The terminal inverted repeats of IS911: requirements for synaptic complex assembly and activity

doi:10.1006/jmbi.2001.4641 available online at http://www.idealibrary.com on J. Mol. Biol. (2001) 308, 853±871

The Terminal Inverted Repeats of IS911: Requirementsfor Synaptic Complex Assembly and Activity

C. Normand, G. Duval-Valentin, L. Haren and M. Chandler*

Laboratoire de Microbiologie etGeÂneÂtique MoleÂculaire, CNRS118 Route de Narbonne31062 Toulouse, France

Present address: L. Haren, InstituMolecular Biology. The University oMay®eld Road, Edinburgh, EH9 3JR

Abbreviations used: IR(s), imperfsequences; IS(s), insertion sequencesKm, kanamycin.

E-mail address of the [email protected]

0022-2836/01/050853±19 $35.00/0

The bacterial insertion sequence IS911 transposes via a covalently closedcircular intermediate. Circle formation involves transposase-mediatedpairing of both insertion sequence ends. While full-length transposase,OrfAB, binds poorly in vitro to IS911 DNA fragments carrying a copyof the IS911 end, truncated protein derivatives carrying the ®rst135 (OrfAB[1-135]) or 149 (OrfAB[1-149]) amino acid residues bindef®ciently. They generate a paired-end complex containing two suchfragments which resembles that expected for the ®rst synaptic complex.Shorter protein derivatives lacking a region involved in multimerisationdo not form these complexes but modify the binding of OrfAB[1-135]and OrfAB[1-149]. DNaseI footprinting demonstrated that OrfAB[1-149]protects a sub-terminal (internal) region of the inverted repeats whichincludes two blocks of sequence (b and g) conserved between the left(IRL) and right (IRR) ends. DNA binding assays in vitro and measure-ment of recombination activity in vivo of sequential deletion derivativesof the two inverted repeats suggested a model in which the N-terminalregion of OrfAB binds the conserved boxes b and g in a sequence-speci®cmanner and anchors the two insertion sequence ends into a paired-endcomplex. The external region of the inverted repeat is proposed to con-tact the C-terminal transposase domain carrying the catalytic site.

# 2001 Academic Press

Keywords: IS911/IS3-family; DNA-binding protein; insertion sequence;transposase; synaptic complex
*Corresponding author
Introduction

The majority of known bacterial insertionsequences (ISs) are bordered by short imperfectrepeated sequences (IRs) in an inverted orientation(reviewed, by Mahillon & Chandler, 1998). Theseare essential for productive transposition, sincethey provide the speci®city for both the binding ofthe transposase and for the cleavage and strand-transfer reactions leading to displacement of theelement. In the case of several insertion sequencesthe IRs are organised in a relatively simple waywith an internal (sub-terminal) region which isrecognised and bound by the transposase and aterminal region which is involved in catalysis

te of Cell andf Edinburgh,, UK.

ect terminal repeated; Ap, ampicillin;

ing author:

(Derbyshire et al., 1987; Huisman et al., 1989; Jilket al., 1996). The ends participate in a synaptic com-plex in which they are bridged in a non-covalentway by their cognate transposase, which is gener-ally in the form of a multimer (IN, Andrake &Skalka, 1996; Tn5, Bhasin et al., 2000; Davies et al.,2000; Mu, Lavoie et al., 1991; IS911, Haren et al.,2000; Tn10, Bolland & Kleckner, 1996). This hasrecently been strikingly illustrated by the determi-nation of the crystallographic structure of an IS50synaptic complex (Davies et al., 2000).

Like other members of the IS3 family of insertionsequences (Lewis & Grindley, 1997; Sekine et al.,1999), IS911 has adopted a two-step transpositionmechanism (reviewed by Rousseau et al., 2001).This entails the initial formation of an autonomouscircular intermediate which then undergoes inte-gration. The pathway implies that the IS911 endsparticipate in two different types of synaptic com-plex. Formation of the ®rst type, synaptic complexA, occurs as one of the ®rst steps in the formationof transposon circles: the pairing of both distant ISends. This complex catalyses single-strand cleavage(hydrolysis) at one IS end and strand transfer to

# 2001 Academic Press

http://www.idealibrary.com

mailto:[email protected]

854 An IS911 Synaptic Complex

the other (trans-esteri®cation) leading to circularisa-tion of a single transposon strand to generate astructure in which both ends are retained by asingle-strand bridge. The bridge is composed ofabutted left (IRL) and right (IRR) ends separatedby three bases originally ¯anking one or other endin the donor molecule (Polard & Chandler, 1995a).When carried by a circular plasmid donor, thisconstrains the molecule into a ®gure-of-eight form(Polard & Chandler, 1995b; Polard et al., 1996). Thesecond transposon strand is then circularised togenerate covalently closed transposon circles inwhich left (IRL) and right (IRR) ends are abuttedin the form of a reactive junction (Polard et al.,1992). Integration of the transposon circles into atarget molecule necessitates a single-strand clea-vage at each IR end and their co-ordinated transferinto a target DNA molecule. These events occurwithin a second type of complex, synaptic complexB. This must be formed on the covalently joinedinverted transposon ends which constitute thereactive junction.

The DNA partners in these reactions are theterminal inverted repeats, IRR and IRL which, inthe case of IS911, are 36 bp long. Arti®cial transpo-sons carrying 52 bp from the right end and 102 bpfrom the left end are pro®cient in these steps bothin vivo and in vitro (Polard & Chandler, 1995b;Polard et al., 1996). IRL and IRR both carry 50-CA-30 as the terminal dinucleotide on the transferredstrand. This is highly conserved in members of theIS3 family. The IRs share 67 % homology whichcan be divided into three blocks (a, b and g; seeFigure 1(b)). The ends are used in an asymmetricmanner in the formation of the bridged ®gure-of-eight intermediate: the cleaved end acts as a donor,while the opposing end acts as a target. Both leftand right ends can assume either donor or targetroles. The phosphodiester bond at the 30 end of thedonor IR undergoes hydrolysis to generate a 30-OHgroup which then participates in a nucleophilicattack of a phosphodiester bond precisely three (orrarely four) bases outside the opposite end. Theconsequence of the position of this attack is thatIRR and IRL are separated by three (or four) base-pairs in the reactive circle junction. Mutation of theterminal 50-CA-30 dinucleotide abolishes donoractivity of either end but does not affect the abilityof the mutated end to act as a target (Polard et al.,1992; Polard & Chandler, 1995b).

The chemical reactions are catalysed by a singleprotein of 382 amino acid residues, OrfAB. This isproduced by ÿ1 programmed translational frame-shifting between an upstream frame, orfA, and asecond downstream frame, orfB (see Figure 1(a)).The downstream region encodes the catalyticdomain of the protein (see Figure 1(c); Polard et al.,1991). The upstream region is required forsequence-speci®c DNA binding (Haren et al., 1998,2000). OrfAB alone is capable of assuring the for-mation of ®gure-of-eight molecules in vitro (Polardet al., 1996). However, ef®cient integration of trans-poson circles requires the product of the upstream

frame, OrfA, in addition to OrfAB (Ton-Hoanget al., 1997, 1998). Previous studies identi®ed sev-eral regions of OrfAB which promote protein mul-timerisation and whose integrity is essential foractivity (Haren et al., 1998). These include the C-terminal catalytic domain, a poorly characterisedregion, M, located towards the N-terminal sectionof the protein (amino acid residues 109-135) and acanonical leucine zipper, also partially shared withOrfA, and located between amino acid residues 63and 95 (see Figure 1(c)).

In the results presented here we address some ofthe factors involved in the assembly of the paired-end complex, synaptic complex A. We haveanalysed protein-DNA interactions which occurbetween the individual IS911 IRs and a transposasederivative truncated for its catalytic domain. Weshow that this protein derivative protects asub-terminal domain of both IRs from attack byDNaseI. We also show, by gel retardation, using aset of IRR and IRL copies carrying consecutivedeletions, that the protected region is necessary forend pairing. In addition, while the terminal regionof both IRs is necessary for donor activity, we ®ndthat the sequence is not essential for target activityin the formation of the bridged ®gure-of-eighttransposition intermediate. These results suggest amodel in which two IS911 ends are anchored in apaired end complex by the N-terminal domain ofthe transposase OrfAB which binds to the sub-terminal region of the IRs. This con®gurationwould leave the terminal IR region accessible tothe C-terminal transposase domain carrying thecatalytic site.

