide
Dynamic Range Camera) connected to a laptop (Dell Latitude E6540) and to infrared
lights (GANZ Infrared Light, IR50/30-850nm) for night-time recording (Figure 5.3).
The observation cage was a modified BugDorm® cage with transparent plexiglass used
on one side of the cage instead of mesh to allow for clearer images to be captured
Chapter 5: Characterisation of key aspects of Ae. koreicus mating biology 78
during videorecording. Males were allowed a sufficient period for genitalia and sperm
development before mating [282], whereas females are usually ready for copula when
they emerge [253]; thus, six to seven-day old virgin males and two to three days old
virgin females ready for copula were caged together and mosquito behaviour recorded.
At twelve to thirteen-hour intervals, 25 females were aspirated from the experiment
cage, anaesthetised with CO2 and dissected in a drop of phosphate-buffered saline
(PBS) on a glass microscope slide under the stereoscope at a magnification of 10x. A
cover slip was placed over the spermatechae to allow for rupture and sperm
visualisation, and spermatechae content was then observed under a microscope at a
magnification of 40x.
Chapter 5: Characterisation of key aspects of Ae. koreicus mating biology 79
Figure 5.3 The environmental chamber used for the Ae. koreicus mating experiment
5.2.3 Preliminary observations on Ae. albopictus and Ae. koreicus mating
interaction
Ae. koreicus larvae were reared as per Ciocchetta et al. [281]. Ae. albopictus
larvae (from a colony established from eggs collected on Hammond Island, Torres
Strait, Australia, in May 2014) were similarly reared, but at a temperature of 27 ± 1°C.
Mosquitoes of both species were synchronised to pupate at the same time. The pupae
were individually placed in Falcon® tubes containing 5 to 10 ml of rain water to emerge
(Figure 5.4) in order to allow for the creation of two different virgin cohorts. Three to
four days old Ae. albopictus males (n=27) ready for copula [282] were introduced in a
Chapter 5: Characterisation of key aspects of Ae. koreicus mating biology 80
BugDorm® cage containing a solution of 10% w/v sucrose and two to three-day old
virgin Ae. koreicus females (n=22). The interaction between the two mosquito species
was recorded utilising a GoPro® Hero 3 camera. After five days, all female mosquitoes
were anesthetised with CO2 and the spermathaecae (three per female mosquito) were
dissected in a drop of saline buffer under the stereoscope and mounted on a slide to be
subsequently observed at a magnification of 40x to evaluate whether successful sperm
transfer had occurred.
Figure 5.4 Ae. koreicus and Ae. albopictus (a) pupae and (b) adult individuals in
Falcon® tubes.
5.2.4 Wolbachia presence in field-collected Ae. koreicus
Field-collected Ae. koreicus sampled during a survey carried out in north-eastern
Italy from 2011 to 2015 [18] were screened for the presence of Wolbachia pipientis.
Females (n=21) were collected in Belluno (46°08'44.3"N 12°12'38.0"E) in July 2014,
a
b
Chapter 5: Characterisation of key aspects of Ae. koreicus mating biology 81
preserved in RNA (Invitrogen™), and stored at -80°C. DNA was extracted using
QIAGEN DNeasy® Blood and Tissue Kit. The extracted DNA was utilised as a
template for the polymerase chain reaction (PCR) targeting the Wolbachia-specific
wsp and 16s genes and the mosquito housekeeping RpS17 gene, which acted as a
positive control for the extraction:
(wsp F: 5´– TGGTCCAATAAGTGATGAAGAAAC–3´, R: 5´–
AAAAATTAAACGCTACTCCA–3´; 16s F: 5´–
TTGTAGCCTGCTATGGTATAACT–3´, R: 5´–
GAATAGGTATGATTTTCATGT–3´; RpS 17 F: 5´–
TCCGTGGTATCTCCATCAAGCT–3´, R: 5´–CACTTCCGGCACGTAGTTGTC–
3´) [283-285].
PCR with wps primers was performed using a Phusion® High-Fidelity PCR Kit
with initial denaturation at 98°C for 30 sec, followed by a 34 cycles consisting of 98°C
for 10 seconds, 59°C for 30 seconds, and 72°C for 30 seconds and a final extension
step at 72°C for 10 minutes. The same protocol was applied with 16s and RpS17
primers, but the annealing temperatures were 56°C for 16s primers and 58°C for RpS17
primers.
DNA for positive controls was extracted from four Ae. aegypti from a colony of
wMel-infected A. aegypti from QIMR Berghofer Insectary [286] using the same
extraction kit of the target samples. In each PCR, a sample from an Ae. aegypti
wildtype colony (QIMR Berghofer) that was negative for Wolbachia was also tested.
Culex sitiens mosquitoes (n=3) infected with Wolbachia (QIMR Berghofer) extracted
using QuickExtract™ DNA Extraction Solution (Epicentre Technologies Corporation)
were tested as an additional positive control.
Chapter 5: Characterisation of key aspects of Ae. koreicus mating biology 82
5.3 RESULTS
5.3.1 Lack of autogeny in Ae. koreicus
Pupal emergence was completed in nine days. A total of 123 males and 134
females emerged in cage 1, 116 males and 146 females emerged in cage 2, and 103
males and 138 females emerged in cage 3. No eggs were observed in the oviposition
trays of the three cages of the experiment up to three weeks from the initial co-caging.
After this period, a volunteer fed the mosquitoes held in cage 2 (97.2% fed, n= 109)
and oviposition on Masonite® sticks occurred seven days post-feeding. Mature
follicles were observed in all five mosquitoes dissected from cage 2. No eggs were
observed on Masonite® sticks in cages 1 and 3, and no mature follicles were found in
the mosquitoes dissected from those cages. The percentage of male and female
mosquitoes still alive at the time of these observations were: cage 1= males 8.9% (n =
123), females 59.7% (n = 134); cage 2 = males 44.8% (n = 116), females 67.1% (n =
146); cage 3 = males 25.2% (n = 103), females 71.0% (n = 138). A total of 4,925 eggs
were counted under the stereoscope from the Masonite® sticks collected from cage 2
(average eggs/female = 50.25, consistent with a previously reported fecundity index
[281]).
5.3.2 Observing Ae. koreicus mating behaviour
No sperm was observed in spermatechae from female mosquitoes dissected 12
and 25 hours after co-caging. Video recording confirmed that no mating activities
occurred in this time window. Mating activity was observed after 25.5 hours showing
Ae. koreicus males and females in the act of copula [287].
Evidence of motile sperm in Ae. koreicus female spermatechae (Figure 5.5) was
found in 28% of females (n=25) sampled after 31 hours of co-caging with males
Chapter 5: Characterisation of key aspects of Ae. koreicus mating biology 83
(females were sampled 5.5 hours after evidence of mating activity in the cage to allow
the sperm a sufficient period to reach the spermatechae [282]) [288].
Figure 5.5 Ae. koreicus sperm visible after spermatechae rupture.
5.3.3 Preliminary observations of Ae. albopictus and Ae. koreicus mating
interaction
Despite repeated interactions between Ae. koreicus female and Ae. albopictus
males [289], no sperm was detected in the 66 spermathaecae dissected (Figure 5.6).
Differences in the size of the mosquitoes (Ae. koreicus females were visibly bigger
than Ae. albopictus males; Figure 5.7) may have been a possible cause for the failure
in interspecific insemination.
Ae. koreicus sperm
Chapter 5: Characterisation of key aspects of Ae. koreicus mating biology 84
Figure 5.6 No evidence of Ae. albopictus sperm in Ae. koreicus spermathaecae (a)
before and (b) after rupture.
Figure 5.7 Difference in size between Ae. koreicus female (left) and Ae. albopictus
male (right).
a
b
Chapter 5: Characterisation of key aspects of Ae. koreicus mating biology 85
5.3.4 Wolbachia absent in field-collected Ae. koreicus
No Wolbachia was identified in the Ae. koreicus field samples. The DNA
extraction was validated by running a PCR analysis using RpS17 housekeeping gene
primers for mosquito DNA (Figure 5.8-5.10), and Wolbachia was detected by the wsp
and 16S primers in all positive controls.
Figure 5.8 PCR products produced by amplifying Ae. koreicus DNA with
oligonucleotide primers corresponding to Wolbachia gene wsp.
(a) positive controls indicated by the symbol + (Ae. aegypti Wolbachia infected, QIMR Berghofer),
Ae. koreicus samples lanes 84 to 96; (b) Ae. koreicus lanes 97 to 104, positive controls indicated by
the symbol + (Culex sitiens Wolbachia infected, Chen Wu, QIMR Berghofer), Ae. aegypti wildtype
Wolbachia-free, QIMR Berghofer.
Chapter 5: Characterisation of key aspects of Ae. koreicus mating biology 86
Figure 5.9 PCR products produced by amplifying Ae. koreicus DNA with
oligonucleotide primers corresponding to Wolbachia gene 16S.
(a) positive controls indicated by the symbol + (Ae. aegypti Wolbachia infected, QIMR Berghofer),
Ae. koreicus lanes 84 to 92; (b) Ae. koreicus lanes 93 to 104, positive controls indicated by the symbol
+ (Culex sitiens Wolbachia infected, Chen Wu, QIMR Berghofer), Ae. aegypti wildtype Wolbachia-
free, QIMR Berghofer.
Chapter 5: Characterisation of key aspects of Ae. koreicus mating biology 87
Figure 5.10 PCR products produced by amplifying Ae. koreicus DNA with
oligonucleotide primers corresponding to the housekeeping gene RsP17.
(a) positive controls indicated by the symbol + (Ae. aegypti Wolbachia infected, QIMR Berghofer),
Ae. koreicus lanes 84 to 95; (b) Ae. koreicus lanes 96 to 104, positive controls indicated by the symbol
+ (Culex sitiens Wolbachia infected, Chen Wu, QIMR Berghofer), Ae. aegypti wildtype Wolbachia-
free, QIMR Berghofer.
5.4 DISCUSSION AND CONCLUSION
These studies explored the probability of an autogenic phenotype in the Ae.
koreicus QIMR colony. Autogenic behaviour may also affect vectorial capacity.
Defined as the possibility to produce offspring in the absence of a blood meal,
autogeny can influence the vector potential of a mosquito by affecting the abundance
or persistence of vectors, even in the absence of immediate hosts [258, 290].
Conversely, autogeny may limit contact with hosts [258, 259]. The results obtained
when exploring the autogenic behaviour of the established colony suggest that Ae.
Chapter 5: Characterisation of key aspects of Ae. koreicus mating biology 88
koreicus did not display this phenotype under the conditions of this experiment. There
was no oviposition when mosquitoes were deprived of a blood source. In early studies
with the mosquito Aedes taeniorhynchus, O’Meara et al. [271] showed that mating
may increase the levels of autogeny and that the expression of autogeny is correlated
to the environmental conditions in which the larval stages develop and the
geographical origin of the population [269]. In this species, mating was necessary only
when larvae were exposed to conditions unfavourable to their development, and was
otherwise not required for the production of viable eggs [269]. The observation of Ae.
koreicus mating behaviour and the detection of sperm in Ae. koreicus spermathecae
confirmed that the absence of autogeny was not due to a lack of mosquito mating.
Moreover, autogenic populations of Ae. japonicus, a species phylogenetically close to
Ae. koreicus, have never been reported in the literature. It was hypothesised that Ae.
koreicus may be an anautogenous mosquito; however, although autogeny was not
present in the studied colony, the phenotype could still be present in different Ae.
koreicus populations, as previously found in Ae. albopictus [268, 291].
The delay of 25.5 hours being observed before mosquito mating could be due to
different factors. Although adult female mosquitoes are ready to be inseminated once
they emerge, male antennae and genitalia at the moment of imaginal stage emergence
are not in the correct morphological conformation to allow copula. Physical changes
must occur for the males to become sexually active [292]. These changes include the
erection of fibrillar hairs in the antennae (Figure 5.11), (important for female
localisation [293]), and the permanent 180° rotation of terminalia part of the genitalia
to correctly orient the male genital structure for mating (Figure 5.12) [294]. In
particular, the time required for this rotation varies among mosquito species and can
take up to four days, for example, as reported in the species Aedes provocans [295].
Chapter 5: Characterisation of key aspects of Ae. koreicus mating biology 89
The time of Ae. koreicus male genitalia rotation is not known; which justifies the
choice to cage females with six to seven day old virgin males. Although unlikely, it is
still possible that males of this species require more time for sexual maturation.
Moreover, mating may be encouraged by behaviours displayed in the wild, such as
swarming [296], that are impossible to create in a laboratory colony due to limited
space in cages, which could be another factor explaining the delay observed from
mosquito co-caging to pairing.
Figure 5.11 Ae. koreicus male antennal hairs.
Chapter 5: Characterisation of key aspects of Ae. koreicus mating biology 90
Figure 5.12 The reproductive system of female (in red) and male (in blue) Aedes and
the sperm transfer during copulation (represented by the arrows) [297].
The most recent information on Ae. koreicus distribution in Italy details the
expansion of this mosquito into the territory, and refers to its adaptation to
mountainous areas previously spared the invasion of Ae. albopictus [15]. Ae. koreicus
seems to not compete with Ae. albopictus in areas of sympatry, and the presence of the
latter therefore seems unlikely to have an impact in containing the spread of Ae.
koreicus. In most cases in the field, Ae. koreicus larvae are found alone and adults of
this species develop earlier compared to Ae. albopictus in areas were populations
overlap [14, 298]. This scenario is similar to that which occurred in the case of Ae.
japonicus in the United States [299, 300] and may facilitate the invasion success of
Ae. koreicus in Europe. Moreover, larval competition between the two species in
laboratory studies is reportedly very weak, reducing Ae. koreicus survivorship only in
one case, in 20 Ae. albopictus:10 Ae. koreicus combinations, at low level diet;
however, the surviving Ae. koreicus developed faster and were bigger [203].
Chapter 5: Characterisation of key aspects of Ae. koreicus mating biology 91
In the preliminary study exploring Ae. koreicus and Ae. albopictus mating
interaction, Ae. albopictus males showed repeated and aggressive mating attempts
towards Ae. koreicus, but were unable to transfer sperm to Ae. koreicus. The different
sizes of the two species might be one explanation for how this has played a role in the
outcome of this experiment. This might be ascribed to the different temperature of
larval rearing (27°C for Ae. albopictus and 23°C for Ae. koreicus). Low rearing
temperatures generally yield adults of bigger sizes [301]. Yet, the lack of sperm does
not necessarily exclude a satyrization effect produced by Ae. albopictus males, due to
the fact that transfer of male accessory glands products (responsible for the satyrization
effect) may occur even in the absence of sperm in the spermathaecae, as demonstrated
by Carrasquilla and Lounibos [2]. Although satyrization between these two species
seems unlikely, the aggressive mating attempts shown by Ae. albopictus males towards
Ae. koreicus females could prevent less aggressive Ae. koreicus males from mating,
and therefore lead to a decrease in Ae. koreicus population. Moreover, these
continuous interaction attempts by Ae. albopictus males could interfere with the
feeding behaviour of Ae. koreicus females, as already demonstrated in the case of Ae.
aegypti [6].
Wolbachia was not detected in Ae. koreicus from the established field population
in Belluno from which the studied colony was derived; thus, the endosymbiont is not
affecting Ae. koreicus reproductive behaviour, nor the mosquitos’ ability to transmit
viruses through its pathogen-blocking action [302-305].
Chapter 6: Vector competence of Ae. koreicus for chikungunya virus 92
Chapter 6: Vector competence of Ae.
koreicus for chikungunya virus
6.1 INTRODUCTION
The vectorial capacity and vector competence of Ae. koreicus are largely
unknown. The species is known to vector dog heartworm Dirofilaria immitis under
laboratory conditions [154, 155]; however, this finding is not supported by field
evidence [156]. Ae. koreicus infection with Wuchereria bancrofti has also been
documented [153], and this mosquito may have a role as an intermediate host for
Brugia malayi to infect humans [158]. Few studies have mentioned Ae. koreicus’
ability to transmit JEV in the laboratory and in the field [123, 140, 152]; however, JEV
was not detected in Ae. koreicus collected in Korea during more recent monitoring
activities [147-149].
Vector competence is defined as the ability of a vector to transmit a pathogen (in
this case an arbovirus) to another susceptible host [23]. It is determined largely by the
ability of wild mosquitoes to acquire and transmit a virus in the field. This is influenced
by the ecology and behaviour of the mosquito (i.e., the probability of biting an infected
host) and the ability of the mosquito to incubate and then transmit that virus to another
host. [42].
The vectorial capacity model applied by Reisen [306] to describe arbovirus
transmission is expressed by the equation:
𝐶 =𝑚𝑎2𝑉𝑝𝑛
− l𝑛 𝑝
where C is the number of new infections of a mosquito-borne pathogen disseminated
by a mosquito feeding on a single infected case per day, m is the number of female
Chapter 6: Vector competence of Ae. koreicus for chikungunya virus 93
mosquitoes per person, a is the proportion of blood-meals taken from humans, V is the
vector competence (or the proportion of female mosquitoes feeding on an infected host
that subsequently transmit a pathogen to a secondary host), p is the daily survival rate
of the vector population, and n is the extrinsic incubation period (EIP) of the parasite
in the vector (the number of days between a mosquito's infection and when it can
transmit a pathogen [307]). In this equation the interaction between vectors and viruses
is represented by two parameters, the vector competence (V) and extrinsic incubation
period (n).
