The vascular endothelial growth factor receptor (VEGFR-1) supports growth and survival of human breast carcinoma

FAST TRACK

The vascular endothelial growth factor receptor (VEGFR-1) supports

growth and survival of human breast carcinoma

Yan Wu1, Andrea T. Hooper4, Zhaojing Zhong1, Larry Witte2, Peter Bohlen3, Shahin Rafii4 and Daniel J. Hicklin1*

1Department of Experimental Therapeutics, ImClone Systems Incorporated, New York, New York2Molecular Biology, ImClone Systems Incorporated, New York, New York3Research, ImClone Systems Incorporated, New York, New York4Department of Medicine, Division of Hematology-Medical Oncology, Howard Hughes Medical Institute,Weill Medical College of Cornell University, New York, New York

Vascular endothelial growth factor receptor 1 (VEGFR-1) is pres-ent on endothelial cells and subsets of human tumor cells, raisingthe hypothesis that angiogenic factors may promote tumor growthboth by inducing angiogenesis and directly signaling through acti-vation of VEGFR-1 on tumor cells. Here, we report that VEGFR-1 is expressed on a panel of 16 human breast tumor cell lines, andthe vasculature and the tumor cell compartment of a subset ofbreast carcinoma lesions, and that selective signaling throughVEGFR-1 on breast cancer cells supports tumor growth throughdownstream activation of the p44/42 mitogen-activated protein ki-nase (MAPK) or Akt pathways. Ligand-stimulated proliferationof breast tumor cells was inhibited by specific blockade with ananti-VEGFR-1 neutralizing monoclonal antibody. Treatment withanti-VEGFR-1 mAb significantly suppressed the growth ofDU4475, MCF-7, BT-474 and MDA-MB-231 breast xenografts inathymic mice. Histological examination of anti-VEGFR-1 mAbtreated tumor xenografts showed a significant reduction of activa-tion of the p44/42 MAPK or Akt pathways in tumor cells resultingin an increase in tumor cell apoptosis. Importantly, cotreatmentwith mAbs targeting human VEGFR-1 on tumor cells and murineVEGFR-1 on vasculature led to more potent growth inhibition ofbreast tumor xenografts. The results suggest that VEGF receptorsmay not only modulate angiogenesis, but also directly influencethe growth of VEGF receptor expressing tumors.' 2006 Wiley-Liss, Inc.

Key words: angiogenesis; VEGFR-1 (Flt-1); breast cancer; endothelium;placental growth factor (PlGF)

Despite significant advances in early detection and treatment,breast carcinoma is the second most prevalent cancer in women inthe United States, accounting for nearly 1 out of every 3 cancersdiagnosed, and is the second leading cause of cancer-related mor-tality.1 At time of detection, approximately 80% of all breast car-cinoma cases are pathologically diagnosed as invasive or infiltrat-ing where they have spread beyond the duct or lobule of origininvading into the surrounding tissue of the breast. Although sur-gery with subsequent chemo- or radiotherapy is the primary courseof treatment for most breast carcinomas, the recent clinical suc-cess of therapeutics, which target specific proteins expressed bytumor cells, has demonstrated that growth factor receptor and tyro-sine kinase inhibitors have important clinical benefit.2

Growth and regulation of breast tumor cells involve a variety ofsteroid hormones and receptors, proteinases and growth factorsand their cognate receptors. Several members of the epidermalgrowth factor receptor (EGFR) family, such as EGFR and HER2,have been shown to be over-expressed in breast carcinoma and aremediators of pathogenesis.3 Also, among growth factors, vascularendothelial growth factor (VEGF) has been indicated to play amajor role in breast carcinoma, as higher levels of cytosolicVEGF-A represent a strong independent prognostic factor innode-negative as well as node-positive breast cancers.4

VEGF-A is a multifunctional cytokine, which is a central regu-lator of physiological and pathological angiogenesis.5,6 VEGF-Aexerts its effects predominantly through 2 receptor tyrosine ki-nases, VEGFR-1/Flt-1 and VEGFR-2/KDR/Flk-1. Although func-

tional VEGF-A receptors are primarily expressed on endothelialcells,7,8 it is now well established that VEGFR-1 is expressed onother cell types, including hematopoietic cells, monocytes andsmooth muscle cells.9–13 Little is known about the signaling cas-cades downstream of VEGFR-1, which may convey signals formonocyte migration and survival14,15 as well as positive or nega-tive signals for endothelial cell mitogenesis and chemotaxis de-pending on the biological condition.16,17 Importantly, another mem-ber of the VEGF family, placental growth factor (PlGF), a specificligand for VEGFR-1, has been shown to promote hematopoiesisand pathological angiogenesis through activation of VEGFR-1.18–21

Several studies have demonstrated the presence of VEGF-Areceptors on hematological malignant cells and solid tumor cellsincluding those of nonsmall cell lung carcinoma, melanoma, pros-tate carcinoma, leukemia and breast carcinoma.22–28 We haveshown that functional VEGF-A/VEGFR-2 autocrine loops arepresent in subsets of human leukemias and support in vivo leuke-mic cell survival and migration.29,30 Therefore, in subsets ofhuman tumors, such as leukemias, VEGF-A may promote growthby directly acting on its receptors via an endothelial cell-independ-ent pathway. In one report, it was demonstrated that VEGFR-1 isexpressed in several breast carcinoma cell lines and that stimula-tion of T-47D breast carcinoma cells with VEGF-A induced inva-sion and signaling in vitro, suggesting a possible autocrine path-way leading to increased tumorigenesis.28 Increased VEGFexpression was reported to be associated with more aggressivetumors through competing with the ligand SEMA3F binding toneuropilin-1 and reducing SEMA3F–mediated suppression of tu-mor angiogenesis in lung cancer.31 Recently, the expression ofVEGFR-1 in breast carcinomas was determined as a significantprognostic indicator of poor outcome, high risk of metastasis andrelapse.32 However, there have been no reports that have formallyevaluated the physiological significance of VEGFR-1 expressionin human breast carcinoma cells and the role of the VEGF-A/VEGFR-1 pathway in breast cancer cells in in-vivo models.

In this study, we examined the role of VEGFR-1 signaling ingrowth and survival of human breast tumor cells and determinedthe potential utility of anti-VEGFR-1 neutralizing monoclonalantibody (mAb) therapy in inhibition of human breast carcinomacells in vitro and human breast carcinoma xenografts in vivo.VEGF-A or PlGF treatment stimulated the growth of breast carci-noma cells in vitro. Blockade of VEGFR-1 function on severalhuman breast carcinomas by an anti-VEGFR-1 neutralizing mAbsuppressed tumor growth in vivo. The antitumor effect was a resultof reduction in activation of MAPK or/and Akt in tumor cellsresulting in reduced proliferation and increased apoptosis. Con-

*Correspondence to: ImClone Systems Incorporated, 180 VarickStreet, New York, NY 10014, USA. Fax:1(212) 645-2054.E-mail: [email protected] 30 August 2005; Accepted 12 January 2006DOI 10.1002/ijc.21865Published online 2 May 2006 in Wiley InterScience (www.interscience.

wiley.com).

Int. J. Cancer: 119, 1519–1529 (2006)' 2006 Wiley-Liss, Inc.

Publication of the International Union Against Cancer

comitant treatment with neutralizing mAbs against humanVEGFR-1 inhibiting functions in cancer cells and against murineVEGFR-1 blocking tumor angiogenesis led to a more potent inhi-bition of tumor growth than either treatment alone. Taken to-gether, these findings suggest that VEGFR-1 has an essential andfunctional role in the growth of breast carcinoma and that target-ing VEGFR-1 may be a novel antitumor strategy for the treatmentof breast carcinoma.

Material and methods

Materials

All reagents and chemicals were purchased from Sigma (St.Louis, MO), unless otherwise noted. Human VEGF165 (VEGF-A)and soluble recombinant extracellular domains of VEGFR-1-alka-line phosphatase (rhuVEGFR-1-AP) proteins were expressed in sta-bly transfected cells and purified from cell culture supernatant, fol-lowing the procedures described previously.33 Cell culture ware andassay plates were purchased from BD Biosciences (Bedford, MA).

