Embed Size (px)
Citation preview
The Role of Type VIII Collagen in Fibrous Cap Formation and
Progression of Atherosclerosis
by
Joshua Lopes, H.B.Sc
A thesis submitted in conformity with the requirements
for the degree of Doctor of Philosophy
Department of Laboratory Medicine and Pathobiology
Faculty of Medicine
University of Toronto
© Copyright by Joshua Lopes 2015
ii
The Role of Type VIII Collagen in Fibrous Cap Formation and
Progression of Atherosclerosis
Joshua Lopes
Doctor of Philosophy
Department of Laboratory Medicine and Pathobiology
Faculty of Medicine
University of Toronto
2015
Abstract
Collagens play an integral role in the progression of atherosclerosis. Collagen synthesis
and remodelling influence inflammation, smooth muscle cell (SMC) proliferation and migration,
and properties such as plaque tensile strength and mechanical stability. Type VIII collagen is
expressed at low levels in the arterial system however, it is dramatically up-regulated in
atherosclerosis. The purpose of this thesis is to determine the role of type VIII collagen in the
development of atherosclerosis.
Our first study uses Col8+/+;Apoe-/- and Col8-/-;Apoe-/- mice on an atherogenic diet to
illustrate that type VIII collagen plays a role in formation of the fibrous cap. Deletion of type
VIII collagen resulted in reduced SMC and fibrillar type I collagen content and gelatinase
activity. Reduced fibrous cap thickness and increased necrotic core size were observed in
plaques from these mice.
The second study shows that the advanced plaques from mice deficient in type VIII
collagen have increased macrophage proliferation and accumulation. Increased features
iii
associated with plaque instability such as breaks in the elastic lamina and cleaved collagen
content were also observed. Plaque stiffness was reduced in Col8-/-;Apoe-/- mice, suggesting that
type VIII collagen plays a role in the mechanical integrity of the plaque.
In the third study, we use a bone marrow transplantation model to generate chimeric mice
with myeloid-specific deletion of type VIII collagen (Col8-/-+/+). We show that plaques from
Col8-/-+/+ mice have reduced elastin content compared to control mice. Finally, preliminary
work suggests a role for type VIII collagen in the expression of fibrillar collagens. Plaques from
Col8-/-;Apoe-/- mice show reduction of type I and III collagen accumulation and a reduction in
type III collagen expression is observed in SMCs from Col8-/- mice.
In summary, the studies presented here suggest that type VIII collagen confers increased
plaque stability by promoting SMC infiltration and fibrosis as well as reducing inflammation.
This work underscores the importance of type VIII collagen expression in atherosclerosis in
order to prevent clinical events due to plaque failure.
iv
Acknowledgements
I would like to dedicate this thesis to my son Alexander, who I know will achieve feats such as
this and greater. This work could not have been completed without the support of my parents
Tony and Elizabeth, and brother Elliot. I would also like to thank my entire family for all their
guidance and love over the years. I especially thank my wife Marzenka for her patience and
understanding throughout our 8 years together. We’ve been on a long and winding road and there
is no one else I would rather have at my side.
Special thanks are needed to my supervisor Dr. Michelle Bendeck for her constant
guidance, patience, understanding and scientific training. Without her support, I could not have
matured into the scientist and teacher I am today. Special thanks are due to my advisory and
examination committee Dr. Scott Heximer, Dr. Chris McCulloch, Dr. Clinton Robbins, Dr. Boris
Hinz and Dr. Gunjan Agarwal for their criticism, commentary and support. I would like to thank
past and present members of the Bendeck lab for their insightful discussions, constructive
criticism and moral support, in solidarity we stand! My gratitude is also given to past and present
members of the Department of Comparative Medicine and Microscopy Imaging Lab whose
technical assistance was invaluable. Lastly, I would like to thank all members who have
contributed to the work in this thesis through providing training or acquisition of data or
materials; your contributions are greatly appreciated.