Temperature is known to greatly affect virus-vector interactions. Different
temperature regimens may affect the EIP [308-310], viruses infection, and viral
dissemination to different tissues [311]. Many of the studies published in the literature
were performed under constant temperature [125, 312-317], although this does not
reflect conditions in nature, where temperatures are subjected to daily fluctuations.
This study tested the ability of Ae. koreicus to feed under artificial conditions,
the survivorship rate of this species after artificial feeding, and the likelihood of Ae.
koreicus to transmit CHIKV ‘La Reunion’ under constant and fluctuating temperature
regimes in the laboratory.
This variant of CHIKV, more adapted to the infection of Ae. albopictus, was
chosen because, until 2017, the largest outbreaks of CHIKV in Europe were caused by
strains belonging to the same clade [25]. The fluctuating temperatures mimicked those
occurring during a typical summer in Belluno, Italy, an area where there are
established and thriving populations of the Ae. koreicus mosquito. This temperature
regimen was introduced to aid the transposition of the experimental results to the ‘real
world’.
Chapter 6: Vector competence of Ae. koreicus for chikungunya virus 94
The model employed to perform the vector competence experiments under
quarantine conditions in the QC3 security level laboratories was based on a
preliminary experimental protocol established utilising Ae. albopictus mosquitoes
from the quarantine colony already established at QIMR Berghofer Insectary QC2
facility (Appendix I).
6.2 METHODS
6.2.1 Ae. koreicus feeding through a porcine intestinal membrane with
defibrinated sheep blood
Ae. koreicus feeding through a porcine intestinal membrane was performed to
test the percentage of mosquitoes feeding and surviving in order to design future vector
competence studies. Mosquitoes obtained at QIMR Berghofer Insectary were blood
fed following the same protocol applied for Ae. albopictus. A Petri® dish containing
dry ice was added near the feeding cups to produce CO2 to increase the feeding rate
(Figure 6.1).
Chapter 6: Vector competence of Ae. koreicus for chikungunya virus 95
Figure 6.1 Apparatus used to feed Ae. koreicus
6.2.2 Experimental infection of Ae. koreicus with CHIKV ‘La Reunion’
Mosquitoes sourced from Belluno were reared in the quarantine insectary at
QIMR Berghofer Medical Research Institute (QIMR Berghofer) as per Ciocchetta et
al. [281]. Infected Ae. albopictus mosquitoes sourced from Hammond Island, Torres
Strait (Australia) (also reared at QIMR Berghofer: Hugo et al. [70]) were used as
validation of the infection technique. Ae. albopictus are known to be susceptible and
easily infected with CHIKV ‘La Reunion’ [318, 319]. Mosquito infection and sample
processing were performed in a biosafety level 3 quarantine facility at QIMR
Berghofer.
After a 24-hour starvation period (in which the standard 10% w/v sucrose
solution was substituted with distilled water only), 342 adult female mosquitoes that
were three to five days old were transferred to 750 ml plastic containers (ca. 100
Chapter 6: Vector competence of Ae. koreicus for chikungunya virus 96
individuals per container) covered with gauze lids. The mosquitoes were allowed to
feed for one hour through glass membrane feeders (37°C) covered by a porcine
intestinal membrane filled with an infectious blood meal [235]. The infectious blood
meal was obtained by adding 1 ml of stock virus CHIKV ‘La Reunion’ strain (LR2006-
OPY1; GenBank KT449801 [320]) to 24 mL of defibrinated sheep blood (Life
Technologies, Mulgrave, VIC, Australia) at a final titre of 108 TCID50/mL. TCID50 is
the dilution ratio of the virus required to cause 50% mortality of cells used as a
substrate for inoculation: in this experiment these were C6/36 Ae. albopictus cells. The
infectious blood meal was sampled before and after feeding to ensure that there was
no degradation of virus titre over the feeding period. During feeding, a tube containing
dry ice generated a small amount of CO2 to encourage feeding activity (Ciocchetta,
unpublished observations). After feeding, mosquitoes were anesthetised with CO2 and
sorted on a cold Petri® dish. Males and non-engorged females were discarded.
Engorged females were transferred to a fresh container and maintained for 14 days in
environmental chambers (Panasonic, Osaka, Japan) at two temperature regimes: 1)
constant temperature of 23°C, with a 12 hour light:12 hour dark cycle and 75 ± 5%
relative humidity; 2) fluctuating temperature based on the average temperatures
registered during summer in Belluno (Italy) (Table 6.1) (data from Belluno Airport
Meteorological Station, code 264, 46°42′00″N-12°07′48″E, May to October 2011-
2014 [321]). Mosquitoes were kept under a 12-hour light:12-hour dark cycle and 75 ±
5% relative humidity. Mosquitoes were provided with 10% w/v sucrose ad libitum
during the holding period.
At three, 10, and 14 days post-feeding, Ae koreicus females were anesthetised
using CO2, and dissected (25 mosquitoes per each day). The Ae. albopictus controls
were included to validate the infection technique and were maintained at the constant
Chapter 6: Vector competence of Ae. koreicus for chikungunya virus 97
temperature regimen. Dissection occurred at day 10 only. Mosquitoes were dissected
and allowed to salivate for 20 minutes in collecting medium (RPMI 1640, 2% v/v
Foetal Bovine Serum (FBS), 1% v/v Penicillin-streptomycin, 0.25 μg/ml
Amphotericin B) (Gibco; Thermo Scientific, Waltham, MA, USA) as described in
Appendix I [322] before being stored at -80°C. The body and wings/legs and saliva of
each mosquito were placed in separate tubes (Appendix I). All samples were stored at
-80°C until processing.
Each mosquito body was placed in collecting medium, homogenised and
inoculated onto C6/36 cells cultured in 5% CO2 atmosphere at 27°C [319]. Wings and
legs were combined and processed in the same way as the body. Inoculations with
saliva and infected blood followed the same procedure, with the exception of the initial
homogenisation step: 10µL of collecting medium with the mosquito saliva were
directly inoculated to the plates after thawing. After a three-day incubation period, all
plates were assayed using the ELISA technique described in Appendix I. Detection of
CHIKV was performed using in house monoclonal antibodies (Hybridoma, clone D7)
that were diluted 1:200 in blocking buffer, with 50 µL added to each well. Cells
infected with CHIKV ‘La Reunion’ provided a positive control for the assay. The final
chromogenic substrate added to the plates consisted of 50µL/well of TMB (3,3′,5,5′-
Tetramethylbenzidine Substrate System, Sigma-Aldrich®). The plates were then
incubated in the dark for 30 minutes. A 50µL/well stop solution (Stop Reagent for
TMB Substrate, Sigma-Aldrich®) was added and the absorbency at 450 nm was
measured in a microplate reader (BioTek™ Synergy™ H4 Hybrid Microplate Reader).
Wells were scored as positive for virus when the optical density (OD) was greater than
twice the mean OD of the uninfected control wells [314]. The virus titres of individual
mosquitoes were determined by calculating 50% end points [323] expressed as the
Chapter 6: Vector competence of Ae. koreicus for chikungunya virus 98
log10 TCID50/mL. CHIKV ‘La Reunion’ infection was first tested in mosquito bodies.
Wings, legs, and saliva were processed only if the body samples were positive for the
virus.
Table 6.1 Daily fluctuating temperature regime under which Ae. koreicus was
maintained (75 ± 5% relative humidity, 12-hour light:12-hour dark cycle).
Phase Degrees (°C) Light step (Illuminance)
1 (0.15 h) 12 1 (1,667 Lx)
2 (0.15 h) 12 2 (3,334 Lx)
3 (2.30 h) 12 3 (5,000 Lx)
4 (3 h) 17 3 (5,000 Lx)
5 (3 h) 22 3 (5,000 Lx)
6 (2.30 h) 27 3 (5,000 Lx)
7 (0.15 h) 27 2 (3,334 Lx)
8 (0.15 h) 27 1 (1,667 Lx)
9 (3 h) 27 0 (0 Lx)
10 (3 h) 22 0 (0 Lx)
11 (3 h) 17 0 (0 Lx)
12 (3 h) 12 0 (0 Lx)
6.3 RESULTS
6.3.1 Ae. koreicus feeding through a porcine intestinal membrane with
defibrinated sheep blood
The preliminary artificial feeding of Ae. koreicus with defibrinated sheep blood
lead to 47.7% of mosquitoes fed (n=287). After six days, the percentage of mosquitoes
surviving was 98.5% (n=137).
6.3.2 Experimental infection of Ae. koreicus with CHIKV ‘La Reunion’
All Ae. albopictus (n=4) were positive for CHIKV at values consistent with
previous experiments (106 TCID50/mL, n=1; 106.5 TCID50/mL, n=3) [319] (Figure 6.2).
Chapter 6: Vector competence of Ae. koreicus for chikungunya virus 99
This expected result indicated that the infection protocols were robust. Ae. koreicus
demonstrated a high survivorship after 14 days at both constant and fluctuating
temperatures (95.8%, n=71; 98.1%, n=53) and high feeding rates (65.5%, n=342).
Virus titres in the blood before and after the feeding period (1 hour) were: 108
TCID50/mL and 106.5 TCID50/mL, respectively. Despite these very favourable
infection conditions, CHIKV ‘La Reunion’ was subsequently detected in a very small
percentage of mosquito bodies: in mosquitoes maintained at 23°C, positive bodies
were 13.8% (n=65), while in mosquitoes maintained at the fluctuating regimen, this
percentage was only 6.2% (n=64). Titres ranged from 102 -104.5 TCID50/mL (at 23°C)
and 102 -102.5 TCID50/mL (at the fluctuating temperature) (Figure 6.2).
Dissemination to wings and legs was observed in just four mosquitoes at days
three and 10 post-feeding (102 - 107 TCID50/mL, Figure 6.2) and salivary dissemination
occurred in two of those four individuals: 102.5 TCID50/mL at day three post-feeding
and 103 TCID50/mL at day 10 post-feeding (Figure 6.2). CHIKV ‘La Reunion’
disseminated to the wings and legs and reached the saliva of Ae. koreicus only when
held at a constant temperature (Table 6.2).
Chapter 6: Vector competence of Ae. koreicus for chikungunya virus 100
Table 6.2 CHIKV ‘La Reunion’ infection and dissemination to the wings/legs and saliva in Ae. koreicus mosquitoes maintained at 23oC and
fluctuating temperature (75 ± 5% relative humidity, 12-hour light:12-hour dark cycle).
Treatment Days post feeding N. engorged mosquitoes N. infected (n. tested) N. with virus in
wings/legs (n tested)
N. with virus in
saliva (n. tested)
23 °C 3 21 3 (21) 2 (3) 1 (3)
10 19 3 (19) 2 (3) 1 (3)
14 25 3 (25) 0 (3) 0 (3)
Fluctuating 3 21 4 (21) 0 (4) 0 (4)
T °C 10 21 0 (21) NT* NT*
14 22 0 (22) NT* NT*
NT*= Not tested as bodies were negative
Chapter 6: Vector competence of Ae. koreicus for chikungunya virus 101
Figure 6.2 Titres of CHIKV ‘La Reunion’ in Ae. koreicus measured three, 10, and 14 days post-feeding in mosquitoes at 23°C and at fluctuating
temperature (75 ± 5% relative humidity, 12 hour light: 12 hour dark cycle). The validation of the technique, using a small number of Ae.
albopictus, is also shown.
Chapter 6: Vector competence of Ae. koreicus for chikungunya virus 102
6.4 DISCUSSION AND CONCLUSION
Effective feeding of mosquitoes under artificial conditions is essential to the
success of vector competence studies. When the feeding behaviour of Ae. koreicus
under experimental condition was evaluated, this species proved to be highly suitable
for vector competence studies due to the high percentage of fed females obtained and
the relatively long lifespan. This favourable result was facilitated by the introduction
of a CO2 source during feeding, a tool often utilised in the trapping of host seeking
mosquitoes [324].
The difference in infection and dissemination between temperature treatments
when the mosquitoes were infected with CHIKV may have resulted from either the
temperature fluctuation itself, or the difference in mean temperature (19.5°C in the
case of the fluctuating regime). Although mosquitoes were not held at a
constant 19.5°C to compare, it is hypothesised that the difference arose from the
temperature fluctuation itself. For example, Zouache et al. [325] investigated the
infection of Ae. albopictus and dissemination to salivary glands by a CHIKV strain
isolated from Reunion (E1-226V mutation) at day six post-exposure. Their
experiments, conducted at 20 and 28°C, showed that salivary dissemination rates were
similar at both temperatures [325]. Whatever the cause, it is clear that artificially
constant temperatures (23°C) yield different results to experiments that reflect ‘real
world’ temperature fluctuations.
In some instances, fluctuation at low temperatures can even shorten the EIP
(estimated in experimental studies as the time the virus is first detected in the salivary
glands). For example, for DENV 1 in Ae. aegypti [326], large fluctuation (18.6°C) at
a mean of 20°C is shown to reduce the EIP50 (defined in this study as the ‘time taken
for 50% of infected individuals to complete the EIP’) by approximately 36%, from
Chapter 6: Vector competence of Ae. koreicus for chikungunya virus 103
29.6 to 18.9 days compared to a constant temperature of 20°C. The impact of
fluctuating temperatures on EIP has been relatively poorly studied compared to
constant temperatures, therefore a clear prediction was difficult to make a priori in
these experiments. Sampling at days 10 and 14 post infection was expected to provide
ample time for salivary dissemination to occur at both temperature regimens. No
dissemination was observed for the fluctuating temperature at any time point. The
virus did reach salivary glands in one mosquito at three days post virus exposure when
held at a constant temperature.
Ae. aegypti and Ae. albopictus are the main vectors of CHIKV [327-332] with
Ae. albopictus being responsible for all CHIKV outbreaks in Europe [29, 333-336].
The average temperature in European cities experiencing CHIKV outbreaks is 20°C
or above [334], although maximum transmission potential is realised between 26–
29°C [337]. A number of other Aedes species are effective vectors of CHIKV under
laboratory conditions. CHIKV E1-A226V (the same mutation exhibited by the strain
used in this study) has been found to disseminate to the saliva of Aedes vigilax, Aedes
procax, and Aedes notoscriptus from Australia at rates ranging from 20% to 76% [312]
and to Ae. japonicus [125]. The latter species is phylogenetically close to Ae. koreicus
and showed a rate of 38.5% salivary dissemination of CHIKV [161, 234] at 14 days
post exposure, after incubation at 28°C. Consistent with this, Ae. koreicus also showed
vector potential under laboratory conditions. Its increasing range in Italy (Figure 1.3),
its human biting habit in some environments [126], and its capacity to incubate CHIKV
in its salivary glands after just three days suggests that the possibility of CHIKV
transmission by this species should not be disregarded.
These results indicate that only a small proportion of Ae. koreicus from the
studied laboratory colony could vector CHIKV under optimal rearing temperatures.
Chapter 6: Vector competence of Ae. koreicus for chikungunya virus 104
No impact was found on Ae. koreicus survival when simulating ‘real world’
temperature fluctuations typical of northern Italy; however, an even smaller number
of mosquitoes showed CHIKV infection and no virus was detected in the saliva. It
appears that realistic temperature fluctuations may mitigate the risks of transmission.
This is consistent with studies on dengue virus, in which mosquitoes exposed to
constant temperatures showed higher midgut infection levels [311] and higher
dissemination [338] rates compared with mosquitoes maintained at fluctuating
temperatures. A statistical comparison of the data for the two different temperature
regimens was not possible due to the low number of positive samples; however, the
results stress the importance of introducing ‘real world’ conditions when evaluating
transmission risks.
Relative humidity was a constant parameter in the temperature regimens used in
this study, although it may also be a variable that could affect Ae. koreicus vector
competence. It is therefore recommended that further studies also mimic the relative
humidity fluctuations that may impact virus dynamics and mosquito survival in the
field [339].
Chapter 7: Concluding discussion 105
Chapter 7: Concluding discussion
Ae. koreicus has shown its invasive potential in Europe over the past decade,
having extended its geographic range to several other countries [167, 169-172, 340]
since its initial discovery in Belgium in 2008 [167]. Despite this invasion, the ecology,
life history traits, and mating behaviour of this mosquito remain largely unknown. No
information has been reported regarding the potential for Ae. koreicus to vector
arboviruses, with the exception of early and limited observations on Japanese
encephalitis virus [123, 140, 152]. The data presented in this thesis elucidates some
of the biology of this mosquito and its capacity to vector human pathogenic viruses,
and also provides the first indication of susceptibility of Ae. koreicus to infection with
CHIKV, allowing better understanding of the public health risk this mosquito poses.