Cell lines

The human breast carcinoma cell lines of DU4475, MCF-7, T-47D, SK-BR-3, MDA-MB-157, MDA-MB-175, MDA-MB-231,MDA-MB-435, MDA-MB-468, AU565, BT-474, BT-483, HCC38,UACC-812 and ZR-75-1, and mouse breast tumor cell line 4T1and P3-X63-Ag8.653 myeloma cell line were purchased fromAmerican Type Tissue Culture Collection (ATCC, Manassas, VA).The human breast cancer cell line MX-1 was obtained from NationalCancer Institute (NCI, Frederick, MD). These cell lines were main-tained in RPMI1640, DMEM, Leibovitz’s L-15, or MaCoy’s 5Amedium (Invitrogen/Life Technologies, Rockville, MD) containing10% FCS (HyClone, Logan, UT) and supplements of L-glutamine,HEPES, glucose or insulin for some cell culture at 37�C in ahumidified, 5% CO2 atmosphere, according to the instruction pro-vided by ATCC and NCI. Porcine aorta endothelial (PAE) cells andVEGFR-1 expressing PAE (PAE-VEGFR-1) cell line were pro-vided by Dr. L. Claesson-Welsh, Uppsala University, and culturedin F12 medium (Invitrogen/Life Technologies, Rockville, MD) con-taining 10% FCS (HyClone, Logan, UT). Human umbilical vein en-dothelial cells (HUVEC) were cultured in complete endothelial me-dium as previously described.30

Anti-VEGFR-1 antibodies

Monoclonal antibodies (mAbs) specifically bound to VEGFR-1were generated by a standard hybridoma technology. Briefly,BALB/c mice or Lewis rats (Harlan Sprague Dawley, Indianapo-lis, IN) were immunized subcutaneously (s.c.) with the recombi-nant human or mouse VEGFR-1-AP proteins emulsified in com-plete Freund’s adjuvant. Animals were intraperitoneally (i.p.)boosted 3 times with either VEGFR-1 protein in incompleteFreund’s adjuvant. Splenocytes were harvested from the immu-nized animals and fused with myeloma cells. The cells were thencultured in HAT (hypoxanthine, aminopterin and thymidine)selection medium for establishing hybridomas. Hybridomas pro-ducing anti-VEGFR-1 specific antibodies were identified byELISA-based binding and blocking, as previously described.34

Positive hybridomas were subcloned 3 times for establishment ofmonoclonal hybridoma cell lines. Antibodies were produced in se-rum-free fermentation and purified through a Protein-A affinitychromatography process.

VEGFR-1 blocking assay

To determine blocking activity of the anti-VEGFR-1 antibodies,mAbs 6.12 or MF1 in different concentrations were preincubatedwith human or mouse VEGFR-1 AP in the ELISA buffer for 1 hrand then incubated in VEGF-A or PlGF (R & D Systems, Minneap-olis, MN) coated 96-well microtiter plates for another hour. Afterwashing, p-nitrophenyl phosphate substrate for AP was added forcolor development, following the manufacturer’s instruction. Theabsorbance at 405 nm was read on a microtiter plate reader (Molec-ular Devices Corp., Sunnyvale, CA) for quantification of VEGFR-1

binding to VEGF-A or PlGF. Data were analyzed using a GraphPadPrism Software (GraphPad Software Inc., San Diego, CA).

Immunohistochemical analysis of human breast carcinomas

Four to six micron of frozen sections or frozen tissue arrays ofhuman normal breast and invasive ductal breast carcinoma of vary-ing pathological stages were stained for VEGFR-1 using theEnVision1Mouse kit (DAKO, Carpinteria, CA) per manufacturer’sinstructions with subtle modifications. Briefly, endogenous peroxi-dases were blocked using Peroxidase Block from the kit, for 5 minat RT. After washing, a mouse monoclonal antibody againsthuman VEGFR-1 (FB5) or isotype control was incubated with thetissue sections at 1 ug/ml for 1 hr at RT, followed by 3 PBSwashes to remove unbound antibody. Anti-mouse IgG HRP-la-beled polymer was incubated with the sections for 30 min at RT,followed by PBS washes. Staining was developed using diamino-benzidine (DAB)1 for 5 min at RT, followed by brief counter-staining in Mayer’s hematoxylin (DAKO), blueing, dehydration,clearing and coverslipping in a permanent mounting medium. Pos-itive immunostaining was analyzed and imaged using an Axioskoplight microscope with an Axiocam digital camera (Zeiss, Thorn-wood, NY).

RNA extraction, cDNA synthesis and RT-PCR

Total RNA was isolated using Trizol (Gibco BRL, Rockville,MD), first-strand cDNA was subsequently synthesized using Super-Script II reverse transcriptase, according to manufacturer’s protocol(Amersham Pharmacia Biotech, Piscataway, NJ). A PCR was per-formed using Advantage 2 polymerase mix (Clontech LaboratoriesInc., Palo Alto, CA) by the following steps: denaturation at 94�Cfor 5 min, annealing at 63�C for 45 sec, and extension at 72�C for45 sec in a precycle reaction; followed by 35 cycles: 94�C for 1 min,63�C for 45 sec, 72�C for 2 min and a final extension at 72�C for7 min. Primers used for VEGFR-1 RT-PCR: 50-primer ATTTGT-GATTTTGGCCTTGC, 30-primer CAGGCTCATGAACTTGAAAGC;VEGF: 50-primer CGAAGTGGTGAAGTTCATGGATG, 30-primerTTCTGTATCAGTCTTTCCTGGTGAG; PlGF: 50-primer CGCTGG-AGAGGCTGGTGG, 30-primer GAACGGATCTTTAGGAG CTG;Primers used for G3PDH: 50-primer TGAAGGTCGGAGTCAACG-GATTTGGT, 30-primer CATGTGGGCCATGAGGTCCACCAC,and b-actin: 50-primer TCATGTTTGAGACC TTCAA, 30-primerGTCTTTGCGGATGTCCACG. We used oligonucleotide primersdesigned to amplify 3 of the VEGF splicing variants (121,165and189).

Flow cytometry analysis

Aliquots of 106 breast carcinoma cells or PAE-VEGFR-1 cellswere harvested from subconfluent cultures and incubated withVEGFR-1 specific mAb FB5, 6.12 or MF1 in PBS with 1% BSAand 0.02% sodium azide (staining buffer) for 1 hr on ice. Amatched mouse IgG isotype (Jackson ImmunoResearch, WestGrove, PA) was used as a negative control. For confirmation ofMF1 binding activity with VEGFR-1, 4T1 cells were incubatedwith 2 lg/ml of VEGF-A prior to addition of MF1. Cells werewashed twice with flow buffer and then incubated with a FITC-labeled goat anti-mouse IgG antibody (BioSource International) instaining buffer for 30 min on ice. Cells were washed as earlier andanalyzed on an Epics XL flow cytometer (Beckman-Coulter,Hialeah, FL). Dead cells and debris were eliminated from the anal-ysis, on the basis of forward and sideways light scatter. The meanfluorescent intensity ratio (MFIR) was calculated to quantitate rel-ative expression levels of VEGFR-1 in these cell lines. The MFIRis the mean fluorescence intensity (MFI) of cells stained withVEGFR-1 specific mAb divided by the MFI of cells stained withan isotype control mAb.

Measurement of VEGF and PlGF levels in cellculture supernatants

Human breast carcinoma cells were cultured for 48 hr prior toanalysis. VEGF-A and PlGF levels in the cell culture supernatants

1520 WU ET AL.

were assessed using ELISA Quantikine Kits (R & D Systems,Minneapolis, MN) per manufacturer’s instructions and normalizedto protein content equal to pg/106 cells/ml. Each sample was meas-ured in duplicate.