“Failures, repeated failures, are finger posts on the road to achievement. One fails forward
toward success.” – C.S. Lewis
v
Table of Contents
Abstract .......................................................................................................................................... ii
Acknowledgements....................................................................................................................... iv
Table of Contents .......................................................................................................................... v
List of Tables and Figures ............................................................................................................ x
List of Abbreviations and Acronyms ....................................................................................... xiii
Chapter 1: Literature Review ...................................................................................................... 1
Introduction ................................................................................................................................... 2
1.1 Pathology of Atherosclerosis .............................................................................................. 3
1.1.1 Normal Arterial Vasculature .......................................................................................... 3
1.1.2 Human Plaque Development and Clinical Manifestations ............................................. 4
1.1.3 The Cellular Mechanisms of Atherosclerotic Plaque Progression ................................. 6
1.1.3.1 Shear Stress and the Endothelium............................................................................ 6
1.1.3.2 Macrophages and Dendritic cells in Atherosclerotic Plaque Progression ............... 8
1.1.3.3 The Origins and Significance of Smooth Muscle Cells and Phenotypic Switching
in Atherosclerosis............................................................................................................... 12
1.2 Mouse Models of Atherosclerosis ..................................................................................... 13
1.2.1 Atherogenic Diet-Induced Model of Atherosclerosis ................................................... 14
1.2.2 Apolipoprotein E-deficient Mouse ............................................................................... 15
1.3 Extracellular Matrix Components and Remodelling in Atherosclerosis ..................... 16
1.3.1 Glycoproteins and Proteoglycans in Atherosclerosis ................................................... 16
1.3.2 Elastin in the Progression of Atherosclerosis ............................................................... 18
1.3.3 Collagens and Collagen Receptors ............................................................................... 19
vi
1.3.3.1 Collagen Fibril Assembly ...................................................................................... 20
1.3.3.2 Collagen Classification .......................................................................................... 22
1.3.3.3 Collagen Receptors: Integrins and Discoidin Domain Receptors .......................... 23
1.3.4 Vulnerable Plaque and the Involvement of Collagen Remodelling ............................. 28
1.3.4.1 Characteristics and Models of the Vulnerable Plaque ........................................... 28
1.3.4.2 Collagen Remodelling and the Vulnerable Plaque ................................................ 30
1.4 Type VIII Collagen............................................................................................................ 33
1.4.1 Structure, Expression and Localization ........................................................................ 34
1.4.2 Receptors for Type VIII Collagen ................................................................................ 36
1.4.3 Functions of Type VIII Collagen.................................................................................. 36
1.4.3.1 Type VIII Collagen in Diabetic Nephropathy........................................................ 38
1.4.3.2 Type VIII Collagen in the Expression and Organization of Fibrillar Collagens ... 40
1.4.4 Type VIII Collagen in Vascular Disease ...................................................................... 41
1.4.4.1 Type VIII Collagen in Smooth Muscle Cell Migration ......................................... 42
1.4.4.2 Type VIII Collagen in Atherosclerosis .................................................................. 43
1.5 Hypothesis and Objectives................................................................................................ 44
1.6 Figures ................................................................................................................................ 46
Chapter 2: Type VIII collagen promotes SMC migration and fibrous cap formation ........ 48
2.1 Introduction ....................................................................................................................... 49
2.2 Materials and Methods ..................................................................................................... 50
2.2.1 Femoral artery injury in Col8+/+ and Col8-/- mice......................................................... 50
2.2.2 mRNA isolation from male C57BL/6 or Apoe-/- mouse aortas .................................... 52
2.2.3 Cell culture and lipoprotein treatment .......................................................................... 53
2.2.4 Real-time RT-qPCR ..................................................................................................... 53
2.2.5 Generation of Col8-/-;Apoe-/- mice ................................................................................ 54
2.2.6 Mean arterial pressure .................................................................................................. 55
2.2.7 Plasma lipid analysis .................................................................................................... 55
2.2.8 Oil Red O staining ........................................................................................................ 56
2.2.9 Immunohistochemistry, matrix staining, and plaque architecture ................................ 56
2.2.10 Fluorescence in situ zymography ............................................................................... 58
vii
2.2.11 Statistical analysis....................................................................................................... 58
2.3 Results................................................................................................................................. 59
2.3.1 Vessel wall thickening and outward remodeling is reduced in Col8-/- mice after
femoral artery injury .............................................................................................................. 59