North-eastern Italy currently hosts the biggest established population of Ae.
koreicus in the European Union, with most of the municipality in the Veneto Region
already colonised [18]. However, the invasive ability of the mosquito necessitates
evaluation of effective surveillance techniques for the development of monitoring
programs in the field. With ovitraps showing limited utility for the collection of Ae.
koreicus eggs [179], the efficacy of additional tools such as BG-Sentinel, CO2, gravid
traps, and human landing catches was tested. None of these trapping tools returned
high numbers of Ae. koreicus, either in rural or urban settings. However, BG-Sentinel
traps baited with lure and CO2 captured the highest number of Ae. koreicus. The recent
establishment of the species in the study area [14] and the unfavourable weather
conditions during the sampling period (low temperatures and frequent precipitation)
may have negatively impacted the number of samples captured. The ability of the BG-
Sentinels baited with lure and CO2 to capture Ae. koreicus, even in conditions of low
Chapter 7: Concluding discussion 106
densities, may be some measure of the efficiency of this trap. The human landing
experiment demonstrated that host-seeking Ae. koreicus feed on humans during the
late afternoon and evening. This species could therefore become a nuisance for the
population living in the area and impact on outdoor behaviours.
Ae. koreicus proved to be suitable for laboratory colonisation at the QIMR
Berghofer Quarantine Insectary. The mosquito develops at a lower temperature
compared to the closely related Ae. japonicus [233] and to other Aedes species
colonised at the QIMR Berghofer Insectary (Ae. aegypti and Ae. albopictus, both
reared at 27°C). The rearing temperature of 23°C may also explain its long gonotrophic
cycle [246]. Low but continuous hatching may represent an adaptive strategy
favouring the survival of Ae. koreicus at lower temperatures compared to Ae.
albopictus, and its presence in mountainous areas. The description of the sexual
dimorphism in Ae. koreicus pupae and the method of creating virgin cohorts of
individuals allowed for the evaluation of the species’ fecundity-size relationship and
reproductive behaviour. These results will facilitate further investigations into the
ecology, competition, and vectorial capacity of Ae. koreicus in laboratory and field
studies.
Prior to the work presented here, very little was known about the reproductive
biology of Ae. koreicus. Autogeny was not detected in the colony at QIMR Berghofer.
Observations of successful mating (validated by presence of sperm in Ae. koreicus
female spermathecae) confirmed that this was not due to a lack of mosquito mating
under laboratory conditions [271, 272]. These findings suggest that Ae. koreicus likely
does not display this phenotype, although different populations of the same mosquito
species can exhibit an autogenic phenotype when exposed to different environments
[268]. The observations of Ae. koreicus and Ae. albopictus reproductive interactions
Chapter 7: Concluding discussion 107
provide the first indications of possible mating interference between these species. The
distribution of Ae. koreicus often overlaps with Ae. albopictus in northern Italy. Ae.
albopictus males display aggressive mating behaviour and are known to mate with
females of other species to sterilise them (satyrization) [3]. The experiment in this
study explored the willingness of Ae. albopictus males to copulate with Ae. koreicus
females, and the receptiveness of Ae. koreicus females to interspecific mating.
Although repeated insemination attempts by Ae. albopictus males were observed, no
sperm was transferred to Ae. koreicus females spermathecae. This might be a result of
the different sizes between the two species, as Ae. albopictus males are significantly
smaller than Ae. koreicus females. Further experiments are required to clarify whether
satyrization could occur between Ae. koreicus males and Ae. albopictus females.
A key aspect that could potentially influence Ae. koreicus reproduction and
vectorial capacity is the presence of the endosymbiont Wolbachia pipientis in
populations of Ae. koreicus. Transinfection of mosquitoes with one strain of
Wolbachia (wMelPop) has been proposed for arbovirus biocontrol due to its pathogen-
blocking activity [302-305, 341, 342]. This form of biocontrol could be applied to
reduce the vectorial capacity of Ae. koreicus in the field if the mosquito was proven to
be naturally Wolbachia-free. However, there was no evidence of Wolbachia in the
samples collected during the 2014 field activities.
An additional outcome of this study was the validation of primers targeting the
housekeeping gene RpS17 (designed based on the reference gene of Ae. aegypti [285])
for use in Ae. koreicus, a species for which genomic information is extremely limited.
The primers can now serve as a positive reference to test the quality of the genetic
material extractions and during gene expression studies.
Chapter 7: Concluding discussion 108
Some information exists regarding the ability of Ae. koreicus to transmit JEV
and the parasite Wuchereria bancrofti [123, 140, 152, 153]. More recently, a study
confirmed the possibility of Ae. koreicus acting as a vector for a parasitic worm
Dirofilaria immitis [154, 155]. Using the information on Ae. koreicus development
time and percentage of hatching obtained from the colony in this study, a protocol was
designed to test the vector competence of Ae. koreicus for a major arbovirus threat to
Europe. Mosquitoes were challenged with CHIKV ‘La Reunion’ at high virus titres,
and maintained at 23°C, as well as a fluctuating temperature close to the climatic
conditions of the established population of Ae. koreicus in Italy. This virus strain (a
variant of CHIKV more adapted to the infection of Ae. albopictus) was chosen
because, until 2017, the largest outbreaks of CHIKV in Europe were caused by strains
belonging the same clade [25]. Virus was detected in the saliva of just two out of 65
(3.1%) exposed mosquitoes from the experimental group maintained at 23°C, one at
three and one at ten days post-feeding. No dissemination of the virus to wings, legs, or
saliva was noted under the fluctuating temperature regime. Infection of Ae. koreicus
indicates that a very small proportion of exposed mosquitoes will vector CHIKV.
When simulating real world temperatures in northern Italy, an even smaller proportion
of mosquitoes showed CHIKV infection, and no virus was detected in the saliva. These
results suggest that ‘real world’ temperature fluctuations may further mitigate the risk
of arbovirus transmission.
Temperature is known to affect both the EIP (arrival of virus in the salivary
glands) and the proportion of infected mosquitoes following virus ingestion.
Carrington et al. (2013) recently demonstrated that large temperature fluctuations
(18.6°C) at a low mean temperature (20°C) shortened the EIP in Ae. aegypti infected
with DENV 1 [326]. Large daily fluctuations (26 ± 8°C) also reduced DENV 1 and
Chapter 7: Concluding discussion 109
DENV 2 midgut infection in Ae. aegypti from two Thailand provinces, with results
similar between mosquito populations and DENV strains [311].
In the current study, the EIP of mosquitoes maintained at 23°C was only three
days. However, when mosquitoes were maintained at a fluctuating temperature, the
virus was not detected in the saliva, suggesting that fluctuating temperatures may
lengthen EIPs in Ae. koreicus.
Similar to the results found in this study, Ae. aegypti exposed to DENV at
constant temperatures have shown a higher rate of midgut infection [311] and higher
salivary dissemination rates compared to mosquitoes maintained at fluctuating diurnal
temperatures [338].
Temperature fluctuations can have mixed effects on EIP and infection rates,
depending on the species studied. Alto et al. (2017) found that the degree of
temperature fluctuation mattered to infection outcome in populations of Ae. albopictus
and Ae. aegypti from several geographical areas in Florida and infected with an Asian
strain of CHIKV. A fluctuation in temperature of 8°C led to higher viral dissemination
in Ae. Aegypti, but significantly lowered dissemination in Ae. albopictus. However, a
constant temperature (27°C) and low temperature variations (fluctuating range of 4°C)
did not have any effect on virus dissemination and salivary infection. Moreover,
mosquitoes from populations in other geographic areas showed minimal changes in
infection rates when exposed to the same fluctuation ranges [343]. The current study
only investigated Ae. koreicus populations from Italy, and populations established
elsewhere could be impacted differently by CHIKV infection when exposed to
fluctuating temperatures. The physiological mechanisms driving the differences
observed between constant and fluctuating temperatures remain to be elucidated but
may include differential expression of RNAi pathway under cold temperatures [344].
Chapter 7: Concluding discussion 110
Regardless of the biological basis, the results of this study stress the importance of
introducing real world conditions when evaluating transmission risks. These results
indicate that transmission of CHIKV ‘La Reunion’ strain by Ae. koreicus in temperate
areas is possible, but unlikely.
The results presented here suggest that the risk of transmission of CHIKV ‘La
Reunion’ strain by Ae. koreicus is low in regions with temperatures similar to those
used in these experiments. The already low risk could be further mitigated by the low
abundance of Ae. koreicus in areas where this mosquito is now established and by its
biological characteristics. The duration of the gonotrophic cycle observed in the
laboratory at 23°C (up to 15 days from blood meal to oviposition) suggests a long
interval between subsequent feedings on hosts for Ae. koreicus in the field in northern
Italy (average summer temperature of 19.4°C). Even under a scenario of rapid CHIKV
dissemination to Ae. koreicus saliva at 23°C, the risk of Ae. koreicus engaging in
subsequent feeding three days after a blood meal is low. Conversely, Myles et al. [345]
showed that low vector competence (as low as 1% of infected mosquitoes) coupled
with a high population survival (as shown in these experiments) will lead to higher
vectorial capacity compared to species with high vector competence but where the
virus negatively impacts mosquito survivorship.
The persistence of Ae. koreicus in already invaded geographic areas is likely to
continue, facilitated by its continual spread [167, 169-172, 340], adaptation to low
temperature climates [18, 127] enabled by strategies such as embryo dormancy and
potential resistance to satyrization by Ae. albopictus. Overall, considering
spatial/temporal niche segregation from Ae. albopictus [127] and weak larval
competition between species [203], these results suggest that Ae. albopictus and Ae.
koreicus are not likely to displace each other.
Chapter 7: Concluding discussion 111
In conclusion, this thesis delivers novel information about Ae. koreicus, by:
• providing an assessment of the strengths and weaknesses of available
mosquito trapping methods when used to target the mosquito;
• confirming the anthropophilic behaviour of the species;
• providing the first guideline for laboratory rearing;
• establishing key biological aspects of laboratory reared mosquitoes, such as
a long gonotrophic cycle, unusually low hatching percentage, a clear
fecundity-size relationship, lack of autogeny, and the absence of Wolbachia
endosymbiont;
• illustrating an easily implemented method for pupal sex differentiation to
create virgin mosquito cohorts for further studies;
• offering a protocol to evaluate vector competence for arboviruses; and
• providing the first evidence of rapid salivary dissemination of CHIKV in a
small proportion of mosquito females.
These findings aid to define the relative public health risks of Ae. koreicus
invasion in comparison with the existing threats posed by Ae. albopictus and will guide
efforts directed at surveillance and/or control initiatives.
References 112
References
1. Edwards F. Notes on Culicidae, with descriptions of new species. Bull Entomol
Res. 1917;7(3):201-229.
2. Carrasquilla MC, Lounibos LP. Satyrization without evidence of successful
insemination from interspecific mating between invasive mosquitoes. Biol Lett.
2015;11(9):20150527.
3. Bargielowski IE, Lounibos LP. Satyrization and satyrization‐resistance in
competitive displacements of invasive mosquito species. Insect Sci.
2016;23(2):162-174.
4. Bargielowski I, Lounibos LP. Rapid evolution of reduced receptivity to
interspecific mating in the dengue vector Aedes aegypti in response to
satyrization by invasive Aedes albopictus. Evol Ecol. 2014;28(1):193-203.
5. Tripet F, Lounibos LP, Robbins D, et al. Competitive reduction by satyrization?
Evidence for interspecific mating in nature and asymmetric reproductive
competition between invasive mosquito vectors. Am J Trop Med Hyg.
2011;85(2):265.
6. Soghigian J, Gibbs K, Stanton A, et al. Sexual harassment and feeding inhibition
between two invasive dengue vectors. Environ Health Insights. 2014;8(Suppl
2):61.
7. Meyerson LA, Mooney HA. Invasive alien species in an era of globalization.
Front Ecol Environ. 2007;5(4):199-208.
8. Hulme PE. Biological invasions in Europe: drivers, pressures, states, impacts
and responses. Biodiversity under threat. Hester R and Harrison RM (Eds).
Cambridge, UK: Cambridge University Press; 2007. p. 56-80.
9. Early R, Bradley BA, Dukes JS, et al. Global threats from invasive alien species
in the twenty-first century and national response capacities. Nat Commun.
2016;7.
10. Rabitsch W, Essl F, Schindler S. The rise of non-native vectors and reservoirs of
human diseases. Impact of Biological Invasions on Ecosystem Services:
Springer; 2017. p. 263-275.
11. Juliano SA, Philip Lounibos L. Ecology of invasive mosquitoes: effects on
resident species and on human health. Ecol Lett. 2005;8(5):558-574.
12. Capelli G, Mathis A, Di Luca M, et al. First report in Italy of the exotic
mosquito species Aedes (Finlaya) koreicus, a potential vector of arboviruses and
filariae. Parasit Vectors. 2011;4(1):188-188.
13. ARPAV. Dipartimento Regionale per la Sicurezza del Territorio Servizio
Meteorologico [Regional Department for Territory Security Meteorological
Service][Internet] Italy: Agenzia Regionale per la Prevenzione e Protezione
References 113
Ambientale del Veneto; 2011 [cited 2018 29 Jan]; [about 3 screens]. Available
from: www.arpa.veneto.it/bollettini/storico/2011/0264_2011_TEMP.htm
14. Montarsi F, Ravagnan S, Ciocchetta S, et al. Distribution and habitat
characterization of the recently introduced invasive mosquito Aedes koreicus
[Hulecoeteomyia koreica], a new potential vector and pest in north-eastern Italy.
Parasit Vectors. 2013;6(1):292-292.
15. Marcantonio M, Metz M, Baldacchino F, et al. First assessment of potential
distribution and dispersal capacity of the emerging invasive mosquito Aedes
koreicus in Northeast Italy. Parasit Vectors. 2016;9(1):1.
16. Ciocchetta S, Martini S, Drago A, et al., editors. Status of Asian tiger mosquito
(Aedes albopictus) population in areas of North Eastern Italy recently colonized.
11th Arbovirus Research in Australia and the 10th Mosquito Control
Association of Australia Symposium 2012; Surfers Paradise, Queensland,
Australia.
17. Mazzucato M, cartographer. Spread of Ae. koreicus and Ae. albopictus in Italy
between 2011 and 2014 [map]. Italy: GIS office database, IZS Ve; 2014. 1
sheet; 11.27 X 15.92 cm; color.
18. Montarsi F, Drago A, Martini S, et al. Current distribution of the invasive
mosquito species, Aedes koreicus [Hulecoeteomyia koreica] in northern Italy.
Parasit Vectors. 2015;8(1):1-5.
19. Mazzucato M, cartographer. Map of municipalities infested with Ae. koreicus
and Ae. albopictus in northern Italy, 2011–2015 Italy: GIS office database, IZS
Ve; 2015. 1 sheet; 13.36 x 18.86 cm; color.
20. Mazzucato M, cartographer. Municipalities infested with Ae. koreicus, Ae.
albopictus and Ae. japonicus in northern Italy, 2017. Italy: GIS office database,
IZS Ve; 2017. 1 sheet; 9.64 x 13.64 cm; color.
21. Halasa YA, Shepard DS, Fonseca DM, et al. Quantifying the impact of
mosquitoes on quality of life and enjoyment of yard and porch activities in New
Jersey. PLoS One. 2014;9(3):e89221.
22. Tomasello D, Schlagenhauf P. Chikungunya and dengue autochthonous cases in
Europe, 2007–2012. Travel Med Infect Dis. 2013;11(5):274-284.
23. Allaby M. A dictionary of ecology. Oxford University Press; 2010.
24. Hardy JL, Houk EJ, Kramer LD, et al. Intrinsic factors affecting vector
competence of mosquitoes for arboviruses. Annu Rev Entomol. 1983;28(1):229-
262.
25. Amraoui F, Failloux A-B. Chikungunya: an unexpected emergence in Europe.
Curr Opin Virol. 2016;21:146-150.
26. Rezza G. Dengue and chikungunya: long-distance spread and outbreaks in naïve
areas. Pathog Glob Health. 2014;108(8):349-55.
27. Venturi G, Di Luca M, Fortuna C, et al. Detection of a chikungunya outbreak in
Central Italy, August to September 2017. Euro Surveill. 2017;22(39).
References 114
28. Angelini R, Finarelli A, Angelini P, et al. An outbreak of chikungunya fever in
the province of Ravenna, Italy. Euro Surveill. 2007;12(9):E070906.
29. Manica M, Guzzetta G, Poletti P, et al. Transmission dynamics of the ongoing
chikungunya outbreak in Central Italy: from coastal areas to the metropolitan
city of Rome, summer 2017. Euro Surveill. 2017;22(44).
30. Lounibos LP. Invasions by Insect Vectors of Human Disease. Annu Rev
Entomol. 2002;47(1):233-266.
31. Kraemer MU, Sinka ME, Duda KA, et al. The global distribution of the
arbovirus vectors Aedes aegypti and Ae. albopictus. Elife. 2015;4:e08347.
32. Kraemer MU, Sinka ME, Duda KA, et al. The global compendium of Aedes
aegypti and Ae. albopictus occurrence. Scientific Data. 2015;2:sdata201535.
33. ECDC. Aedes albopictus - Factsheet for experts[Internet] European Union:
European Centre for Disease Prevention and Control 2018 [updated 20 Dec
2016; cited 2018 Jan 29]; [about 3 screens]. Available from:
https://ecdc.europa.eu/en/disease-vectors/facts/mosquito-factsheets/aedes-
albopictus
34. Tabachnick WJ. Evolutionary Genetics and Arthropod-borne Disease: The
Yellow Fever Mosquito. Am Entomol. 1991;37(1):14-26.
