The SSK2 MAPKKK of Candida albicans is required for oxidant adaptation in vitro

R E S E A R C H A R T I C L E

TheSSK2 MAPKKKofCandidaalbicans is required foroxidantadaptation invitroAditi Walia & Richard Calderone

Department of Microbiology and Immunology, Georgetown University Medical Center, Washington, DC, USA

Correspondence: Richard Calderone,

Department of Microbiology and

Immunology, Georgetown University Medical

Center, 302 NW Med Dent Building, 3900

Reservoir Rd, NW, Washington, DC 20057,

USA. Tel.: 11 202 687 1513; fax: 11 202 687

1800; e-mail: [email protected]

Received 2 August 2007; revised 21 September

2007; accepted 1 October 2007.

First published online 17 December 2007.

DOI:10.1111/j.1567-1364.2007.00329.x

Editor: Jose Ruiz-Herrera

Keywords

Hog1 MAPK pathway; oxidant adaptation;

osmotic stress.

Abstract

The Ssk2p (MAPKKK) of Candida albicans was deleted and functions assigned

based on phenotyping studies. SSK2 deletion was first attempted using the UAU1

disruption method. All transformants lacking one copy of SSK2 appeared to be

triploids, suggesting that the SSK2 is essential for the organism. To verify this

observation, a strain was constructed in which one allele was deleted using the

SAT1 flipper disruption method. The second allele was then placed under control

of the on/off tetracycline-regulatable (TetR) promoter. The transcription of SSK2

was measured by reverse transcriptase-PCR and although the promoter was

somewhat leaky, transcript was significantly reduced in an ssk2/TetR-SSK2 transfor-

mant (AT2) in the presence of doxycycline. Strains AT1 and AT2 constructed using

the SAT1 flipper and TetR promoter method, respectively, were studied phenotypi-

cally in different growth media to determine the role of Ssk2p in morphogenesis.

The mutants were also compared under on/off conditions in the presence of 1.5 M

NaCl and various types of oxidants. Strain AT2 demonstrated resistance to 1.5 M

NaCl in the absence of doxycycline but was inhibited by 8 mM hydrogen peroxide.

Introduction

Adaptation to a variety of adverse environmental conditions

requires signal transduction pathways for cells to transcrip-

tionally switch genes to an adaptive mode. For example,

an osmotic stress response is elicited when the osmolarity of

the medium increases. This response includes restructuring

of the actin cytoskeleton, transient cell cycle arrest, and an

increase in the intracellular glycerol concentration to main-

tain cellular osmotic pressure and thus prevent water loss

and eventual death (Tao et al., 1999). The high-osmolarity

glycerol (HOG) pathway, which regulates the adaptive

response to high osmolarity, has been the focus of study

not only in Saccharomyces cerevisiae but also in Candida

albicans.

The S. cerevisiae HOG mitogen-activated protein kinase

(MAPK) cascade is regulated by two osmosensing systems:

the first is homologous to prokaryotic two-component

signal transducers and is composed of three proteins (Sln1p,

Ypd1p, and Ssk1p), whereas the second is initiated by the

Sho1p osmosensor, another transmembrane protein. Under

conditions of normal osmolarity, Sln1p autophosphorylates

a histidine residue (His576). In this activated state, the

phosphoryl group is transferred in an intramolecular reac-

tion to Asp1144 in the response regulator domain (Maeda

et al., 1994). Ypd1p, a histidine-containing phosphotransfer

(HPt) protein, receives the phosphoryl group from Sln1p

and is phosphorylated at a histidine residue, His64, located

at the center of a four-helix bundle (Xu & West, 1999).

Ypd1p forms a relatively weak complex with the response-

regulator domain of Ssk1p (Porter et al., 2003) with the

His64 site in close proximity to the active site (Xu et al.,

2003). Thus, Ssk1p is phosphorylated at an aspartate residue

(Asp554) within its receiver domain. The phosphorylated

Ssk1p cannot activate the Ssk2p and Ssk22p MAPKKKs, and

thus signaling via the HOG cascade is inhibited.

Under conditions of high osmolarity, Sln1p is not phos-

phorylated and thus phosphotransfer via Ypd1p is inhibited.

Unphosphorylated Ssk1p activates the MAPKKK, either

Ssk2p or Ssk22p, of the Hog1 MAPK system (O’Rourke &

Herskowitz, 2002). Phosphorylation of Ssk2/Ssk22p and

then phosphotransfer to Pbs2p (MAPKK; Tatebayashi

et al., 2003) and Hog1p (MAPK) occur such that Hog1p is

translocated to the nucleus where it interacts with several

transcription factors resulting in the activation of genes

associated with osmotic adaptation (Posas et al., 1996;

FEMS Yeast Res 8 (2008) 287–299 c� 2007 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved

Ferrigno et al., 1998). Hot1p (high-osmolarity-induced

transcription) induces transcription of GPD1 and GPP2

(encode glycerol biosynthesis enzymes), resulting in the

synthesis of glycerol-3-phosphate dehydrogenase, which

converts dihydroxyacetone phosphate to glycerol-3-phos-

phate (Posas et al., 1996). The zinc-finger transcription

factors Msn2p and Msn4p retain Hog1p within the nucleus

(O’Rourke et al., 2002) and anchor Hog1p to CTT1 (en-

codes catalase T) and HSP12 (encodes heat shock protein

12) (Rep et al., 1999).

The second osmosensor Sho1p (synthetic, high-osmolar-

ity-sensitive) is an integral membrane protein that possibly

functions as a turgor and heat sensor. In response to

hyperosmotic conditions (0.5–1.0 M NaCl), the phospho-

transfer circuitry includes among other proteins, Msb2p,

Cdc42p, Ste50p, Ste20p, and Ste11p, which is associated

with the cytosolic tail of Sho1p (Westfall et al., 2004). Pbs2p

localizes to the membrane through the interaction of a

proline-based motif with an SH3 domain on Sho1p (Seet &

Pawson, 2004). Pbs2p then interacts with Cdc42p through

the adaptor protein Ste50p (Westfall et al., 2004). Activated

Ste11p phosphorylates Pbs2p, resulting in Hog1p activation

(Westfall et al., 2004). This branch of the HOG pathway

bypasses Ssk2/Ssk22p.

The functionally-redundant MAPKKKs SSK2 and SSK22

in S. cerevisiae both possess an N-terminal noncatalytic

domain and a C-terminal kinase domain. When the

N-terminal region of both proteins was deleted, constitutively

activated forms of the proteins occur, indicating that this

domain may play a negative regulatory role in controlling

kinase activity. Such cells were nonviable due to the over-

activation of the HOG pathway. However, single mutants of

each gene are viable. Both Ssk2p and Ssk22p can interact

with Ssk1p; in the case of Ssk2p, only the N-terminal

nonkinase domain is required (Maeda et al., 1995). Ssk2p

rapidly autophosphorylates at Thr1460 in an intramolecular

reaction (O’Rourke et al., 2002). Tyrosine phosphorylation

of Hog1p in a strain lacking SSK2 and SHO1 was somewhat

less than in a strain without SSK22 and SHO1, suggesting

that the expression or activity (or both) of Ssk22p is weaker

(Maeda et al., 1995).