2.3.2 Type VIII collagen is up-regulated in Apoe-/- mice...................................................... 60
2.3.3 Plaque size and burden of atherosclerosis is similar in Col8-/-;Apoe-/- and Col8+/+;Apoe-
/- mice ..................................................................................................................................... 61
2.3.4 SMC accumulation is reduced in plaques from Col8-/-;Apoe-/- mice ........................... 62
2.3.5 Collagen and elastin accumulation are reduced in Col8-/ -;Apoe-/- mice ....................... 63
2.3.6 Plaques from Col8-/-;Apoe-/- mice exhibit thin fibrous caps and increased necrotic core
size ......................................................................................................................................... 63
2.3.7 Gelatinase activity is decreased in plaques from Col8-/-;Apoe-/- mice ......................... 64
2.4 Discussion ........................................................................................................................... 65
2.5 Tables and Figures ............................................................................................................ 70
Chapter 3: Deficiency in type VIII collagen leads to atherosclerotic plaque instability ...... 85
3.1 Introduction ....................................................................................................................... 86
3.2 Materials and Methods ..................................................................................................... 87
3.2.1 Generation of Col8+/+;Apoe-/ - and Col8-/-;Apoe-/- Mice ................................................ 87
3.2.2 Histological assessment of atherosclerosis ................................................................... 87
3.2.3 Specimen preparation and plaque delamination experiments ...................................... 89
3.2.4 Statistical analysis......................................................................................................... 89
3.3 Results................................................................................................................................. 90
3.3.1 Plaque size and burden do not differ between genotypes ............................................. 90
3.3.2 Macrophage accumulation is increased in plaques from Col8-/-;Apoe-/- mice ............. 90
3.3.3 Matrix content is similar in Col8+/+;Apoe-/- and Col8-/-;Apoe-/- mice ........................... 91
3.3.4 Plaques from Col8-/-;Apoe-/- mice show reduced fibrous cap thickness and increased
breaks in the elastic lamellae ................................................................................................. 92
3.3.5 Plaques from Col8-/-;Apoe-/- mice have increased cleaved collagen ............................ 92
3.3.6 The majority of plaques from Col8-/-;Apoe-/- mice are thin fibrous cap atheromas ... 93
3.3.7 Stiffness is reduced in plaques from Col8-/-;Apoe-/- mice ............................................ 93
3.4 Discussion ........................................................................................................................... 94
viii
3.5 Tables and Figures ............................................................................................................ 99
Chapter 4: The deletion of type VIII collagen in bone marrow derived cells attenuates the
accumulation of elastin in the atherosclerotic plaque............................................................ 115
4.1 Introduction ..................................................................................................................... 116
4.2 Materials and Methods ................................................................................................... 117
4.2.1 Bone marrow transplantation and atherosclerotic plaque analysis. ............................ 117
4.2.2 Assessment of male:female chimerism and flow cytometry ...................................... 118
4.2.3 Statistical analysis....................................................................................................... 119
4.3 Results............................................................................................................................... 119
4.3.1 Plaque area was similar in Col8+/++/+ and Col8-/-+/+ mice ....................................... 119
4.3.2 Cellular composition of the plaque was similar in Col8+/++/+ and Col8-/-+/+ mice .. 120
4.3.3 Elastin content was reduced in plaques from Col8-/-+/+ mice compared to Col8+/++/+
mice ..................................................................................................................................... 120
4.3.4 Donor bone marrow engraftment increases over time post-transplant ....................... 121
4.4 Discussion ......................................................................................................................... 121
4.5 Tables and Figures .......................................................................................................... 125
Chapter 5: General discussion and future directions ............................................................ 133
5.1 Type VIII collagen facilitates formation of the fibrous cap in atherosclerosis .......... 135
5.1.1 Type VIII collagen and fibrillar collagens ................................................................. 135
5.1.2 Type VIII collagen and matrix degradation ............................................................... 138
5.2 Type VIII collagen and atherosclerotic plaque stability .............................................. 140
5.3 The role of type VIII collagen in cytokine production and cell-specific deletion ...... 142
5.4 Limitations ....................................................................................................................... 143
5.5 Closing comments ............................................................................................................ 147
5.6 Figures .............................................................................................................................. 148
ix
Appendix: Type VIII collagen and fibrillar collagen expression ......................................... 151
A1.1 Introduction .................................................................................................................. 152
A1.2 Materials and Methods ................................................................................................ 152
A1.2.1 Transmission Electron Microscopy ......................................................................... 153
A1.2.2 Laser capture microdissection of atherosclerotic plaque and gene expression ....... 153
A1.2.3 Cell culture............................................................................................................... 154
A1.2.4 Real-time qPCR of cultured SMCs.......................................................................... 154