35. Mattingly PF. Genetical aspects of the Aedes aegypti problem. I. Taxonom: and
bionomics. Ann Trop Med Parasitol. 1957 Dec;51(4):392-408.
36. Hahn MB, Eisen RJ, Eisen L, et al. Reported distribution of Aedes (Stegomyia)
aegypti and Aedes (Stegomyia) albopictus in the United States, 1995-2016
(Diptera: Culicidae). J Med Entomol. 2016;53(5):1169-1175.
37. Vasilakis N. Arboviruses. Caister Academic Press; 2016.
38. Bhatt S, Gething PW, Brady OJ, et al. The global distribution and burden of
dengue. Nature. 2013;496(7446):504-507.
39. Mackenzie JS, Gubler DJ, Petersen LR. Emerging flaviviruses: the spread and
resurgence of Japanese encephalitis, West Nile and dengue viruses. Nat Med.
2004;10:S98-S109.
40. Musso D, Gubler DJ. Zika virus. Clin Microbiol Rev. 2016;29(3):487-524.
41. Pialoux G, Gaüzère B-A, Jauréguiberry S, et al. Chikungunya, an epidemic
arbovirosis. Lancet Infect Dis. 2007;7(5):319-327.
42. Harley D, Sleigh A, Ritchie S. Ross River virus transmission, infection, and
disease: a cross-disciplinary review. Clin Microbiol Rev. 2001;14(4):909-932.
43. Jacups SP, Whelan PI, Currie BJ. Ross River virus and Barmah Forest virus
infections: A review of history, ecology, and predictive models, with
implications for tropical northern Australia. Vector Borne Zoonotic Dis.
2008;8(2):283-298.
44. Weaver SC, Ferro C, Barrera R, et al. Venezuelan equine encephalitis. Annu
Rev in Entomol. 2004;49(1):141-174.
References 115
45. Whitehead SS, Durbin AP, Pierce KK, et al. In a randomized trial, the live
attenuated tetravalent dengue vaccine TV003 is well-tolerated and highly
immunogenic in subjects with flavivirus exposure prior to vaccination. PLoS
Negl Trop Dis. 2017;11(5):e0005584.
46. Dans AL, Dans LF, Lansang MAD, et al. Review of a licensed dengue vaccine:
Inappropriate subgroup analyses and selective reporting may cause harm in
mass vaccination programs. J Clin Epidemiol. 2017.
47. Benelli G, Mehlhorn H. Declining malaria, rising of dengue and Zika virus:
insights for mosquito vector control. Parasitol Res. 2016;115(5):1747-1754.
48. Guzman MG, Gubler DJ, Izquierdo A, et al. Dengue infection. Nat Rev Dise
prime. 2016;2:16055.
49. Abajobir AA, Abate KH, Abbafati C, et al. Global, regional, and national
disability-adjusted life-years (DALYs) for 333 diseases and injuries and healthy
life expectancy (HALE) for 195 countries and territories, 1990–2016: a
systematic analysis for the Global Burden of Disease Study 2016. The Lancet.
2017;390(10100):1260-1344.
50. Wilder-Smith A, Quam M, Sessions O, et al. The 2012 dengue outbreak in
Madeira: Exploring the origins. Euro Survell. 2014;19(8):20718.
51. Giron S, Rizzi J, Leparc-Goffart I, et al. New occurrence of autochthonous cases
of dengue fever in Southeast France, August-September 2014. Bull Epidemiol
Hebd (Paris). 2015:13-14.
52. Dick G, Kitchen S, Haddow A. Zika virus (I). Isolations and serological
specificity. Trans R Soc Trop Med Hyg. 1952;46(5):509-520.
53. Faye O, Freire CC, Iamarino A, et al. Molecular evolution of Zika virus during
its emergence in the 20th century. PLoS Negl Trop Dis. 2014;8(1):e2636.
54. Duffy MR, Chen T-H, Hancock WT, et al. Zika virus outbreak on Yap Island,
federated states of Micronesia. N Engl J Med. 2009;360(24):2536-2543.
55. Weaver SC, Costa F, Garcia-Blanco MA, et al. Zika virus: History, emergence,
biology, and prospects for control. Antiviral Res. 2016;130:69-80.
56. de Melo Freire CC, Iamarino A, de Lima Neto DF, et al. Spread of the pandemic
Zika virus lineage is associated with NS1 codon usage adaptation in humans.
BioRxiv. 2015:032839.
57. Oehler E, Watrin L, Larre P, et al. Zika virus infection complicated by Guillain-
Barre syndrome–case report, French Polynesia, December 2013. Euro Surveill.
2014;19(9):20720.
58. Malinger G, Timor-Tritsch IE, Herrera M. Congenital Zika Virus Syndrome.
Obstetric Imaging: Fetal Diagnosis and Care (Second Edition): Elsevier; 2018.
p. 681-684. e1.
59. Roth A, Mercier A, Lepers C, et al. Concurrent outbreaks of dengue,
chikungunya and Zika virus infections–an unprecedented epidemic wave of
References 116
mosquito-borne viruses in the Pacific 2012–2014. Euro Surveill.
2014;19(41):20929.
60. Fauci AS, Morens DM. Zika virus in the Americas—yet another arbovirus
threat. N Engl J Med. 2016;374(7):601-604.
61. Plourde AR, Bloch EM. A literature review of Zika virus. Emerg Infect Dis.
2016;22(7):1185.
62. Couderc T, Lecuit M. Focus on Chikungunya pathophysiology in human and
animal models. Microbes Infect. 2009;11(14):1197-1205.
63. Volk SM, Chen R, Tsetsarkin KA, et al. Genome-scale phylogenetic analyses of
chikungunya virus reveal independent emergences of recent epidemics and
various evolutionary rates. J Virol. 2010;84(13):6497-6504.
64. Mason P, Haddow A. An epidemic of virus disease in Southern Province,
Tanganyika Territory, in 1952–1953: An additional note on Chikungunya virus
isolations and serum antibodies. Trans R Soc Trop Med Hyg. 1957;51(3):238-
240.
65. Carey DE. Chikungunya and dengue: A case of mistaken identity? J Hist Med
Allied Sci. 1971;26(3):243.
66. Powers AM, Logue CH. Changing patterns of chikungunya virus: Re-emergence
of a zoonotic arbovirus. J Gen Virol. 2007;88(9):2363-2377.
67. Nimmannitya S, Halstead SB, Cohen SN, et al. Dengue and chikungunya virus
infection in man in Thailand, 1962–1964. Am J Trop Med Hyg. 1969;18(6):954-
971.
68. Shah KV, Gibbs Jr C, Banerjee G. Virological investigation of the epidemic of
haemorrhagic fever in Calcutta: Isolation of three strains of Chikungunya Virus.
Indian J Med Res. 1964;52:676-683.
69. Myers R, Carey D, Reuben R, et al. The 1964 epidemic of dengue-like fever in
South India: Isolation of chikungunya virus from human sera and from
mosquitoes. Indian J Med Res. 1965;53(8).
70. Sergon K, Njuguna C, Kalani R, et al. Seroprevalence of chikungunya virus
(CHIKV) infection on Lamu Island, Kenya, October 2004. Am J Trop Med
Hyg. 2008;78(2):333-337.
71. Schwartz O, Albert ML. Biology and pathogenesis of chikungunya virus. Nat
Rev Microbiol. 2010;8(7):491-500.
72. Rezza G, Nicoletti L, Angelini R, et al. Infection with chikungunya virus in
Italy: An outbreak in a temperate region. The Lancet. 2007;370(9602):1840-
1846.
73. Ng LC, Hapuarachchi HC. Tracing the path of Chikungunya virus—evolution
and adaptation. Infect Genet Evol. 2010;10(7):876-885.
References 117
74. Njenga MK, Nderitu L, Ledermann J, et al. Tracking epidemic chikungunya
virus into the Indian Ocean from East Africa. J Gen Virol. 2008;89(11):2754-
2760.
75. Angelini P, Macini P, Finarelli A, et al. Chikungunya epidemic outbreak in
Emilia-Romagna (Italy) during summer 2007. Parassitologia. 2008;50(1-2):97-
98.
76. European Centre for Disease Prevention and Control. Cluster of autochtonous
chikungunya cases in France – 23 August 2017. Stockholm: ECDC. 2017.
77. Delisle E, Rousseau C, Broche B, et al. chikungunya outbreak in Montpellier,
France, September to October 2014. Euro Surveill. 2015;20(17):21108.
78. Gould E, Gallian P, De Lamballerie X, et al. First cases of autochthonous
dengue fever and chikungunya fever in France: From bad dream to reality! Clin
Microbiol Infect. 2010;16(12):1702-1704.
79. Mayer SV, Tesh RB, Vasilakis N. The emergence of arthropod-borne viral
diseases: A global prospective on dengue, chikungunya and zika fevers. Acta
Trop. 2017;166:155-163.
80. Kindhauser MK, Allen T, Frank V, et al. Zika: The origin and spread of a
mosquito-borne virus. Bull World Health Organ. 2016;94(9):675-686C.
81. Failloux A-B, Bouattour A, Faraj C, et al. Surveillance of arthropod-borne
viruses and their vectors in the Mediterranean and Black Sea Regions within the
MediLabSecure Network. Curr Trop Med Rep. 2017;4(1):27-39.
82. Guzman MG, Harris E. Dengue. Lancet. 2015 Jan 31;385(9966):453-65.
83. Theiler M, Casals J, Moutousses C. Etiology of the 1927-28 epidemic of dengue
in Greece. Proc Soc Exp Biol Med. 1960;103(1):244-246.
84. Holstein M. Dynamics of Aedes aegypti distribution, density and seasonal
prevalence in the Mediterranean area. Bull World Health Organ.
1967;36(4):541.
85. Lambrechts L, Scott TW, Gubler DJ. Consequences of the expanding global
distribution of Aedes albopictus for dengue virus transmission. PLoS Negl Trop
Dis. 2010;4(5):e646.
86. Hotta S. Dengue vector mosquitoes in Japan: The role of Aedes albopictus and
Aedes aegypti in the 1942-1944 dengue epidemics of Japanese Main Islands.
Med Entomol Zool. 1998;49:267-274.
87. Metselaar D, Grainger C, Oei K, et al. An outbreak of type 2 dengue fever in the
Seychelles, probably transmitted by Aedes albopictus (Skuse). Bull World
Health Organ. 1980;58(6):937.
88. Paupy C, Girod R, Salvan M, et al. Population structure of Aedes albopictus
from La Reunion Island (Indian Ocean) with respect to susceptibility to a
dengue virus. Heredity (Edinb). 2001;87(3):273-283.
References 118
89. Qiu F-X, Gubler DJ, Liu J-C, et al. Dengue in China: a clinical review. Bull
World Health Organ. 1993;71(3-4):349.
90. Almeida APG, Baptista SSSG, Sousa CAGC, et al. Bioecology and vectorial
capacity of Aedes albopictus (Diptera: Culicidae) in Macao, China, in relation to
dengue virus transmission. J Med Entomol. 2005;42(3):419-428.
91. Gubler DJ. Epidemic dengue and dengue hemorrhagic fever: A global public
health problem in the 21st century. Emerging infections 1: American Society of
Microbiology; 1998. p. 1-14.
92. Effler PV, Pang L, Kitsutani P, et al. Dengue fever, hawaii, 2001–2002. Emerg
Infect Dis. 2005;11(5):742.
93. Leroy EM, Nkoghe D, Ollomo B, et al. Concurrent chikungunya and dengue
virus infections during simultaneous outbreaks, Gabon, 2007. Emerg Infect Dis.
2009;15(4):591.
94. Issack MI, Pursem VN, Barkham TM, et al. Reemergence of dengue in
Mauritius. Emerg Infect Dis. 2010;16(4):716.
95. Olson J, Ksiazek T. Zika virus, a cause of fever in Central Java, Indonesia.
Trans R Soc Trop Med Hyg. 1981;75(3):389-393.
96. Grard G, Caron M, Mombo IM, et al. Zika virus in Gabon (Central Africa)–
2007: a new threat from Aedes albopictus? PLoS Negl Trop Dis.
2014;8(2):e2681.
97. Hawley WA, Reiter P, Copeland RS, et al. Aedes albopictus in North America:
Probable introduction in used tires from northern Asia. Science. 1987;236:1114-
1117.
98. Pless E, Gloria-Soria A, Evans BR, et al. Multiple introductions of the dengue
vector, Aedes aegypti, into California. PLoS Negl Trop Dis.
2017;11(8):e0005718.
99. Heitmann A, Jansen S, Lühken R, et al. Experimental transmission of Zika virus
by mosquitoes from central Europe. Euro Surveill. 2017;22(2).
100. Tsetsarkin KA, McGee CE, Volk SM, et al. Epistatic roles of E2 glycoprotein
mutations in adaption of chikungunya virus to Aedes albopictus and Ae. aegypti
mosquitoes. PLoS One. 2009;4(8):e6835.
101. Grandadam M, Caro V, Plumet S, et al. Chikungunya virus, southeastern
France. Emerg Infect Dis. 2011;17(5):910.
102. Calba C, Guerbois-Galla M, Franke F, et al. Preliminary report of an
autochthonous chikungunya outbreak in France, July to September 2017. Euro
Surveill. 2017;22(39).
103. Cella E, Riva E, Salemi M, et al. The new Chikungunya virus outbreak in Italy
possibly originated from a single introduction from Asia. Pathog Glob Health.
2017 (just-accepted):1-8.
References 119
104. Schaffner F, Medlock JM, Van Bortel W. Public health significance of invasive
mosquitoes in Europe. Clin Microbiol Infect. 2013;19(8):685-692.
105. Adhami J, Reiter P. Introduction and establishment of Aedes (Stegomyia)
albopictus skuse (Diptera: Culicidae) in Albania. J Am Mosq Control Assoc.
1998;14(3):340-343.
106. Sabatini A, Raineri V, Trovato G, et al. Aedes albopictus in Italy and possible
diffusion of the species into the Mediterranean area. Parassitologia.
1990;32(3):301-304.
107. Dalla Pozza G, Majori G. First record of Aedes albopictus establishment in Italy.
J Am Mosq Control Assoc. 1992;8(3):318-320.
108. Dutto M, Mosca A. Preliminary considerations about the presence of Aedes
albopictus (Skuse 1897)(Diptera: Culicidae) during winter in the Northwestern
Italy. Annali di Igiene: Medicina preventiva e di comunita’. 2017;29(1):86-90.
109. ECDC. Ae. albopictus - current known distribution in Europe, September
2017[Internet] European Union: European Centre for Disease Prevention and
Control 2017 [updated 10 Oct 2017; cited 2018 Jan 29]; [about 1 screen].
Available from: https://ecdc.europa.eu/en/publications-data/aedes-albopictus-
current-known-distribution-september-2017
110. Canali M, Rivas-Morales S, Beutels P, et al. The Cost of Arbovirus Disease
Prevention in Europe: Area-Wide Integrated Control of Tiger Mosquito, Aedes
albopictus, in Emilia-Romagna, Northern Italy. Int J Environ Res Public Health.
2017;14(4):444.
111. Valerio L, Marini F, Bongiorno G, et al. Host-feeding patterns of Aedes
albopictus (Diptera: Culicidae) in urban and rural contexts within Rome
province, Italy. Vector-Borne and Zoonotic Diseases. 2010;10(3):291-294.
112. Lindsay SW, Wilson A, Golding N, et al. Improving the built environment in
urban areas to control Aedes aegypti-borne diseases. Bull World Health Organ.
2017.
113. Dallimore T, Hunter T, Medlock JM, et al. Discovery of a single male Aedes
aegypti (L.) in Merseyside, England. Parasit Vectors. 2017;10(1):309.
114. Akiner MM, Demirci B, Babuadze G, et al. Spread of the invasive mosquitoes
Aedes aegypti and Aedes albopictus in the Black Sea region increases risk of
chikungunya, dengue, and Zika outbreaks in Europe. PLoS Negl Trop Dis.
2016;10(4):e0004664.
115. ECDC/EFSA. VectorNet[Internet] European Union: European Food Safety
Authority (EFSA) and the European Centre for Disease Prevention and Control
(ECDC); 2018 [cited 2018 Jan 29]. Available from:
https://vectornet.ecdc.europa.eu/
116. Schaffner F, Kaufmann C, Hegglin D, et al. The invasive mosquito Aedes
japonicus in Central Europe. Med Vet Entomol. 2009;23(4):448-451.
117. Kaufman MG, Fonseca DM. Invasion biology of Aedes japonicus japonicus
(Diptera: Culicidae). Annu Rev Entomol. 2014;59:31.
References 120
118. Krebs T, Bindler P, L'Ambert G, et al. First establishment of Aedes japonicus
japonicus (Theobald, 1901) (Diptera: Culicidae) in France in 2013 and its
impact on public health. J Vector Ecol. 2014;39(2):437-440.
119. Zielke DE, Ibáñez-Justicia A, Kalan K, et al. Recently discovered Aedes
japonicus japonicus (Diptera: Culicidae) populations in The Netherlands and
northern Germany resulted from a new introduction event and from a split from
an existing population. Parasit Vectors. 2015;8(1):40.