Stress-response studies of ScSSK2 and ScSSK22 single and

double mutants have focused solely on osmolarity. (The

effects of peroxide stress have not been studied.) ssk2 ssk22

mutants were able to induce tyrosine phosphorylation of

Hog1p and were resistant to the effects of high osmolarity

(0.4 M NaCl) (Maeda et al., 1995). In response to osmotic

stress, the actin cytoskeleton rapidly disassembles and is

induced to reassemble only after osmotic balance with the

environment has been reestablished. Disassembly caused by

osmotic stress or through latrunculin A treatment resulted

in the concentration of Ssk2p in the neck of budding yeast

cells and the formation of a 1 : 1 complex with actin. Amino

acids (aa) 323–1032 of Ssk2p, which partially overlap the

binding region for Ssk1p (294–413 aa), interacted specifi-

cally with actin. An analogous fragment of Ssk22p

(141–787 aa) was unable to interact with actin. Approxi-

mately 1 h after osmotic stress, Ssk2p was uniformly dis-

tributed in the cytosol. Translocation of Ssk2p was not

affected in a sho1 sln1 ssk1 mutant, indicating that activation

of HOG pathway proteins upstream or downstream of

Ssk2p was not required. Ssk2p also facilitated reassembly of

a polarized actin cytoskeleton at the end of the cell cycle. The

Ssk2p MAPKKK associated with the scaffold protein Spa2p

in the bud and Shs1p in the neck, thus regulating substrates

involved in polarized actin assembly (Yuzyuk et al., 2002).

Because the Ssk2p MAPKKK has not been studied in

C. albicans, the experiments were designed to demonstrate

the role of this protein in adaptive responses to stress.

Materials and methods

Strains and culture conditions

Strain BWP17 [(Wilson et al., 1999); Table 1] and plasmids

pBME101, pGEM-HIS1, and pGEM-URA3 were provided

by Dr Aaron Mitchell (Columbia University). Strains were

grown in YPD (2% dextrose, 2% peptone, 1% yeast extract).

Synthetic dextrose (SD) medium consisted of 2% dextrose,

0.67% yeast nitrogen base, 2% agar, and supplemented with

all amino acids except those as specified below. Plasmid

pSFS1A was provided by Dr Joachim Morschhauser

Table 1. Strains used in this study

Strain Genotype References

BWP17 ura3D::limm434/ura3D::limm434 his1::hisG/his1::hisG arg4::hisG/arg4::hisG Wilson et al. (2000)

AU1 ura3D::limm434/ura3D::limm434 his1::hisG/his1::hisG arg4::hisG/arg4::hisG ssk2::UAU1/SSK2 This study

AU2–AU31 ura3D::limm434/ura3D::limm434 his1::hisG/his1::hisG arg4::hisG/arg4::hisG ssk2::UAU1/ssk2::URA3/SSK2 This study

THE1 ade2::hisG/ade2::hisG ura3::limm434/ura3::limm434 ENO1/eno1::ENO1-tetR-ScHAP4AD-33HA-ADE2 Nakayama et al.

(2000)

AT1 ade2::hisG/ade2::hisG ura3::limm434/ura3::limm434 ENO1/eno1::ENO1-tetR-ScHAP4AD-33HA-ADE2

ssk2::FRT/SSK2

This study

AT2 ade2::hisG/ade2::hisG ura3::limm434/ura3::limm434 ENO1/eno1::ENO1-tetR-ScHAP4AD-33HA-ADE2

ssk2::FRT/97t-SSK2-URA3

This study

FEMS Yeast Res 8 (2008) 287–299c� 2007 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved

288 A. Walia & R. Calderone

(Universitat Wurzburg, Germany). Strain THE1 [(Nakaya-

ma et al., 2000); Table 1] and plasmids p97CAU1, p98CAU1,

and p99CAU1 were provided by Dr Hironobu Nakayama

(Nippon Roche K.K. Research Center).

Enzymatic reaction reagents

All components of PCR, restriction digestion, and ligation

mixtures (i.e. buffer, MgSO4, dNTPs, and enzymes) as well

as materials for DNAse-treatment of RNA samples and the

NEBlot kit for producing a radioactive probe were obtained

from New England BioLabs.

DNA manipulations

Genomic DNA was extracted from all C. albicans strains

according to the method described by Sambrook et al.

(1989). The probe for Southern blot hybridization was

produced by PCR using primers Ssk2 Probe 50L and Ssk2

Probe 30L to amplify SSK2 sequence from � 387 to 782 bp

(Table 2). The radioactive probe was produced by random

priming using the NEBlot kit and 32P-dCTP. The probe was

purified using the Sephadex G-50 Spin Column Elutips (GE

Healthcare). Southern hybridization was performed according

to standard methods (Sambrook et al., 1989). Ten micrograms

of genomic DNA was digested with 40 U of HpaII. Each

digested sample was loaded into the wells of a 0.7% TAE

agarose gel and transferred by upward capillary action to a

positively-charged nylon Hybond-N1 membrane (Amersham)

(Ausubel et al., 1994–2000). Prehybridization and hybridiza-

tion were performed in prewarmed modified Church’s buffer

(32.9 g L�1 sodium phosphate–monobasic, 70.1 g L�1 sodium

phosphate–dibasic, 70 g L�1 mM sodium dodecyl sulfate,

1 g L�1 sodium pyrophosphate, 2 mM EDTA, pH 8.0).

Construction of UAU1 disruption cassette

The cassette for disrupting SSK2 was constructed by ampli-

fying the UAU1 insertion allele from pBME101. The primers

consisted of 102 bp homologous to the 50 and 30 termini of

SSK2 as well as 20 bp homologous to the two URA3 deletion

derivatives, ura3D30 and ura3D50. The 102 bp homologous

to the 50 terminus of SSK2 comprises sequence from

the ORF, specifically 67–168 bp. The 102 bp homologous to

the 30 terminus of SSK2 originates from 4343–4443 bp. The

20 bp of sequence homologous to each URA3 deletion

Table 2. Primer sets used in the disruption methodologies and in the tetracycline-regulatable expression system

Primer Direction Sequence Application

100Ssk2uau50 F GGCAATAATGACAATAAAGAAACTGGTAAAGATTAAGTTC

AACTCATACCCATCATAGAGTCACGTTTGCGGAACAACAA

CCAATTTCCACCTCAAGCAGGGTTTTCCCAGTCACGACGTT

UAU1 disruption cassette;

50 region of SSK2

100Ssk2uau30 R CGGACCTGCAACCTCTGATAATGGTGTAGTTGTACATCG

GAATTTCCAAATGCCATATGTCTGATTTCAACCATCCATGGA

TCAGCTAGTAATTCAACAGCGTGGAATTGTGAGCGGATA

UAU1 disruption cassette;

30 region of SSK2

50UAUdet (P1) F GAACAACAACCAATTTCCACCTCAAG 50 end of SSK2 ORF

Arg4det (P2) F GGAATTGATCAATTATCTTTTGAAC ARG4 integration confirmation

New Ssk2amp30 (P3) R GATAATGGTGTAGTTGTAACATCG 30 end of SSK2 ORF

30UAUdet (P4) R CTCTGATAATGGTGTAGTTGTAACATCG 30 end of SSK2 ORF

50URA3UAU1 (P5) F CCTTAGTGGTATCAACGTCA URA3 integration confirmation

Ssk2amp30 (P6) R GACCTGCAACCTCTGATAATG 30 end of SSK2 ORF

Ssk2KO50 F CAAGAGAGAAATCGCCAGGTCGTCATTCC SSK2 ORF amplification

Ssk2KO30 R CTGATTGAAACGCTTGAAAATGACGATGCC SSK2 ORF amplification

Ssk2 SAT1 KpnI F GATTATGGTACCGAGTTACTCTTAGCTTAACTTAG Upstream region of SSK2

Ssk2 SAT1 XhoI R GTTAACTCGAGGTAGTAGTTGTGAAATGTATTC Upstream region of SSK2

Ssk2 SAT1 NotI F ATTAAATTGCGGCCGCGAAATCAGACATATGGCATTTGG ORF and downstream region of SSK2

Ssk2 SAT1 SacII (rev) R GCTGGTGCCGCGGGAATTACCTAATAATGGATTTGG ORF and downstream region of SSK2