Results

Protein requirements for complex formation

A simpli®ed representation of IS911-encodedproteins including certain structural features whichare important in their function is presented inFigure 1(c). To clarify the present analysis, a sum-mary of the results of gel-retardation experimentsdesigned to de®ne the complexes generated bydifferent derivatives of these proteins and a DNAfragment carrying IRR is presented in Figure 2.The results presented in Figure 2 (panels (a) and(b)) were extracted from published work (Harenet al., 1998, 2000). Full-length OrfAB had beenobserved to bind inef®ciently to IRR to generate ahighly retarded band. The appearance of thisspecies (complex *, Figure 2, panel (a)) requiredextremely high levels of OrfAB. A prominentspecies (complex III) carrying contaminating C-terminal truncated derivatives was also observed.This suggested that the C-terminal end of OrfABmay interfere with binding (Haren et al., 1998).Further analysis demonstrated that a derivative ofOrfAB carrying the ®rst 149 amino acid residues(OrfAB[1-149], Figure 1(c)) generated a slowlymigrating complex which included two copies ofthe terminal inverted repeats (complex I; Figure 2,

Figure 1. Organisation of IS911. (a) Genetic organis-ation. The grey boxes at each end represent the left(IRL) and right (IRR) terminal inverted repeats. The rela-tive reading phases (0 and ÿ1) of OrfA and OrfB areindicated. The reading frames are represented as cross-hatched boxes and the indigenous promoter, pIRL, isshown. The region of overlap between orfA and orfB inwhich the frameshifting event occurs to produce orfABlies within IS911 coordinates 300 and 400. (b) Nucleotidesequence of the terminal inverted repeats. The conservedbase-pairs are shown as white letters on a grey back-ground. Three conserved domains are de®ned as a, band g. The terminal 50-CA-30 located on the transferredstrand (bottom strand) is highly conserved throughoutthe IS3 family to which IS911 belongs. (c) Structure/function map of OrfAB and OrfA. The ®gures above thecartoon represent coordinates in amino acid residues.HTH, a potential helix-turn-helix motif; LZ, a leucinezipper motif involved in homo- and hetero-multimerisa-tion of OrfAB and OrfA. Programmed translational fra-meshifting which fuses OrfA and OrfB to generate thetransposase OrfAB occurs within the fourth heptad. TheLZ of OrfA and OrfAB therefore differ in their fourthheptad. A second region, M, necessary for multimerisa-tion of OrfAB is shown, as is the catalytic core of theenzyme which carries a third multimerisation domainand a conserved DDE motif. The extent of the truncatedOrfAB proteins used in these studies are indicatedbelow.

An IS911 Synaptic Complex 855

panel (b)). At higher protein concentrations asecond faster-migrating complex (II) appeared(Haren et al., 2000). We show here (Figure 2, panel(c)) that similar complexes were obtained with aderivative carrying the N-terminal 135 amino acidresidues (OrfAB[1-135]). On the other hand, aderivative carrying only the ®rst 109 amino acid

residues (OrfAB[1-109]) did not bind signi®cantlyto the IRs (Figure 2, panel (c)).

Figure 2 (panel (b)) also illustrates the effect ofaddition of OrfA to complexes generated byOrfAB[1-149]. Like OrfAB[1-109], OrfA alone didnot bind signi®cantly even at very high molarities.However, in the presence of OrfAB[1-149], a thirdspecies, with migration properties identical withthose of complex III, appeared at the expense ofcomplexes I and II. Surprisingly, no OrfA could bedetected in this complex (Haren et al., 2000). Herewe show that OrfAB[1-109] modi®ed the migrationof complexes formed with OrfAB[1-135] to gener-ate a species with migration properties identicalwith those of complex III (Figure 2, panel (c)).

Together, these results indicate that a regionbetween amino acid residues 109 and 135(Figure 1(c)) is essential for binding the IRs. Thisregion is absent in both OrfAB[1-109] and OrfAand was previously shown to be involved in pro-tein multimerisation (Haren et al., 1998). However,although neither of these proteins bind the IRs sig-ni®cantly alone, both derivatives carry a leucinezipper motif which also promotes multimerisation.It seems probable that OrfAB[1-109] and OrfAexert their activity by modulating the multimerisa-tion of the longer protein derivatives in the synap-tic complex and that OrfAB[1-109] and OrfA-mediated complexes are similar. The difference inmigration of the different complexes may thereforesimply re¯ect a change in the stoichiometry of thelonger derivatives or a change in the way theyinteract with their binding sites. Although no for-mal proof is as yet available, we postulate that thepaired-end complex (I) includes at least a transpo-sase dimer and two IS911 ends, that complex II hasa similar protein composition but contains only asingle IS end, while in complex III the transposasestoichiometry has been modi®ed by interactionwith OrfA (Haren et al., 2000).

Protection patterns observed in complexes I, IIand III

The protein-DNA interactions occurring in eachspecies were investigated by two different foot-printing procedures: DNaseI protection, to deter-mine the extent of occupation by the protein, andcopper-phenanthroline, Cu(OP)2, footprinting toprobe minor-groove interactions and protein-induced changes in DNA conformation.

For DNaseI footprinting, suitably end-labelledIR-containing fragments were included in a bind-ing reaction with OrfAB[1-149] and brie¯y exposedto the enzyme (see Materials and Methods). Thedifferent species were fractionated by electrophor-esis and puri®ed from the gel. The isolated com-plexes were analysed by electrophoresis through asequencing gel. The results obtained with IRR areshown in Figure 3(a) and summarised inFigure 3(b). Protection of the ``upper'' strandextends from base 44 (internal to the 36 bp IR) tobase 16, whereas protection of the ``lower'' strand

Figure 2. Gel retardation of an IRR-carrying DNA fragment by different IS911 derivative proteins. The DNA frag-ment used, generated by PCR, is schematised at the top of the Figure. The grey box shows the 36 bp of IRR,additional internal IS911 sequence included in the fragment is shown as a pale grey box and the black line representsthe ¯anking backbone DNA derived from the plasmid pAPT166. The IS911 DNA is indicated by coordinates beneaththe drawing The binding reaction was performed for 30 minutes at 30 �C and complexes were separated by electro-phoresis on a 5 % native polyacrylamide gel. The ®nal protein concentration in each assay is given under thecorresponding lane. (a) Incubation of full-length OrfAB. The low mobility complex (*) was previously shown tocontain only full-length OrfAB (Haren et al., 1998) while the majority complex III was shown to contain onlyC-terminal deleted derivatives of OrfAB which are present as low-level contaminants in the puri®ed protein prep-aration. (b) The ®rst three lanes present results of binding studies of OrfA; the second three lanes present the resultsof binding of OrfAB[1-149]; the last lane shows the results of mixing OrfAB[1-149] with OrfA. Note that complex Iwas previously shown to contain two IRR-carrying DNA fragments while complex III carries only OrfAB[1-149] andis devoid of OrfA (Haren et al., 2000). (c) The binding activity of OrfAB(1-109) is shown in the ®rst three lanes; thatof OrfAB[1-135] is presented in the second group of three lanes; the last lane shows the result of mixing OrfAB[1-135]with OrfAB[1-109]. Note that, like OrfA, OrfAB[1-109] does not contain the M region while OrfAB[1-135] andOrfAB[1-149] do (Figure 1(c)).


occurs between bases 40 and 10-14. This includesconserved regions b and g (Figure 1(b)). Similarresults obtained with IRL (data not shown) arealso summarised in Figure 3(b).

Surprisingly, no striking differences in DNaseIprotection were revealed between complexes I, IIand III. This is not due to exchange between DNAfragments and protein during the DNaseI treat-ment or loading of the gel, since naked DNA iso-lated from the binding reaction showed anidentical DNaseI digestion pattern to DNA whichhad not been exposed to protein (data not shown).

Thus the changes in electrophoretic mobility ofthese complexes are not primarily the result ofchanges in protein-DNA interactions (site occu-pancy) but are presumably due to changes inprotein-protein interactions.

Protein-DNA interactions were also investigatedby Cu(OP)2 footprinting. Following electrophoreticseparation, the IRR-OrfAB[1-149] complexes werecleaved directly in the gel and the products werefractionated by electrophoresis through a sequen-cing gel. The protection patterns are presented inFigure 4(a) and a quantitative analysis in

Figure 3. OrfAB[1-149]-mediated protection to DNaseI cleavage on IRR. The IRR-carrying DNA fragment (128 bp,see Materials and Methods) was incubated with OrfAB[1-149] (140 nM) and OrfA (2500 nM) for 30 minutes at 30 �Cin the standard binding buffer. DNaseI was added together with CaCl2 and MgCl2 and the reaction was incubatedfor one minute at 30 �C. Complexes were separated by electrophoresis through a 5 % native polyacrylamide gel andDNA was eluted from each band and analysed on a sequencing gel. (a) DNaseI cleavage pattern revealed by electro-phoresis on a 6 % denaturing polyacrylamide gel. Pyr, Pur: Chemical sequence of the DNA fragment. Free indicatesnon-complexed DNA. Lanes labelled I, II and III, show the DNaseI protection pattern in isolated complex I, II and IIIrespectively. The coordinates in bases are given on the left side of each gel. Note that the terminal base-pair A �T ofIRR is de®ned as position 1. (b) DNA sequence of IRR and IRL protected from DNaseI attack. The symbols used fordescribing IRL and IRR are the same as those used in Figure 1(b). Extended grey rectangles above and below thesequence show the region protected on both ends. The small grey boxes on the bottom strand of IRR indicate baseswhere protection was unclear.