Protein extraction and Western blotting

BT-474, DU4475, MCF-7 and MDA-MB-231 cells were seededat a density of 5 3 105/dish in 100 3 20 mm2 petri dishes and cul-tured in serum-free medium for 18 hr. After replacing the culturemedium, the cells were treated with 100 nM of mAb 6.12 or iso-type control for 1 hr and then incubated with 50 ng/ml of VEGF-Aor 100 ng/ml of PlGF for 10 min. After treatments, total cell pro-tein extracts were isolated, immunoprecipitated and immuno-blotted as described previously.25 For evaluation of MAPK andAkt phosphorylation, cell lyses were subjected to SDS-PAGE fol-lowing electrotransfer. Membranes were incubated with antibodiesagainst phosphorylated p44/p42 MAP kinases (Thr202/Tyr204;Cell Signaling Technology, Beverly, MA) or phosphorylated Akt(Ser473, Cell Signaling Technology, Beverly, MA), at a concen-tration of 1 lg/ml, followed by incubation with a secondary HRPconjugate (EMD Biosciences, San Diego, CA). To ensure equalloading of samples, membranes were stripped and reprobed withanti-p44/p42 (Cell Signaling Technology, Beverly, MA) or anti-Akt antibodies (Cell Signaling Technology, Beverly, MA). Pro-teins were detected using the ECL chemiluminescence system(Amersham Pharmacia Biotech, Piscataway, NJ), and quantifiedby densitometry using NIH Image (National Institute of MentalHealth, Bethesda, MD).

Cell proliferation assays

DU4475 carcinoma cells were seeded at a density of 5 3 103/well into 96-well plates in serum-free conditions for 24 hr. Fordetermination of stimulatory effect of growth factors on the tumorcells, the cells were incubated with VEGF-A (25–200 ng/ml) orPlGF (50–400 ng/ml) in 1 or 5% FCS containing RPMI1640 me-dium for additional 48 hr. To assess the inhibitory effect of anti-VEGFR-1 antibody on the tumor cell growth, the cells were incu-bated with mAb 6.12 at dose of 0.3, 1, 3, 10, 30 and 90 lg/ml inthe presence of 50 ng/ml of VEGF-A or 200 ng/ml of PlGF foradditional 48 hr. Viable cells were counted in triplicate using aCoulter cytometer (Coulter Electronics Ltd. Luton, Beds, Eng-land). Each experiment was done in triplicate. Following formulawas used for calculation of percentages of the control. %Control 5((Tx 2 To)/(GC 2 To)) 3 100. Tx, antibody-treated; To, untreatedbackground; GC, growth control, i.e., VEGF-A or PlGF stimulatedcell growth.

Treatment of human breast carcinoma xenografts

Athymic nude mice (Charles River Laboratories, Wilmington,MA) were injected subcutaneously in the left flank area with 2 3106 of DU4475 cells or 5 3 106 of BT-474, MCF-7 and MDA-MB-231 cells mixed in Matrigel (Collaborative Research Bio-chemicals, Bedford, MA). For estrogen-dependent BT-474 andMCF-7 models, the mouse was implanted subcutaneously with apellet containing 0.72 mg of 17-b-estradiol (Innovative Researchof America, Sarasota, FL) 3 days prior to engraftment of tumorcells. Tumors were allowed to reach approximately 200 mm3 insize, and then, mice were randomized into groups of 10 animalsper group. Animals received intraperitoneal administration of anti-human VEGFR-1 mAb 6.12 at a dose of 1 mg every 3 days or ve-hicle control. Anti-mouse VEGFR-1 mAb MF1 at the same dosewas used in combination treatment with mAb 6.12 in the DU4475tumor model. Treatment of animals was continued for the durationof the experiment. Tumors were measured twice each week withcalipers. Tumor volumes were calculated using the formula [p/6(w1 3 w2 3 w2)], where ‘‘w1’’ represents the largest tumor diam-eter and ‘‘w2’’ represents the smallest tumor diameter. All animalstudies were conducted under approved IACUC protocols.

Immunohistochemical analysis of human breast xenografts

Paraffin-embedded BT-474, DU4475, MCF-7 and MDA-MB-231 xenografts were immunohistochemically stained with Ki-67rabbit polyclonal antibody (pAb, 5 lg/ml; Lab Vision, Fremont,CA), phospho-specific p44/42 MAPK (Thr202/Tyr204) rabbitpAb (1 lg/ml; Cell Signaling Technology), phospho-specific AKT(Ser473) rabbit pAb (2 lg/ml; Cell Signaling Technology), fol-lowed by the EnVision1 System for rabbit antibodies (DAKO,Carpinteria, CA) per kit instructions. The peroxidase reaction wasdeveloped with DAB1 substrate per kit instructions. After briefcounterstaining in Mayer’s hematoxylin, all sections were dehy-drated, cleared and coverslipped using a permanent mounting me-dium. Tumor apoptosis was assessed by TUNEL assay usingin situ cell death detection kit (Roche Molecular Biochemicals, In-dianapolis, IN), per kit instructions. Stained sections were cover-slipped with Gelmount (Biomeda, Foster City, CA). Positive im-munostaining and TUNEL positive immunofluorescence were an-alyzed and imaged using an Axioskop light microscope with anAxiocam digital camera (Zeiss, Thornwood, NY).

Statistical analysis

The difference of tumor volume and in vitro tumor cell growth ratewere analyzed using Student’s t-test. The difference of VEGFR-1expression in cancer cells in tumor lesions between or among gradewas analyzed using chi-square analysis. The statistic analysis wasperformed using the SigmaStat statistical package (v. 2.03; JandelScientific, San Rafael, CA). Differences of p < 0.05 were consid-ered statistically significant.

Results

Specificity and binding and blocking activity ofanti-VEGFR-1 antibodies

Anti-human VEGFR-1 neutralizing mAb 6.12 and a nonneutral-izing mAb FB5 were raised from a human VEGFR-1 protein-immunized mouse. Anti-mouse VEGFR-1 neutralizing mAb MF-1was raised from a rat immunized with mouse VEGFR-1 protein.Specificity of mAbs 6.12 and MF1 to human VEGFR-1 or mouseVEGFR-1 was reported previously.34 Binding assay indicated thatthe nonneutralizing anti-human VEGFR-1 mAb FB5 had a strongbinding activity with human VEGFR-1 and a weak binding activ-ity with mouse VEGFR-1 (data not shown). Flow cytometry anal-ysis showed the binding activity of mAb 6.12 with surface ex-pressed VEGFR-1 on PAE-VEGFR-1 transfectant cells (Fig. 1a).The antibody 6.12 displayed no binding activity with parental por-cine aorta endothelial cells (data not shown). A similar result wasobserved with mAb FB5 in FACS (data not shown). Binding activ-ity of anti-mouse VEGFR-1 neutralizing antibody MF1 with surfaceexpressed VEGFR-1 on 4T1 tumor cells was demonstrated in flowcytometry where MF1 recognized VEGFR-1 on the cells and thebinding activity was diminished by VEGF-A, confirming the speci-ficity of MF1 to VEGFR-1 (Fig. 1b). Anti-human VEGFR-1 mAb6.12 effectively blocked the binding of VEGF-A and PlGF tohuman VEGFR-1 with an IC50 of 0.6 and 0.3 nM, respectively(Figs. 1c and 1d). Anti-mouse VEGFR-1 mAb MF1 effectivelyblocked the binding of PlGF and VEGF-A to mouse VEGFR-1 withan IC50 of 0.1 and 0.3 nM, respectively (Figs. 1e and 1f). A controlisotype-matched antibody did not interfere with the ligand bindingto VEGFR-1.