Ssk2 tet KpnI F GATTTAGGTACCCTTTGGTTAAATATGTGGTGTGTAG Region A of SSK2

Ssk2 tet XhoI R GATTACTCGAGGTTAAGCTAAGAGTAACTCGGTATC Region A of SSK2

Ssk2 tet SpeI F CGGGCGACTAGTCACAACTACTACTGCTAATAGTTC Region B of SSK2

Ssk2 tet SacII R CTATATCCGCGGGAGTTACTATCGGAAGTAACACC Region B of SSK2

Ssk2 Probe 50L F CAAACCCAACTTAAATCATCATACACGCCTTG SSK2-specific probe

Ssk2 Probe 30L R GCATTATCACCACCGTCAAAGGAAGAGTG SSK2-specific probe

ACT1 Fwd F GACGACGCTCCAAGAGCTGTTTTCCC ACT1 ORF amplification

ACT1 Rev R GTGGTTTGGTCAATACCAGCAGCTTCC ACT1 ORF amplification

Ssk2 NB 50 F CATACCCATCATAGAGTCACGTTTGCG SSK2 ORF amplification

Ssk2 NB 30 R CACTACGAACTACATCACCTG

TTAACACTG

SSK2 ORF amplification

F, forward primer; R, reverse primer.


289The Ssk2p of C. albicans

derivative was used to amplify the UAU1 insertion allele

from pBME101 and is underlined in Table 2. The UAU1

disruption cassette was 4252 bp in length. Transformation of

strain BWP17 with the UAU1 cassette was performed as

detailed by Enloe et al. (2000) and Cognetti et al. (2002).

The resulting transformants were plated on SD medium

lacking arginine, to select for Arg1His�Uri� transformants.

Integration of the UAU1 cassette was determined by a PCR

screen of the transformants using primers Arg4det and

Ssk2amp3 (P2 and P3) (Fig. 1a).

Strain AU1 (ssk2/SSK2) was streaked for isolation on YPD

containing 80mg mL�1 uridine and incubated at 30 1C for

36 h. Thirty Uri1 isolates (strains AU2–AU31) were cultured

overnight at 30 1C in YPD broth. The cells were subsequently

resuspended in H2O and a 100mL aliquot of each of the 30

cultures was plated on SD medium lacking arginine and

uridine, to select for Arg1His�Uri1 transformants. To identify

homozygote disruptants or to determine whether all isolates

carried a third copy of the gene of interest, the 30 transfor-

mants were screened by PCR using primers 50UAUdet/

30UAUdet (P1/P4). In addition, the correct integration of the

intact URA3 gene into the second allele of SSK2 was verified

using primers 50URA3UAU1 (P5) and Sskamp30 (P6) (Fig.

1a). To verify the presence of the wild-type SSK2 allele in the

putative triploids, a fourth PCR screen was performed

utilizing primers Ssk2KO50 (P7) and Ssk2KO30 (P8), which

amplify the SSK2 ORF from 503 to 3530 bp (Fig. 1a).

Plasmid construction

For the SAT1-FLP and TetR promoter disruption experi-

ments, electroporation using electrocompetent Escherichia

Fig. 1. (a) Primers (P1–P8) and strategy to disrupt both wild-type alleles of SSK2 by the UAU1 disruption cassette. Generation of the intact URA3 gene is

also shown. Four sets of PCR reactions are indicated. (b) The UAU1 cassette has disrupted one copy of SSK2 as indicated by the�1.6-kb band amplified

in strains AU1–AU4 using primers P2 and P3. BWP17 = wild-type. AU1 = ssk2/SSK2. AU2–AU4 = putative trisomics. (c) The URA3 marker (�1.7 kb) is

present in the second copy of SSK2. The presence of the �4-kb band amplified in strains AU2–AU4 using primers P1 and P4 putatively indicates that

these isolates are trisomics. (d) The URA3 marker as correctly integrated into the second SSK2 allele as indicated by the 752-bp band amplified in strains

AU2–AU4 using primers P5 and P6. (e) The ORF of the SSK2 is present in the strains BWP17, AU1, and AU11–AU13 (putative trisomics), as indicated by

the �3-kb band amplified using primers P7 and P8.



coli DH5a was performed according to the protocol de-

scribed previously (Ausubel et al., 1994–2000). Plasmid prep

isolation was performed according to the protocol as

described in Sambrook et al. (1989).

Escherichia coli colony PCR

A single colony was spotted on an Luria–Bertani1ampicillin

plate (incubated at 37 1C for 24 h) and the remainder mixed

into 50mL of H2O. After heating at 95–100 1C for 7 min, the

contents were briefly centrifuged. Five microliters of the

supernatant was used in the PCR reaction.

SAT1 flipper disruption strategy

The cassette for disrupting SSK2 was constructed by cloning

upstream and downstream regions of the gene into plasmid

pSFS1A. Primers Ssk2 sat1 KpnI and Ssk2 sat1 XhoI were

used to amplify the region upstream (US) of SSK2 (� 299

to � 59 bp; 240 bp in length). The PCR product was purified

according to the protocol provided with the Qiagen MinE-

lute PCR Purification kit. The purified fragment was subse-

quently cloned into the KpnI and XhoI sites of pSFS1A. The

downstream (DS) region, consisting of sequence from the 30

terminus of the ORF and continuing downstream of SSK2

(4375 to 1482 bp; 564 bp in length), was amplified with

primers Ssk2 sat1 NotI and Ssk2 sat1 SacII (rev). The

purified fragment was then cloned into the NotI and SacII

sites of pSFS1A1US (upstream region cloned into pSFS1A).

Colony PCR was utilized to screen all transformants. The

SAT1–FLP disruption cassette, 5519 bp in length, was re-

leased from pSFS1A1US1DS by digestion with KpnI and

SacII.

Construction of the SSK2 heterozygote

The SAT1–FLP cassette was electroporated into strain THE1

(Thompson et al., 1998). Two hundred fifty microliters

aliquots of the transformation mixture were plated on YPD

containing 200mg mL�1 of streptothricin (Alexis Biochem-

icals) and incubated at 30 1C for 48 h. Two colonies from

each transformation were individually streaked onto a fresh

YPD plate containing 200 mg mL�1 streptothricin and incu-

bated at 30 1C for 24 h. Each colony was simultaneously

inoculated into 2 mL of YPD broth containing 200 mg mL�1

streptothricin and incubated at 30 1C overnight with hor-

izontal shaking. Genomic DNA was isolated and Southern

hybridization performed to confirm the integration of the

SAT1–FLP cassette into the SSK2 locus.

Construction of the tetracycline-regulatable(TetR) promoter cassettes

The cassettes for placing the second allele of SSK2 under the

control of the TetR promoter were constructed by cloning

Regions A and B of the gene into plasmids p97CAU1,

p98CAU1, and p99CAU1. Region A was amplified using

primers Ssk2 tet KpnI and Ssk2 tet XhoI and consisted of

sequence upstream of the SSK2 ORF (� 874 to � 281 bp;

617 bp in length). The purified fragment was cloned into the

KpnI and XhoI sites of p97/98/99 CAU1. Region B, consist-

ing of sequence upstream and continuing into the ORF

(� 70 to 392 bp; 486 bp in length), was amplified with

primers Ssk2 tet SpeI and Ssk1 tet SacII and cloned into the

SpeI and SacII sites of p97/98/99 CAU11Reg A (Region A

cloned into p97/98/99 CAU1). All transformants were

screened by colony PCR. The TetR promoter cassettes were

liberated from p97/98/99CAU11Reg A1Reg B by digestion

with KpnI and SacII. The lengths of the cassettes were

3074 bp for p97, 3020 bp for p98, and 3023 bp for

p99CAU11Reg A1Reg B.