Figure 4. Copper phenanthroline cleavage protection on IRR complex with OrfAB[1-149]. The standard bindingprocedure was performed as for DNaseI protection. Following electrophoresis on a 5 % polyacrylamide gel, DNAcleavage was performed in situ and DNA from each band was recovered. (a) Cu(OP)2-cleavage patterns. Left:cleavage pattern revealed on a 6 % sequencing gel. Lanes are: Pyr, Pur, chemical sequencing reactions; Free, non-complexed DNA; I, II and III, protection pattern in isolated complex I, II and III, respectively. The coordinates aregiven on the right part of each gel (position 1: terminal base-pair A �T of IRR). Right panels: quantitative analysis ofthe sequencing gels. Each band was quanti®ed using a Fuji X BAS1000 phosphorimaging system coupled to thePCBas software package. Red, non-complexed DNA; blue, complex I; purple, complex II; green, complex III; black,non-complexed fragment. (b) Model of end pairing in complex I. The grey boxes a, b and g indicate the conservedblocks in the IRs (Figure 1(b)). The cross-hatched area represents OrfAB[1-149] shown here for convenience as adimer. The two IR copies are shown anchored by the N-terminal part of the transposase leaving the terminal base-pairs free for interaction with the catalytic domain carried by the C-terminal region.



Figure 4(b). For complexes I and II, strong protec-tion extended from position 46/44 to position 13on the upper strand and from 36/37 and 13/14 onthe lower strand. DNA from base 13 within theend to at least base 8 in the adjacent vector DNA(position ÿ8, Figure 4(a)), was not completely pro-tected and exhibited weak cleavage on bothstrands compared to non-complexed DNA. Thepattern was somewhat different for complex III;upper-strand protection was limited to a regionbetween positions 46/44 and 17/16 while lower,strand protection extended from 13/14 to 45 withweaker cleavage at position 46 and 47.

Both DNaseI and Cu(OP)2 footprints suggest amodel in which the two IR copies are anchored bythe N-terminal part of the transposase, leaving theterminal base-pairs free for interaction with the cat-alytic domain carried by the C-terminal part(Figure 4(c)). The partial protection from Cu(OP)2

cleavage observed in the CA terminal region (blocka, Figure 1(b)) on both strands for complex I and IIsuggests that OrfAB[1-149] may make non-speci®ccontacts with DNA which has been displaced byDNaseI.

IRL and IRR function in vivo

To probe the functional organisation of IRL andIRR in more detail, a plasmid carrying suitablerestriction sites to facilitate exchange of differentIRR and IRL sequences was constructed. This plas-mid, pCN100 (Figure 5(a)), is a derivative ofpAPT174 (Ton-Hoang et al., 1997) and carries IS911ends ¯anking a lacZ translational fusion to the ®rstten codons of orfA. IRR is ¯anked by an XbaI siteon one side and an engineered NcoI site on theother. IRL is ¯anked by a HindIII site and anengineered NsiI site within the ÿ10 hexamer of theresident transposase promoter, pIRL (Figure 1(a)).These sites were used in cloning deletion deriva-tives of each of the ends.

Overall functional equivalence of IRR and IRL

To determine whether IRL and IRR are function-ally equivalent, two plasmids carrying either twocopies of IRR (pCN113; Figure 5(b)) or two copiesof IRL (pCN112; Figure 5(b)) were constructed.Both IRR- and IRL-carrying fragments included theexternal DNA sequences found in pCN100.For pCN113, the terminal 1-41 base-pairs of IRL(IRL1-41) of pCN100 were replaced by IRR1-42. ForpCN112, IRR1-52 was replaced by IRL1-41. Theactivity of each derivative was assessed in vivo bythe level of transposon circles and ®gure-of-eightforms produced under standard culture conditions(see Materials and Methods). Transposase, OrfAB,was supplied in trans, under the control of placUV5

from plasmid pAPT111 (Polard & Chandler, 1995a;see Materials and Methods). Transposon circlesand ®gure-of-eight forms were revealed by diges-tion with AccI, which converts the ®gure-of-eightform into a w structure and linearises the trans-

poson circle, and were separated by agarose gelelectrophoresis. The relative level of both ®gure-of-eight and circular transposon forms wasdetermined by hybridisation of the dried gel witholigonucleotide ocn4 (speci®c for lacZ; seeMaterials and Methods).

The results of a typical experiment are presentedin lanes 4, 5 and 6 of Figure 5(c). Quanti®cation ofthe transposition products (Figure 5(d)) indicatedthat all three plasmids generated indistinguishablelevels of ®gure-of-eight and circular forms. Thusno large differences in the activities of each term-inal IR were detectable.

Deletion analysis

Extensive studies involving point mutationsfailed to identify a single base-pair within theIRs essential for activity (C.N., unpublishedresults). To analyse more precisely which nucleo-tide sequences contained within IRR and IRL areimplicated in the recombination activity of theends, a deletion analysis was therefore under-taken.

To determine whether the 36 bp IRs of IS911 aresuf®cient in promoting recombination NsiI-HindIIIIRL and XbaI-NcoI IRR fragments carrying only the36 bp IR were assembled from synthetic oligonu-cleotides and substituted for the correspondingpCN100 fragments to generate, respectively, plas-mids pCN142 (IRL1-36) and pCN143 (IRR1-36;Figure 5(b)). The transposition activity of thesederivatives was measured as described above. Theresults are shown in Figure 5(d). Surprisingly,while pCN142 and pCN100 exhibited similar trans-position levels, pCN143 activity was only about40 % of pCN100. This suggests either that the¯anking DNA from the vector backbone oradditional IS911 sequences of the pCN100 in theoriginal XbaI-NcoI IRR fragment are required foroptimal IRR activity.

Plasmids pCN146 and pCN147 (Figure 5(b)),which retain, respectively, the original ¯ankingdonor backbone or the IS911 sequence, were con-structed and their activities tested. The results pre-sented in Figure 5(d) show that pCN146 retains thelevel of activity of pCN100 while the activity ofpCN147 is signi®cantly decreased. Sequenceswithin the 25 bp of donor backbone DNA ¯ankingIRR therefore clearly stimulate IRR activity.Although the nature of this effect remains to beexamined, the results demonstrate that the 36 bpterminal inverted repeats alone are ef®cient in pro-moting recombination.

Sequential deletion of IRR and IRL

In a second series of experiments, we determinedthe extent of one IR required for ®gure-of-eightand circle formation in the presence of a wild-typesecond end. Two sets of transposons were con-structed from plasmid pCN100 (see Materials andMethods and Table 1) in which one intact extre-

A

ori-pBR

Figure 5. Formation of ®gure-of-eight molecules and transposon circles in vivo. (a) Structure of plasmid pCN100used as a cloning vector here. Only relevant restriction sites are shown. A, AccI; H, HindIII; N, NcoI; Ns, NsiI; X,XbaI. Large white boxes, left and right terminal inverted repeats, IRL and IRR; cross-hatched box, fusion between the30 part of orfA and lacZ from the eighth codon (orfA0-lacZ); pIRL, indigenous IS911 promoter; un®lled oval, origin ofplasmid replication; bla, b-lactamase gene. Note that the DNA ¯anking IRL and IRR has been coded as an aid for dis-tinguishing the sequence environment of the IRs in the different plasmid constructs presented in (b). (b) Structure ofplasmids carrying various combinations of IRL and IRR. The construction of the indicated plasmids was accom-plished by cloning either double-strand oligonucleotides or PCR products (see Materials and Methods; the HindIII/NsiI or the NcoI/XbaI sites ¯anking the pCN100 IRL and IRR fragments, respectively. Note that the cloned IRL-carry-ing fragment includes 5 bp of ¯anking vector backbone DNA and 5 bp of the adjacent IS911 DNA that originally¯anked IRL on pCN100, while the equivalent IRR fragment also carries 9 bp of ¯anking vector backbone DNA and6 bp of the adjacent IS911 DNA that originally ¯anked IRR. The different ¯anking sequences are pattern-coded forcomparison. (c) Figure-of-eight and transposon circle formation. Plasmid DNA was extracted, digested with AccI, sep-arated by electrophoresis on a 1.5 % agarose gel and stained with ethidium bromide. Lane 1, pCN100 (IRL-IRR); lane2, pAPT111 (OrfAB); lane3, pCN100 �pAPT110 (vector); lane 4 to 6, pAPT111 (OrfAB) together with pCN100(IRL-IRR), pCN112 (IRL-IRL) or pCN113 (IRR-IRR), respectively; w, digested ®gure-of-eight; transposon, linearisedtransposon circle. (d) Relative activities of different combinations of ends. The end activity was determined followinghybridisation of the dried gel with a transposon-speci®c probe. Bands were quanti®ed by phosphorimagery. Theactivity of two independent induction experiments was calculated as the quantity of product (®gure-of-eights andtransposon circles) relative to the quantity of donor plasmid in each lane. The values given in the histogramexpressed as the relative ends activity compared to the wild-type plasmid activity were calculated as indicated inMaterials and Methods.


mity was retained while the other carried eitherprogressive terminal (from the outside) or sub-terminal (from the inside) deletions. The plasmidsused are illustrated in Figure 6(a). Typical results

for terminal deletions of IRL are shown inFigure 6(b). A progressive decrease in the level ofboth ®gure-of-eight and transposon circles wasobserved with increasing deletion length.

Table 1. Oligonucleotides used to generate IS911 different ends

Derivatives carrying consecutive deletions of the inside and outside regions of IRL and IRR were generated by PCR usingpCN100 as a matrix. Four nested sets of oligonucleotides (one set for each series of deletions) were used. Each carries a non-comple-mentary 50 extension which introduces one of the four restriction sites (HindIII, NsiI, XbaI or NcoI) appropriate for recloning. The 30region of each oligonucleotide carried the IR sequence which was to be retained. The digested PCR fragment was used to replacethe corresponding wild-type end fragment of pCN100.