Expression of VEGF-A receptors in primary breastcarcinoma tissue sections

We analyzed the pattern of VEGFR-1 expression in tissue sec-tions of 65 cases of invasive ductal breast carcinomas and 18 casesof normal breast tissues. VEGFR-1 expression was detected onsubsets of epithelial tumor cells in invasive ductal carcinoma in15.4% of the cases studied, but was negative in the epithelial cellsof normal breast tissues (data not shown). The staining pattern forVEGFR-1 expression in cancer cells was heterogeneous within the

1521THE ROLE OF VEGFR-1 IN BREAST CANCER

lesions analyzed (Fig. 2a,b). VEGFR-1 expression, in most cases,was detected on the tumor vascular endothelium (Fig. 2c).VEGFR-1 expression was also frequently detected on myoepithe-lial cells surrounding the intraductal tumor cells found withininvasive carcinomas (Fig. 2d). These results suggest that VEGFR-1 expression in breast tumor cells, myoepithelial cells and tumorvascular endothelium may be indicative of malignant phenotypefor invasive ductal carcinoma. Histology analysis indicates thatthe difference of VEGFR-1 expression in cancer cells between oramong grades is not statistically significant (p > 0.4), suggestingthat VEGFR-1 expression in ductal invasive breast carcinomascollected from different grades of 65 tumor samples may not beassociated with invasiveness of disease. The correlation ofVEGFR-1 expression with tumor grade is summarized in Table I.

VEGF-A, PlGF and VEGFR-1 are coexpressed by humanbreast carcinoma cell lines

VEGF-A, PlGF and VEGFR-1 expression were analyzed in 16breast carcinoma cell lines. VEGF-A was expressed at the mRNAand protein levels in all cell lines tested (Table II). PlGF tran-

scripts were detected in all cell lines, but PlGF protein was barelydetectable in the supernatant collected from these cultured celllines. VEGFR-1 mRNA was detected in 100% of the breast carci-noma cell lines (Table II). All cell lines were positive for cell sur-face expressed VEGFR-1 as examined by flow cytometry. Expres-sion of the VEGFR-1 on the cell lines BT-474, DU4475, MCF-7and MDA-MB-231 is shown in Figure 3a as a representativeresult. Figure 3b shows the mRNA expression of VEGFR-1 in 4representative cell lines BT-474, DU4475, MCF-7 and MDA-MB-231. These results indicate that VEGFR-1 and its ligand VEGF-Aare widely coexpressed in breast carcinoma cell lines.

VEGF and PlGF induce activation of downstream signalingsin breast cancer cells

To address whether VEGF-A or PlGF stimulation inducesVEGFR-1-mediated activation of downstream signaling pathways,the ligand-induced phosphorylation of p44/p42 MAP kinase andAkt was examined in BT-474, DU4475, MCF-7 and MDA-MB-231 cells. VEGF-A or PlGF stimulation induced phosphorylationof MAPK in MCF-7 cells (Fig. 4a). The ligand-induced MAPK

FIGURE 1 – Specificity and block-ing activity of the anti-VEGFR-1mAbs. (a) The anti-human VEGFR-1antibody 6.12 specifically binds tosurface expressing VEGFR-1 onPAE-VEGFR-1 transfectant cells(open histogram). Gray histogramrepresents the staining with irrel-evant isotype-matched IgG. (b)Anti-mouse VEGFR-1 antibodyMF1 specifically binds to murineVEGFR-1 expressing 4T1 cells(green line histogram). The bindingactivity is diminished by VEGF-A(red line histogram). Anti-humanVEGFR-1 mAb 6.12 effectivelyblocked the binding of VEGF-A(c) and PlGF (d) to humanVEGFR-1. Anti-mouse VEGFR-1mAb MF1 effectively blocked thebinding of VEGF-A (e) and PlGF(f) to mouse VEGFR-1. A controlisotype-matched antibody did notinterfere with the ligand binding toVEGFR-1.

1522 WU ET AL.

activation was inhibited by treatment with the anti-VEGFR-1 mAb6.12. Isotype-matched irrelevant IgG did not have effect on theMAPK activation. A high level of constitutive phosphorylation ofMAPK was detected in BT-474, DU4475 and MDA-MB-231 cellsand was not affected by either stimulation with exogenous VEGF-A and PlGF or treatment with anti-VEGFR-1 mAb 6.12 as shownin Figures 4b–4d, respectively. VEGF-A and PlGF treatmentmarkedly increased phosphorylation of Akt in BT-474 cells (Fig.4b). The ligands-induced Akt activation in the cells was blockedby treatment with the anti-human VEGFR-1 mAb 6.12. Isotype-matched irrelevant IgG did not have effect on the Akt activation.Activation of Akt via VEGFR-1 stimulation was not induced byligand stimulations in the MCF-7, DU4475 and MDA-MB-231cells as shown in Figures 4a, 4c and 4d, respectively. These resultssuggest that the ligand-stimulated VEGFR-1 activation can inducesubsequent MAPK or Akt downstream signaling cascades in cer-tain breast tumor cell lines in low serum culture conditions.

VEGF-A and PlGF induce in vitro proliferationof breast cancer cells

To assess growth of breast cancer cells in response to ligandstimulation, the suspension DU4475 cell line was selected for pro-liferation assay. The tumor cells were cultured in serum-free me-dium for 24 hr and then treated with exogenous VEGF-A or PlGFfor additional 48 hr. Stimulation with VEGF-A or PlGF resultedin a dose-dependent increase in DU4475 cell proliferation (datanot shown). Treatment with the neutralizing anti-human VEGFR-1 mAb 6.12 for 72 hr significantly inhibited either VEGF-A orPlGF stimulated proliferation of DU4475 carcinoma cells in dose

response (Figs. 5a and 5b). An IgG isotype control did not showinhibitory effect on cell proliferation. The inhibitory effect of anti-VEGFR-1 mAb was not observed in the assay where the cellswere cultured in medium containing serum greater than 5% (datanot shown), likely due to lack of effect of the mAbs on the stimu-lation of the tumor cells induced by other growth factors in highconcentration serum.

Inhibition of VEGFR-1 by a specific mAb suppresses in vivogrowth of human xenograft breast carcinomas

To evaluate the functional role of VEGFR-1 on the breast can-cer cells in vivo, we performed xenograft studies with neutralizinganti-human VEGFR-1 mAb 6.12 to test whether VEGFR-1 block-ade prevent the growth of VEGFR-1 expressing human breasttumors established in athymic mice. Systemic administration ofmAb 6.12 at a dose of 1 mg/mouse every 3 days led a statisticallysignificant (p < 0.05) suppression of the growth of DU4475, BT-

FIGURE 2 – Subsets of ductal breast carci-noma cells express VEGFR-1. Frozen sectionsof human ductal breast carcinoma were im-munostained with anti-VEGFR-1 mAb FB5.VEGFR-1 expression pattern was variable be-tween different tumor samples. VEGFR-1 im-munoreactivity was observed on subsets of tu-mor cells in invasive ductal carcinoma (a) and(b); Inset, isotype control). VEGFR-1 wasdetected on the tumor vascular endothelium inmost breast ductal carcinoma specimens (c).VEGFR-1 immunoreactivity was observed inthe myoepithelial layer surrounding intraductaltumor cells within invasive carcinomas (d).Original magnifications: 2003.

TABLE II – ANALYSIS OF VEGFR-1, VEGF AND PLGF EXPRESSION INHUMAN BREAST CARCINOMA CELL LINES

Cell LineVEGFR-1 VEGF PlGF

FACS RT-PCR ELISA RT-PCR ELISA RT-PCR

DU4475 91 1 2502 1 <302 1AU565 5 1 250 1 <30 1T-47D 5 1 1000 1 <30 1MCF7 6 1 680 1 <30 1MDA-MB-231 4 1 10,500 1 45 1MDA-MB-157 11 1 526 1 <30 1MDA-MB-175 3 1 150 1 <30 1MDA-MB-435 11 1 250 1 <30 1MDA-MB-468 6 1 429 1 <30 1MX-1 5 1 1,525 1 <30 1BT-474 6 1 1,050 1 <30 1BT-483 ND 1 350 1 <30 1HCC38 4 1 200 1 <30 1SKBR-3 7 1 500 1 <30 1UACC-812 ND 1 410 1 <30 1ZR-75-1 12 1 900 1 <30 1

ND, not determined.1MFIR, Mean fluorescence intensity ratio; MFIR indicates relative ex-

pression level of VEGFR-1 in the cells.–2Value 5 pg/106 cells per ml.