Construction of tetracycline-regulated strains

The p97/98/99 TetR promoter cassettes (from digest

samples) were transformed via electroporation into strain

AT1 and the transformants selected on SD medium lacking

uridine. Southern hybridization was performed to confirm

the integration of the TetR promoter cassettes upstream of

the second allele of SSK2. The protocol and probe described

above to screen the SAT1-FLP transformants were utilized.

Reverse transcriptase (RT)-PCR

An isolated colony from strains THE1, AT1, and AT2 was

inoculated into duplicate 10 mL aliquots of YPD with or

without 20 mg mL�1 of doxycycline. Total RNA was isolated

using a standard procedure (Ausubel et al., 1994–2000) and

DNAse treated. The RT-PCR reactions to quantify SSK2 and

ACT1 (internal control) were performed in duplicate to

detect both transcripts for all six samples (strains THE1,

AT1, and AT2 cultured with or without 20 mg mL�1 doxycy-

cline) according to the protocol for the Qiagen One-Step

RT-PCR Kit. One microgram of total RNA was used for each

PCR. The amplification conditions were optimized for

detecting the SSK2 transcript (primers Ssk2 NB 50 and Ssk2

NB 30) and the ACT1 transcript (primers ACT1 Fwd and

ACT1 Rev). All PCR products were resolved on 1% agarose

gels containing ethidium bromide. A gel imager (Alpha

Imager 2000, Alpha Innotech Corp.) was used to quantify

the intensity of the bands for both transcripts. The level of

the SSK2 transcript was calculated by dividing the band

intensity of SSK2 by the band intensity of ACT1 for each

RNA sample and expressed as a ratio. The fold difference

between the strains cultured with and without doxycycline

was determined by dividing the ratios. Calculations were

performed for all six samples from three independent

experiments. The two-tailed Student’s t-test was used to

determine the significance of the values.



Sensitivity assays

Ten milliliters of YPD was inoculated with a single colony of

each strain and incubation performed overnight at 30 1C

with horizontal shaking. The cell number for each strain was

determined using a hemocytometer. Dilutions of cells were

prepared for sensitivity assays, and 5mL from each dilution

was spotted on agar plates to yield a final concentration of

5� 105–5� 101 cells�1.

Morphogenesis and sensitivity assay media

Strains were grown on Spider, SLAD, and M-199 as

described previously (Calera et al., 2000). SLAD plates were

incubated at 30 1C for 7 days. Spider, M-199 (pH 7.5), and

10% serum plates were incubated at 37 1C for 5 days. NaCl

(at the specified concentration) was added to YPD and 2%

agar and subsequently autoclaved. The oxidants hydrogen

peroxide (H2O2) (30% w/w; Sigma), t-butyl hydroperoxide

(Sigma), KO2 (Sigma), and menadione sodium bisulfite

(Sigma) were added to autoclaved YPD with 2% agar. All

oxidants were freshly prepared per experiment. Growth

of strains was evaluated after 48 h. Uridine was added

to YPD and morphogenesis media at a concentration of

100mg mL�1 to compensate for the ectopic location or

absence of URA3.

Results

A BLAST search using the nucleotide sequence of the ScSSK2

ORF (4740 bp), derived from the Saccharomyces Genome

Database (www.yeastgenome.org), was performed on the

Candida Genome Database (www.candidagenome.org),

resulting in the identification of ORF 19.11257, a putative

protein kinase. This ORF is 4455 bp in length and encodes a

protein consisting of 1485 aa and is located on chromosome

4. ORF 19.3775 on the second allele is 4038 bp in length and

lacks 417 bp of sequence at the 30 end of the ORF. However,

this disparity is due to a sequencing error as reported by the

Candida Genome Database. The two alleles are in fact

equivalent in length as determined by PCR reactions

described below. A BLAST search with the nucleotide sequence

of the ScSSK22 ORF (3997 bp) produced the same results,

indicating that the SSK22 gene is not present in C. albicans.

A BLAST search using the CaSsk2p protein sequence (ORF

19.11257) performed on the Saccharomyces Genome Data-

base revealed a 49% identity and 67% similarity with

ScSsk2p as well as a 48% identity and 68% similarity with

ScSsk22p along the same region of sequence. Using

the bl2seq database (www.ncbi.nlm.nih.gov/blast/bl2seq/

wblast2.cgi), alignment of CaSsk2p with ScSsk2p revealed

a 37% identity and 50% similarity whereas a comparison

to ScSsk22p showed a 38% identity and 57% similarity.

SMARTanalysis (http://smart.embl-heidelberg.de/) of CaSsk2p,

ScSsk2p, and ScSsk22p revealed that all three proteins

possess a serine-kinase domain near the C-terminus. In

addition, ScSsk22p and CaSsk2p both possess a coiled-coil

region upstream of the kinase domain. Therefore, it is

believed that ORFs 19.11257 and 19.3775 in the Candida

genome should be identified as CaSSK22 instead of CaSSK2.

However, the SSK2 gene nomenclature was retained, in

accordance with the gene designation in the Candida

Genome Database.

There are several explanations for the presence of only

SSK2 in the C. albicans genome. After diverging from

C. albicans, a gene duplication event may have occurred in

S. cerevisiae resulting in the two MAPKKKs, SSK2 and SSK22.

Alternatively, SSK22 may have been lost from the C. albicans

genome, such that a sole MAPKKK is present in C. albicans.

We considered determining whether CaSsk2p is the

functional homolog of ScSsk2p or ScSsk22p by performing

complementation studies wherein the ORFs of ScSSK2 and

ScSSK22 are replaced by that of CaSSK2. However, this was

not seen as a feasible investigation because CaSSK2 contains

41 CUG codons, which would be translated as leucine in

S. cerevisiae instead of as serine.

UAU1 disruption and PCR analysis oftransformants

Following transformation of strain BWP17 with the UAU1

disruption cassette, Arg1 transformants were screened with

primers Arg4det and New Sskamp30 (P2 and P3; Table 2)

with the expected result of a PCR product of 1654 bp, with

1568 bp derived from the ARG4 marker and the ura3D50

flanking sequences as well as 86 bp from the 30 terminus of

the SSK2 ORF (Fig. 1a). As can be seen in Fig. 1b, a band of

this size was amplified from strain AU1 as well as strains

AU2–AU4 but not in BWP17. (The presence of minor bands

below the 1.0-kb marker is the result of a low annealing

temperature.) These data indicate that one allele of SSK2 has

been disrupted by the UAU1 cassette.

Strain AU1 (ssk2/SSK2) was streaked for isolation on

YPD containing uridine. Thirty Uri1 isolates (strains

AU2–AU31) were cultured overnight in YPD broth and an

aliquot of each of the 30 cultures was subsequently plated on

SD medium lacking arginine and uridine, to select for

Arg1His�Uri1 transformants. The second PCR screen,

involving the 50UAU det and 30UAU det primers (P1 and

P4), was performed to identify the URA3 insertion allele in

the second copy of SSK2. These primers were also capable of

amplifying the wild-type allele, if it was present. A PCR

product of 1664 bp with 1544 bp originating from URA3,

30 bp from the 50 terminus of the SSK2 ORF, and 90 bp from

the 30 terminus of the ORF, will indicate the presence of the

URA3. In Fig. 1c, the 1664-bp product can be seen in strains

AU2–AU4 but not in strains BWP17 and AU1. A product of



4303 bp representing the wild-type allele was present in all

strains. Therefore, the second copy of SSK2 had been

disrupted by URA3, but a wild-type copy of SSK2 was still

present, possibly generated by a duplication event, so that

strains AU2–AU31 are putatively trisomics.