Figure 6 (legend opposite)


The quantitative results for the four sets of del-etions are shown in panels 1-4 of Figure 6(c). Here,the reference activity (100 %) used for terminal IRRdeletions was that of pCN147 (deleted for the orig-inal external donor sequences at IRR; Figure 5(b))while for terminal IRL deletions, pCN143 (deleted

for the original external donor sequences at IRL)was used. Both curves exhibit a similar form. Onemajor difference, however, is that the activity ofIRR is more robust to deletion than that of IRL.Activity of IRR declined relatively slowly for del-etions up to base-pair 16 whereas deletions includ-


ing base-pair 19 showed only very low residualactivity (panel 1). For IRL, signi®cant loss ofactivity was observed for terminal deletions includ-ing base-pair 10. This implies that domain a is notessential for the formation of synaptic complex I inthe context of full-length transposase in vivo, and,moreover, that retention of activity re¯ects thecapacity of the terminally deleted derivative endsto act as targets in ®gure-of-eight and circle for-mation.

The results obtained with sub-terminal deletionsof IRR and IRL (panels 2 and 4) were similar toeach other. Activity decreased sharply for a frag-ment including base-pair 33, remained relativelyconstant for fragments of more than 25 bp, andwas reduced to residual levels for a fragment car-rying only the ®rst 21-23 bp. Note that this is theregion covered by the OrfAB[1-149] protection(Figure 3) and would therefore be expected to beinvolved in transposase binding.

These results show that a central segment,extending from base 8 to 25 in IRL and base 16 to24 in IRR, is important for IR activity. In bothcases, this includes domain b which is stronglyprotected by OrfAB[1-149]. However, this region isnot suf®cient for activity. When present togetherwith the opposite wild-type end, neither IRL8-25

nor IRR16-24 show activity in vivo (data not shown),suggesting that speci®c additional ¯ankingsequences on one side or the other are required.

Binding of OrfAB[1-149] to the deleted ends

In an attempt to distinguish between defects intransposase binding and in activity as a recombina-tion substrate, the set of deleted IRR ends wasexamined for OrfAB[1-149] binding using a gel-retardation assay. The DNA fragments used(Figure 7(a)) were all designed to have an identicallength of 128 bp. The results are shownin Figure 7(b). The wild-type end, which carriesthe terminal 52 bp and therefore includes the

Figure 6. Activity of IRL and IRR-carrying sequential deleassaying the activity of sequentially deleted left and right Isymbols are those used in Figure 5(a)). Consecutive arrowhor right indicate consecutive deletions of the test end fromsites used to clone the IRR derivatives are indicated withincated within the plasmid on the right were used to generatetransposition products are indicated on both plasmids. (brevealed on ethidium bromide stained 1.5 % agarose gels. Or100 mM IPTG. Plasmid DNA was prepared by the cleared-lyscating the ®rst and the last base positions retained on the IRthe corresponding lane. (c) Quanti®cation of the level of ®gdried gels. The x-axis represents the last base of the 36 bp IRinal base-pair is coordinate 1. The standard procedure descriwere quanti®ed by phosphorimagery. The activity was caltransposon circles) relative to the quantity of donor plasmidbase-pair 1 towards the inside border; panel (2), sub-terminpanel (3), terminal deletions of IRL from base-pair 1 towardIRL from base-pair 36 towards the end.

entire region protected from DNaseI attack byOrfAB[1-149], is shown in panel 3. A DNA frag-ment carrying only the 36 bp IRR (panel 2) wasobserved to behave in an identical manner. Thisindicates that the additional IS911 residues 37-42,protected by OrfAB[1-149], do not play a key rolein generating the paired-end complex. Removal ofbase-pairs 34-36 (fragment 1-33; panel 1), however,strongly affected formation of the paired end com-plex. Although bands corresponding to complex Iand complex II appeared at high protein concen-trations, the bands emerged together and signi®-cant levels of free DNA remained. Thus deletion ofonly 3 bp at the internal end of IRR greatlyreduced but did not entirely eliminate, paired-endformation and overall binding. This suggests thatthe last 3 bp of IRR may be involved in stabilisingthe paired-end complex. On the other hand, del-etion of base-pairs 1-19 had only a small effect onbinding (fragment IRR20-36; panel 4), whereas del-etion of base-pairs 1-20 completely eliminatedbinding (fragment IRR21-36; panel 5). These resultstherefore de®ne a region of 16 bp between pos-itions 20 and 36 which is essential for the bindingof OrfAB[1-149].

For IRL, a fragment carrying base-pair, 1-33displayed a similarly reduced binding activitycompared to wild-type IRL (1-36; data not shown).It is interesting to note, however, that a fragmentdeleted for bp 1-13 (IRL fragment 14-36) exhibitednearly wild-type levels of binding (data notshown) but exhibited no transposition activity incombination with a wild-type end (Figure 6(c)panel 3).

These results are consistent with the idea thatthe CA terminal region is involved in recognitionand activity of the catalytic domain of OrfAB whilethe sub-terminal region is required for synapticcomplex formation.

tions in vivo. (a) A generic map of the plasmids used inS911 ends in the presence of the wild-type partner. Theeads associated with IRR or IRL and pointing to the leftthe inside or outside of the element. The XbaI and NcoIthe plasmid on the left. The NsiI and HindIII sites indi-IRL derivatives. Positions of the AccI sites used to reveal) In vivo activity of IRL terminal deletion derivativesfAB expression (from plasmid pAPT111) was induced byate procedure and digested with AccI. Coordinates, indi-L fragment for each derivative, are given on the top of

ure-of-eight and transposon circles determined from thes retained in the particular deletion derivative. The term-bed for (a) was used for each set of deleted ends. Bandsculated as the quantity of product (®gure-of-eights and

in each lane. Panel (1), terminal deletions of IRR fromal deletions of IRR from base-pair 36 towards the end;s the inside border; panel (4), sub-terminal deletions of

Figure 7. OrfAB[1-149] binding to deleted ends in vitro. (a) PCR fragments used in (b). The oligonucleotides usedhybridised at a ®xed distance from a central position in IRR to generate fragments with an identical length of 128 bp.For each IRR-derivative fragment, the plasmid matrix and the primers used in the PCR reaction are indicated. Thedifferent parts of the IRR fragments are represented as in Figure 5(b). (b) Autoradiographs of gel-retardation assaysshowing OrfAB[1-149] binding activity to IRR derivatives. Panels 1 to 5, radiolabelled IRR-carrying PCR fragments(7 nM) were incubated for 30 minutes at 30 �C with various amount of OrfAB[1-149] (40 ng, 20 ng, 10 ng, 8 ng and3.2 ng). Complexed and non-complexed DNA molecules were separated on 5 % native polyacrylamide gels. Non-complexed DNA (Free) and the positions of complex I and II are indicated.


What determines the location of the targetphosphodiester bond?

Figure-of-eight and circle formation occur withhigh sequence ®delity. Strand transfer occurs prin-cipally three bases from the terminal CA dinucleo-tide. As described previously, mutation of theterminal dinucleotide of IRL and IRR suppressestheir capacity to act as donors in the strand-transfer reaction, but not their activities as targets(Polard et al., 1992; Polard & Chandler, 1995a).This did not affect the ®delity of strand transfer,which was shown to occur at the same position inthe mutant target end as in its wild-type counter-part. Moreover, ends which carry larger deletionsfrom the terminal CA dinucleotide were also pro®-cient as targets, although there was a progressive

reduction in target activity with increasing deletionlength. For example, deletion of the ®rst ten base-pairs of IRL reduced activity to 10 % that of a wild-type IRL (Figure 6).

An important question which arises from theseobservations is whether such relatively long del-etions affect the ®delity of strand transfer. Toinvestigate this, transposon circles generated fromderivatives carrying various terminal deletions inIRL or IRR were isolated and the nucleotidesequence of the junction was determined. Theresults are presented in Figure 8(a). Normally, theabutted IRL and IRR in IS911 circles are separatedby a 3 bp (or more rarely 4 bp) spacer sequencederived from sequences ¯anking the left or rightend (Figure 8(a), top; Polard et al., 1992). Transpo-son circles derived from transposons with pro-

Figure 8. (a) Junction sequences of IS911 circles obtained with deleted-end derivatives. The sequences wereobtained from PCR-ampli®ed fragments using transposon circles as a matrix. IRL and IRR sequences are shown inbold. Note that only the relevant part of the IRs is included. Conserved sequences in both ends are shown in boldwhite within grey boxes. WT, junction sequences circle from pCN100. A 3 bp spacer for the wild-type junction isshown as NNN. The nature of this sequence depends on which end (IRL or IRR) is used as the donor. �IRL and�IRR, junctions obtained from derivatives with deleted IRL or IRR. The parental plasmids with the coordinates car-ried by the deleted end are shown on the right. Note that two sequences were obtained for circles from pCN72. (b)Model of the synaptic complex. Grey boxes a, b and g indicate the conserved sequence blocks in the IRs (Figure 1(b)).The N-terminal OrfAB-binding domains are shown as cross-hatched objects and the catalytic domains are shown ingrey. The two IR copies are shown anchored by the N-terminal part of the transposase, leaving the terminal base-pairs free for interaction with the catalytic domain. The Figure shows that attack of the target end (white arrow) bythe donor end can occur in the absence of the normal terminal IR sequence. These interactions are shown to occur incis (the catalytic domain of the OrfAB molecule bound to one end acting on the bound end) but may occur alterna-tively in trans (the catalytic domain of the OrfAB molecule bound to one end acting on opposite end).


gressive terminal deletions of the left (�IRL) orright (�IRR) ends exhibit a similarly conservedspacing. These results thus indicate that attackby the wild-type end occurs at a ®xed distancefrom the region of the target end which carries thebinding site for the transposase derivative

OrfAB([1-149]. The position of attack of the phos-phodiester bond in the target end does not there-fore depend on the nature of the neighbouringDNA sequence. The presence of the OrfAB[1-149]binding domain is therefore suf®cient to positionthe target end for attack (Figure 8(b)).