TABLE I – CORRELATION OF VEGFR-1 EXPRESSION WITH GRADE INBREAST CARCINOMAS

GradeVEGFR-1

No. oflesions

No. ofpositive (%)

p-value*

I 3 0 (0)II 32 6 (18.8) 0.41 (vs. I)III 30 4 (13.3) 0.49 (vs. I), 0.56 (vs. II)Total 65 10 (15.4) 0.63

*p-value was calculated using v2 analysis.


474, MCF-7 and MDA-MB-231 tumor xenografts (Table III, Figs.6a–6d). These results demonstrate that blockade of the VEGF-A/VEGFR-1 signaling pathway in VEGFR-1 positive breast carci-noma cells can lead to a significant inhibition of breast tumorgrowth. The antitumor effects are likely in part due to inhibitionof activation of p44/42 MAP kinase or Akt signaling by the anti-human VEGFR-1 mAb 6.12 as observed in histology analysis oftumor sections of the treated xenografts.

In vivo blockade of human and murine VEGFR-1 leadsto regression of human breast carcinoma xenograft

To assess the antitumor effects of dual blockade of host (mouse)VEGFR-1, thereby blocking endogenous hemangiogenesis, andVEGFR-1 present on human breast tumor cells in vivo, neutralizinganti-human VEGFR-1 mAb 6.12 and anti-mouse VEGFR-1 mAbMF1 were concomitantly given to mice bearing DU4475 breastcarcinoma xenografts. Combination treatment with mAbs 6.12 and

MF1 at a dose of 1 mg/mouse every 3 days resulted in an increasedantitumor activity than that of either treatment alone (Fig. 6e). Thedifference between dual antibody treatment and treatment with ei-ther antibody alone is statistically significant (p < 0.05). Moreover,regressions of established tumors of 4000 mm3 were observed aftercombination treatment with mAbs 6.12 and MF1 (Fig. 6f). Thesedata suggest that the anti-VEGFR-1 therapy may directly interferewith autocrine ligand stimulation of the VEGFR-1 expressing tu-mor cells in addition to disrupting tumor vascularization, therebyresulting in more effective antitumor effects in vivo.

Anti-human VEGFR-1 treatment inhibits in vivo signaling ofMAPK and Akt, and induces tumor cell apoptosis

To further analyze the effects of anti-human VEGFR-1 mAb6.12 treatment on intracellular activity in breast tumor xenografts,

FIGURE 3 – Gene and protein expression of VEGFR-1 in the breastcarcinoma cell lines. (a) Surface expression of VEGFR-1 on breastcarcinoma cells was detected by flow cytometry using anti-humanVEGFR-1 mAb FB5 (gray histograms). Open histograms represent thestaining with irrelevant isotype-matched IgG. Expression of VEGFR-1on BT-474, DU4475, MCF-7 and MDA-MB-231 cell lines is shownas a representative result. Mean fluorescence intensity ratio for theVEGFR-11 cells was summarized in Table I. B. VEGFR-1 geneexpression. RT-PCR relative to genes of VEGFR-1 and b-actin weredetected by RT-PCR, using the cDNA isolated from the breast carci-noma cancer cells. HUVEC was used for the positive control forVEGFR-1 expression. All breast carcinoma cell lines expressed com-parable level of VEGFR-1 messenger RNA. A representative resultwith 4 cell lines is shown.

FIGURE 4 – Ligands-induced activation of the downstream MAP ki-nase and Akt signaling pathways in breast carcinoma cells. (a) VEGF-A and PlGF induced an increase in p44/p42 MAPK phosphorylationin MCF-7 cells. Treatment with anti-VEGFR-1 mAb 6.12 inhibitedthe MAPK activation. A constitutive activation of p44/p42 MAPKphosphorylation was detected in BT-474 (b), DU4475 (c) and MDA-MB-231 (d) cells. Western blots were probed for phosphorylated p44/p42 MAPK (top) and reprobed with an antibody for total MAPK (sec-ond) in each panel. (b) Akt phosphorylation was increased by thetreatment with VEGF or PlGF, and inhibited by anti-VEGFR-1 mAb6.12 in the BT-474 cells. Akt phosphorylation was not altered in thepresence of ligands and mAb 6.12 in MCF-7 (a), DU4475 (c) andMDA-MB-231 (d) cells. The activation status of Akt kinase wasassessed using an Akt phospho-specific antibody (third) and total Aktlevels were evaluated using an anti-Akt antibody (4th) in each panel.

1524 WU ET AL.

cellular proliferation (Ki-67), apoptosis (TUNEL), phospho-specificp44/42 MAP kinase and Akt were examined by immunohisto-chemistry on the treated xenograft tumors. As shown in Figure 7a,activity of proliferative molecule Ki-67 was significantly reducedin the mAb 6.12 treated BT-474, MCF-7, and MDA-MB-231 tu-mor tissues, but such inhibitory effect was less pronounced intreated DU4475 tumors. Furthermore, anti-VEGFR-1 mAb treat-ment resulted in a markedly decreased activation of downstreamp44/p42 MAP kinases signaling in tumor cells in all treated xeno-graft tumors (Fig. 7b). A significant decrease in Akt phosphoryla-tion was detected in the mAb 6.12 treated BT-474 tumors in addi-

tion to an increase in apoptosis as measured by TUNEL positiveevents (Fig. 7c). These results suggest that the antitumor effects ofanti-VEGFR-1 mAb treatment on human breast tumor xenograftsis at least in part due to the disruption of cellular proliferation andsurvival signaling mechanisms specifically mediated by this recep-tor in breast cancer cells.

Discussion

The recent success of ‘‘antiangiogenic’’ strategies to treathuman cancers has opened up new avenues of research to improvethe therapeutic outcome of existing therapies. Recently, a neutral-izing mAb to VEGF-A was shown to improve clinical outcome incolorectal cancer patients when used in combination with existingchemotherapeutic regimens.35,36 However, the complex expres-sion pattern of VEGF-A and its receptors within the tumor andother host tissues have raised important questions related to theprecise mechanism whereby antiangiogenic agents exert their anti-tumor or ‘‘antivascular’’ effect.

The angiogenic factor VEGF-A promotes tumor angiogenesisprimarily through activation of VEGFR-1 and VEGFR-2 signalingpathways in endothelial cells. VEGFR-2 expression is primarilyrestricted to endothelial cells. In contrast, functional VEGFR-1expression is found not only on endothelium, but also in other nor-mal cell types, such as various hematopoietic lineages and smoothmuscle cells.9–13 In addition, VEGFR-1 expression has been de-tected on certain tumor cells, such as leukemias, melanoma, non-small cell lung carcinoma, prostate carcinoma and breast carci-noma.22–28 The significance of this observed expression has notbeen studied. Therefore, it is conceivable that angiogenic factorssupport tumor growth not only by inducing angiogenesis, but alsoby acting directly through VEGFR-1 expressed on the tumor cells.Here, we provide the first demonstration of VEGFR-1 expressionon breast cancer cells in situ and VEGFR-1 activation in tumorcells contributing to tumor growth in preclinical models. Usingneutralizing mAb that selectively targets human but not murineVEGFR-1, we demonstrate that inhibition of VEGFR-1 is effec-tive in blocking tumor growth in established breast tumor xeno-grafts. Furthermore, interference with the murine VEGFR-1 sig-naling by using selective antimurine VEGFR-1 mAb in combina-tion with mAb specific for human VEGFR-1 had an additiveeffect in diminishing tumor growth and angiogenesis. Collec-tively, these data introduce the novel concept that antiangiogenicagents may target vascular and nonvascular targets within subsetsof the breast cancers. Since the vast majority of solid tumors and avariety of hematologic malignancies have the capacity to expressVEGF-A, expression of VEGFR-1 by tumor cells implicates apotential role for VEGF-A/VEGFR-1 autocrine loops in thesetumors in addition to the paracrine loops in the stroma and endo-thelium. Consistent with this hypothesis, recent studies haveshown that for certain leukemias VEGFR-1 may be essential fortumor cell growth by promoting a VEGF-A/VEGFR-1 autocrineloop, that when disrupted induces tumor growth arrest and apopto-sis.25,27 In breast cancer cell lines, reports have demonstrated anincrease in survival and mitogenic signals promoted by VEGF-A,but the receptor and mechanisms responsible for this observed ac-tivity have not been fully characterized.28,37,38

FIGURE 5 – Inhibition of VEGF-A and PlGF-induced proliferationof VRGFR-1 expressing breast tumor cells. An increase in prolifera-tion was induced when DU4475 tumor cells was stimulated withligands (open diamond) VEGF-A (a) or PlGF (b). Treatment withanti-VEGFR-1 mAb 6.12 (closed diamond) significantly inhibitedVEGF-A (a) and PlGF (b) stimulated proliferation of DU4475 tumorcells in a dose response compared to control antibody treatment(closed triangle). Growth of cells untreated with ligands and antibod-ies (open square) represents basal activity. Data are represented as per-centage change of the number of antibody-treated cells versus the con-trol as described in the Methods. Asterisks indicate statistic signifi-cance (p < 0.005) of the difference in percent inhibition of cellstreated with mAb 6.12 and mAb control. This is a representativeexperiment of 3 with similar results.