120. Seidel B, Montarsi F, Huemer HP, et al. First record of the Asian bush
mosquito, Aedes japonicus japonicus, in Italy: invasion from an established
Austrian population. Parasit Vectors. 2016;9(1):284.
121. ECDC. Ae. japonicus - current known distribution in Europe, September
2017[Internet] European Union: European Centre for Disease Prevention and
Control 2017 [updated 10 Oct 2017; cited 2018 Jan 29]; [about 1 screen].
Available from: https://ecdc.europa.eu/en/publications-data/aedes-japonicus-
current-known-distribution-september-2017
122. Schaffner F, Chouin S, Guilloteau J. First record of Ochlerotatus (Finlaya)
japonicus japonicus (Theobald, 1901) in metropolitan France. J Am Mosq
Control Assoc. 2003;19(1):1-5.
123. Takashima I, Rosen L. Horizontal and vertical transmission of Japanese
encephalitis virus by Aedes japonicus (Diptera: Culicidae). J Med Entomol.
1989;26(5):454-458.
124. Sardelis MR, Turell MJ. Ochlerotatus j. japonicus in Frederick County,
Maryland: discovery, distribution, and vector competence for West Nile virus. J
Am Mosq Control Assoc. 2001;17(2):137-141.
125. Schaffner F, Vazeille M, Kaufmann C, et al. Vector competence of Aedes
japonicus for chikungunya and dengue viruses. Eur Mosq Bull. 2011;29:141-
142.
126. Ciocchetta S, Luca T, Camuffo S, et al., editors. Indications on the host
preference of Aedes koreicus [Hulecoeteomyia koreica], a new invasive
mosquito to Italy. 9th CVBD symposium; 2014; Lisbon, Portugal.
127. Montarsi F, Drago A, Dal Pont M, et al. Current knowledge on the distribution
and biology of the recently introduced invasive mosquito Aedes koreicus
(diptera: Culicidae) Accademia Nazionale Italiana di Entomologia. 2014:169-
174.
128. ECDC. Mosquito maps[Internet] European Union: European Centre for Disease
Prevention and Control 2018 [updated 10 Oct 2017; cited 2018 Jan 29]; [about 1
screen]. Available from: https://ecdc.europa.eu/en/disease-vectors/surveillance-
and-disease-data/mosquito-maps
129. Wilder-Smith A, Quam M, Sessions O, et al. The 2012 dengue outbreak in
Madeira: exploring the origins. Euro Surveill. 2014 Feb 27;19(8):20718.
References 121
130. Succo T, Leparc-Goffart I, Ferré J-B, et al. Autochthonous dengue outbreak in
Nîmes, south of France, July to September 2015. Euro Surveill.
2016;21(21):30240.
131. Gjenero-Margan I, Aleraj B, Krajcar D, et al. Autochthonous dengue fever in
Croatia, August-September 2010. Euro Surveill. 2011;16(9):19805.
132. Marchand E, Prat C, Jeannin C, et al. Autochthonous case of dengue in France,
October 2013. Euro Surveill. 2013;201:18-50.
133. Savino S, Ciocchetta S, cartographers. Distribution of invasive Aedes mosquito
species in Europe. Australia: QIMR Berghofer Medical Research Institute &
University of Padua; 2017. 1 sheet; 13.36 x 18.86 cm; color.
134. Tanaka K, Saugstad ES, Mizusawa K. A revision of the adult and larval
mosquitoes of Japan (including the Ryukyu Archipelago and the Ogasawara
Islands) and Korea (Diptera: Culicidae). Army Medical Lab, San Francisco;
1979.
135. Knight KL. The Aedes (Finlaya) chrysolineatus group of mosquitoes (Diptera:
Culicidae). Ann Entomol Soc Am. 1947;40(4):624-649.
136. Ho Ci. Study of the adult Culicidae of Peiping. Bull Fan Mem Inst Biol.
1931;11.
137. Kim HC, Chong ST, O’Brien LL, et al. Seasonal prevalence of mosquitoes
collected from light traps in the Republic of Korea in 2003. Entomol Res.
2006;36(3):139-148.
138. Kim HC, Chong ST, Collier BW, et al. Seasonal prevalence of mosquitoes
collected from light traps with notes on malaria in the Republic of Korea, 2004.
Entomol Res. 2007;37(3):180-189.
139. Kim HC, Chong ST, Collier BW, et al. Seasonal prevalence of mosquitoes
collected from light traps in the Republic of Korea, 2005. Entomol Res.
2009;39(1):70-77.
140. Miles J. Some ecological aspects of the problem of arthropod-borne animal
viruses in the Western Pacific and South-East Asia regions. Bull World Health
Organ. 1964;30(2):197-210.
141. Feng L-C. A critical review of literature regarding the records of mosquitoes in
China. 1 Part I. Subfamijy Culicinae, Tribe Anophelini. Peking Nat Hist Bull.
1938;12(pt. 3).
142. Ye Y, Ng TS, Frentiu FD, et al. Comparative susceptibility of mosquito
populations in North Queensland, Australia to oral infection with Dengue virus.
Am J Trop Med Hyg. 2014.
143. Horwood P, Bande G, Dagina R, et al. The threat of chikungunya in Oceania.
Western Pacific surveillance and response journal: WPSAR. 2013;4(2):8.
144. Kelly-Hope LA, Purdie DM, Kay BH. Ross River virus disease in Australia,
1886-1998, with analysis of risk factors associated with outbreaks. J Med
Entomol. 2004;41(2):133-150.
References 122
145. Watson TM, Kay BH. Vector competence of Aedes notoscriptus (Diptera:
Culicidae) for Ross River virus in Queensland, Australia. J Med Entomol.
1998;35(2):104-106.
146. Petriščeva PA. Course on Natural Foci of Infection. USSR Acad Med Sci &
WHO; 1962.
147. Kim HC, Wilkerson RC, Pecor JE, et al. New Records and Reference Collection
of Mosquitoes (Diptera: Culicidae) on Jeju Island, Republic of Korea. Entomol
Res. 2005;35(1):55-66.
148. Kim HC, Turell MJ, O’Guinn ML, et al. Historical review and surveillance of
Japanese encephalitis, Republic of Korea, 2002–2004. Entomol Res.
2007;37(4):267-274.
149. Gutsevich A, Monchadskii A, Stackelberg A. Fauna of the USSR. Diptera. Vol.
3, Issue 4. Mosquitoes of the Family Culicidae. Nauka, Leningrad; 1970.
150. Kampen H, Werner D. Out of the bush: The Asian bush mosquito Aedes
japonicus japonicus (Theobald, 1901)(Diptera, Culicidae) becomes invasive.
Parasit Vectors. 2014;7(1):59.
151. van den Hurk AF, Ritchie SA, Mackenzie JS. Ecology and geographical
expansion of Japanese encephalitis virus. Annu Rev Entomol. 2009;54:17-35.
152. Gutsevich A, Monchadskii A, Shtakel’berg A. Fauna SSSR Vol. 3.(4). Family
Culicidae. 1971.
153. Yamada S. An experimental study on twenty-four species of Japanese
mosquitoes regarding their suitability as intermediate hosts for Filaria bancrofti
Cobbold. Sci Rep Gov Inst Inf Dis. 1927;6:559-622.
154. Feng L-C. Experiments with Dirofilaria immitis and local species of mosquitoes
in Peiping, North China. Ann Trop Med Parasitol. 1930;24:347-366.
155. Montarsi F, Ciocchetta S, Ravagnan S, et al. Laboratory evidence on vector
competence of the invasive mosquito Aedes koreicus [Hulecoeteomyia koreica]
for Dirofilaria immitis. Parasit Vectors. 2014;7(Suppl 1):O34.
156. Lee S-E, Kim H-C, Chong S-T, et al. Molecular survey of Dirofilaria immitis
and Dirofilaria repens by direct PCR for wild caught mosquitoes in the
Republic of Korea. Vet Parasitol. 2007;148(2):149-155.
157. Woolhouse ME, Gowtage-Sequeria S. Host range and emerging and reemerging
pathogens. Emerg Infect Dis. 2005;11(12):1842.
158. Korean Centre for Disease Control. Elimination of Lymphatic filariasis in
Korea. National document for certification. Republic of Korea: National
Institute of Health. Centres for Disease Control and Prevention, Ministry of
Health and Welfare, 2007.
159. Cosgrove J, Wood R, Petrić D, et al. A convenient mosquito membrane feeding
system. J Am Mosq Control Assoc. 1994;10(3):434-436.
References 123
160. Versteirt V, Pecor JE, Fonseca DM, et al. Confirmation of Aedes koreicus
(Diptera: Culicidae) in Belgium and description of morphological differences
between Korean and Belgian specimens validated by molecular identification.
Zootaxa. 2012;3191:21-32.
161. Cameron EC, Wilkerson RC, Mogi M, et al. Molecular phylogenetics of Aedes
japonicus, a disease vector that recently invaded Western Europe, North
America, and the Hawaiian islands. J Med Entomol. 2010 Jul;47(4):527-35.
162. Widdel AK, McCuiston LJ, Crans WJ, et al. Finding needles in the haystack:
Single copy microsatellite loci for Aedes japonicus (Diptera: Culicidae). Am J
Trop Med Hyg. 2005 Oct;73(4):744-8.
163. Unit Walter Reed Biosystematics. Aedes koreicus specimens. Washington, DC,
USA: Smithsonian Institution.
164. Montarsi F, Ravagnan S, Ciocchetta S, et al. Distribution and habitat
characterization of the recently introduced invasive mosquito Aedes koreicus
[Hulecoeteomyia koreica], a new potential vector and pest in north-eastern Italy.
Parasit Vectors. 2013;6(1):292-292. Electronic supplementary material:
Additional file 3, Drawings of the main characteristics considered for the
identification of female Culicinae mosquito.
165. Versteirt V, Pecor JE, Fonseca DM, et al. Confirmation of Aedes koreicus
(Diptera: Culicidae) in Belgium and description of morphological differences
between Korean and Belgian specimens validated by molecular identification.
Zootaxa. 2012;3191:21-32. Figure 4, Differences in hindleg ornamentation of
(a) Aedes koreicus from Belgium, (b) Aedes koreicus from peninsular Korea and
(c) Aedes j. japonicus from Belgium; p. 27.
166. Takken W. Mosquito vectors of disease: Spatial biodiversity, drivers of change
and risk “MODIRISK”. 2009.
167. Versteirt V, De Clercq E, Fonseca D, et al. Bionomics of the established exotic
mosquito species Aedes koreicus in Belgium, Europe. J Med Entomol.
2012;49(6):1226-1232.
168. Deblauwe I, Sohier C, Schaffner F, et al. Implementation of surveillance of
invasive mosquitoes in Belgium according to the ECDC guidelines. Parasit
Vectors. 2014;7(1):201.
169. Bezzhonova OV, Patraman IV, Ganushkina LA, et al. [The first finding of
invasive species Aedes (Finlaya) koreicus (Edwards, 1917) in European Russia].
Med Parazitol (Mosk). 2014 Jan-Mar(1):16-9. russian.
170. Suter T, Flacio E, Fariña BF, et al. First report of the invasive mosquito species
Aedes koreicus in the Swiss-Italian border region. Parasit Vectors. 2015;8(1):1-
4.
171. Werner D, Zielke D, Kampen H. First record of Aedes koreicus (Diptera:
Culicidae) in Germany. Parasitol Res. 2015 2015/11/28:1-4.
References 124
172. Kurucz K, Kiss V, Zana B, et al. Emergence of Aedes koreicus (Diptera:
Culicidae) in an urban area, Hungary, 2016. Parasitol Res. 2016;115(12):4687-
4689.
173. Schaffner F, Kaufmann C, Pflüger V, et al. Rapid protein profiling facilitates
surveillance of invasive mosquito species. Parasit Vectors. 2014;7(1):142.
174. Kim HC, Chong ST, Pike JG, et al. Seasonal Prevalence of Mosquitoes
Collected from Light Traps in the Republic of Korea, 2002. Entomol Res.
2004;34(3):177-186.
175. Kim HC, Friendly OS, Pike JG, et al. Seasonal Prevalence of Mosquitoes
Collected from Light Traps in the Republic of Korea, 2001. Entomol Res.
2003;33(3):189-201.
176. Kim HC, Lee KW, Richards RS, et al. Seasonal Prevalence of Mosquitoes
Collected from Light Traps in Korea (1999‐2000). Entomol Res. 2003;33(1):9-
16.
177. CCMCP. New Jersey Light Trap Massachusetts (USA): Central Massachusetts
Mosquito Control; 2007 [cited 2018 Jan 29]; [about 1 screen]. Available from:
http://www.cmmcp.org/njtrap.htm
178. MosquitoMagnet. CO2 Mosquito Traps By Mosquito Magnet® USA: Mosquito
Magnet; 2017 [cited 2018 Jan 29]; [about 3 screens]. Available from:
http://www.mosquitomagnet.com/store/mosquito-magnet-trap
179. European Centre for Disease Prevention and Control. Guidelines for the
surveillance of invasive mosquitoes in Europe. Stockholm: ECDC; 2012.
180. Melaun C, Werblow A, Cunze S, et al. Modeling of the putative distribution of
the arbovirus vector Ochlerotatus japonicus japonicus (Diptera: Culicidae) in
Germany. Parasitol Res. 2015:1-11.
181. Schaffner F, Bellini R, Petric D, et al. Development of guidelines for the
surveillance of invasive mosquitoes in Europe. Parasit Vectors. 2013;6:209.
182. Baldacchino F, Montarsi F, Arnoldi D, et al. A 2-yr mosquito survey focusing
on Aedes koreicus (Diptera: Culicidae) in Northern Italy and implications for
adult trapping. J Med Entomol. 2017;54(3):622-630.
183. European Centre for Disease Prevention and Control. Guidelines for the
surveillance of invasive mosquitoes in Europe. Stockholm: ECDC; 2012. Table
5, Methods of collection of IMS adult or detection by egg collection and their
efficacy according to mosquito species; p 16.
184. Williamson M. Biological invasions. Vol. 15. Springer; 1996.
185. Alto BW, Lounibos LP. Vector competence for arboviruses in relation to the
larval environment of mosquitoes. Ecology of parasite-vector interactions:
Springer; 2013. p. 81-101.
186. Lounibos L. Competitive displacement and reduction. J Am Mosq Control
Assoc. 2007;23(2 Suppl):276.
References 125
187. Ribeiro J, Spielman A. The satyr effect: A model predicting parapatry and
species extinction. Am Nat. 1986;128(4):513-528.
188. Ali SR, Rozeboom LE. Cross-insemination frequencies between strains of Aedes
albopictus and members of the Aedes scutellaris group. J Med Entomol.
1971;8(3):263-265.
189. Ali SR, Rozeboom LE. Cross-mating between Aedes (S.) polynesiensis Marks
and Aedes (S.) albopictus Skuse in a large cage. Mosquito News. 1971;31(1):80-
4.
190. Gubler DJ. Induced sterility in Aedes (Stegomyia) polynesiensis Marks by cross-
insemination with Aedes (Stegomyia) albopictus Skuse. J Med Entomol.
1970;7(1):65-70.
191. Bargielowski IE, Lounibos LP, Carrasquilla MC. Evolution of resistance to
satyrization through reproductive character displacement in populations of
invasive dengue vectors. Proceedings of the National Academy of Sciences.
2013;110(8):2888-2892.
192. Nazni W, Lee H, Dayang H, et al. Cross-mating between Malaysian strains of
Aedes aegypti and Aedes albopictus in the laboratory. Southeast Asian J Trop
Med Public Health. 2009;40(1):40-6.
193. Lima-Camara TN, Codeco CT, Honorio NA, et al. Male accessory gland
substances from Aedes albopictus affect the locomotor activity of Aedes aegypti
females. Mem Inst Oswaldo Cruz. 2013;108:18-25.
194. Black WC, Rai KS, Turco BJ, et al. Laboratory study of competition between
United States strains of Aedes albopictus and Aedes aegypti (Diptera:
Culicidae). J Med Entomol. 1989;26(4):260-271.
195. Nasci R, Hare S, Willis F. Interspecific mating between Louisiana strains of
Aedes albopictus and Aedes aegypti in the field and laboratory. J Am Mosq
Control Assoc. 1989;5(3):416-421.
196. Bargielowski I, Lounibos L, Shin D, et al. Widespread evidence for interspecific
mating between Aedes aegypti and Aedes albopictus (Diptera: Culicidae) in
nature. Infect Genet Evol. 2015;36:456-461.197. Juliano SA. Species
introduction and replacement among mosquitoes: Interspecific resource
competition or apparent competition? Ecology. 1998;79(1):255-268.
197. Juliano SA. Species introduction and replacement among mosquitoes:
Interspecific resource competition or apparent competition? Ecology.
1998;79(1):255-268.
198. Russell RC. Larval competition between the introduced vector of dengue fever
in Australia, Aedes aegypti (L), and a native container-breeding mosquito, Aedes
notoscriptus (Skuse)(Diptera, Culicidae). Aust J Zool. 1986;34(4):527-534.