Discussion

For those IS elements which have been exam-ined, the terminal IRs carry only a single transpo-sase binding site. Interactions betweentransposases and the single sites in their cognateends has been detected for several ISs. Theseinclude the bacterial elements IS10 (Sakai et al.,1995), IS30 (Stalder et al., 1990), IS50 (Wiegand &Reznikoff, 1994), IS903 (Derbyshire & Grindley,1992; Tavakoli et al., 1997), and IS911 (Haren et al.,1998, 2000). Transposase interactions have alsobeen observed with the simple ends of two trans-posons of the Tn3 family, gd (Wiater & Grindley,1988) and Tn3 itself (New et al., 1988). On the otherhand, paired-end or synaptic complexes have beenobserved directly only for IS10 (Sakai et al., 1995),IS50 (Bhasin et al., 2000) and IS911 (with a catalyti-cally truncated transposase; Haren et al., 2000). Inthe results presented here we have analysed var-ious components involved in the assembly ofsynaptic complexes which lead to the formation of®gure-of-eight molecules in the IS911 transpositionpathway. It should be kept in mind that since wehave used transposase derivatives which havebeen deleted for a large part of their C-terminalregion, the complexes we observe are not strictlyintermediates in the pathway of ®gure-of-eightformation. While they are clearly not completesynaptic complexes, since they lack the catalyticTpase domains, we believe that they share basicend-pairing characteristics with the fully assembledsynaptic complex.

Protein components required for end binding

The formation of complexes containing twoIS911 ends requires a transposase derivative carry-ing the ®rst 135 amino acid residues of OrfAB.Three major complexes (I, II and III) could beobserved using a band-shift assay (Figure 2). Full-length OrfAB is extremely inef®cient in bindingIS911 ends in vitro but the pairing of two IS911ends by derivatives of OrfAB deleted for theC-terminal region (OrfAB[1-135] or OrfAB[1-149])occurred ef®ciently to generate a paired-end com-plex (complex I). These proteins carry the HTH, LZand M regions (Figure 1(c)). Deletion of the Mregion or mutation of the LZ impair both multi-merisation and OrfAB-IR binding. This suggestedthat multimerisation of the protein is importantfor its DNA binding activity (Haren et al., 1998,2000). Formation of complex I appeared highly co-operative. No intermediates in the assembly path-way could be identi®ed. Complex II is thought toresult from titration of the IRs by increasingamounts of protein and to contain only one IRfragment bound by OrfAB[1-149]. Although com-plex III could be generated ef®ciently by prior mix-ing of OrfAB[1-135] or OrfAB[1-149] with either ashorter OrfAB derivative, OrfAB[1-109] or OrfAitself, neither of the shorter proteins appeared tobind the IRs alone nor could they be detected in

the complex (Haren et al., 2000). This suggests thatformation of complex III involves interactionsbetween proteins with and without the M region(residues 109-135; Figure 1(c)). The LZ motif(residues 63-95) is certainly involved, sincemutations L84R or L84P abolish or strongly reduceformation of complex III (Haren et al., 1998). Therapid mobility of complex III may re¯ect thepresence of a lower-order OrfAB[1-149] multimerbound to a single end (Haren et al., 2000).Although OrfA clearly modi®es the binding prop-erties of OrfAB[1-149], care should be exercised inextrapolating these results to full-length transpo-sase. The presence of the C-terminal region, whichmodi®es the multimerisation properties of OrfAB,may also modify the consequences of OrfA inter-actions. Indeed, in vitro, OrfA appears to have nonotable effect on OrfAB-mediated ®gure-of-eightformation which involves formation of synapse A(Haren et al., 1998) while it strongly modi®es fulllength OrfAB activity in promoting integrationthrough synapse B (C. Loot, unpublished results).

IS50 exhibits some similarities to, and somedifferences from, IS911. Like IS911 OrfAB, wild-type IS50 transposase bound only poorly to theterminal IRs. However it was found to bind asingle end, either when complexed with the inhibi-tor protein, Inh, or other derivatives truncated forthe N-terminal region (Wiegand & Reznikoff,1994), or when deleted for its C-terminal domain(Weinreich et al., 1994; York & Reznikoff, 1996). Inorder to visualise a paired-end complex, it wasfound necessary to use a hyperactive transposasemutant (Goryshin & Reznikoff, 1998). Thismutation presumably releases interactions withinthe protein which are inhibitory for binding(Davies et al., 2000). In contrast to IS911 OrfAB,deletion of as little as eight amino acid residuesfrom the C-terminal end greatly reduced dimerisa-tion and assembly of the synaptic complex(Steiniger-White & Reznikoff, 2000). This presum-ably simply re¯ects a different arrangement in thefunctional regions of the two proteins.

For other ISs, while binding of partial (IS30,Stalder et al., 1990; IS903, Tavakoli et al., 1997; Tn3,Maekawa et al., 1993) or full-length (IS903,Derbyshire & Grindley, 1992; Tn3, Ichikawa et al.,1987; New et al., 1988; gd, Wiater & Grindley, 1988)transposase has been observed, no paired-endcomplexes have yet been identi®ed by gel retar-dation. For the three bacterial elements, IS10, IS50and IS911, where paired-end complexes have beenidenti®ed by gel retardation, no intermediates intheir assembly have been detected, implying thatthis process is highly organised and co-operative(Sakai et al., 1995; Steiniger-White & Reznikoff,2000; Haren et al., 2000). This is true even in thecase of IS10 where formation of paired-end com-plexes with ``outside ends'' requires the assistanceof the host IHF protein (Sakai et al., 1995).


Protection profiles of DNA sequences inOrfAB[1-149]-IR complexes

All three IS911 complexes showed similar pro-tection patterns when analysed by DNaseI foot-printing: OrfAB[1-149] protected the sub-terminalregion of both IRs encompassing the conservedsegments b and g (Figure 1(b)). Protection of IRRextended between bases 40 and 16, leaving theterminal 15 base-pairs accessible (conserved regiona, Figures 1(b), 3 and 4). This demonstrates that noadditional DNA sites are occupied on increasingthe protein concentration. These results are inagreement with the idea that complex II is derivedfrom complex I by loss of one of the two DNAfragments by titration while retaining the samenumber of protein monomers in the complex(Haren et al., 2000). They also demonstrate thatOrfA does not dramatically change the interactionof OrfAB[1-149] with its binding site and are con-sistent with the idea that complex III is generatedby OrfA-induced changes in the interactionbetween OrfAB[1-149] protomers. The results ofCu(OP)2 protection are coherent with thoseobtained by DNaseI protection (Figure 3). Inaddition, for complexes I and II, accessibility toDNA is reduced in the terminal region includingthe conserved block a (Figure 1(b)) although thisregion remains sensitive to DNaseI. This suggestseither that binding of OrfAB[1-149] modi®es DNAconformation or that non-speci®c DNA-proteininteractions occur which are displaced by DNaseIbut not by the Cu(OP)2 reagent. On the otherhand, the pattern obtained for complex III is moreclearly similar to that of the free DNA. It is inter-esting to note that a crude extract containing trans-posase protects a similar region against DNaseI inthe 41 bp IRs of the related IS2 element. Thisoccurred between base-pairs 16 and 42 for IRR and16 to 46 for IRL (Hu et al., 1996). It is possible,however, that as shown for IS911, this footprintis due to preferential binding of truncatedOrfAB derivatives in the preparation. A similartype of protection has been demonstrated for theN-terminal 17 kDa region of the IS30 transposase(Stalder et al., 1990).

DNA sequences required for OrfAB[1-149]binding

The extent of the OrfAB[1-149] binding site onIRR was also analysed by the capacity of ends car-rying consecutive deletions to bind the truncatedprotein (Figure 7). These results showed that, whileprotected against DNaseI attack, the nature of thesequence between bases 36 and 44 is not importantfor binding, since it can be exchanged for ¯ankingvector DNA. Terminal deletions including base-pair 20 or sub-terminal deletions including base-pair 34 strongly reduced or eliminated binding.These limits include precisely the conserved b andg regions of IRR.

The results show that about 16 bp of IRR(position 20-36) are suf®cient for ®xation ofOrfAB[1-149] and for end pairing. Similar resultsobtained with IRL suggest that it too carries ananalogously located sequence core. This suggests amodel in which the ends are anchored by the bind-ing of the N-terminal region of OrfAB (Figure 4(b)).The region accessible to DNaseI attack is presum-ably contacted by the C-terminal part of OrfABthat contains the catalytic core.