TABLE III – SUMMARY OF TUMOR GROWTH INHIBITION WITHANTI-VEGFR-1 MAB 6.121

Xenograft No. of mice/group % T/C2 (day) p-value

DU4475 10 32 (26) <0.001MDA-MB-231 10 46 (49) <0.02BT-474 10 47 (52) <0.05MCF-7 10 62 (49) <0.05

1Anti-VEGFR-1 mAb 6.12 was administered i.p. at 1 mg/dose ev-ery 3 days.–2Percentage of tumor growth inhibition, where T is themean tumor volume of treated group and C is the mean tumor volumeof control group on the designated day.


Considerable experimental evidence has linked signalingthrough VEGFR-2 to mitogenesis, migration, survival and perme-ability in endothelial cells. Activation of PLC g, focal adhesion ki-nase, MAPK and Akt pathways downstream of VEGFR-2 activa-tion are all strongly implicated in mediating these diverse cellularprocesses.39,40 In contrast, VEGFR-1 has been reported to bemarkedly less effective in mediating such functions, and the sig-naling pathways downstream of VEGFR-1 activation are lessclearly understood. VEGFR-1 has been implicated as an inert‘‘decoy’’ receptor by some studies or as a negative regulator ofVEGFR-2 signaling in endothelial cells.17,41 This inhibitory effecthas been shown to be mediated through a PI-3K-dependent Rac1and CDC42 pathways.42 In addition, studies have shown that thejuxtamembrane region of VEGFR-1 prevents key signaling func-tions in endothelial cells.16 In contrast, other studies have shownthat VEGFR-1 plays a significant role in certain conditions ofpathological angiogenesis.20,21 Our results suggest that VEGFR-1activation promotes proliferation and survival signals through the

MAPK and Akt pathways in breast tumor cells, activities that areuniquely different from those induced in endothelial cells. Thesefindings raise the possibility that VEGFR-1 activation may elicitmitogenic and/or survival signals, which are cell-type specific,and that are distinctly different from those observed in endothelialcells. Alternatively, it is possible that other, as yet unidentifiedmembrane bound or intracellular mediators of VEGFR-1 signalingare present in subsets of breast tumor cells.

Our findings are consistent with a number of studies showingthat VEGF-A can be a survival factor for breast tumor cells. Inprevious studies, Price and colleagues demonstrated that VEGF-Astimulation induced the intracellular signaling of p44/42 MAP ki-nase and PI 3-kinase/Akt pathways in T-47D breast cancer cellsand in vitro invasion of the tumor cells.28 Bachelder et al. demon-strated a role for VEGF-A in the survival and invasive potential ofhuman breast tumor cell lines in vitro.38 VEGF-mediated survivalof breast tumor cells was found to be regulated through an Akt-de-pendent signaling pathway in these studies; however, the VEGF

FIGURE 6 – Inhibition of thegrowth of xenografts of VEGFR-1expressing human breast tumor cells.(a)–(d) Athymic nude mice bearingestablished breast tumor xenograftsof DU4475 (a), BT-474 (b), MDA-MD-231 (c) and MCF-7 (d) wereadministered with anti-humanVEGFR-1 mAb 6.12 (closed circle)at dose of 1 mg/dose 3 3 per weekwhen average tumor size reached�200 mm3. Mice in control groups(opened circle) were injected withvehicle (PBS). The antibody-medi-ated blockade of VEGFR-1 signifi-cantly suppressed the growth ofall human breast tumor xenografts.p-Values and % T/C are summar-ized in Table II. E, Combined treat-ments with 1 mg/dose of anti-human VEGFR-1 mAb 6.12 andanti-mouse VEGFR-1 mAb MF1(closed triangle) resulted in a morepotent antitumor effect compared toeither mAb 6.12 (closed circle) orMF1 (closed square) alone. Singleasterisk indicates statistic signifi-cance (p < 0.05) when comparingtreatment with antibody to control.Double asterisks indicate statisticsignificance (p < 0.05) when com-paring dual antibody treatment totreatment with either antibody alone.(f) Treatment with mAb 6.12 andMF had a comparable efficacy inmice bearing 200 mm3 (closedcircle) and 1200 mm3 (closed trian-gle) established tumors. Treatmentof mice bearing 4000 mm3 (closeddiamond) tumors with both anti-human and mouse VEGFR-1 mAbsinduced a tumor remission. Arrowsindicate initiation of the treatment.Data represent 1 of 2 individual ex-periments. Bar: Mean6 SEM.

1526 WU ET AL.

receptor responsible for this survival signal was not identified.More recent studies have suggested that VEGF-A regulated ex-pression of the chemokine receptor CXCR4 is essential for breasttumor cell migration, but not for tumor cell survival.43 Interest-ingly, expression of neuropilin-1 (NP-1), but not VEGFR-1, wasidentified as essential for this function. A study has suggested thatVEGF-A and NP-1 pathway may promote progression of lungcancer through facilitating VEGF receptor activation and delocali-zation of NP-1 ligand SEMA3F in lung cancer cells.44 Notably,we have observed coexpression of VEGFR-1 and NP-1 in allbreast tumor cell lines examined (data not shown). It will be of in-terest to determine in future studies whether cooperative signalingmechanisms between VEGFR-1 and NP-1 play a role in diversesignaling pathways in breast tumor cells.

Our in vitro observations were extended to studies of severalhuman VEGFR-1 expressing breast carcinoma xenograft models.

In these studies, treatment with anti-human VEGFR-1 neutralizingmAb 6.12 resulted in significant suppression of breast tumorgrowth. Histological examination of tumor xenografts revealedextensive tumor necrosis suggesting that anti-VEGFR-1 treatmentin these models was not merely cytostatic, but that therapy alsoinflicted significant tumor cell death. Histological analysis of6.12-treated breast tumor xenografts showed a marked reductionof tumor cell proliferation, activated p44/42 MAPK and Akt, andan increase in apoptosis. These findings suggest that the efficacyof anti-VEGFR-1 treatment involves the disruption of both growthand survival signaling mechanisms specifically mediated byVEGFR-1 in breast cancer cells. It should be noted, however, thatVEGFR-1 therapy did not completely inhibit tumor growth in anyof the models tested. In this regard, it will be of interest in futurestudies to determine whether combined anti-VEGFR-1 treatment

FIGURE 7 – Inhibition of intracel-lular activity and signaling activa-tion in treated tumor xenografts. BT-474, DU4475, MCF-7 and MDA-MB-231 breast tumor xenografts treatedwith anti-VEGFR-1 mAb 6.12 wereimmunohistochemically stained withpolyclonal antibodies specific for pro-liferation marker Ki-67 (a) and phos-pho-specific p44/42 MAP kinase (b).Activities of Ki-67 molecule andphospho-p44/42 MAP kinase weresignificantly reduced in tumor cellsin the xenografts treated with mAb6.12 compared to controls, expectfor insignificant reduction of Ki-67activity in DU4475 xenografts. (c)BT-474 xenografts were evaluatedfor apoptosis by TUNEL assay andAkt activation by staining with anti-phospho-Akt specific antibody. In-creased apoptosis and reduced Aktactivation were found in tumor cellsin the antibody treated xenografts.Original magnifications: 2003.


with anti-VEGFR-2 agents or cytotoxic agents will enhance theefficacy of VEGFR-1 therapy.