A1.2.5 Immunoblotting of cultured SMCs .......................................................................... 155
A1.2.6 Statistical analysis.................................................................................................... 156
A1.3 Results............................................................................................................................ 156
A1.3.1 Collagen fibers in the fibrous cap are disorganized in plaque from Col8 -/-;Apoe-/-
mice ..................................................................................................................................... 156
A1.3.2 No difference in type I and III collagen expression in Apoe-/- mice 12 weeks on diet
............................................................................................................................................. 157
A1.3.3 Cultured Col8-/- SMCs revealed a reduction in procollagen α1 (III) mRNA
expression ............................................................................................................................ 157
A1.3.4 No difference in collagen protein and modification enzyme expression in cultured
SMCs ................................................................................................................................... 158
A1.4 Discussion ...................................................................................................................... 158
A1.5 Tables and Figures ....................................................................................................... 161
x
List of Tables and Figures
Chapter 1: Literature Review ...................................................................................................... 1
Figure 1.1 Type VIII collagen signalling promotes vascular SMC infiltration ............................ 47
Chapter 2: Type VIII collagen increases atherosclerotic plaque stability by promoting
fibrous cap formation ................................................................................................................. 48
Figure 2.1 Vessel wall thickening, cell number, and vessel diameter are reduced, but apoptosis
and proliferation are increased after injury of the femoral artery in Col8-/- mice ......................... 71
Figure 2.2 Expression of Col8a1 mRNA is suppressed by ApoE and HDL ................................ 73
Figure 2.3 Expression of Col8a1 mRNA is increased in Apoe-/- mouse ....................................... 74
Figure 2.4 Atherosclerotic plaque size and total plaque burden does not differ between
Col8+/+;Apoe-/- and Col8-/-;Apoe-/ - mice........................................................................................ 75
Figure 2.5 SMC accumulation and proliferation are reduced in Col8-/ -;Apoe-/- mice................... 77
Figure 2.6 Matrix accumulation and fibrous cap thickness are decreased, and plaque necrotic
core size is increased in plaques from Col8-/-;Apoe-/ - mice........................................................... 79
Figure 2.7 Fibrillar collagen content is decreased in the plaques from Col8-/-;Apoe-/- mice ........ 81
Figure 2.8 Plaque in situ gelatinase activity is decreased in Col8-/-;Apoe-/- mice ......................... 82
Table 2.1 Data for Uninjured Femoral Arteries ............................................................................ 83
Table 2.2 Systemic Variables for Mice Fed an Atherogenic Diet ................................................ 84
Chapter 3: Deficiency in type VIII collagen leads to plaque instability in atherosclerosis .. 85
Figure 3.1 A representative image of a raw load and displacement curve ................................. 100
Figure 3.2 Total plaque size is slightly elevated in Col8-/-;Apoe-/- mice while plaque burden
remains unchanged between genotypes ...................................................................................... 101
Figure 3.3 Macrophage accumulation and proliferation are increased in plaques from Col8-/-
;Apoe-/- mice ................................................................................................................................ 103
Figure 3.4 SMC proliferation does not differ between Col8+/+;Apoe-/- and Col8-/-;Apoe-/- mice 104
xi
Figure 3.5 Macrophage proliferation slightly increased in plaque from Col8-/-;Apoe-/- mice .... 105
Figure 3.6 Representative negative control images for dual SMA-Ki67 and Mac2-Ki67
immunolabelling ......................................................................................................................... 106
Figure 3.7 Fibrous cap thickness reduced in Col8-/-;Apoe-/- mice............................................... 107
Figure 3.8 Increased cleaved collagen is observed in plaque from Col8-/-;Apoe-/- mice ............ 109
Figure 3.9 Majority of plaques found in Col8-/ -;Apoe-/- mice are thin fibrous cap atheromas.... 110
Figure 3.10 Local energy release rate remains unchanged between genotypes .......................... 111
Table 3.1 Data for Mice Fed an Atherogenic Diet for 24 Weeks ............................................... 112
Table 3.2 Morphological Data Taken from Plaques of mice on Diet for 24 Weeks .................. 113
Table 3.3 Statistical Parameters for Energy Release Rate, Stiffness, and Failure Load Values for
Col8+/+;Apoe-/- and Col8-/-;Apoe-/ - mice...................................................................................... 114
Chapter 4: The deletion of type VIII collagen in bone marrow derived cells and progression
of atherosclerosis ....................................................................................................................... 115
Figure 4.1 No difference in plaque area observed between Col8+/++/+ and Col8-/-+/+ mice ... 126
Figure 4.2 No difference in plaque cellular content is observed between Col8+/++/+ and Col8-/-
+/+ mice ..................................................................................................................................... 127
Figure 4.3 Elastin content reduced in aortic sinus plaques from Col8-/-+/+ mice...................... 129
Table 4.1 Systemic Variables for Transplanted Mice ................................................................. 131
Table 4.2 CD45.1 CD45.2 Bone Marrow Re-Constitution Data Post-Transplant ................. 132
Chapter 5: General discussion and future directions ............................................................ 115
Figure 5.1 Summary of the mechanism of type VIII collagen in the progression of atherosclerosis
..................................................................................................................................................... 149
Figure 5.2 The role of type VIII collagen in fibrosis and fibrous cap formation........................ 150
Appendix: Type VIII collagen and fibrillar collagen expression and formation ................ 151