199. Barrera R. Competition and resistance to starvation in larvae of container-
inhabiting Aedes mosquitoes. Ecol Entomol. 1996;21(2):117-27.
200. Alto BW, Lounibos LP, Higgs S, et al. Larval competition differentially affects
arbovirus infection in Aedes mosquitoes. Ecology. 2005;86(12):3279-3288.
References 126
201. Alto BW, Lounibos LP, Mores CN, et al. Larval competition alters susceptibility
of adult Aedes mosquitoes to dengue infection. Proceedings of the Royal Society
B: Biological Sciences. 2008;275(1633):463-471.
202. Bevins SN. Invasive mosquitoes, larval competition, and indirect effects on the
vector competence of native mosquito species (Diptera: Culicidae). Biol
Invasions. 2008;10(7):1109-1117.
203. Baldacchino F, Arnoldi D, Lapère C, et al. Weak Larval Competition Between
Two Invasive Mosquitoes Aedes koreicus and Aedes albopictus (Diptera:
Culicidae). J Med Entomol. 2017:tjx093.
204. Focks DA. A review of entomological sampling methods and indicators for
dengue vectors. Geneva: WHO. 2004.
205. Silver JB. Mosquito ecology: field sampling methods. Springer Science &
Business Media; 2007.
206. Kroeckel U, Rose A, Eiras ÁE, et al. New tools for surveillance of adult yellow
fever mosquitoes: Comparison of trap catches with human landing rates in an
urban environment. J Am Mosq Control Assoc. 2006;22(2):229-238.
207. Bhalala H, Arias JR. The Zumba™ mosquito trap and BG-Sentinel™ trap:
Novel surveillance tools for host-seeking mosquitoes. J Am Mosq Control
Assoc. 2009;25(2):134-139.
208. Carrieri M, Albieri A, Angelini P, et al. Surveillance of the chikungunya vector
Aedes albopictus (Skuse) in Emilia‐Romagna (northern Italy): organizational
and technical aspects of a large scale monitoring system. J Vector Ecol.
2011;36(1):108-116.
209. Ritchie SA, Buhagiar TS, Townsend M, et al. Field Validation of the Gravid
Aedes Trap (GAT) for Collection of Aedes aegypti (Diptera: Culicidae). J Med
Entomol. 2014;51(1):210-219.
210. Miyagi I. Notes on the Aedes (Finlaya) chrysolineatus subgroup in Japan and
Korea (Diptera: Culicidae). 熱帯医学 Tropical medicine. 1971;13(3):141-151.
211. Romi R, Pontuale G, Sabatinelli G. Le zanzare italiane: Generalità e
identificazione degli stadi preimaginali (Diptera, Culicidae) [Italian mosquitoes:
Generality and identification of the preimaginal stages (Diptera, Culicidae)].
Vol. 29. Università degli Studi di Roma" La Sapienza", Dipartimento di
Biologia Animale e dell'Uomo; 1997. Italian.
212. Severini F, Toma L, Di Luca M, et al. Italian mosquitoes: Generality and
identification of adults (Diptera, Culicidae). Fragmenta entomologica.
2009;41:213-372.
213. Ree HI. Taxonomic Review and Revised Keys of the Korean Mosquitoes
(Diptera: Culicidae). Entomol Res. 2003;33(1):39-52.
214. Becker N. Mosquitoes and their control. Heidelberg: Springer; 2010.
215. ARPAV. Dipartimento Regionale per la Sicurezza del Territorio Servizio
Meteorologico[Internet] [Regional Department for Territory Security
References 127
Meteorological Service]. Italy: Agenzia Regionale per la Prevenzione e
Protezione Ambientale del Veneto; 2014 [cited 2018 29 Jan]; [about 3 screens].
Available from:
http://www.arpa.veneto.it/bollettini/storico/2014/0264_2014_TEMP.htm
216. ARPAV. Dipartimento Regionale per la Sicurezza del Territorio Servizio
Meteorologico[Internet] [Regional Department for Territory Security
Meteorological Service]. Italy: Agenzia Regionale per la Prevenzione e
Protezione Ambientale del Veneto; 2014 [cited 2018 29 Jan]; [about 2 screens].
Available from:
http://www.arpa.veneto.it/bollettini/storico/2014/0264_2014_PREC.htm
217. ARPAV. Dipartimento Regionale per la Sicurezza del Territorio Servizio
Meteorologico[Internet] [Regional Department for Territory Security
Meteorological Service]. Italy: Agenzia Regionale per la Prevenzione e
Protezione Ambientale del Veneto; 2014 [cited 2018 29 Jan]; [about 1 screen].
Available from:
http://www.arpa.veneto.it/bollettini/storico/2014/0264_2014_VVENTO.htm
218. Drago A, Marini F, Caputo B, et al. Looking for the gold standard: Assessment
of the effectiveness of four traps for monitoring mosquitoes in Italy. J Vector
Ecol. 2012;37(1):117-123.
219. Montarsi F, Tripepi L, Drago A, et al., editors. Host preference and
anthropophilic behaviour of the invasive mosquito Aedes koreicus. European
Society for Vector Ecology E-SOVE 2014; 2014; Thessaloniki (Greece).
220. Fay RW. The biology and bionomics of Aedes aegypti in the laboratory. Mosq
News. 1964;24(3):300-308.
221. Hartberg W, Gerberg E. Laboratory colonization of Aedes simpsoni (Theobald)
and Eretmapodites quinquevittatus Theobald. Bull World Health Organ.
1971;45(6):850.
222. Deshmukh P, Guttikar S, Guru P, et al. Colonization of two species of
mosquitoes, Aedes novalbopictus and Aedes w-albus. Indian J Med Res.
1973;61(4):503-505.
223. Choochote W. A note on laboratory colonization of Aedes (Muscidus)
quasiferinus Mattingly 1961, Amphur Muang Chiang Mai, Northern Thailand.
1987. Southeast Asian J Trop Med Public Health. 1987;18(1):128.
224. Hugo L, Kay B, Ryan P. Autogeny in Ochlerotatus vigilax (Diptera: Culicidae)
from Southeast Queensland, Australia. J Med Entomol. 2003;40(6):897-902.
225. Blackmore MS, Lord CC. The relationship between size and fecundity in Aedes
albopictus. J Vector Ecol. 2000;25:212-217.
226. Armbruster P, Hutchinson RA. Pupal mass and wing length as indicators of
fecundity in Aedes albopictus and Aedes geniculatus (Diptera: Culicidae). J Med
Entomol. 2002;39(4):699-704.
References 128
227. Lyimo EO, Takken W. Effects of adult body size on fecundity and the pre‐gravid rate of Anopheles gambiae females in Tanzania. Med Vet Entomol.
1993;7(4):328-332.
228. Lounibos L, Larson V, Morris C. Parity, fecundity and body size of Mansonia
dyari in Florida. J Am Mosq Control Assoc. 1990;6(1):121-126.
229. Reiskind M, Lounibos L. Effects of intraspecific larval competition on adult
longevity in the mosquitoes Aedes aegypti and Aedes albopictus. Med Vet
Entomol. 2009;23(1):62-68.
230. Kesavaraju B, Leisnham PT, Keane S, et al. Interspecific competition between
Aedes albopictus and A. sierrensis: potential for competitive displacement in the
Western United States. PLoS One. 2014;9(2):e89698.
231. Leonard PM, Juliano SA. Effect of leaf litter and density on fitness and
population performance of the hole mosquito Aedes triseriatus. Ecol Entomol.
1995;20(2):125-136.
232. Lounibos LP, Nishimura N, Escher RL. Fitness of a treehole mosquito:
Influences of food type and predation. Oikos. 1993:114-118.
233. Williges E, Farajollahi A, Scott JJ, et al. Laboratory colonization of Aedes
japonicus japonicus. J Am Mosq Control Assoc. 2008;24(4):591-593.
234. Versteirt V, Nagy Z, Roelants P, et al. Identification of Belgian mosquito
species (Diptera: Culicidae) by DNA barcoding. Mol Ecol Resour.
2015;15(2):449-457.
235. Rutledge L, Ward R, Gould D. Studies on the feeding response of mosquitoes to
nutritive solutions in a new membrane feeder. Mosq News. 1964;24(4):407-9.
236. Crampton J, Beard C, Louis C. The molecular biology of insect disease vectors:
a methods manual. Springer; 1997.
237. Russell B, Kay B, Shipton W. Survival of Aedes aegypti (Diptera: Culicidae)
eggs in surface and subterranean breeding sites during the northern Queensland
dry season. J Med Entomol. 2001;38(3):441-445.
238. Trpiš M. A new bleaching and decalcifying method for general use in zoology.
Can J Zool. 1970;48(4):892-893.
239. Clements A, Boocock M. Ovarian development in mosquitoes: Stages of growth
and arrest, and follicular resorption. Physiol Entomol. 1984;9(1):1-8.
240. Itina VI, Noutcha MAE, Okiwelu SN. Wuchereria bancrofti Infection Rates in
Humans (Vertebrata: Hominidae) and Mosquitoes (Diptera: Culicidae), Akwa
Ibom State, Nigeria. Res Zool. 2014;4(1):1-7.
241. Christophers SR. The development of the egg follicle in anophelines. Paludism.
1911;2:73-88.
242. Itina VI, Noutcha MAE, Okiwelu SN. Wuchereria bancrofti Infection Rates in
Humans (Vertebrata: Hominidae) and Mosquitoes (Diptera: Culicidae), Akwa
References 129
Ibom State, Nigeria. Res Zool. 2014;4(1):1-7. Figure 2, Egg Follicle
development in mosquitoes; p 4.
243. Minakawa N, Githure JI, Beier JC, et al. Anopheline Mosquito Survival
Strategies During the Dry Period in Western Kenya. J Med Entomol. 2001
2001-05-01 00:00:00;38(3):388-392.
244. Decoursey JD, Webster A. A method of clearing the chorion of Aedes sollicitans
(Walker) eggs and preliminary observations on their embryonic development.
Ann Entomol Soc Am. 1952;45(4):625-632.
245. Alto BW, Juliano SA. Temperature Effects on the Dynamics of Aedes
albopictus (Diptera: Culicidae) Populations in the Laboratory. J Med Entomol.
2001;38(4):548-556.
246. Delatte H, Gimonneau G, Triboire A, et al. Influence of temperature on
immature development, survival, longevity, fecundity, and gonotrophic cycles
of Aedes albopictus, vector of chikungunya and dengue in the Indian Ocean. J
Med Entomol. 2009;46(1):33-41.
247. Moorefield H. Sexual dimorphism in mosquito pupae Mosquito News.
1951;11(3):175-177.
248. Haddow AJ, Gillett JD, Corbet PS. Laboratory Observations on Pupation and
Emergence in the Mosquito Aëdes (Stegomyia) Aegypti (Linnaeus). Ann Trop
Med Parasitol. 1959 1959/06/01;53(2):123-131.
249. Scott JJ. The ecology of the exotic mosquito Ochlerotatus (Finlaya) japonicus
japonicus (Theobald 1901)(Diptera: Culicidae) and an examination of its role in
the West Nile virus cycle in New Jersey. 2003; 4171.
250. Lounibos LP, Rey JR, Frank JH, editors. Ecology of mosquitoes. Proceedings of
a Workshop. Florida Medical Entomology Laboratory, Vero Beach, Florida,
USA; 1985.
251. Briegel H. Metabolic relationship between female body size, reserves, and
fecundity of Aedes aegypti. J Insect Physiol. 1990;36(3):165-172.
252. Farjana T, Tuno N, Higa Y. Effects of temperature and diet on development and
interspecies competition in Aedes aegypti and Aedes albopictus. Med Vet
Entomol. 2012;26(2):210-217.
253. Takken W, Costantini C, Dolo G, et al. Mosquito mating behaviour. Bridging
laboratory and field research for genetic control of disease vectors. 2006:183-
188.
254. Clements A. The biology of mosquitoes. Vol. I. Development, nutrition and
reproduction. Chapman and Hall; 1992.
255. Roubaud E. Cycle autogene d'attente et generations hivernales suractives
inapparentes chez le moustique commun, Culex pipiens L. [Autogenic waiting
cycle and inapparent overactive winter generations in the common mosquito,
Culex pipiens L.] CR Acad Sci, Paris. 1929;188:735-738. French.
References 130
256. Thomas Va, Leng Y. The inheritance of autogeny in Aedes (Finlaya) togoi
(Theobald) from Malaysia and some aspects of its biology. Southeast Asian J
Trop Med Public Health. 1972;3(2):163-74.
257. Mulla T. Selection-dependent trends of autogeny and blood feeding in an
autogenous strain of Culex tarsalis (Diptera: Culicidae). J Am Mosq Control
Assoc. 1997;13(2):145-149.
258. Reisen WK, Milby MM. Studies on autogeny in Culex tarsalis: 3. Life table
attributes of autogenous and anautogenous strains under laboratory conditions. J
Am Mosq Control Assoc. 1987;3(4):619-625.
259. Spadoni R, Nelson R, Reeves W. Seasonal Occurrence, Egg Production, and
Blood-feeding Activity of Autogenous Culex tarsalis 1, 2. Ann Entomol Soc
Am. 1974;67(6):895-902.
260. Corbet P. Facultative autogeny in Arctic mosquitoes. Nature. 1967;215:662-3.
261. Spielman A. Studies on autogeny in natural populations of Culex pipiens II.
Seasonal abundance of autogenous and anautogenous populations. J Med
Entomol. 1971;8(5):555-561.
262. Clements AN. The Physiology of Mosquitoes: International Series of
Monographs on Pure and Applied Biology: Zoology. Vol. 17. Elsevier; 2013.
263. Spielman A. The inheritance of autogeny in the Culex pipiens complex of
mosquitoes. American journal of hygiene. 1957;65(3).
264. Tveten M, Meola R. Autogeny in Culex salinarius from Texas, Florida and New
Jersey. J Am Mosq Control Assoc. 1988;4(4):436-441.
265. Provost‐Javier KN, Chen S, Rasgon JL. Vitellogenin gene expression in
autogenous Culex tarsalis. Insect Mol Biol. 2010;19(4):423-429.
266. Sweeney A, Russell R. Autogeny in Anopheles amictus hilli. Mosquito News.
1973;33(3):467-8.
267. O'Meara GF, Larson VL, Mook DH. Blood feeding and autogeny in the
peridomestic mosquito Aedes bahamensis (Diptera: Culicidae). J Med Entomol.
1993;30(2):378-383.
268. Mori A, Romero-Severson J, Black IV W, et al. Quantitative trait loci
determining autogeny and body size in the Asian tiger mosquito (Aedes
albopictus). Heredity (Edinb). 2008;101(1):75.
269. O'Meara GF. Variable expressions of autogeny in three mosquito species. Int J
Invertebr Reprod. 1979;1(4):253-261.
270. Lea AO. Selection for Autogeny in Aedes aegypti (Diptera: Culicidae. Ann
Entomol Soc Am. 1964;57(5):656-657.
271. O'Meara GF, Evans DG. The influence of mating on autogenous egg
development in the mosquito, Aedes taeniorhynchus. J Insect Physiol.
1976;22(4):613-617.
References 131
272. O'Meara GF, Evans DG. Autogeny in saltmarsh mosquitoes induced by a
substance from the male accessory gland. Nature. 1977;267(5609):342-344.
273. Hertig M, Wolbach SB. Studies on rickettsia-like micro-organisms in insects. J
Med Res. 1924;44(3):329.
274. Hilgenboecker K, Hammerstein P, Schlattmann P, et al. How many species are
infected with Wolbachia?–A statistical analysis of current data. FEMS
Microbiol Lett. 2008;281(2):215-220.
275. Jeyaprakash A, Hoy MA. Long PCR improves Wolbachia DNA amplification:
wsp sequences found in 76% of sixty‐three arthropod species. Insect Mol Biol.
2000;9(4):393-405.
276. Werren JH, Baldo L, Clark ME. Wolbachia: Master manipulators of invertebrate
biology. Nat Rev Microbiol. 2008;6(10):741.
277. Stouthamer R, Breeuwer JA, Hurst GD. Wolbachia pipientis: microbial
manipulator of arthropod reproduction. Annu Rev Microbiol. 1999;53(1):71-
102.
278. Alexandrov I, Alexandrova M, Goryacheva I, et al. Removing endosymbiotic
Wolbachia specifically decreases lifespan of females and competitiveness in a
laboratory strain of Drosophila melanogaster. Russ J Genet. 2007;43(10):1147-
1152.
279. Dedeine F, Bandi C, Boulétreau M, et al. Insights into Wolbachia obligatory
symbiosis. Insect Symbiosis. 2003;1:267-282.
280. Dedeine F, Vavre F, Fleury F, et al. Removing symbiotic Wolbachia bacteria
specifically inhibits oogenesis in a parasitic wasp. Proceedings of the National
Academy of Sciences. 2001;98(11):6247-6252.
281. Ciocchetta S, Darbro JM, Frentiu FD, et al. Laboratory colonization of the
European invasive mosquito Aedes (Finlaya) koreicus. Parasit Vectors.
2017;10(1):74.
282. Oliva CF, Damiens D, Benedict MQ. Male reproductive biology of Aedes
mosquitoes. Acta Trop. 2014;132:S12-S19.