The anti-VEGFR-1 neutralizing mAb 6.12 used in these studiesis specific for human VEGFR-1 and does not crossreact withmouse VEGFR-1.34 To recapitulate dual blockade of VEGFR-1on breast tumor cells and host (mouse) tumor vasculature, we per-formed in vivo studies using a murine VEGFR-1 specific neutraliz-ing mAb (MF1) that was previously showed to inhibit tumorangiogenesis.21 Blockade of both the endothelial cell-dependentVEGFR-1 pathway on tumor vasculature (MF1) and the endothe-lial cell-independent VEGFR-1 loop on the breast tumor cells(6.12) resulted in an enhanced antitumor effect. This observationis consistent with previous evidence demonstrating that VEGFR-1is expressed by the tumor vasculature and involved in pathologicalangiogenesis.21,22 Moreover, the presence of VEGFR-1 on inflam-matory cells such as monocytes and hematopoietic progenitor andstem cells, suggests that these cells may be recruited specificallyto sites of neovascularization, where they can contribute to theprocess of angiogenesis through MMP-9 release.45 We and othershave shown that incorporation of VEGFR-1-positive myeloid cellscontributes to the growth of xenotransplanted murine lymphomasand lung cancer.11 However, it remains to be determined whetherinhibition of mobilization and incorporation of VEGFR-1 positiveinflammatory cells play a role in the growth of breast cancer cells.Nonetheless, combination therapy against both human and mouseVEGFR-1 resulted in a greater antitumor effect, even in models ofestablished breast tumors. Additional studies will be necessary to

specifically address the contribution of VEGFR-11 tumor endo-thelium versus VEGFR-11 bone marrow-derived myeloid pro-genitors on the growth of solid tumors. Nevertheless, the effects ofboth anti-human and anti-mouse VEGFR-1 treatments would in-hibit different components of a growing tumor, acting as an anti-angiogenic therapy by affecting the tumor vasculature and directlyas an antitumor therapy, demonstrating the relevance of specifi-cally targeting growth factor/receptor tyrosine kinase pathways ondifferent cell types in human cancer.

In conclusion, we have demonstrated a functional role forVEGFR-1 in the subsets of human breast carcinoma cells, and thatspecific blockade of this receptor by a neutralizing mAb can sig-nificantly suppress the growth of breast tumor cells in vitro and invivo. These studies provide further insight into the contribution ofthe VEGF-A/VEGFR pathways in human cancers beyond theirrole in tumor vasculature. This observation supports further evalu-ation of a targeted approach to therapy of subsets of breast carci-noma with novel inhibitors of VEGFR-1.

Acknowledgements

We thank following coworkers Rajiv Bassi, Bridget Finnertyand Huiling Li for their excellent technical assistance. ShahinRafii was supported by National Institutes of Health (NHLBI),American Cancer Society and Leukemia and Lymphoma Societyof America.

References

1. Cancer facts and figures. American Cancer Society. 2004.2. Cobleigh MA, Vogel CL, Tripathy D, Robert NJ, Scholl S, Fehren-

bacher L, Wolter JM, Paton V, Shak S, Lieberman G, Slamon DJ.Multinational study of the efficacy and safety of humanized anti-HER2 monoclonal antibody in women who have HER2-overexpres-sing metastatic breast cancer that has progressed after chemotherapyfor metastatic disease. J Clin Oncol 1999;17:2639–48.

3. Arteaga CL, Moulder SL, Yakes FM. HER (erbB) tyrosine kinaseinhibitors in the treatment of breast cancer. Semin Oncol 2002;29:4–10.

4. Linderholm B, Grankvist K, Wilking N, Johansson M, Tavelin B, Hen-riksson R. Correlation of vascular endothelial growth factor content withrecurrences, survival, and first relapse site in primary node-positive breastcarcinoma after adjuvant treatment. J Clin Oncol 1998;18:1423–31.

5. Folkman J. Angiogenesis in cancer, vascular, rheumatoid and otherdisease. Nat Med 1995;1:27–31.

6. Carmeliet P, Jain RK. Angiogenesis in cancer and other diseases. Na-ture 2000;407:249–57.

7. Quinn TP, Peters KG, De Vries C, Ferrara N, Williams LT. Fetal liverkinase 1 is a receptor for vascular endothelial growth factor and isselectively expressed in vascular endothelium. Proc Natl Acad SciUSA 1993;90:7533–7.

8. Fong GH, Klingensmith J, Wood CR, Rossant J, Breitman ML. Regula-tion of flt-1 expression during mouse embryogenesis suggests a role inthe establishment of vascular endothelium. Dev Dyn 1996;207:1–10.

9. Wang H, Keiser JA. Vascular endothelial growth factor upregulatesthe expression of matrix metalloproteinases in vascular smooth mus-cle cells: role of flt-1. Circ Res 1998;83:832–40.

10. Grosskreutz CL, Anand-Apte B, Duplaa C, Quinn TP, Terman BI,Zetter B, D’Amore PA. Vascular endothelial growth factor-inducedmigration of vascular smooth muscle cells in vitro. Microvasc Res1999;58:128–36.

11. Lyden D, Hattori K, Dias S, Costa C, Blaikie P, Butros L, Chadburn A,Heissig B, Marks W, Witte L, Wu Y, Hicklin D, et al. Impaired recruit-ment of bone-marrow-derived endothelial and hematopoietic precursorcells blocks tumor angiogenesis and growth. Nat Med 2001;7:1194–201.

12. Sawano A, Iwai S, Sakurai Y, Ito M, Shitara K, Nakahata T, ShibuyaM. Flt-1, vascular endothelial growth factor receptor 1, is a novel cellsurface marker for the lineage of monocyte-macrophages in humans.Blood 2001;97:785–91.

13. Ishida A, Murray J, Saito Y, Kanthou C, Benzakour O, Shibuya M,Wijelath ES. Expression of vascular endothelial growth factor recep-tors in smooth muscle cells. J Cell Physiol 2001;188:359–68.

14. Barleon B, Sozzani S, Zhou D, Weich HA, Mantovani A, Marme D.Migration of human monocytes in response to vascular endothelialgrowth factor (VEGF) is mediated via the VEGF receptor flt-1. Blood1996;87:3336–43.

15. Clauss M, Weich H, Breier G, Knies U, Rockl W, Waltenberger J,Risau W. The vascular endothelial growth factor receptor Flt-1 medi-

ates biological activities: implications for a functional role of placentagrowth factor in monocyte activation and chemotaxis. J Biol Chem1996;271:17629–34.

16. Gille H, Kowalski J, Yu L, Chen H, Pisabarro MT, Davis-Smyth T,Ferrara N. A repressor sequence in the juxtamembrane domain of Flt-1 (VEGFR-1) constitutively inhibits vascular endothelial growth fac-tor-dependent phosphatidylinositol 30-kinase activation and endothe-lial cell migration. EMBO J 2000;19:4064–73.

17. Zeng H, Dvorak HF, Mukhopadhyay D. Vascular permeability factor(VPF)/vascular endothelial growth factor (VEGF) peceptor-1 down-modulates VPF/VEGF receptor-2-mediated endothelial cell prolifera-tion, but not migration, through phosphatidylinositol 3-kinase-depend-ent pathways. J Biol Chem 2001;276:26969–79.

18. Hattori K, Heissig B, Wu Y, Dias S, Tejada R, Ferris B, Hicklin DJ, ZhuZ, Bohlen P, Witte L, Hendrikx J, Hackett NR, et al. Placental growthfactor reconstitutes hematopoiesis by recruiting VEGFR1(1) stem cellsfrom bone-marrow microenvironment. Nat Med 2002;8:841–9.