xii
Figure A1.1 Reduced collagen fiber content and organization in the fibrous cap is observed in
plaque from Col8-/ -;Apoe-/- mice ................................................................................................. 162
Figure A1.2 Procollagen α1 (I) and (III) mRNA expression slightly reduced in plaques from
Col8-/-;Apoe-/- mice ..................................................................................................................... 163
Figure A1.3 Fibrillar collagen mRNA expression reduced in Col8-/- SMCs .............................. 164
Figure A1.4 Type I collagen expression slightly reduced in Col8-/- Real-time qPCR of cultured
SMCs........................................................................................................................................... 165
Figure A1.5 No change in LOX protein expression is observed between genotypes................. 166
xiii
List of Abbreviations and Acronyms
AB aortic banding
ABCA1 ATP-binding cassette transporter A1
ADAMTS a disintegrin and metalloproteinase with thrombospondin
motif
AngII angiotensin II
ApoA apolipoprotein A
ApoB apolipoprotein B
ApoE apolipoprotein E
BAPN β-aminopropionitrile
bFGF basic fibroblast growth factor
BMP bone morphogenic protein
CD cluster of differentiation
CDK cyclin dependent kinase
cDNA complimentary deoxyribonucleic acid
cGy centigray
CHOP C/EB-homologous protein
CP4H collagen prolyl 4 hydroxylase
CX3CR1 fractalkine receptor
DC dendritic cell
DDR discoidin domain receptor
DNA deoxyribonucleic acid
ECM extracellular matrix
ER endoplasmic reticulum
ERK extracellular signal-regulated kinase
FACIT fibril-associated collagens with interrupted helices
FACS fluorescence-activated cell sorting
FAK focal adhesion kinase
FMT-CT fluorescence molecular tomography-computed tomography
FSP-1 fibroblast specific protein 1
GAG glycosaminoglycan
GAPDH glyceraldehyde-3-phosphate dehydrogenase
Gly glycine
GM-CSF granulocyte macrophage-colony stimulating factor
GPCR g-protein coupled receptor
HDL high density lipoprotein
HF heart failure
HRP horseradish peroxidase
HSP heat shock protein
ICAM-1 intercellular cell adhesion molecule 1
IDL intermediate density lipoproteins
IFN interferon
IGF-1 insulin growth factor 1
IL interleukin
JNK jun N-terminal kinase
xiv
KLF krüppel-like factor
LDL low density lipoproteins
LDLR low density lipoprotein receptor
LOX lysyl oxidase
LRP low density lipoprotein receptor like related protein
LV left ventricle
NF-κB nuclear factor kappa B
NO nitric oxide
NOD nucleotide-binding oligomerization domain
MAPK mitogen activated protein kinase
MCP-1 monocyte chemoattractant protein 1
M-CSF monocyte colony stimulating factor
MI myocardial infarction
MIDAS metal ion-dependent adhesion site
MMP matrix metalloproteinase
MyD88 myeloid differentiation factor 88
NC non-collagenous
OCT optimal cutting temperature medium
oxLDL oxidized low density lipoprotein
PAGE polyacrylamide gel electrophoresis
PBS phosphate buffered saline
PECAM-1 platelet endothelial cell adhesion molecule 1
PDGF platelet-derived growth factor
PDGFR platelet-derived growth factor receptor
PG proteoglycan
PI3K phosphoinositol-3 kinase
POVPC 1-palmitoyl-2-(5-oxovaleroyl)-sn-glycero-3-
phosphorylcholine
PSR picosirius red
RER rough endoplasmic reticulum
ROS reactive oxygen species
RNA ribonucleic acid
RT-qPCR real time quantitative polymerase chain reaction
Runx runt-related transcription factor
SDS sodium dodecyl sulfate
SMA smooth muscle α-actin
SMC smooth muscle cell
SM-MHC smooth muscle-myosin heavy chain
SPARC secreted protein, acidic and rich in cysteine
STAT-1 signal transducer and activator of transcription 1
STZ streptozotocin
TEM transmission electron microscopy
TGF-β transforming growth factor β
TIMP tissue inhibitor of matrix metalloproteinase
TNF-α tumor necrosis factor α
TLR toll-like receptors
xv
TUNEL terminal deoxynucleotidyl transferase dUTP nick end
labelling
VCAM-1 vascular cell adhesion molecule 1
VEGFR vascular endothelial growth factor receptor
VLDL very low density lipoproteins
ZO-1 zonula occluding 1
1
Chapter 1: Literature Review
2
Introduction
Chronic occlusive cardiovascular diseases such as atherosclerosis and restenosis are the
leading causes of death in North America. Atherosclerosis is a chronic inflammatory disease of
the arterial wall. Its development is dependent upon a number of biological processes such as the
accumulation of modified low-density lipoproteins (LDL), infiltration of macrophages,
proliferation and migration of smooth muscle cells (SMCs), and the deposition and remodelling
of the extracellular matrix (ECM). Collagens play an integral part in atherosclerotic plaque
development. They are synthesized and remodelled throughout plaque progression and
contribute greatly to the mechanical stability and tensile strength of the plaque. Collagen
signalling and composition also play roles in the pathogenesis of plaque development. One
matrix molecule that is upregulated in atherosclerotic plaque progression is type VIII collagen.
The effect of type VIII collagen on plaque development and the mechanism by which it
contributes to plaque progression remain an interesting avenue of research.
In the following review, the pathology of atherosclerosis is discussed with particular
focus on changes in arterial composition, the progression of atherosclerosis and its clinical
manifestations. This will be followed by a discussion of current mouse models of atherosclerosis.
Next, ECM components and remodelling during atherosclerotic plaque progression will be
discussed along with a link to plaque instability. Lastly, the biology of type VIII collagen is
discussed along with its role in mediating cellular behaviour and matrix remodelling. Particular
focus is placed on the role of type VIII collagen in atherosclerotic plaque progression, as this is
the underlying theme of this thesis.
3
1.1 Pathology of Atherosclerosis
1.1.1 Normal Arterial Vasculature
Large muscular or elastic arteries, are composed of three layers beginning with the
innermost tunica intima followed by the tunica media and finally the outermost tunica adventitia.
The luminal side of the tunica intima consists of a thin monolayer of endothelial cells which are
responsible for a number of functions including: sensing blood flow and shear stress, regulation
of vascular tone and SMC quiescence, vessel permeability and maintenance of a non-
thrombogenic blood-vessel wall surface.1, 2 The endothelium lays over a basement membrane
rich in network forming type IV collagen and laminin. In addition to this, a network of
microfibrils composed of elastic fibers and fibrillin connect and form anchors within the existing
basement membrane network.3, 4 This basement membrane rests over a fenestrated layer of
insoluble elastin known as the internal elastic lamina which marks the division between the
tunica intima and the tunica media.