DNA sequences required forrecombination activity

The results raise the question of whether asynaptic complex assembled with one end com-posed of the minimal binding sequence (targetend) and a wild-type (donor) end shows recombi-nation activity. Measurement of the activity ofdeleted ends in vivo provided some insight. Sub-terminal deletions of both IRR and IRL decreaseactivity in a similar way (Figure 6(b), panels 2 and4). This fall in activity is correlated with a decreasein the capacity to bind OrfAB[1-149] (Figure 7).Although the reduction in activity for terminal del-etions of IRR (Figure 6(b), panel 1) correlated wellwith the capacity of the ends to bind OrfAB[1-149]the situation appears somewhat different for IRL.Terminal deletions including base-pair 13 of IRLare not active in ®gure-of-eight and circle for-mation in vivo but display relatively good bindingactivity in vitro. Thus additional bases within blocka are required for IRL activity. This may be due tothe fact that we have used a truncated form ofOrfAB, amputated for its catalytic domain, in thebinding assay while transposition activity wasassayed using full-length transposase. It is possiblethat the catalytic domain of the transposase, byinteracting with block a, contributes to the stabilityof the paired-end complex. This contribution maybe different for IRR and IRL due to the sequencedifferences in this region. This notion is supportedby the reciprocal observation that sub-terminal del-etions which reduce binding of OrfAB[1-149] retainsigni®cant transposition activity. Analysis of sev-eral other systems has suggested that the transpo-sase catalytic domain also contributes to DNArecognition. Examples such as speci®c cross-linkingof retroviral ends to residues in the IN active site(e.g. Jenkins et al., 1997), and the highly revealingIS50 synaptic structure with precleaved ends(Davies et al., 2000) all support this view.

A model of the IS911 synaptic complex I

Together, the results can be incorporated into amodel of the type shown in Figure 8(b), in whichthe N-terminal region of OrfAB binds the con-served boxes b and g in a sequence-speci®c mannerand anchors the two IS ends into a paired-endcomplex. The external region of the IR is proposedto contact the C-terminal transposase domain car-rying the catalytic site. This is supported by the


nucleotide sequence of circle junctions generatedfrom IS911 derivatives which carry consecutiveterminal deletions of one or other end (Figure 8(a)).These demonstrated that strand transfer occurredat a ®xed distance from the transposase bindingsite on the target deleted end. This implies that theposition of attack is determined by the position ofthe target end in the complex (Figure 8(b)). How-ever, in view of the subtle differences in activity ofthe IRR and IRL sequences, interactions betweentransposase and the terminal region probably alsoshow some sequence-speci®city that seems to beimportant at least for IRL activity.

The model shown depicts the two ends in a par-allel con®guration. This is for convenience only.Recent studies with the transposase of IS50 haveshown that two precleaved IS ends are assembledtogether with a transposase dimer in an antiparal-lel con®guration (Davies et al., 2000) and that clea-vage and strand transfer occurs in trans wheretransposase bound to one end cleaves and transfersthe opposite end (Naumann & Reznikoff, 2000).Although in the case of IS911 cleavage and strandtransfer which occurs in synaptic complex A isasymmetric, it is possible that the IS911 synapticcomplex assumes a similar con®guration.

The results presented here provide a descriptionof a paired-end complex generated between twoIS911 ends and the N-terminal region of the OrfABtransposase. This represents a ®rst step in de®ningthe ®rst synaptic complex in the IS911 transposi-tion pathway. Future studies must be directedtowards determining the protein stoichiometryin the different complexes, and comparing thesecomplexes with those formed with the full-lengthprotein.

Materials and Methods

Bacterial strains and media

The Escherichia coli strains used were derivatives ofMC1061 (Casadaban & Cohen, 1980). The in vivo tests ofIS911 end activity used JS219 (Cam et al., 1988). IS911proteins were prepared from Mi898 (Polard et al., 1996).Cells were grown in terri®c broth (TeB) medium,supplemented where necessary with ampicillin (Ap,100 mg/ml) and kanamycin (Km, 25 mg/ml).

Plasmids

Plasmids pAPT110 and pAPT111 have been described(Polard & Chandler, 1995a). Brie¯y, pAPT110 is a p15A-based plasmid carrying the promoter, placUV5, the lacIQ

gene and a kanamycin-resistance cassette. PlasmidpAPT111 was derived from pAPT110. It carries orfABtogether with the indigenous IS911 ribosome binding site(rbs) under the control of placUV5. The sequence of thecritical regions of all plasmids described below was con-®rmed using either the Amersham thermosequenasecycle sequencing kit or the T7 sequencing kit (PharmaciaBiotech).

Vector pCN100

The vector plasmid carrying the wild-type IS911 endsused here was pCN100, and was constructed as follows.Plasmid pAPT174 carries a synthetic IS911 transposon(Ton-Hoang et al., 1997). It was digested with XbaI andXhoI to remove a 135 bp fragment including a copy ofthe placUV5 promoter located within the synthetic trans-poson close to IRR. The digested plasmid was treatedwith T4-DNA polymerase to generate ¯ush ends. It wasrecircularised by self-ligation and used to transform hoststrain JS219. The resulting plasmids were isolated andone lacking the XhoI site but in which the XbaI site hadbeen regenerated by imperfect T4 polymerase ®lling wasretained. A BamHI-HindIII fragment (134 bp) containingIRL and a SphI-XbaI fragment (450 bp) containing IRRwere transferred from this plasmid, pAPT174B, intoM13mp19 to generate M13BH and M13SX and submittedto site-speci®c mutagenesis using the method describedby Kunkel et al. (1987).

Oligonucleotides ocn2 (50GTTCTGAGGTGATGCATATCACCTCTG) and ocn1 (50GCTGTTGAGCCATGGTGATTTCGC) were used to introduce an NsiI site at theinternal boundary of IRL and an NcoI site outside IRR.The mutated fragments were transferred back intopAPT174B using the same restriction sites used for theinitial cloning into M13mp19. This generated pCN100carrying IRL on a 75 bp HindIII-NsiI fragment and IRRon an 88 bp XbaI-NcoI fragment (Figure 5(a)).

Deleted-end derivatives

Derivatives carrying consecutive deletions of theinside (sub-terminal) and outside (terminal) regions ofIRL and IRR were generated by PCR using pCN100 as amatrix. Four nested sets of oligonucleotides (one set foreach series of deletions) was used. Each carried a non-complementary 50 extension which introduces one of thefour restriction sites (HindIII, NsiI, XbaI or NcoI) appro-priate for recloning. The 30 region of each oligonucleotidecarried the IR sequence which was to be retained. Foreach set of oligonucleotides, the complementary oligonu-cleotide hybridises downstream of the relevant restric-tion sites. All the oligonucleotides used to construct thedeletion derivatives are shown in Table 1.

IRL derivatives with sub-terminal deletions weregenerated using the oligonucleotides ocn31, ocn15, ocn9,ocn32, ocn33 or ocn34 (carrying an NsiI 50extension),together with ocn7. The NsiI/HindIII-digested fragmentswere transferred into pCN100 to generate plasmidspCN65 (IRL1-33), pCN53 (IRL1-31), pCN55 (IRL1-26),pCN66 (IRL1-25), pCN74 (IRL1-23) and pCN67 (IRL1-22).

IRL derivatives with terminal deletions were gener-ated using oligonucleotides ocn39, ocn40, ocn8, ocn41or ocn13 (carrying a HindIII 50 extension) togetherwith ocn4. The NsiI/HindIII-digested fragments weretransferred into pCN100 to generate plasmids pCN72(IRL6-36), pCN73 (IRL8-36), pCN56 (IRL11-36), pCN75(IRL12-36) and pCN59 (IRL14-36).

IRR derivatives with sub-terminal deletions were gen-erated using oligonucleotides ocn104, ocn50, ocn49,ocn11, ocn35, ocn36, ocn22, ocn37 or ocn38 (carrying aXbaI 50extension) together with ocn6. The XbaI/NcoI-digested PCR fragments were transferred into pCN100to generate plasmids pCN146 (IRR1-36), pCN86 (IRR1-33),pCN82 (IRR1-30), pCN57 (IRR1-26), pCN68 (IRR1-24),pCN69 (IRR1-22), pCN61 (IRR1-21), pCN70 (IRR1-19) andpCN71 (IRR1-18).


IRR derivatives with terminal deletions were gener-ated using oligonucleotides ocn105, ocn99, ocn23, ocn51,ocn52, ocn53, ocn54 or ocn26 (carrying an NcoI50extension), together with ocn47. The XbaI/NcoI-digested PCR fragments were transferred into pCN100to generate, respectively, plasmids pCN147 (IRR1-36),pCN58 (IRR6-36), pCN60 (IRR16-36), pCN83 (IRR18-36),pCN84 (IRR19-36), pCN85 (IRR20-36) and pCN63 (IRR21-36).

Oligonucleotides ocn101 and ocn102 (Table 1) werehybridised and ligated to the 6747 bp XbaI-NcoIfragment of pCN100. This generated plasmid pCN143carrying a 36 bp XbaI-NcoI IRR fragment.