19. Hiratsuka S, Maru Y, Okada A, Seiki M, Noda T, Shibuya M.Involvement of Flt-1 tyrosine kinase (vascular endothelial growth fac-tor receptor-1) in pathological angiogenesis. Cancer Res 2001;61:1207–13.

20. Carmeliet P, Moons L, Luttun A, Vincenti V, Compernolle V, DeMol M, Wu Y, Bono F, Devy L, Beck H, Scholz D, Acker T, et al.Synergism between vascular endothelial growth factor and placentalgrowth factor contributes to angiogenesis and plasma extravasation inpathological conditions. Nat Med 2001;7:575–83.

21. Luttun A, Tjwa M, Moons L, Wu Y, Angelillo-Scherrer A, Liao F,Nagy JA, Hooper A, Priller J, De Klerck B, Compernolle V, Daci E,et al. Revascularization of ischemic tissues by PlGF treatment, and in-hibition of tumor angiogenesis, arthritis and atherosclerosis by anti-Flt1. Nat Med 2002;8:831–40.

22. Bellamy WT, Richter L, Frutiger Y, Grogan TM. Expression of vasc-ular endothelial growth factor and its receptors in hematopoietic malig-nancies. Cancer Res 1999;59:728–33.

23. Decaussin M, Sartelet H, Robert C, Moro D, Claraz C, Brambilla C,Brambilla E. Expression of vascular endothelial growth factor(VEGF) and its two receptors (VEGF-R1-Flt1 and VEGF-R2-Flk1/KDR) in non-small cell lung carcinomas (NSCLCs): correlation withangiogenesis and survival. J Pathol 1999;188:369–77.

24. Ferrer FA, Miller LJ, Lindquist R, Kowalczyk P, Laudone VP, Albert-sen PC, Kreutzer DL. Expression of vascular endothelial growth fac-tor receptors in human prostate cancer. Urology 1999;54:567–72.

25. Dias S, Hattori K, Zhu Z, Heissig B, Choy M, Lane W, Wu Y, Chad-burn A, Hyjek E, Gill M, Hicklin DJ, Witte L, et al. Autocrine stimu-lation of VEGFR-2 activates human leukemic cell growth and migra-tion. J Clin Invest 2000;106:511–21.

26. Lacal PM, Failla CM, Pagani E, Odorisio T, Schietroma C, Falcinelli S,Zambruno G, D’Atri S. Human melanoma cells secrete and respond to

1528 WU ET AL.

placenta growth factor and vascular endothelial growth factor. J InvestDermatol 2000;115:1000–7.

27. Hayashibara T, Yamada Y, Miyanishi T, Mori H, Joh T, Maeda T,Mori N, Maita T, Kamihira S, Tomonaga M. Vascular endothelialgrowth factor and cellular chemotaxis: a possible autocrine pathway inadult T-cell leukemia cell invasion. Clin Cancer Res 2001;7:2719–26.

28. Price DJ, Miralem T, Jiang S, Steinberg R, Avraham H. Role of vascu-lar endothelial growth factor in the stimulation of cellular invasion andsignaling of breast cancer cells. Cell Growth Differ 2001;12:129–35.

29. Dias S, Hattori K, Heissig B, Zhu Z, Wu Y, Witte L, Hicklin DJ,Tateno M, Bohlen P, Moore MA, Rafii S. Inhibition of both paracrineand autocrine VEGF/ VEGFR-2 signaling pathways is essential toinduce long-term remission of xenotransplanted human leukemias.Proc Natl Acad Sci USA 2001;98:10857–62.

30. Dias S, Shmelkov SV, Lam G, Rafii S. VEGF165 promotes survival ofleukemic cells by Hsp90-mediated induction of Bcl-2 expression andapoptosis inhibition. Blood 2002;99:2532–40.

31. Brambilla E, Constantin B, Drabkin H, Roche J. SemaphorinSEMA3F localization in malignant human lung and cell lines: a sug-gested role in cell adhesion and cell migration. Am J Pathol 2000;156:939–50.

32. Dales JP, Garcia S, Bonnier P, Duffaud F, Carpentier S, Djemli A,Ramuz O, Andrac L, Lavaut M, Allasia C, Charpin C. Prognostic sig-nificance of VEGF receptors, VEGFR-1 (Flt-1) and VEGFR-2 (KDR/Flk-1) in breast carcinoma. Ann Pathol 2003;23:297–305.

33. Tessler S, Rockwell P, Hicklin D, Cohen T, Levi BZ, Witte L,Lemischka IR, Neufeld G. Heparin modulates the interaction ofVEGF165 with soluble and cell associated Flk-1 receptors. J BiolChem 1994;269:12456–61.

34. Wang ES, Teruya-Feldstein J, Wu Y, Zhu Z, Hicklin DJ, Moore MA.Targeting autocrine and paracrine VEGF receptor pathways inhibitshuman lymphoma xenografts in vivo. Blood 2004;104:2893–902.

35. Fernando NH, Hurwitz HI. Inhibition of vascular endothelial growthfactor in the treatment of colorectal cancer. Semin Oncol 2003;30(3Suppl. 6):39–50.

36. Yang JC, Haworth L, Sherry RM, Hwu P, Schwartzentruber DJ,Topalian SL, Steinberg SM, Chen HX, Rosenberg SA. A randomized

trial of bevacizumab, an anti-vascular endothelial growth factor anti-body, for metastatic renal cancer. N Engl J Med 2003;349:427–34.

37. Miralem T, Steinberg R, Price D, Avraham H. VEGF165 requiresextracellular matrix components to induce mitogenic effects and mi-gratory response in breast cancer cells. Oncogene 2001;20:5511–24.

38. Bachelder RE, Crago A, Chung J, Wendt MA, Shaw LM, RobinsonG, Mercurio AM. Vascular endothelial growth factor is an autocrinesurvival factor for neuropilin-expressing breast carcinoma cells. Can-cer Res 2001;61:5736–40.

39. Wu LW, Mayo LD, Dunbar JD, Kessler KM, Baerwald MR, JaffeEA, Wang D, Warren RS, Donner DB. Utilization of distinct signalingpathways by receptors for vascular endothelial cell growth factor andother mitogens in the induction of endothelial cell proliferation. J BiolChem 2000;275:5096–103.

40. Zachary I, Gliki G. Signaling transduction mechanisms mediating bio-logical actions of the vascular endothelial growth factor family. Cardi-ovasc Res 2001;49:568–81.

41. Bussolati B, Dunk C, Grohman M, Kontos CD, Mason J, Ahmed A.Vascular endothelial growth factor receptor-1 modulates vascular endo-thelial growth factor-mediated angiogenesis via nitric oxide. Am J Pathol2001;159:993–1008.

42. Zeng H, Zhao D, Mukhopadhyay D. Flt-1-mediated down-regulationof endothelial cell proliferation through pertussis toxin-sensitive Gproteins, bg subunits, small GTPase CDC42, and partly by Rac-1. J BiolChem 2002;277:4003–9.

43. Bachelder RE, Wendt MA, Mercurio AM. Vascular endothelialgrowth factor promotes breast carcinoma invasion in an autocrinemanner by regulating the chemokine receptor CXCR4. Cancer Res2002;62:7203–6.

44. Lantuejoul S, Constantin B, Drabkin H, Brambilla C, Roche J, Bram-billa E. Expression of VEGF, semaphorin SEMA3F, and their com-mon receptors neuropilins NP1 and NP2 in preinvasive bronchiallesions, lung tumours, and cell lines. J Pathol 2003;200:336–47.

45. Hiratsuka S, Nakamura K, Iwai S, Murakami M, Itoh T, Kijima H,Shipley JM, Senior RM, Shibuya M. MMP9 induction by vascular en-dothelial growth factor receptor-1 is involved in lung-specific metas-tasis. Cancer Cell 2002;2:289–300.


Documents

The vascular endothelial growth factor receptor (VEGFR-1) supports growth and survival of human breast carcinoma