The tunica media is composed of alternating layers of circumferentially oriented lamellar
units. Each lamellar unit is composed of a continuous sheath of fenestrated elastin known as the
elastic lamella, followed by a layer of vascular SMCs. In normal adults, predominantly in
resistance arteries, these SMCs maintain a contractile phenotype and regulate vascular tone in
response to various agonists. The SMCs are surrounded by a matrix rich in fibrillar type I, III,
and V collagen as well as proteoglycans.5 These lamellar units of SMCs and matrix withstand
tensional forces generated by blood pressure during the cardiac cycle and increase in number in
arteries more proximal to the heart.6
4
The outermost tunica adventitia is separated from the tunica media by the external elastic
lamina. The adventitia is composed of different cell types including fibroblasts, neurons,
macrophages, mast cells, T-cells, vascular progenitor cells and adipocytes. Cells in the adventitia
provide immune surveillance, and a stem cell niche which can mediate repair after arterial
injury.7 The stem cells may contribute to vessel occlusion and atherogenesis.8 The adventitia also
has its own blood supply, the vasa vasorum, consisting of capillaries and small arterioles, which
provide metabolic support to the vessel wall.7 The extracellular matrix within the adventitia is
predominantly composed of fibrillar type I and III collagen which function to give tensile
strength and prevent arterial rupture.9
1.1.2 Human Plaque Development and Clinical Manifestations
Globally, ischemic heart diseases are the leading cause of death and disability with the
majority of individuals affected in developing countries.10 In Canada, heart attacks and strokes
are two of three leading causes of mortality being responsible for 29% of all deaths as of 2008
(Statistics Canada, 2011c). Atherosclerosis is a multifactorial disease and its progression is
dependent on a number of risk factors such as blood concentration of LDL, hypertension,
smoking, male gender, diabetes, familial hypercholesterolemia and other gene-based
hyperlipidemias.11 Of these risk factors, blood LDL concentration is particularly important given
that individuals with low LDL do not generally develop clinically relevant atherosclerosis
regardless of the prevalence of other risk factors.12
The development of atherosclerotic plaques occurs over decades but can begin in
childhood with fatty streaks appearing in atherosclerosis-prone areas of the arterial tree. Details
of the mechanism of atherosclerotic plaque progression will be described in the following section
5
(The Cellular Mechanisms of Atherosclerotic Plaque Progression). Briefly, initiation of the
disease begins at sites of low oscillatory endothelial shear stress13 such as inner curvatures,
branch points, coronary arteries, abdominal aorta, and carotid bifurcations. Exposure of the
endothelium to low, oscillatory flow results in endothelial cell dysfunction and increases
permeability to atherogenic stimuli such as LDLs and changes the ECM composition to increase
LDL retention in the sub-endothelial space.14 Biochemical modification of these LDL particles
triggers increased adherence and recruitment of monocytes to the endothelium. The monocytes
then transmigrate through the endothelium and differentiate into macrophages where they engulf
modified LDL particles resulting in increased intracellular lipids and foam cell formation
(reviewed in Hansson and Libby).15 Over time, lipid laden foam cells as well as debris from
necrotic or apoptotic cells lead to the formation of a highly thrombogenic lipid necrotic core
characterized by the presence of foam cells, extracellular lipids and cholesterol clefts.16
Atherosclerotic plaque development involves the migration and infiltration of vascular
SMCs from the tunica media into the tunica intima.16 This occurs in response to a number of
stimuli which trigger a phenotypic switch of smooth muscle cells from a contractile, agonist-
responsive differentiated phenotype to an activated matrix synthesizing and proliferative
phenotype.17 The fibrous cap is a region of the atherosclerotic plaque just under the endothelium
that is rich in concentrically arranged SMCs embedded in a matrix rich with elastin and collagen
fibers (reviewed in Finn et al).18 Vulnerable plaques (those that are susceptible to rupture and can
trigger a clinical event) are characterized by presence of a thin fibrous cap, low numbers of
SMCs, prominent necrotic core and high numbers of inflammatory cells within the shoulder
regions of the plaque. Complicated lesions contain focal sites of calcification, angiogenesis, and
intraplaque hemorrhage which contribute to plaque burden and instability.16, 18
6
Clinical manifestations of atherosclerosis are generally not present until middle age or
later and are frequently associated with ischemia in down-stream tissues. The majority of plaques
remain asymptomatic. Some however, can lead to severe blood vessel luminal narrowing that
cannot be remedied by compensatory outward arterial remodelling.19 Severe luminal narrowing
of coronary arteries (>70% occlusion) presents as stable angina while narrowing of peripheral
arteries that supply the extremities can lead to tissue ischemia and gangrene. Alternatively,
plaques can rupture or erode resulting in a thrombotic event with vessel occlusion at the rupture
site, or downstream due to thromboemboli. This can result in acute coronary syndrome in vessels
that supply the heart, or a transient ischemic attack or stroke in vessels that supply the brain (i.e.
carotid arteries). In addition to plaque rupture, complicated atherosclerotic plaques can, with
severe degradation of the vessel media, lead to aneurysm formation.
1.1.3 The Cellular Mechanisms of Atherosclerotic Plaque Progression
Atherosclerotic plaque development is dependent upon the interplay of a number of
different factors including lipoprotein retention, inflammatory cell recruitment, formation of
foam cells, proliferation and migration of smooth muscle cells, matrix synthesis, apoptosis and
necrosis, calcification, angiogenesis, fibrous cap formation and rupture, and thrombosis. In this
section, a current understanding of the cell biology underlying the development of the
atherosclerotic plaque will be discussed, focusing on the endothelium, immune cells, and SMCs.
1.1.3.1 Shear Stress and the Endothelium
There are a number of systemic risk factors, discussed above, that contribute to
atherosclerotic plaque progression. Despite this, the disease only initiates at certain regions of the
7
vasculature, in particular sites that are exposed to low endothelial shear stress and oscillatory or
disturbed flow. Conversely, sites of higher shear stress exposed to laminar flow remain
protected.20 Shear stress is defined as the frictional force incurred by the endothelium through
blood flow.21 Athero-protected regions occur in straight segments of the artery exposed to
unidirectional flow with endothelial shear stresses varying between 15 and 30 dyn/cm2. Athero-
prone regions of the vasculature such as those found in inner curvatures, branch points and other
sites of irregular arterial geometry are exposed to disturbed oscillatory flow with shear stresses
<10-15 dyn/cm2.22 These hemodynamic forces are sensed by mechanoreceptors on the basal and
luminal sides and at cell-cell junctions in endothelial cells which co-ordinate and cross-talk with
one another to respond to endothelial shear stress stimuli. Examples of such sensors are:
integrins, G-protein coupled receptors (GPCRs), K+ ion channels, receptor tyrosine kinases such
as vascular endothelial growth factor receptor (VEGFR) or Flk-1, platelet endothelial cell
adhesion molecule-1 (PECAM-1), and the lipid bilayer of the cell membrane (reviewed in Li et
al).23 A number of groups have identified the mitogen-activated protein kinase (MAPK)
signalling pathway as a common mechanism for the response of endothelial cells to shear stress .