The third PCR screen was performed to verify the correct

integration of URA3. Utilizing the primers 50URA3UAU1

and Sskamp30 (P5 and P6), a product of 752 bp is expected,

with 652 bp derived from the URA3 sequence and 100 bp

from the 30 terminus of the SSK2 ORF. This product was

observed in strains AU2–AU4 (Fig. 1d). (This screen can also

serve as an indicator of the presence of the UAU1 insertion

allele and as such the 752-bp fragment is amplified from

strain AU1.) Therefore, the URA3 marker correctly inte-

grated into the second copy.

Because primers 50UAUdet and 30UAUdet (P1 and P4) are

also capable of amplifying the UAU1 disruption cassette,

which is similar in size to the SSK2 wild-type allele (4265

and 4138 bp, respectively), a fourth PCR screen was per-

formed using primers Ssk2KO50 (P7) and Ssk2KO30 (P8) to

determine whether a wild-type SSK2 allele was indeed

present in the genome. The PCR was designed to amplify

a portion of the ORF deleted by the UAU1 disruption

cassette and the URA3 marker. In fact, the presence of a

wild-type allele was observed as can be seen in Fig. 1e;

strains BWP17, AU1, and AU11–AU13 all exhibited a

fragment of 3027 kb, representing the ORF of SSK2.

All four PCR screens were performed on strains

AU2–AU31 (data not shown) with results as stated above.

Thus, the ORF is present in the putative trisomics. A wild-

type copy of SSK2 was detected in 30 out of 30 isolates,

suggesting that SSK2 is an essential gene.

SAT1 -FLP construct

In order to verify that SSK2 is essential, the TetR expression

system was used. In the absence of tetracycline (or doxycy-

cline), tetR (transactivator; integrated at the ENO1 locus in

strain THE1) specifically binds tetO (a minimal promoter

element with a tetracycline operator sequence) as a dimer

and the gene is actively expressed. Dimerization of tetR is

inhibited by tetracycline and expression is repressed as tetR

rapidly dissociates from tetO (Nakayama et al., 2000). In a

heterozygous strain, SSK2 would be proven essential if

suppressing its expression resulted in cells that were no

longer viable.

An SSK2 heterozygote was constructed by transforming

the SAT1-FLP disruption cassette into strain THE1 to

subsequently generate a TetR strain. To confirm the integra-

tion of the SAT1-FLP disruption cassette into one allele of

SSK2, Southern hybridization was performed by digesting

genomic DNA from strain THE1 and five transformants

with HpaII. The two alleles of SSK2 will produce distinct

bands upon digestion based on the sequences in the Candida

Genome Database. Allele 1 will result in bands of 433, 1247,

and 4185 bp in size, of which the latter two will be detected

by the probe (� 387 to 782 bp of SSK2 sequence) as can be

seen in Fig. 2a. Allele 2 will exhibit bands of 1709, 4182, and

544 bp, with the first two detected by the probe. If the SAT1-

FLP cassette disrupts an allele of SSK2, bands of 1915 or

2375 bp will be present for allele 1 and 2, respectively.

However, these bands were not observed. Examining the

digestion pattern for an FRT-disrupted allele, bands of 1010

or 1469 bp are expected for allele 1 or 2, respectively. As can

be seen in Fig. 2b, transformant AT1 possesses a band at the

1.0-kb marker, indicating that allele 1 has been replaced by

the FRT sequence.

The genomic DNA used in the Southern hybridization

was obtained from transformants cultured overnight in YPD

broth containing 200mg mL�1 streptothricin. According to

Reub et al. (2004), YCB liquid media containing bovine

serum albumin (BSA) induces the SAP2 promoter, which

drives the FLP recombinase. Site-specific recombination

between the FRT direct repeats results in the elimination

of the sequences for the SAP2 promoter, caSAT1 marker,

and the caFLP gene. Because the FRT-disrupted allele was

present before propagation of the cells in YCB–BSA, this

indicates that the SAP2 promoter is not tightly regulated or

‘leaky.’ When culturing the transformants in YPD broth

containing streptothricin, the SAP2 promoter was induced

and the recombinase activated, resulting in the loss of the

SAT1-FLP construct.

TetR expression

With one allele of SSK2 disrupted by the FRT sequence,

cassettes were generated to place the remaining allele under

the control of three TetR promoters, 97t, 98t, and 99t.

Regions A and B were cloned into the three plasmids,

p97CAU1, p98CAU1, and p99CAU1, to direct the integra-

tion of each cassette upstream of the SSK2 ORF. URA3

served as the selectable marker. The p97/98/99CAU11Reg

A1Reg B cassettes were individually transformed into strain

AT1 (ssk2/SSK2) and the resulting transformants screened

by Southern hybridization to confirm correct integration.

As can be seen in Fig. 2a (bottom set of 2 diagrams), in a

transformant possessing one allele disrupted by the FRT

sequence and the promoter region of the second allele

replaced by the TetR promoter construct, bands of 1010 bp

(for the FRT-disrupted allele), either 537, 576, or 599 bp

(for the p97/98/99 TetR-promoter cassettes, respectively),

and 4182 bp (from ORF) are expected. Ten transformants

for each of the TetR-promoter constructs were screened

and only one, designated strain AT2, possessed the

p97CAU11Reg A1Reg B construct as indicated by the three

bands (Fig. 2c).



In order to test whether SSK2 is essential for viability,

strains THE1, AT1, and AT2 were grown on YPD plates

with (20 mg mL�1) or without doxycycline. If SSK2 is an

essential gene, strain AT2 will not grow in the presence of

doxycycline because expression of the gene will be repressed.

However, strain AT2 grew similarly in the absence and

presence of doxycycline. According to this assay, SSK2 is

not an essential gene.

To investigate whether doxycycline was indeed entering

the cells and effecting transcription, RT-PCR was per-

formed. Strains THE1, AT1, and AT2 were cultured in YPD

broth with or without 20 mg mL�1 doxycycline overnight and

the RNA was extracted. The intensity of the bands was

quantified by the Alpha Imager 2000 (Fig. 3). The data were

normalized by dividing the SSK2 band intensity by the band

intensity for ACT1 for each sample. The change in transcript

level was assessed by dividing the normalized value for

THE1 by the value for the SAT1-FLP heterozygote (AT1)

and the value for the heterozygote by the value for the p97

TetR Transformant (AT2). The results of three independent

experiments revealed that there was a significant difference

(P-value o 0.05) between transcript levels under either

condition. In the absence of doxycycline, comparing THE1

with AT1 demonstrated a significant decrease in SSK2

expression (P = 3.99� 10�4), as expected, whereas transcrip-

tion in AT2 was higher than in AT1 (P = 0.057, which is

marginally significant). The difference in the level of tran-

script between strains AT1 and AT2 in the absence of

doxycycline may be due to the fact that the TetR promoter

is perhaps stronger than the native promoter of SSK2.

Comparing SSK2 expression in the absence or presence of

doxycycline, there was a significant decrease in strain AT2

(P = 0.007), indicating that the level of inhibition by the

TetR promoter was significant but not enough to completely

inhibit SSK2 transcription. Thus, the TetR promoter is

significantly repressed; however, the small amount of tran-

script that is still being produced is enough such that the

viability of the cell is not affected.

Phenotypic analysis of strains

Phenotypic analysis of strain THE1, the heterozygote (AT1),

and TetR strain (AT2) was conducted to investigate the role

Fig. 3. RT-PCR reactions of strains THE1, SAT1-FLP heterozygote (AT1),

and p97 TetR transformant (AT2) are shown for SSK2. Strains were

cultured overnight at 30 1C with or without 20 mg mL�1 of doxycycline.

The expression of SSK2 was determined by quantifying the intensity of

the bands. ACT1 expression levels were used for normalization.