283. O'Neill SL, Giordano R, Colbert A, et al. 16S rRNA phylogenetic analysis of
the bacterial endosymbionts associated with cytoplasmic incompatibility in
insects. Proceedings of the National Academy of Sciences. 1992;89(7):2699-
2702.
284. Braig HR, Zhou W, Dobson SL, et al. Cloning and Characterization of a Gene
Encoding the Major Surface Protein of the Bacterial Endosymbiont Wolbachia
pipientis. J Bacteriol. 1998;180(9):2373-2378.
285. Cook PE, Hugo LE, Iturbe-Ormaetxe I, et al. The use of transcriptional profiles
to predict adult mosquito age under field conditions. Proceedings of the National
Academy of Sciences. 2006;103(48):18060-18065.
286. Ulrich JN, Beier JC, Devine GJ, et al. Heat Sensitivity of wMel Wolbachia
during Aedes aegypti Development. PLoS Negl Trop Dis. 2016;10(7):e0004873.
References 132
287. Ciocchetta S. Ae. koreicus mating [Internet]. Australia: QUT Media Warehouse,
Ciocchetta S, editor and producer; 2016; [1 video: 8 sec., color, 720x1280].
Available from:
https://mediawarehouse.qut.edu.au/QMW/player/?dID=59523&dDocName=Q
MW_049598
288. Ciocchetta S. Ae. koreicus sperm[Internet]. Australia: QUT Media Warehouse,
Ciocchetta S, editor and producer; 2016; [1 video: 11 sec., color, 720x1280].
Available from:
https://mediawarehouse.qut.edu.au/QMW/player/?dID=59524&dDocName=Q
MW_049599
289. Ciocchetta S. Ae. albopictus/Ae. koreicus interaction [Internet]. Australia: QUT
Media Warehouse, Ciocchetta S, editor and producer; 2016; [1 video: 11 sec.,
color, 480x854]. Available from:
https://mediawarehouse.qut.edu.au/QMW/player/?dID=59525&dDocName=Q
MW_049600
290. Tsuji N, Okazawa T, Yamamura N. Autogenous and anautogenous mosquitoes:
a mathematical analysis of reproductive strategies. J Med Entomol.
1990;27(4):446-453.
291. Chambers GM, Klowden MJ. Nutritional reserves of autogenous and
anautogenous selected strains of Aedes albopictus (Diptera: Culicidae). J Med
Entomol. 1994;31(4):554-560.
292. Oliva CF, Damiens D, Benedict MQ. Male reproductive biology of Aedes
mosquitoes. Acta Trop. 2014;132:S12-S19.
293. Roth LM. A study of mosquito behavior. An experimental laboratory study of
the sexual behavior of Aedes aegypti (Linnaeus). Am Midl Nat. 1948;40(2):265-
352.
294. Lamb C. The geometry of insect pairing. Proceedings of the Royal Society of
London Series B, Containing Papers of a Biological Character. 1922;94(656):1-
11.
295. Smith S, Gadawski R. Swarming and mating in Aedes provocans (Diptera:
Culicidae). Great Lakes Entomol. 1994;27(3):175.
296. Cabrera M, Jaffe K. An aggregation pheromone modulates lekking behavior in
the vector mosquito Aedes aegypti (Diptera: Culicidae). J Am Mosq Control
Assoc. 2007;23(1):1-10.
297. Oliva CF, Damiens D, Benedict MQ. Male reproductive biology of Aedes
mosquitoes. Acta Trop. 2014;132:S12-S19. Figure 1, The reproductive system
of female (in red) and male (in blue) Aedes and the sperm transfer during
copulation (represented by the arrows). Adapted from Clements (1999) and
Jones (1968); p. 2.
298. Montarsi F, Drago A, Martini S, et al. Current distribution of the invasive
mosquito species, Aedes koreicus [Hulecoeteomyia koreica] in northern Italy.
Parasit Vectors. 2015;8(1):614.
References 133
299. Armistead JS, Nishimura N, Arias JR, et al. Community ecology of container
mosquitoes (Diptera: Culicidae) in Virginia following invasion by Aedes
japonicus. J Med Entomol. 2014;49(6):1318-1327.
300. Armistead J, Arias J, Nishimura N, et al. Interspecific larval competition
between Aedes albopictus and Aedes japonicus (Diptera: Culicidae) in northern
Virginia. J Med Entomol. 2008;45(4):629.
301. Mohammed A, Chadee DD. Effects of different temperature regimens on the
development of Aedes aegypti (L.)(Diptera: Culicidae) mosquitoes. Acta Trop.
2011;119(1):38-43.
302. Aliota MT, Peinado SA, Velez ID, et al. The wMel strain of Wolbachia Reduces
Transmission of Zika virus by Aedes aegypti. Sci Rep. 2016;6:28792.
303. Frentiu FD, Zakir T, Walker T, et al. Limited dengue virus replication in field-
collected Aedes aegypti mosquitoes infected with Wolbachia. PLoS Negl Trop
Dis. 2014;8(2):e2688.
304. Walker T, Johnson P, Moreira L, et al. The wMel Wolbachia strain blocks
dengue and invades caged Aedes aegypti populations. Nature.
2011;476(7361):450.
305. Blagrove MS, Arias-Goeta C, Failloux A-B, et al. Wolbachia strain wMel
induces cytoplasmic incompatibility and blocks dengue transmission in Aedes
albopictus. Proceedings of the National Academy of Sciences. 2012;109(1):255-
260.
306. Reisen W. Estimation of vectorial capacity, Palm Springs CA, November 16,
1988. Bull Soc Vector Ecolog. 1989;14(1):39-70.
307. Chan M, Johansson MA. The incubation periods of dengue viruses. PLoS One.
2012;7(11):e50972.
308. Dohm DJ, O’Guinn ML, Turell MJ. Effect of environmental temperature on the
ability of Culex pipiens (Diptera: Culicidae) to transmit West Nile virus. J Med
Entomol. 2002;39(1):221-225.
309. Reisen W, Meyer R, Presser S, et al. Effect of temperature on the transmission
of western equine encephalomyelitis and St. Louis encephalitis viruses by Culex
tarsalis (Diptera: Culicidae). J Med Entomol. 1993;30(1):151-160.
310. Davis NC. The Effect of Various Temperatures in modifying the Extrinsic
Incubation Period of the Yellow Fever Virus in Aedes aegypti. Am J Hyg.
1932;16(1).
311. Lambrechts L, Paaijmans KP, Fansiri T, et al. Impact of daily temperature
fluctuations on dengue virus transmission by Aedes aegypti. Proceedings of the
National Academy of Sciences. 2011;108(18):7460-7465.
312. van den Hurk AF, Hall-Mendelin S, Pyke AT, et al. Vector competence of
Australian mosquitoes for chikungunya virus. Vector Borne Zoonotic Dis.
2010;10(5):489-495.
References 134
313. van den Hurk AF, Higgs S, McElroy K, et al. Vector competence of Australian
mosquitoes for yellow fever virus. Am J Trop Med Hyg. 2011;85(3):446-451.
314. Knox T, Kay B, Hall R, et al. Enhanced vector competence of Aedes aegypti
(Diptera: Culicidae) from the Torres Strait compared with mainland Australia
for dengue 2 and 4 viruses. J Med Entomol. 2003;40(6):950-956.
315. van den Hurk A, Nisbet D, Hall R, et al. Vector competence of Australian
mosquitoes (Diptera: Culicidae) for Japanese encephalitis virus. J Med Entomol.
2003;40(1):82-90.
316. Jeffery JA, Ryan PA, Lyons SA, et al. Vector competence of Coquillettidia
linealis (Skuse)(Diptera: Culicidae) for Ross River and Barmah Forest viruses.
Aust J Entomol. 2002;41(4):339-344.
317. Ryan P, Kay B. Vector competence of mosquitoes (Diptera: Culicidae) from
Maroochy Shire, Australia, for Barmah Forest virus. J Med Entomol.
1999;36(6):856-860.
318. Vazeille M, Moutailler S, Coudrier D, et al. Two Chikungunya isolates from the
outbreak of La Reunion (Indian Ocean) exhibit different patterns of infection in
the mosquito, Aedes albopictus. PLoS One. 2007;2(11):e1168.
319. Hugo LE, Prow NA, Tang B, et al. Chikungunya virus transmission between
Aedes albopictus and laboratory mice. Parasit Vectors. 2016;9(1):555.
320. Poo YS, Rudd PA, Gardner J, et al. Multiple immune factors are involved in
controlling acute and chronic chikungunya virus infection. PLoS Negl Trop Dis.
2014;8(12):e3354.
321. ARPAV. Dipartimento Regionale per la Sicurezza del Territorio Servizio
Meteorologico[Internet] [Regional Department for Territory Security
Meteorological Service]. Italy: Agenzia Regionale per la Prevenzione e
Protezione Ambientale del Veneto; 2018 [cited 2018 29 Jan]. Available from:
http://www.arpa.veneto.it/bollettini/storico/Mappa_2017_TEMP.htm
322. Ciocchetta S. WP 20150825 017 [Internet]. Australia: YouTubeAu, Ciocchetta
S, editor and producer; 2015; 1 video: 35 sec., color, 720x1280]. Available
from: https://www.youtube.com/watch?v=We7f10tPnKU
323. Reed LJ, Muench H. A simple method of estimating fifty per cent endpoints.
Am J Epidemiol. 1938;27(3):493-497.
324. Takken W. The role of olfaction in host-seeking of mosquitoes: a review. Int J
Trop Insect Sci. 1991;12(1-2-3):287-295.
325. Zouache K, Fontaine A, Vega-Rua A, et al. Three-way interactions between
mosquito population, viral strain and temperature underlying chikungunya virus
transmission potential. Proceedings of the Royal Society of London B:
Biological Sciences. 2014;281(1792):20141078.
326. Carrington LB, Armijos MV, Lambrechts L, et al. Fluctuations at a low mean
temperature accelerate dengue virus transmission by Aedes aegypti. PLoS Negl
Trop Dis. 2013;7(4):e2190.
References 135
327. Delatte H, Paupy C, Dehecq J, et al. Aedes albopictus, vector of chikungunya
and dengue viruses in Reunion Island: biology and control. Parasite (Paris,
France). 2008;15(1):3-13.
328. Paupy C, Delatte H, Bagny L, et al. Aedes albopictus, an arbovirus vector: from
the darkness to the light. Microbes Infect. 2009;11(14):1177-1185.
329. Paupy C, Ollomo B, Kamgang B, et al. Comparative role of Aedes albopictus
and Aedes aegypti in the emergence of Dengue and Chikungunya in central
Africa. Vector Borne Zoonotic Dis. 2010;10(3):259-266.
330. Charrel RN, de Lamballerie X, Raoult D. Chikungunya outbreaks-the
globalization of vectorborne diseases. N Engl J Med. 2007;356(8):769.
331. Thavara U, Tawatsin A, Pengsakul T, et al. Outbreak of chikungunya fever in
Thailand and virus detection in field population of vector mosquitoes, Aedes
aegypti (L.) and Aedes albopictus Skuse (Diptera: Culicidae). Southeast Asian J
Trop Med Public Health. 2009;40(5):951.
332. Pagès F, Peyrefitte CN, Mve MT, et al. Aedes albopictus mosquito: The main
vector of the 2007 Chikungunya outbreak in Gabon. PLoS One.
2009;4(3):e4691.
333. Fischer D, Thomas SM, Suk JE, et al. Climate change effects on Chikungunya
transmission in Europe: Geospatial analysis of vector’s climatic suitability and
virus’ temperature requirements. Int J Health Geogr. 2013;12(1):51.
334. Tilston N, Skelly C, Weinstein P. Pan-European Chikungunya surveillance:
designing risk stratified surveillance zones. Int J Health Geogr. 2009;8(1):61.
335. Sigfrid L, Reusken C, Eckerle I, et al. Preparing clinicians for (re-) emerging
arbovirus infectious diseases in Europe. Clin Microbiol Infect. 2017.
336. Erguler K, Chandra NL, Proestos Y, et al. A large-scale stochastic
spatiotemporal model for Aedes albopictus-borne chikungunya epidemiology.
PLoS One. 2017;12(3):e0174293.
337. Mordecai EA, Cohen JM, Evans MV, et al. Detecting the impact of temperature
on transmission of Zika, dengue, and chikungunya using mechanistic models.
PLoS Negl Trop Dis. 2017;11(4):e0005568.
338. Yixin HY, Carrasco AM, Dong Y, et al. The effect of temperature on
Wolbachia-mediated dengue virus blocking in Aedes aegypti. Am J Trop Med
Hyg. 2016;94(4):812-819.
339. Thu HM, Aye KM, Thein S. The effect of temperature and humidity on dengue
virus propagation in Aedes aegypti mosquitos. Southeast Asian J Trop Med
Public Health. 1998 Jun;29(2):280-4.
340. Kalan K, Šušnjar J, Ivović V, et al. First record of Aedes koreicus (Diptera,
Culicidae) in Slovenia. Parasitol Res. 2017:1-4.
341. McMeniman CJ, Lane RV, Cass BN, et al. Stable introduction of a life-
shortening Wolbachia infection into the mosquito Aedes aegypti. Science.
2009;323(5910):141-144.
References 136
342. Sinkins S, O'Neill S. Wolbachia as a vehicle to modify insect populations. In:
Handler AF, James AA, editors. Insect Transgenesis: Methods and Applications.
New York: CRC Press. pp. 271–287.
343. Alto BW, Wiggins K, Eastmond B, et al. Diurnal Temperature Range and
Chikungunya Virus Infection in Invasive Mosquito Vectors. J Med Entomol.
2017;55(1):217-224.
344. Adelman ZN, Anderson MA, Wiley MR, et al. Cooler temperatures destabilize
RNA interference and increase susceptibility of disease vector mosquitoes to
viral infection. PLoS Negl Trop Dis. 2013;7(5):e2239.
345. Myles KM, Wiley MR, Morazzani EM, et al. Alphavirus-derived small RNAs
modulate pathogenesis in disease vector mosquitoes. Proceedings of the
National Academy of Sciences. 2008;105(50):19938-19943.
346. Carver S, Bestall A, Jardine A, et al. Influence of hosts on the ecology of
arboviral transmission: potential mechanisms influencing dengue, Murray
Valley encephalitis, and Ross River virus in Australia. Vector Borne Zoonotic
Dis. 2009 Feb;9(1):51-64.
347. Edwards A. An unusual epidemic. Med J Aust. 1928;1:664-665.
348. Nimmo J. An unusual epidemic. Med J Aust. 1928;1:549-550.
349. Glass K. Ecological mechanisms that promote arbovirus survival: A
mathematical model of Ross River virus transmission. Trans R Soc Trop Med
Hyg. 2005 Apr;99(4):252-60.
350. Jones A, Lowry K, Aaskov J, et al. Molecular evolutionary dynamics of Ross
River virus and implications for vaccine efficacy. J Gen Virol. 2010 Jan;91(Pt
1):182-8.
351. Suhrbier A, La Linn M. Clinical and pathologic aspects of arthritis due to Ross
River virus and other alphaviruses. Curr Opin Rheumatol. 2004 Jul;16(4):374-9.
352. Mylonas AD, Brown AM, Carthew TL, et al. Natural history of Ross River
virus-induced epidemic polyarthritis. Med J Aust. 2002 Oct 7;177(7):356-60.
353. Lau C, Aubry M, Musso D, et al. New evidence for endemic circulation of Ross
River virus in the Pacific Islands and the potential for emergence. Int J Infect
Dis. 2017;57:73-76.
354. Reusken C, Cleton N, Melo MM, et al. Ross river virus disease in two Dutch
travelers returning from Australia, February to April 2015. Euro Surveill.
2015;20(31).
355. Mitchell C, Miller B, Gubler D. Vector competence of Aedes albopictus from
Houston, Texas, for dengue serotypes 1 to 4, yellow fever and Ross River
viruses. J Am Mosq Control Assoc. 1987;3(3):460-465.
356. Nicholson J, Ritchie S, Van Den Hurk A. Aedes albopictus (Diptera: Culicidae)
as a Potential Vector of Endemic and Exotic Arboviruses in Australia. J Med
Entomol. 2014;51(3):661-669.
References 137
357. Aaskov J, Fokine A, Liu W. Ross River virus evolution: Implications for
vaccine development. Future Virol. 2012;7(2):173-178.
Appendices 138
Appendices
Appendix A: Development of a protocol for vector competence using Ae.
albopictus as a model
Introduction
In Australia, experiments involving CHIKV and Ae. koreicus must be performed
in a PC3/QC3 insectary. In order to design protocols to evaluate the potential of Ae,
koreicus to vector CHIKV, preliminary experiments were performed with Ross River
virus (RRV) and Ae. albopictus. A vector competence study (Experiment 1 and 2) was
designed for and performed on Ae. albopictus from a colony maintained at QIMR
Berghofer to verify the validity of the protocol in assessing the vector competence of
this species for RRV.