Oligonucleotides ocn100 and ocn103 (Table 1) werehybridised and ligated to the 6760 bp HindIII-NsiIfragment of pCN100. This generated plasmid pCN142carrying a 36 bp HindIII-NsiI IRL fragment.

IRR-IRR and IRL-IRL donor plasmids

Oligonucleotides ocn69 and ocn70 (Table 1) werehybridised and ligated to the pCN100 6747 bp XbaI-NcoIfragment to generate pCN112 containing two copies ofIRL.

Oligonucleotides and ocn71 and ocn72 (Table 1) werehybridised and ligated with the pCN100 6760 bpHindIII-NsiI fragment to generate pCN113 containingtwo copies of IRR.

DNA procedures

Standard techniques were used for DNA manipulationand cloning (Sambrook et al., 1989). For in vivo studies,plasmid DNA was extracted using a modi®cation ofthe cleared-lysate procedure, as described (Polard &Chandler, 1995a). After treatment with proteinase K thelysate was precipitated with 0.6 volume of isopropanol,washed with 70 % (v/v) ethanol and immediately resus-pended in 100 ml of TE buffer. A 500 ml volume of PBbuffer (Qiagen) was added and the DNA was puri®edusing a Qiagen miniprep kit following the procedurerecommended by the supplier.

Reaction products obtained in vivo were quanti®ed fol-lowing digestion of plasmid DNA with AccI, separationof the species on a 1.6 % (w/v) agarose gel in TAE bufferat room temperature and staining with ethidiumbromide.

DNA quanti®cations were performed by hybridisationof the dried, ethidium bromide stained gel. The gel wasdried at 70 �C for one hour and hybridised directly with50 32P-radiolabelled oligonucleotide ocn4 (Table 1; Polard& Chandler, 1995a). Hybridisation was for 12-15 hoursat 42 �C. The bands were quanti®ed using a Fuji XBAS1000 phosphorimaging system coupled to the PCBassoftware package.

All the PCR fragments used here were puri®ed on10 % (w/v) polyacrylamide gels and eluted overnight at37 �C from the gel in 10 mM Tris-HCl (pH 8.0), 1 mMEDTA (pH 8.0), 0.2 % (w/v) SDS, 0.3 M NaCl buffer.The same elution procedure was used to recover DNAfrom retardation complexes in the DNA footprintingexperiments.

Protein purification

Puri®cation of OrfA (from cells carrying pAPT156) hasbeen described (Ton-Hoang et al., 1998). The transposaseOrfAB was prepared, as described, from Mi898-contain-ing pAPT158 (Ton-Hoang et al., 1998). OrfAB[1-149]

(from cells carrying pLHT114), OrfAB[1-135] (from cellscarrying pLHT117) and OrfAB[1-109] (from cells carry-ing pLHT56) were puri®ed in an identical way to OrfAB(Haren et al., 1998). OrfA was stored in buffer A (25 mMHepes (pH 7.5), 2 mM EDTA, 1 mM dithiothreitol(DTT), 20 % (v/v) glycerol) containing 0.4 M KCl,2 mM Chaps. OrfAB, OrfAB[1-149], OrfAB[1-135] andOrfAB[1-109] were stored in buffer A containing0.4 M KCl.

DNaseI and Cu(OP)2 footprinting

The IRR fragment used was generated by PCR usingpCN100 as a matrix and ocn47 (Table 1) and ocn77(50CAGCCTGCTCAGGGTCAACG) as primers. Their50ends hybridised, respectively, 107 bp downstream and20 bp upstream of the A1 position (Figure 1) of IRR.Depending on the strand studied, either ocn47 (lowerstrand) or ocn77 (upper strand) was radiolabelled with[g-32P]ATP. The binding reaction was performed asdescribed (Haren et al., 1998, 2000). The IRR fragment(7 nM) was incubated with 38.4 ng (140 nM ®nal concen-tration) of OrfAB[1-149] and 440 ng (2500 nM ®nal con-centration) of OrfA in a ®nal volume of 16 ml.

DNaseI footprinting was performed after a bindingreaction of 30 minutes (see gel-retardation assay sectionbelow); 7 � 10ÿ5 units of DNaseI (Sigma-Aldrich) dilutedin OrfAB[1-149] storage buffer, MgCl2 (7 nM ®nal con-centration) and CaCl2 (3 nM ®nal concentration) wereadded in a ®nal volume of 20 ml. Cleavage was per-formed for one minute at 30 �C and terminated by theaddition of 1 ml of 500 mM EDTA. Complexes were sep-arated on a 5 % polyacrylamide gel. For the Cu(OP)2

footprinting, protein-DNA complexes were separated ona 5 % polyacrylamide gel prior to cleavage. The cleavagewas performed by incubating the gel with Cu(OP)2 asdescribed (Kuwabara & Sigman, 1987). For both foot-printing procedures, DNA was recovered from the gel,precipitated with ethanol and resuspended in distilledwater (10000 cpm/ml). Formamide was added to 50 %(v/v) ®nal concentration. The cleavage pattern wasrevealed by electrophoresis on a 6 % sequencing gel. Ahydrazine and formic acid standard chemical sequencingreaction (Maxam & Gilbert, 1980) performed on the samePCR fragment was used as a size standard.

In vivo activity of deleted ends

pCN100 derivatives were individually introduced intoJS219 together with pAPT111 (to provide OrfAB) orpAPT110 (vector) by cotransformation. TeB medium(100 ml) supplemented with Km and Ap was inoculatedto A540 � 0.05 with an overnight preculture grown at42 �C (in supplemented TeB). Cells were grown at 30 �Cand OrfAB expression was induced at A540 � 0.6-0.7 bythe addition of IPTG to 0.1 mM for 150 minutes. PlasmidDNA was extracted as described above and digestedwith AccI.

Gel-retardation assay

All IRR fragments used were generated by PCR andradiolabelled with 32P. Plasmid pAPT166 with oligonu-cleotides o5 and o6 were used as previously described togenerate the 100 bp IRR fragment used for Figure 2(Haren et al., 2000). The IRR fragments used for Figure 8were generated as follows. The oligonucleotides usedhybridised at a ®xed distance from a central position in


IRR to generate fragments with an identical length of128 bp (Figure 8(a)). The following combination ofmatrices and primers were used. IRR(1-52): pCN100with oligonucleotides ocn47 and ocn77. IRR(1-36):pCN143 with oligonucleotides ocn104 (50TAACCGGGCAGGCCATGTCTG) and ocn105 (50CTATGCAGAAATCACCAT). IRR(1-33): pCN86 with primersocn65 (50AATAACCGGGCAGGCCATGT) and ocn77.IRR(18-36): pCN83 with primers ocn79 (50CACCCCCAAGTCTGGCTATG) and ocn47. IRR(20-36): pCN85with primers ocn84 (50TCAATCACCCCCAAGTCTGGC)and ocn47. IRR(21-36): pCN63 with primers ocn88(50AACTCATCACCCCCAAGTCT) and ocn47. In a stan-dard gel-retardation assay (Haren et al., 1998) 7 nM ofthe DNA fragment (5000 cpm Cerenkov) were incubatedwith OrfAB, OrfAB[1-149], OrfAB[1-135], OrfAB[1-109]or OrfA in a ®nal volume of 16 ml. The various amountsof proteins used in the results presented in Figure 2 aredescribed in the Figure legend. For the results presentedin Figure 8, the amounts of OrfAB[1-149] were 40 ng,20 ng, 10 ng, 8 ng and 3.2 ng. Complexes were separatedin a 5 % polyacrylamide gel in TBE buffer.

Sequence of the circle junction

The sequences of the circle junctions presented inFigure 9 were obtained in two steps. In the ®rst step,PCR-ampli®ed fragments were generated from transpo-son circles of pCN72, pCN73, pCN56, pCN58 andpCN60. The circles, generated as described above, wereseparated from other species by electrophoresis in 0.7 %agarose gels in TAE buffer. A gel plug containing thecircular species was removed with a Pasteur pipetteand placed directly in 100 ml of PCR mix containing0.6 mM of each oligonucleotide ocn4 and ocn46(50CGCGGCGACTTCCAGTTCAA), 100 mM each dNTP,3U pfu polymerase (Promega) in the recommended buf-fer. A total of 26 cycles of 30 seconds (95 �C), 1 minute(60 �C) and 1 minute (72 �C) were used. PCR productswere puri®ed using the QIAquick PCR puri®cation kit(Qiagen) and sequenced with the Amersham thermose-quenase cycle sequencing kit using oligonucleotide ocn4.

Note added in proof

Recent studies from the laboratories of Lewis andGrindley with the related IS2 sequence have providedsimilar and complementary results. In addition, theyhave demonstrated that the position of the terminal CArelative to the sub-terminal transposase binding domainis important in its activity as a donor (L. A. Lewis,M. Greene, R. Saby, N. Gadura & N. D. F. Grindley,unpublished results).

Acknowledgements

We thank members of the Mobile Genetic ElementsGroup (P. Rousseau, C. Turlan, C. Loot and R. Alazard)for discussions and critical reading of the manuscript,and B. Cointin for technical assistance. C. N. was sup-ported by a grant from the MinisteÁre d'Education Natio-nale and a predoctoral fellowship from the Fondationpour la Recherche Medicale. This work bene®ted fromgrants from the CNRS (UPR9007), the ``Programme Phy-

sique et Chimie du vivant'' (CNRS) and the ``Programmemicrobiologie'' (MENRST).