Fig. 2. (a) Expected results for Southern blot screening of SAT1-FLP-disrupted transformants demonstrating the integration of the TetR promoter

cassettes. The predicted sizes of the fragments are shown beneath each allele. (b) Southern hybridization confirmed integration of the SAT1-FLP

cassette into SSK2 since a band of �1 kb is observed, resulting in strain AT1. (c) Southern blot hybridization confirmed integration of the p97 TetR

promoter cassette into the remaining allele of SSK2, generating strain AT2.



of SSK2 in morphology, morphogenesis, and the adaptation

to osmotic and oxidative stress. The morphology of each

strain was examined on YPD, Spider, SLAD, and M-199 (pH

7.5), and 10% serum solid media. For all inocula, the cell

count was determined and 250 cells of each strain were

spotted onto each medium.

The strains were cultured in YPD broth with or without

20 mg mL�1 of doxycycline at 30 1C, and the cells were plated

on media with or without doxycycline to repress the TetR

promoter as well as assess the effect of doxycycline on the

strains. On YPD plates containing doxycycline and incu-

bated at 37 and 42 1C, all strains exhibited a wrinkled colony

morphology but grew similarly. The three strains on YPD

without doxycycline appeared the same. Colonies from all of

the plates were mixed into 10 mL of H2O on a microscope

slide and viewed at 400� magnification. All of the colonies

exhibited normal ovoid cells and elongated forms resem-

bling hyphae (data not shown).

When grown on SLAD, Spider or 10% serum agar, all

three strains exhibited the same morphology with or with-

out 20mg mL�1 of doxycycline. On M-199 (pH 7.5) plates,

AT2 colonies in the presence and absence of doxycycline,

were smaller than THE1 and AT1 colonies, but each strain

formed filaments (Fig. 4).

The role of SSK2 in the response to osmotic and oxidative

stress was determined by conducting sensitivity assays

wherein inhibitors were incorporated into YPD agar con-

taining or lacking 20mg mL�1 doxycycline. The oxidants

tested included H2O2, t-butyl hydroperoxide, menadione (a

superoxide-generating agent), and KO2 (potassium super-

oxide). The strains were also spotted on YPD agar with or

without 20 mg mL�1 doxycycline as controls to assess growth.

All plates were incubated at 30 1C for 48 h. Strains THE1 and

AT1 demonstrated equal sensitivity to 1.5 M NaCl; however,

AT2 was more resistant in the absence of doxycycline which

may be related to an increase in transcription of SSK2 in AT2

vs. AT1 (Fig. 5). This resistance was impaired in the presence

of doxycycline, indicating that the lower expression of the

SSK2 allele under the TetR promoter negatively affected the

ability of strain AT2 to tolerate salt stress. At 8 mM H2O2,

the strain AT2 was more sensitive but no doxycycline-

dependent effect was seen. None of the strains were sensitive

to t-butyl hydroperoxide, menadione, or KO2.

Discussion

Based on sequence homology and/or complementation

experiments, all of the constituent proteins of the Sln1p-

Ypd1p-Ssk1p arm of the HOG pathway have been identified

in C. albicans. Phenotypic analysis has been performed on

all except CaYpd1p and CaSsk2p. Collectively, mutant

strains have demonstrated sensitivity to NaCl, H2O2, and

menadione, albeit at different concentrations for each

mutant. A comparison of HOG-pathway proteins in

S. cerevisiae to those in C. albicans has revealed functional

differences. Mutants of CaSln1p do not exhibit an extensive

growth impairment in high-osmolarity media or the

absence of filamentation seen with ScSln1p mutants (Naga-

hashi et al., 1998). CaSsk1p was unable to complement the

lack of ScSsk1p (Calera et al., 2000). An ssk1 mutant had

minimal sensitivity under osmotic stress, but was strongly

inhibited by 5 mM H2O2 (Calera et al., 2000; Chauhan et al.,

2003). CaPbs2p is located upstream of CaHog1p because the

absence of Pbs2p results in the lack of phosphorylation of

CaHog1p under basal or activating conditions (1 M NaCl)

(Arana et al., 2005). The other arm of the HOG1 MAPK

pathway includes Sho1p but bypasses Ssk1p and Ssk2/

Ssk22p, at least in S. cerevisiae. Based on the phenotypes

of the C. albicans SSK1 null mutant, one would predict

that the Ssk2p mutant would have a nearly similar pheno-

type, i.e., sensitivity to oxidants, minimal sensitivity to high

osmotic conditions. To determine CaSsk2p functions,

therefore, deletion mutants were constructed using several

approaches.

Fig. 4. Colonies of strain AT2 exhibited a

reduction in growth on M-199 (pH 7.5) agar

media. AT2 colonies in the presence and ab-

sence of 20mg mL�1 of doxycycline were smaller

than THE1 and AT1 colonies, but each strain

formed filaments. Media was inoculated with

250 cells and incubated at 37 1C for 5 days.



The UAU1 disruption strategy (also known as the homo-

zygote trisomy or HT test) generates homozygous mutants

after a single transformation of strain BWP17 (arg4 his1

ura3), providing a rapid test for essential genes. A UAU1

insertion in nonessential genes yields both homozygous and

triplication-bearing segregants, but a UAU1 insertion in an

essential gene should yield only triplication-bearing segre-

gants. In order to conclude that a gene is essential, a wild-

type copy of the gene must be detected in 30 out of 30

Arg1Ura1 transformants (Enloe et al., 2000).

Phenotypic analysis was not performed on the hetero-

zygote (AU1) constructed using the UAU1 disruption strat-

egy because the parental strain BWP17 possesses a partial

chromosome deletion. Strain BWP17 was derived from

the C. albicans clinical isolate SC5314 by sequential deletion

of both copies of URA3, HIS1, and ARG4. Comparative

genome hybridization to over 6000 C. albicans ORFs in-

dicated that a deletion within chromosome 5 (Ch5) in strain

BWP17 occurred upon disruption of HIS1 in strain RM100

with the URA-blaster cassette. The deletion was due to the

loss of one copy of all ORFs distal to HIS1 on Ch5 as well as

due to the addition of 9 nucleotides to the telomere-like

sequence adjacent to the HIS1 locus. Therefore, strains

RM1000#6 and BWP17 have one copy of Ch5 (Ch5b) that

is shorter than the standard-sized copy (Ch5a) in SC5314

(Selmecki et al., 2005). This can possibly influence the

phenotypic analysis of mutant strains constructed using

RM1000#6 and BWP17.

The UAU1 deletion method suggested that CaSSK2 may

be essential for growth, indicating that both wild-type alleles

probably cannot be deleted by other disruption strategies.

Furthermore, the URA-blaster (Fonzi & Irwin, 1993) and

URA3-dpl200 (Wilson et al., 2000) strategies were also

attempted, but isolating a single gene-disrupted strain was

not possible. Essential genes have been studied by disrupting

one allele and placing the second under the control of a

regulatable promoter such that gene expression can be

turned ‘on’ and ‘off ’. This strategy can be utilized to

investigate the role of a gene of interest under various

conditions and thuswas followed to characterize the func-

tions of SSK2. With the SAT1 flipper/TetR promoter system,

a strain was constructed in which one allele was disrupted by

an FRT sequence and the other placed under the control of

the TetR promoter. However, the ‘leakiness’ of the TetR

promoter prevented definitive assessment of whether SSK2

is essential.