Parmar et al showed that endothelial cell exposure to athero-protected laminar flow activates
Krüppel-like factor (KLF)2 through the MAPK pathway to regulate a number of genes
responsible for controlling vascular tone, inflammation, thrombosis and hemostasis.24
Low shear stress triggers a number of phenotypic changes in the endothelium that
promote the initiation and progression of atherosclerosis. Exposure to low flow results in
increased permeability and accumulation and oxidative modification of LDL particles in the
subendothelial space.25 In addition to this it decreases nitric oxide (NO) production and induces
endothelial cell apoptosis.26 Increased activation of nuclear factor kappa B (NF-κB) is observed
8
in cells exposed to low shear stress. These changes result in increased expression of a number of
pro-inflammatory chemokines, cytokines and adhesion molecules27 which increase the
infiltration of monocyte-derived macrophages, dendritic cells and other immune cells to the
subendothelial intima, leading to initiation and progression of plaque growth.
1.1.3.2 Macrophages and Dendritic cells in Atherosclerotic Plaque Progression
Leukocyte recruitment from the bloodstream into the intimal space is dependent upon
endothelial expression of cellular adhesion molecules such as intercellular cell adhesion
molecule (ICAM)-1, vascular cell adhesion molecule (VCAM)-1, E-selectin, and P-selectin.28
Decreased expression or impairment of ligand-receptor binding of these adhesion molecules
reduces monocyte recruitment and atherosclerotic plaque size.29 In humans there are three major
monocyte subsets: the classical cluster of differentiation (CD)14++CD16- C-C chemokine
receptor type 2 (CCR2)hi subset (pro-inflammatory Ly6Chi mouse equivalent), the smaller non-
classical CD14+CD16++CCR2lo subset (patrolling Ly6Clo mouse equivalent), and the
intermediate CD14++CD16+ subset.30, 31 Patients that contain a greater level of the pro-
inflammatory subset maybe more at risk for a clinical event, because fibrous cap thickness is
reduced in these individuals.32 Monocytes play an important role in the sequestration of modified
LDL particles in the intimal layer of the artery. Proteoglycans, a type of extracellular matrix
molecule known to bind and retain lipoprotein particles, are secreted by intimal monocytes,33
thus resulting in enhanced inflammation. Progression of atherosclerosis is dependent upon the
conversion of monocytes into macrophages via the cytokine monocyte-colony stimulating factor
(M-CSF). Mice deficient in M-CSF upon either the apolipoprotein E (ApoE)-deficient or LDL
9
receptor (LDLR)-deficient background have reduced plaque development and reduced
macrophage content compared to controls.34-36
Macrophages play a pivotal role in the development of atherosclerosis. They are
responsible for inflammation, extracellular matrix remodelling, intra-plaque lipid and cholesterol
levels and necrotic core formation.37 Inflammatory processes that occur during the development
of atherosclerosis are dependent upon inflammatory pathways within the two subsets of
macrophages: M1 and M2. M1 macrophages have a pro-inflammatory microbicidal phenotype
and are more associated with plaque vulnerability, while the anti-inflammatory M2 macrophages
function to maintain and heal tissue and are believed to be associated with plaque stability.38 The
origin of these macrophage subsets is under debate, however a number of studies have shown
that changes in the local tissue microenvironment can polarize macrophages into either the M1 or
M2 subset (reviewed in Italiani et al).38 For example, Cheng et al showed that low shear stress
upregulates pro-inflammatory mediators within the atherosclerotic plaque such as C-reactive
protein and interleukin (IL)-6, 39 which can induce M1 macrophage polarization. Other studies
have shown that oscillatory shear stress increases expression of the p65 subunit of NF-κB (RelA)
and c-Jun N-terminal kinase (c-JNK) promoting M1 polarization,40 and that this increases the
inflammatory response in atherosclerosis.41 M1 macrophages produce a number of pro-
inflammatory cytokines such as tumor necrosis factor-α (TNF- α), IL-1 and IL-23.42 These
cytokines further promote the infiltration of monocytes and T-cells which exacerbate the
inflammatory response and contribute to foam cell formation and plaque progression.43 Several
studies have also suggested that M1 macrophages play an important role in the degradation of
the extracellular matrix and thinning of the fibrous cap.44 Histologic studies of macrophage
10
subsets have revealed that M1 macrophages are more often located in the rupture-prone shoulder
regions of the plaque while M2 macrophages are more commonly found in the adventitia.45
M2 macrophage polarization down-regulates inflammatory signals via inhibition of RelA
and signal transducer and activator of transcription-1 (STAT-1).46 Interestingly, the M2
macrophage population accumulates in the early atherosclerotic plaque, while more developed
and complex plaques predominantly contain the M1 phenotype.47 Macrophages also contribute to
early atherogenesis through the uptake of LDL and subsequent modification into oxidized LDL
(oxLDL), via release of myeloperoxidase from granulocytes and subsequent reactive oxygen
species formation.48 oxLDL is taken up by scavenger receptors CD36 and A1, resulting in the