References

Andrake, M. D. & Skalka, A. M. (1996). Retroviral inte-grase, putting the pieces together. J. Biol. Chem. 271,19633-19636.

Bhasin, A., Goryshin, I. Y., Steiniger-White, M., York, D.& Reznikoff, W. S. (2000). Characterization of a Tn5pre-cleavage synaptic complex. J. Mol. Biol. 302,49-63.

Bolland, S. & Kleckner, N. (1996). The three chemicalsteps of Tn10/IS10 transposition involve repeatedutilization of a single active site. Cell, 84, 223-233.

Cam, K., Bejar, S., Gil, D. & Bouche, J. P. (1988). Identi®-cation and sequence of gene dicB: translation of thedivision inhibitor from an in-phase internal start.Nucl. Acids Res. 16, 6327-6338.

Casadaban, M. J. & Cohen, S. N. (1980). Analysis ofgene control signals by DNA fusion and cloning inEscherichia coli. J. Mol. Biol. 138, 179-207.

Davies, D. R., Goryshin, I. Y., Reznikoff, W. S. &Rayment, I. (2000). Three-dimensional structure ofthe Tn5 synaptic complex transposition intermedi-ate. Science, 289, 77-85.

Derbyshire, K. M. & Grindley, N. D. (1992). Binding ofthe IS903 transposase to its inverted repeat in vitro.EMBO J. 11, 3449-3455.

Derbyshire, K. M., Hwang, L. & Grindley, N. D. (1987).Genetic analysis of the interaction of the insertionsequence IS903 transposase with its terminalinverted repeats. Proc. Natl Acad. Sci. USA, 84, 8049-8053.

Goryshin, I. Y. & Reznikoff, W. S. (1998). Tn5 in vitrotransposition. J. Biol. Chem. 273, 7367-7374.

Haren, L., Polard, P., Ton-Hoang, B. & Chandler, M.(1998). Multiple oligomerisation domains in theIS911 transposase: a leucine zipper motif is essentialfor activity. J. Mol. Biol. 283, 29-41.

Haren, L., Normand, C., Polard, P., Alazard, R. &Chandler, M. (2000). IS911 transposition is regu-lated by protein-protein interactions via a leucinezipper motif. J. Mol. Biol. 296, 757-768.

Hu, S. T., Lee, L. C. & Lei, G. S. (1996). Detection of anIS2-encoded 46-kilodalton protein capable of bind-ing terminal repeats of IS2. J. Bacteriol. 178, 5652-5659.

Huisman, O., Errada, P. R., Signon, L. & Kleckner, N.(1989). Mutational analysis of IS10`s outside end.EMBO J. 8, 2101-2109.

Ichikawa, H., Ikeda, K., Wishart, W. L. & Ohtsubo, E.(1987). Speci®c binding of transposase to terminalinverted repeats of transposable element Tn3. Proc.Natl Acad. Sci. USA, 84, 8220-8224.

Jenkins, T. M., Esposito, D., Engelman, A. & Craigie, R.(1997). Critical contacts between HIV-1 integraseand viral DNA identi®ed by structure-based anal-ysis and photo-crosslinking. EMBO J. 16, 6849-6859.

Jilk, R. A., York, D. & Reznikoff, W. S. (1996). Theorganization of the outside end of transposon Tn5.J. Bacteriol. 178, 1671-1679.

Kunkel, T. A., Roberts, J. D. & Zakour, R. A. (1987).Rapid and ef®cient site-speci®c mutagenesiswithout phenotypic selection. Methods Enzymol. 154,367-382.

Kuwabara, M. D. & Sigman, D. S. (1987). FootprintingDNA-protein complexes in situ following gel retar-


dation assays using 1,10-phenanthroline-copper ion:Escherichia coli RNA polymerase-lac promoter com-plexes. Biochemistry, 26, 7234-7238.

Lavoie, B. D., Chan, B. S., Allison, R. G. & Chaconas, G.(1991). Structural aspects of a higher order nucleo-protein complex: induction of an altered DNAstructure at the Mu-host junction of the Mu type 1transpososome. EMBO J. 10, 3051-3059.

Lewis, L. A. & Grindley, N. D. (1997). Two abundantintramolecular transposition products, resultingfrom reactions initiated at a single end, suggest thatIS2 transposes by an unconventional pathway. Mol.Microbiol. 25, 517-529.

Maekawa, T., Amemura-Maekawa, J. & Ohtsubo, E.(1993). DNA binding domains in Tn3 transposase.Mol. Gen. Genet. 236, 267-274.

Mahillon, J. & Chandler, M. (1998). Insertion sequences.Microbiol. Mol. Biol. Rev. 62, 725-774.

Maxam, A. M. & Gilbert, W. (1980). Sequencing end-labeled DNA with base-speci®c chemical cleavages.Methods Enzymol. 65, 499-560.

Naumann, T. A. & Reznikoff, W. S. (2000). Trans cataly-sis in Tn5 transposition. Proc. Natl Acad. Sci. USA,97, 8944-8949.

New, J. H., Eggleston, A. K. & Fennewald, M. (1988).Binding of the Tn3 transposase to the invertedrepeats of Tn3. J. Mol. Biol. 201, 589-599.

Polard, P. & Chandler, M. (1995a). An in vivo transpo-sase-catalyzed single-stranded DNA circularizationreaction. Genes Dev. 9, 2846-2858.

Polard, P. & Chandler, M. (1995b). Bacterial transpo-sases and retroviral integrases. Mol. Microbiol. 15,13-23.

Polard, P., Prere, M. F., Chandler, M. & Fayet, O. (1991).Programmed translational frameshifting andinitiation at an AUU codon in gene expression ofbacterial insertion sequence IS911. J Mol. Biol. 222,465-477.

Polard, P., Prere, M. F., Fayet, O. & Chandler, M. (1992).Transposase-induced excision and circularization ofthe bacterial insertion sequence IS911. EMBO J. 11,5079-5090.

Polard, P., Ton-Hoang, B., Haren, L., Betermier, M.,Walczak, R. & Chandler, M. (1996). IS911-mediatedtranspositional recombination in vitro. J. Mol. Biol.264, 68-81.

Rousseau, P., Normand, C., Loot, C., Turlan, C.,Alazard, R., Duval-Valentin, G. & Chandler, M.

(2001). Transposition of IS911. In Mobile DNA II(Craig, N., Craigie, R., Gellert, M. & Lambowitz, A.,eds), ASM Press (in the press), Washington.

Sakai, J., Chalmers, R. M. & Kleckner, N. (1995). Identi®-cation and characterization of a pre-cleavage synap-tic complex that is an early intermediate in Tn10transposition. EMBO J. 14, 4374-4383.

Sambrook, J., Fritsh, E. F. & Maniatis, T. (1989). Molecu-lar Cloning: A Laboratory Manual, 2nd edit., ColdSpring Harbor Laboratory Press, Cold SpringHarbor, NY.

Sekine, Y., Aihara, K. & Ohtsubo, E. (1999). Lineariza-tion and transposition of circular molecules ofinsertion sequence IS3. J. Mol. Biol. 294, 21-34.

Stalder, R., Caspers, P., Olasz, F. & Arber, W. (1990).The N-terminal domain of the insertion sequence 30transposase interacts speci®cally with the terminalinverted repeats of the element. J Biol. Chem. 265,3757-3762.

Steiniger-White, M. & Reznikoff, W. S. (2000). The C-terminal {alpha} helix of Tn5 transposase is requiredfor synaptic complex formation. J. Biol. Chem. 275,23127-23133.

Tavakoli, N. P., DeVost, J. & Derbyshire, K. M. (1997).De®ning functional regions of the IS903 transpo-sase. J. Mol. Biol. 274, 491-504.

Ton-Hoang, B., Betermier, M., Polard, P. & Chandler, M.(1997). Assembly of a strong promoter followingIS911 circularization and the role of circles in trans-position. EMBO J. 16, 3357-3371.

Ton-Hoang, B., Polard, P. & Chandler, M. (1998).Ef®cient transposition of IS911 circles in vitro.EMBO J. 17, 1169-1181.

Weinreich, M. D., Mahnke-Braam, L. & Reznikoff, W. S.(1994). A functional analysis of the Tn5 transposase.Identi®cation of domains required for DNA bindingand multimerization. J Mol. Biol. 241, 166-177.

Wiater, L. A. & Grindley, N. D. (1988). Gamma deltatransposase and integration host factor bind coop-eratively at both ends of gamma delta. EMBO J. 7,1907-1911.

Wiegand, T. W. & Reznikoff, W. S. (1994). Interaction ofTn5 transposase with the transposon termini. J. Mol.Biol. 235, 486-495.

York, D. & Reznikoff, W. S. (1996). Puri®cation and bio-chemical analyses of a monomeric form of Tn5transposase. Nucl. Acids Res. 24, 3790-3796.

Edited by I. B. Holland

(Received 12 December 2000; received in revised form 14 March 2001; accepted 16 March 2001)

Documents

The terminal inverted repeats of IS911: requirements for synaptic complex assembly and activity