Although regulatable promoter systems such as the GAL,

MAL, MET3, and PCK1 (Park et al., 1997; Care et al., 1999;

Mendoza et al., 1999; Backen et al., 2000) have been utilized

by other research groups, they all require the manipulation

of a metabolite to regulate a gene of interest. An alteration

in carbon or amino acid sources could possibly result in

changes in global gene expression. In addition, certain

phenotypic tests have specific nutritional requirements that

may conflict with those used to control expression from a

regulatable promoter. Furthermore, it should be noted that

none of these promoters are ‘leak-proof ’ (Leuker et al.,

1997; Backen et al., 2000; Roig & Gozalbo, 2002; Rodaki

et al., 2006). The ‘leakiness’ of the TetR promoter system

encountered in this study had not been described in prior

publications.

It has been noted that for an essential gene, the level of

basal transcription sufficient for growth may be gene-

dependent. If the amount of gene product is insufficient

to support growth, but the mutant cells are still viable,

progressive accumulation of gene product may allow growth

at normal rates after a long lag phase, thus making it difficult

to assess the essential character of a gene (Roig & Gozalbo,

2002). In fact, in the RT-PCR transcript analysis of this

study, no signal could be detected during the exponential

growth of any strain (data not shown). The stability of the

SSK2 transcript may also play a role in its persistence in the

cells, i.e. the transcript may be less susceptible to degrada-

tion. Perhaps the transcript persists until the required

amount of protein is produced instead of repeatedly expres-

sing the gene. In a study of 8687 yeast mRNAs, half-lives

varied widely, ranging from o 3 min to 4 90 min. No

simple correlation between mRNA half-lives and ORF size,

codon bias, ribosome density, or abundance was found.

However, the decay rates of mRNAs encoding groups of

proteins that act together in stoichiometric complexes were

generally closely matched (Wang et al., 2002). The decay

rates of individual mRNAs differ extensively. With most

transcripts, such as those encoding housekeeping genes,

decay rates are invariant while the half-lives of numerous

Fig. 5. Spot-plate sensitivity testing of all strains to osmotic and per-

oxide stress. (a) YPD agar; (b) osmotic stress (1.5 M NaCl); (c) 8 mM H2O2

stress. All strains were grown in the absence and presence of 20 mg mL�1

of doxycycline. Media (with or without 20 mg mL�1 of doxycycline) were

inoculated with equal numbers of cells (final concentration of cells

spotted, 5�105–5� 101). The plates were incubated at 30 1C for 48 h.



mRNAs change strikingly in response to environmental

cues. These differences have notable effects on the expres-

sion of specific genes, providing the cell with flexibility in

effecting rapid change in transcript abundance (Wilusz

et al., 2001).

No distinct phenotypes were observed with strain AT1

and all phenotypes were identical to those of THE1. Thus,

SSK2 does not demonstrate gene-dosage-dependent effects,

but this can be phenotype- or gene-dependent. It is possible

that the amount of transcript produced from one SSK2 allele

is enough to maintain the wild-type phenotype.

The few phenotypes observed with strain AT2 were

examined under the conditions of gene expression (no

doxycycline) and repression (presence of doxycycline).

No doxycycline-dependent phenotype was observed even

though according to RT-PCR results transcription was

significantly decreased in the presence of doxycycline. It

is possible that in the time period before the interaction of

doxycycline with the transactivator, a certain amount of

transcript was produced. This level of transcript may result

in the production of enough functional protein.

In the presence of 1.5 M NaCl and doxycycline, all strains

demonstrated similar sensitivity. However, strain AT2 grew

better in the absence of doxycycline. An interpretation of

these data is that another pathway may be compensating for

the lower amount of Ssk2p such that the cells are more

tolerant to the osmotic stress. The Sho1p arm of the HOG1

MAPK pathway, which may play a major role in osmoadap-

tation was mentioned previously. An ssk2 sho1 mutant,

which was not constructed in this study, could explain

whether the Sho1p arm is compensating for the lack of

functionality of the Sln1p-Ypd1p-Ssk1p pathway. Other

signaling mechanisms are also possible. In fact, this observa-

tion correlates well with the C. albicans ssk1 mutant, which is

likewise insensitive to hyperosmotic conditions (Calera

et al., 2000).

Another pathway involved in adaptation to osmotic stress

is the protein kinase C (PKC)–MAPK cell-integrity pathway,

which is activated by low osmolarity, as well as by nutrient

and pheromone sensing and thermal stress. In S. cerevisiae,

the PKC pathway is thought to maintain cell integrity by

controlling cell wall assembly and perhaps membrane

assembly (Banuett, 1998).

Pkc1p and Rom2p are also necessary for the adaptation to

oxidation. pkc1 and rom2 strains were found to be sensitive

to H2O2 (0.5, 1, 1.5, 2, 4, and 6 mM) (Vilella et al., 2005). In

addition, H2O2 induced a transient depolarization of actin

followed by a subsequent repolarization after 3 h of treat-

ment. Mtl1p, Pkc1p, and Rom2p were needed to repolarize

and restore the actin cytoskeleton (Vilella et al., 2005).

In terms of oxidative stress, inhibition by H2O2 was

observed at 8 mM for strain AT2 while ssk1 and sho1 strains

displayed sensitivity to lower concentrations of H2O2

[5 mM; (Chauhan et al., 2003; Roman et al., 2005)] and

pbs2 strains to higher concentrations [50 mM; (Arana et al.,

2005)]. Therefore, according to the peroxide sensitivity of

strain AT2, CaSsk2p may be a part of the HOG pathway.

However, strain AT2 demonstrated equivalent sensitivity

in the absence and presence of doxycycline. The lack of a

doxycycline-dependent effect could be due to another path-

way, such as the PKC–MAPK pathway, responding to the

peroxide stress and therefore compensating for the fluctua-

tion in the levels of Ssk2p.

Future investigations of CaSsk2p should focus on its role

in the adaptation to osmotic and oxidative stress, whether

through the HOG or another pathway, determine its inter-

actions with other proteins, and resolve the issue of essenti-

ality. If SSK2 is essential, is this attributable to its role within

a signaling pathway that responds to environmental stress or

its contribution to viability? The viability of the ssk2 ssk22

double mutant in S. cerevisiae and the inability to obtain an

SSK2 mutant in C. albicans suggest a divergence in function

of the MAPKKK. Further study of Ssk2p will provide insight

into the function of this serine–threonine kinase within the

extensive signaling networks operating in C. albicans.

Acknowledgements

This study was supported by Public Health Service grants

NIH-NIAID AI47047 and NIH-NIAID AI43465. The

authors wish to thank Dr Joy Sturtevant (LSUHSC School

of Medicine) for assistance with the HT test protocol and

Dr William Fonzi (Georgetown University) for frequent

discussions regarding disruption strategies.

References

Arana DM, Nombela C, Alonso-Monge R & Pla J (2005) The

Pbs2 MAP kinase kinase is essential for the oxidative-stress

response in the fungal pathogen Candida albicans.

Microbiology 151: 1033–1049.

Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman JG,

Smith JA & Struhl K (1994-2000) Current Protocols in

Molecular Biology. John Wiley & Sons Inc., New York.

Backen AC, Broadbent ID, Fetherston RW, Rosamond JDC,

Schnell NF & Stark MJR (2000) Evaluation of the CaMAL2

promoter for regulated expression of genes in Candida

albicans. Yeast 16: 1121–1129.

Banuett F (1998) Signalling in the yeasts: an informational

cascade with links to the filamentous fungi. Microbiol Mol Biol

Rev 62: 249–274.

Calera JA, Zhao X-J & Calderone R (2000) Defective hyphal

development and avirulence caused by a deletion of the SSK1

response regulator gene in Candida albicans. Infect Immun 68:

518–525.



Care RS, Trevethick J, Binley KM & Sudbery PE (1999) The MET3

promoter: a new tool for Candida albicans molecular genetics.

Mol Microbiol 34: 792–798.