Ae. albopictus were infected with RRV belonging to two different strains: a
human strain (ORG), and a bird strain (2982B) in consideration of the possible
differences of these two subtypes in the mosquito infection. This is an alphavirus
belonging to the family Togaviridae, which is endemic in Australia, and it presents
fewer restrictions in its experimental use than CHIKV. It is transmitted by a variety of
mosquitoes and several vertebrate species are suspected to play a role as reservoirs
[42], with a major role of marsupials as amplifying hosts [346]. The first reports linked
to this virus date back to 1928 [347, 348], and to date, three different strains of RRV
have been identified [346, 349, 350]. In humans, although in some cases the infection
could be asymptomatic [42], the clinical manifestation is usually associated with skin
rash, fever, and polyarthritis, with sequelae in some cases lasting over six months post
infection [351, 352]. Outside Australia, the virus has been repeatedly reported from
the Pacific Island Countries and Territories [353]; however, due to the variety of
Appendices 139
vectors involved and globalisation of travel, European outbreaks cannot be excluded
[354].
The role of Ae. albopictus as a vector for RRV was demonstrated for the first
time by the experimental infection of mosquito populations from Houston, Texas
infected with a RRV isolate from the Cook Islands [355]. Its role as a vector was
confirmed years later, with the experimental infection with RRV of Ae. albopictus
from a field population established in the Torres Strait region [356].
The aim of this experiment was to subsequently apply this model to the study of
Ae. koreicus.
After this model proved to be effective in evaluating the infection of the
mosquitoes and the dissemination of the virus to the saliva, the protocol was applied
to assess the risk of transmission of chikungunya associated with Ae. koreicus.
Methods
Mosquito rearing
Ae. albopictus originated from the QIMR Berghofer Quarantine colony
established in May 2014 from eggs collected on Hammond Island (Torres Strait,
Australia – Quarantine Import Permit Number 6-2104). The colony was maintained at
27 °C, 70 % relative humidity and 12:12 hour light:dark cycling, with 30 minute
crepuscular periods. Eggs were hatched by flooding dried eggs on paper with
rainwater. Larvae were reared in 45 x 40 x 5 cm white plastic trays in approximately
5 litres of rain water at densities of ≈ 500 larvae per tray. Larvae were fed ground
Tetramin® fish food solution in distilled water as per Table A1 to produce adults of
similar sizes (Table A1). Pupae were collected and placed in rainwater white trays (©
2014 Genfac Plastics Pty Ltd, 18.3 x 15.2 x 6.5 cm) inside a 30 × 30 × 30 cm cage
Appendices 140
(BugDorm®, MegaView Science Education Services Co., Taichung, Taiwan). Once
emerged, adult mosquitoes were provided with a 10% w/v sucrose solution ad libitum.
Table A.1: Volume of 0.125 g/ml Tetramin® fish food solution diluted in distilled
water administered daily to different instar larvae during rearing.
Oral infection with virus
After a 24-hour period of starvation in which 10% w/v sucrose solution in
distilled water was substituted with distilled water only, a bottle of hot water was
placed beside one of the cage walls. Females (five to six days old) that probed against
the bottle were aspirated and transferred to 750 ml plastic containers with gauze lids
(approximately 100 mosquitoes per container) and allowed to feed for one hour on
glass membrane feeders covered by a porcine intestinal membrane filled with an
infectious blood meal [235]. Infectious blood meals consisted of either one of two
strains of RRV (2982B-bird strain isolate from an infected bird [350] and ORG -human
strain isolate from a patient in north Queensland in 1989). The virus was added to
defibrinated sheep blood (Thermo Fisher Scientific® Aust Pty Ltd) at the final titers of
108.7 and 108.8 CCID50 per mL, respectively for the first experiment and106.8 CCID50
per mL for both strains in the second experiment.
Day Predominant Instar Tetramin® fish food solution
Volume per tray (mL)
0 I 0.5
1 I 0.5
2 I 0.5
3 II 1
4 III 1.5
5 III 1.5
6 IV 2
7 IV 2
8 3/4 IV, 1/4 Pupae 1.5
9 1/2 IV, 1/2 Pupae 1
10 Mostly Pupae 0
Appendices 141
The core of the glass membrane feeder was surrounded by a chamber that
contained water circulating from a 37°C bath to warm the blood. Cups of mosquitoes
were exposed to one of each of the above dilutions of viruses. As a control, one cup of
mosquitoes was fed under the same conditions on blood without virus. The infectious
blood provided was sampled before and after the feeding to quantify any degradation
of the virus titre over the feeding period.
After feeding, mosquitoes were anesthetised with CO2 and sorted on a cold table
(4°C). Non-engorged females were discarded, while engorged females were
transferred to a clean container. A count of engorged and total mosquito numbers was
made to determine the proportion of feeding. The mosquitoes were maintained in
environmental chambers (Panasonic, Osaka, Japan) at 27 C, 70% relative humidity
and 12:12 hour light:dark cycling, with 30 minute crepuscular periods and provided
with 10% w/v sucrose as a food source.
Processing mosquitoes
Mosquito processing was carried out in a Perspex® glove box. In Experiment 1
mosquitoes were dissected at day six post-feeding. Based on the results obtained, RRV
virus dissemination in Ae. albopictus was evaluated in Experiment 2 at days three, six,
and 10 post-feeding.
The mosquitoes were anesthetised using CO2 and samples were dissected on a
cold table at 4°C. The legs and wings were removed from each mosquito and
transferred to a 1.5 mL microfuge tube containing four glass beads and then transferred
to dry ice, followed by storage at -80°C. Mosquitoes deprived of wing and legs were
placed on double-sided sticky tape on a glass plate and allowed to salivate for 20
minutes by inserting their proboscis into a P200 micropipette tip previously loaded
with 50 µL of collecting medium (RPMI 1640 with 3% v/v Foetal Bovine Serum
Appendices 142
(FBS), 1% v/v L-Glutamine, 1% v/v Penicillin Streptomycin, 0.25 μg/ml
Amphotericin B) (Gibco; Thermo Scientific, Waltham, MA, USA). Mosquitoes were
observed under a stereoscope and peristaltic movements of the abdomen and labellae
indicated that saliva was ejected. After 20 minutes, P200 tips were emptied into a 1.5
mL microfuge tube and the bodies were placed in a separate tube. All samples were
then stored at -80°C.
Detection of virus infection
Mosquito bodies were added to 500 µL of collecting medium and centrifuged at
10,000 rpm for 10 minutes at 4°C. Supernatants were tested for RRV in C6/36 plates
seeded two days before the inoculation at a density of 2.25×105cells/mL, in replicates
of two.
C6/36 (ATCC # CRL-1660) were cultured in 5% CO2 atmosphere at 27°C, with
15 ml of cell culture medium composed of RPMI 1640 added with 10% v/v Foetal
Bovine Serum (FBS), 1% v/v L-Glutamine, 1% v/v Penicillin Streptomycin (Gibco;
Thermo Scientific, Waltham, MA, USA). Cells were transferred every three to four
days after removing the medium, washing the cell monolayer three times with 5 ml of
phosphate buffered saline (PBS), then incubating with 0.5 ml of 0.05% v/v Trypsin-
EDTA, phenol red (Gibco; Thermo Scientific, Waltham, MA, USA) at 37°C for five
minutes to allow cells to detach from the tissue culture flasks lower wall. 96-well plates
were seeded with 200µL per well of cells in culture medium.
After two days, medium (180µL) was removed from the seeded plates and
replaced with 130µL fresh 3% FBS medium (RPMI 1640 with 3% v/v FBS, 1% v/v
L-Glutamine, 1% v/v Penicillin Streptomycin). On clean 96-well plates, 108µL of
collecting medium was added from well 1 to well 11 and 12µL of sample (mosquito
bodies or legs added of collecting medium) were added to the first well and mixed by
Appendices 143
resuspension. Then 12µL of this first undiluted solution were removed from the first
well and placed into the second well of the same row, making a tenfold dilution (10-
1). The procedure was repeated from well 1 to well 11 giving serial dilutions from 10-
1 to 10-10. 50µL of the final mosquito grind dilution obtained was added to a C6/36
plate in duplicate from well 2 to 12, well 1 was added of 50µL undiluted mosquito
bodies or legs added of collecting medium. The same protocol was applied for saliva
samples, with the exception of the quantity of the sample added to the first C6/36 well,
which was 10µL of undiluted sample. Plates were then incubated at 27°C for three
days.
After the three-day incubation period, plates were assayed using an ELISA. The
protocol of Jeffery et al. [316] was followed, except that the conjugate solution
(horseradish peroxidase-labelled affinity purified goat-antimouse immunoglobulin G,
DAKO Corporation, Carpinteria, CA, USA) was diluted at 1:1000 instead of 1:2000.
The final chromogenic substrate added to the plates consisted of 50µL/well of TMB
(3,3′,5,5′-tetramethylbenzidine, SIGMA®). The plates were then incubated in the dark
overnight.
Infectious titers of individual mosquitoes were determined using a formula for
calculating 50% end points [323] and expressed as the log10 TCID50/mosquito
(TCID50 is defined as dilution ratio of the virus to generate 50% mortality of the cells).
Immunohistochemistry assay
For Experiment 1, ten mosquitoes exposed to ORG RRV and eight mosquitoes
exposed to 2982B RRV were processed for immunohistochemistry. Samples were
deprived of wings and legs and submerged in a solution of 4% paraformaldehyde
(PFA) containing 0.5% Triton-X (v/v). After two hours mosquitoes were transferred
to 70% EtOH and stored at 4°C until processing. Paraffin sections were stained with a
Appendices 144
monoclonal antibody (D7 from hybridoma [357]) and an Alexa Fluor 488 donkey anti-
mouse secondary antibody (green), with DNA stained using DAPI (blue) as described
more recently by Hugo, Prow et al. [319]. Stained sections were scanned with Aperio
eSlide Manager and ImageScope Viewer software (Aperio).
Statistical analysis
Mosquito feeding rates were analysed using a 𝜒2 test. The infectivity (n of
positive mosquito bodies/total mosquito n) of the two virus strains was tested with
Fisher’s exact test. Statistically significant differences in virus titres in mosquito
bodies between strains were tested performing Mann-Whitney test. All the statistical
tests were performed with GraphPad Prism Program (GraphPad Software, San Diego,
CA, USA).
Results
RRV infection was initially tested in mosquito bodies. Saliva was processed only
from virus-positive body samples. The percentage of engorged mosquitoes obtained
from the two experiments is shown in Table A2.
TableA.2: Proportion of Ae. albopictus obtained after artificial feeding from
Experiment 1 and Experiment 2.
Experiment 1
Treatment
Group N. mosquitoes N. Fed % Fed
Control 140 31 22.1
ORG 584 99 16.9
2982B 460 66 14.3
Experiment 2
Treatment Group N. mosquitoes N. Fed % Fed
Control 191 36 18.8
ORG 396 105 26.5
2982B 347 95 27.4
For both experiments (Experiment 1 and 2), the feeding rates for mosquitoes fed
with blood infected with ORG RRV or 2982B RRV were not significantly different
Appendices 145
when compared to those fed with plain sheep blood (𝜒2 test, Experiment 1: P = 0.0883,
df= 4.853, 2; Experiment 2: P = 0.0702, df= 5.313, 2).
In the first experiment (Experiment 1), the infectivity for mosquitoes fed with
blood infected with ORG virus (86.2%, n=29) was not significantly different when
compared to mosquitoes fed with blood infected with 2982B RRV (90%, n=30)
(Fisher’s exact test, P = 0.7065) (Table A3). A statistical analysis was not applied to
the salivary dissemination (13% salivary dissemination for ORG RRV, 19.2% salivary
dissemination for 2982B; Table A4) due to the low number of samples. Titres for the
saliva samples ranged from100.8 TCID50/mL to104.8 TCID50/mL for ORG RRV (n=
3) and from 100.8 TCID50/mL to103.8 TCID50/mL for 2982B RRV (n= 5).
Table A3: Proportion of Ae albopictus bodies infected with ORG RRV and 2982B
RRV six days post-feeding.
Virus Total Positive Infectivity (%)
ORG 29 25 86.2
2982B 30 27 90.0
Table A4: Proportion of Ae albopictus with virus in the saliva for ORG RRV and
2982B RRV six days post-feeding.
Virus Total Positive Dissemination (%)
ORG 23 3 13
2982B 26 5 19.2
A Mann-Whitney test found a significant difference between the two strains in
titres, as assayed using mosquito bodies for Experiment 1 (P= 0.0222, U= 219.5,
Median of ORG= 5.8, n=25, Median of 2982B= 6.8, n=27) (FigureA.1).
Appendices 146
Figure A1: Box-Plot of virus titers in bodies of Ae. albopictus infected with ORG
RRV and 2982B RRV at Day six post-feeding (p< 0.05, Experiment 1).
Interestingly, the total percentage of infected bodies obtained with 2982B RRV
strain (76%, n=75) in the second experiment (Experiment 2) performed was
significantly different from the total percentage of body infected obtained with ORG
RRV strain (25.3%, n= 75) (Fisher’s exact test, P= 0.0003). Table A5 reports the
number of infected body for the two different virus strains per each time points and
the salivary dissemination of the virus.
Table A.5: Ae. albopictus body infection and saliva dissemination after feeding on
blood meal at final titers of 106.8 TCID50/mL of 2982B RRV and ORG RRV
(Experiment 2).
RRV strain Days post feeding Body infection (n) Saliva dissemination (n)
ORG 3 6 (25) 0 (6)
6 5 (25) 0 (5)
10 8 (25) 1 (8)
2982B 3 19 (25) 1 (19)
6 17 (25) 1 (17)
10 21 (25) 5 (21)
Appendices 147
Virus titres in Ae. albopictus bodies ranged from 102.8 to 107.8 TCID50/mL in
mosquitoes infected with ORG RRV (n= 19) and from 104.6 to 107.8 TCID50/mL (n=
57) in mosquitoes infected with 2982B RRV (Figure A2). Only one sample of Ae.
albopictus saliva was positive for ORG RRV at day 10 post feeding (104.8
TCID50/mL); one saliva sample was positive for 2982B RRV at both days three and
six post feeding (102.8 TCID50/mL in both samples), whereas saliva titres for 2982B
RRV at day 10 post feeding ranged from 101.8 TCID50/mL to 103.8 TCID50/mL (n=
5) (Figure A3).
Figure A2: Box-Plot of virus titers of mosquito bodies infected with ORG RRV and
2982B RRV at days six, 10, and 14 post-feeding (Experiment 2).
Appendices 148
Figure A3: Box-Plot of virus titers of mosquito saliva infected with ORG RRV and
2982B RRV at days six, 10 and 14 post-feeding (Experiment 2).
No statistical difference was found at day three post infection between mosquito
bodies infected with either virus strains (P= 0 0.0561, U= 28.5, Median of ORG= 3.8,
n=6, Median of 2982B= 5.8, n=19, Figure A4) when performing a Mann-Whitney test
for separate time points. At days six and 10 post infection, the titres of mosquito bodies
infected with 2982B RRV were significantly higher than ORG RRV (P= 0.0002, U=
1.5, Median of ORG= 4.8, n=5, Median of 2982B= 6.8, n=17, Figure A5; P= 0.0152,
U= 36.5, Median of ORG= 4.8, n=8, Median of 2982B= 6.8, n=21, Figure A6).
Appendices 149
Figure A4: Box-Plot of titers of RRV in mosquito bodies at day 3 post-feeding
(Experiment 2).
Figure A5: Box-Plot of titers of RRV in mosquito bodies at day 6 post-feeding (p<
0.0005, Experiment 2).
***
Appendices 150
Figure A6: Box-Plot of titers of RRV in mosquito bodies at day 10 post-feeding (p<
0.05, Experiment 2).
Of the samples analysed with immunohistochemistry, six mosquitoes showed
signs of 2982B RRV infection (n=8) and five mosquitoes showed signs of ORG RRV
infection (n=10). Infection had disseminated beyond the midgut in two of the six
mosquitoes infected with RRV 2982B and four of the five mosquitoes that showed
signs of RRV ORG (Figure A7).
*
Appendices 151
Figure A7: Indirect immunofluorescence on a section Ae. albopictus infected with
2982B RRV (a), demonstrating dissemination to the foregut (b) and to the midgut (c)
(Experiment 1).
Discussion and conclusion
The model proposed using the invasive mosquito Ae. albopictus to test Ae.
koreicus vector competence was successful. Low salivary dissemination rate of ORG
RRV and 2982B RRV obtained after the first experiment, although with some high
titres, led to a further evaluation of the possible role of Ae. albopictus in RRV
transmission by designing a second experiment to assess the virus dissemination at
different time points. This experiment confirmed previous results (Table A5).
Appendices 152
The results revealed that Ae. albopictus is susceptible to RRV infection and
dissemination, as confirmed by the indirect immunofluorescence assay (Figure A7)
and might still transmit the virus with a lower impact as a vector (ORG RRV higher
saliva titre of 104.8 TCID50/mL and 2982B RRV higher saliva titre of 103.8
TCID50/mL).
Appendices 153
Appendix B
Appendices 154
Appendices 155
Appendices 156
Appendices 157
Appendix C: Publications included in this document
Appendices 158
Appendices 159
Appendices 160
Appendices 161
Appendices 162
Appendices 163
Appendices 164
Appendices 165
Appendices 166
Appendices 167
Appendices 168
Appendices 169
Appendices 170
Appendices 171