Chauhan N, Inglis D, Roman E, Pla J, Li D, Calera JA & Calderone

R (2003) Candida albicans response regulator gene SSK1

regulates a subset of genes whose functions are associated with

cell wall biosynthesis and adaptation to oxidative stress.

Eukaryotic Cell 2: 1018–1024.

Cognetti D, Davis D & Sturtevant J (2002) The Candida albicans

14-3-3 gene, BMH1, is essential for growth. Yeast 19: 55–67.

Enloe B, Diamond A & Mitchell AP (2000) A single-

transformation gene function test in diploid Candida albicans.

J Bacteriol 182: 5730–5736.

Ferrigno P, Posas F, Koepp D, Saito H & Silver PA (1998)

Regulated nucleo/cytoplasmic exchange of HOG1 MAPK

requires the importin b homologs NMD5 and XPO1. EMBO J

17: 5606–5614.

Fonzi WA & Irwin MY (1993) Isogenic strain construction and

gene mapping in Candida albicans. Genetics 134: 717–828.

Leuker CE, Sonneborn A, Delbruck S & Ernst JF (1997) Sequence

and promoter regulation of the PCK1 gene encoding

phosphoenolpyruvate caboxykinase of the fungal pathogen

Candida albicans. Gene 192: 235–240.

Maeda T, Wurgler-Murphy SM & Saito H (1994) A two-

component system that regulates an osmosensing MAP kinase

cascade in yeast. Nature 369: 242–245.

Maeda T, Tatekawa M & Saito H (1995) Activation of yeast PBS2

MAPKK by MAPKKKs or by binding of an SH3-containing

Osmosensor. Science 269: 554–558.

Mendoza A, Serramia MJ, Capa L & Garcia-Bustos JF (1999)

Translation elongation factor 2 is encoded by a single essential

gene in Candida albicans. Gene 229: 183–191.

Nagahashi S, Mio T, Ono N, Yamada-Okabe T, Arisawa M, Bussey

H & Yamada-Okabe H (1998) Isolation of CaSLN1 and

CaNIK1, the genes for osmosensing histidine kinase

homologues, from the pathogenic fungus Candida albicans.

Microbiology 144: 425–432.

Nakayama H, Mio T, Nagahashi S, Kokado M, Arisawa M & Aoki

Y (2000) Tetracycline-regulatable system to tightly control

gene expression in the pathogenic fungus Candida albicans.

Infect Immun 68: 6712–6719.

O’Rourke SM & Herskowitz I (2002) A third osmosensing branch

in Saccharomyces cerevisiae requires the Msb2 protein and

functions in parallel with the Sho1 branch. Mol Cell Biol 22:

4739–4749.

O’Rourke SM, Herskowitz I & O’Shea EK (2002) Yeast go the

whole HOG for the hyperosmotic response. Trends Genet 18:

405–412.

Park SM, Ohkuma M, Masuda Y, Ohta A & Takagi M (1997)

Galactose-inducible expression systems in Candida maltosa

using promoters of newly-isolated GAL1 and GAL10 genes.

Yeast 13: 21–29.

Porter SW, Xu Q & West AH (2003) Ssk1p response regulator

binding surface on histidine-containing phosphotransfer

Ypd1p. Eukaryotic Cell 2: 27–33.

Posas F, Wurgler-Murphy SM, Maeda T, Witten EA, Thai TC &

Saito H (1996) Yeast HOG1 MAP kinase cascade is regulated

by a multistep phosphorelay mechanism in the SLN1-YPD1-

SSK1 ‘‘two-component’’ Osmosensor. Cell 86: 865–875.

Rep M, Reiser V, Gartner U, Thevelein JM, Hohmann S,

Ammerer G & Ruis H (1999) Osmotic stress-induced gene

expression in Saccharomyces cerevisiae requires Msn1p and the

novel nuclear factor Hot1p. Mol Cell Biol 19: 5474–5485.

Reub O, Vik A, Kolter R & Morschhauser J (2004) The SAT1

flipper, an optimized tool for gene disruption in Candida

albicans. Gene 341: 119–127.

Rodaki A, Young T & Brown AJP (2006) Effects of depleting the

essential central metabolic enzyme fructose-1,6-bisphosphate

aldolase on the growth and viability of Candida albicans:

implications for antifungal drug target discovery. Eukaryotic

Cell 5: 1371–1377.

Roig P & Gozalbo D (2002) The Candida albicans UBI3 gene

encoding a hybrid ubiquitin fusion protein involved in

ribosome biogenesis is essential for growth. FEMS Yeast Res 2:

25–30.

Roman E, Nombela C & Pla J (2005) The Sho1 adaptor protein

links oxidative stress to morphogenesis and cell wall

biosynthesis in the fungal pathogen Candida albicans. Mol Cell

Biol 25: 10611–10627.

Sambrook J, Fritsch EF & Maniatis T (1989) Molecular Cloning:

A Laboratory Manual. Cold Spring Harbor Laboratory, Cold

Spring Harbor, NY.

Seet BT & Pawson T (2004) MAPK signaling: Sho business. Curr

Biol 14: R708–R710.

Selmecki A, Bergmann S & Berman J (2005) Comparative

genome hybridization reveals widespread aneuploidy in

Candida albicans laboratory strains. Mol Microbiol 55:

1553–1565.

Tao W, Deschenes RJ & Fassler JS (1999) Intracellular glycerol

levels modulate the activity of Sln1p, a Saccharomyces

cerevisiae two-component regulator. J Biol Chem 274:

360–367.

Tatebayashi K, Takekawa M & Saito H (2003) A docking site

determining specificity of Pbs2 MAPKK for Ssk2/Ssk22

MAPKKKs in the yeast HOG pathway. EMBO J 22: 3624–3634.

Thompson JR, Register E, Curotto J, Kurtz M & Kelly R (1998) An

improved protocol for the preparation of yeast cells for

transformation by electroporation. Yeast 14: 565–571.

Vilella F, Herrero E, Torres J & Torre-Ruiz MAdl (2005) Pkc1 and

the upstream elements of the cell integrity pathway in

Saccharomyces cerevisiae, Rom2 and Mtl1, are required for

cellular responses to oxidative stress. J Biol Chem 280:

9149–9159.

Wang Y, Liu CL, Storey JD, Tibshirani RJ, Herschlag D & Brown

PO (2002) Precision and functional specificity in mRNA

decay. Proc Natl Acad Sci USA 99: 5860–5865.

Westfall PJ, Ballon DR & Thorner H (2004) When the stress of

your environment makes you go HOG wild. Science 306:

1511–1512.



Wilson RB, Davis D & Mitchell AP (1999) Rapid hypothesis

testing with Candida albicans through gene disruption

with short homology regions. J Bacteriol 181:

1868–1874.

Wilson RB, Davis D, Enloe BM & Mitchell AP (2000) A recyclable

Candida albicans URA3 cassette for PCR product-directed

gene disruptions. Yeast 16: 65–70.

Wilusz CJ, Wormington M & Peltz SW (2001) The cap-to-tail

guide to mRNA turnover. Nat Rev Mol Cell Biol 2:

237–246.

Xu Q & West AH (1999) Conservation of structure and function

among histidine-containing phosphotransfer (HPt) domains

as revealed by the crystal structure of YPD1. J Mol Biol 292:

1039–1050.

Xu Q, Porter SW & West AH (2003) The Yeast YPD1/SLN1

complex: insights into molecular recognition in two-

component signaling systems. Structure 11: 1569–1581.

Yuzyuk T, Foehr M & Amberg DC (2002) The MEK kinase Ssk2p

promotes actin cytoskeleton recovery after osmotic stress. Mol

Biol Cell 13: 2869–2880.



Documents

The SSK2 MAPKKK of Candida albicans is required for oxidant adaptation in vitro