formation of lipid-laden foam cells.49 Retention of modified lipoproteins within the plasma
membrane can lead to activation of inflammatory receptors such as toll-like receptors (TLR) and
nucleotide-binding oligomerization domain (NOD)- like receptors.50 Inflammatory pathway
activation can result from oxidative stress caused by these modified lipoproteins.51
Macrophage accumulation in the atherosclerotic lesion is dependent on proliferation,
recruitment, and apoptosis. For decades, it was thought that every macrophage originated from a
single recruited monocyte. Recent work by Robbins et al illustrates that local macrophage
proliferation, rather than recruitment, is the dominant process of macrophage accumulation in
mouse atherosclerotic plaques.52 Macrophage apoptosis plays a large role in formation of the
necrotic core and the vulnerable plaque. Apoptosis can be induced by a number of factors such
as oxidized phospholipids and lipoproteins as well as excess accumulation of cholesterol within
the endoplasmic reticulum (ER).53 One common mechanism which may be involved in these
apoptotic pathways is the activation of the unfolded protein response. Increased macrophage
11
apoptosis results in formation of a larger necrotic core which is associated with plaque
instability.54
In addition to macrophages, monocytes can give rise to dendritic cells (DCs). These cells
are responsible for prolonging immune responses through antigen presentation to T-cells and can
either sustain or inhibit T-cell activation depending on the stimulation of innate immune
receptors such as the TLR family.55 Monocyte differentiation into DCs occurs in response to
TLR4 ligands and granulocyte macrophage-colony stimulating factor (GM-CSF).37 DCs may
play an important role in early atherogenesis. One study showed that DCs accumulated in athero-
prone regions of the arterial intima in the absence of any systemic risk factors.56 This
accumulation may be due to fractalkine receptor (CX3CR1), seeing as mice deficient in CX3CR1
show reduced DC accumulation in regions predisposed to atherosclerosis as well as reduced
plaque burden.57 Functional contribution of DCs to atherosclerotic plaque pathogenesis has also
been studied. For example, Nickel et al showed that treatment of DCs with oxLDL induced DC
maturation and activated the NF-κB signalling pathway which induced the expression of the pro-
inflammatory cytokine IL-6, and reduced expression of the anti-inflammatory cytokine, IL-10.58
Another cytokine family recently found to contribute to atherosclerosis by promoting
macrophage-endothelial cell adhesion, increasing macrophage accumulation and facilitating
necrotic core development are the type I interferons (IFN): IFNα and IFNβ.59 Plasmacytoid DCs
are a major source of type I IFNs and have been associated with vulnerable sites of the
atherosclerotic plaque.60, 61 In summary, macrophages and dendritic cells play important roles in
the initiation, progression and stability of atherosclerotic plaque through ineffective cholesterol
and apoptotic debris clearance as well as secretion of pro-inflammatory cytokines responsible for
plaque development.
12
1.1.3.3 The Origins and Significance of Smooth Muscle Cells and Phenotypic
Switching in Atherosclerosis
Aortic SMCs are derived from a number of different origins during development
(reviewed in Majesky, 2007).62 Secondary heart field cells form the base of the aorta, neural crest
cells give rise to the ascending aorta and the aortic arch, somatic cells form the proximal end of
the dorsal aorta and splanchnic mesoderm forms the distal end of the dorsal aorta.62 Although
studies have shown that SMC lineage may play a role in plaque development,63, 64 SMC
phenotypic switching remains an integral part in atherogenesis. Endothelial activation,
inflammation, platelet-derived growth factor (PDGF), basic fibroblast growth factor (bFGF),
oxidized phospholipids and LDL exposure can modulate a switch in the phenotype of SMCs.17
Under atherogenic conditions SMCs down-regulate differentiation markers such as smooth
muscle-myosin heavy chain (SM-MHC) and smooth muscle α-actin (SMA) and begin to
proliferate and migrate as well as synthesize a number of ECM molecules such as collagen,
elastin and proteoglycans. The phenotypic switch acts as a mechanism for responding to vessel
injury and is important for maintaining atherosclerotic plaque stability because the activated
SMCs migrate and proliferate to form the fibrous cap.65-67
Ambiguity as to which cells in the atherosclerotic plaque are SMC-derived or
macrophage-derived complicates studies regarding SMC phenotypic switching. SMC lineage
tracing experiments in Apoe-/- mice have shown that SMCs from advanced atherosclerotic
plaques express macrophage markers CD68 and Mac2.68 Conversely, myeloid lineage tracing
studies in Apoe-/- mice indicate that myeloid-derived cells express SMA but not SM-MHC in
plaques.69 Furthermore, analysis of human plaque from patients who have undergone cross-
13
gender bone marrow transplantation have shown that over 10% of SMA-positive cells are
myeloid-derived.70 Recent studies have illustrated the importance of phenotypic differences in
SMCs on atherosclerotic plaque progression. For example, compared to SMA-negative; CD68-
positive myeloid foam cells, SMA-positive foam cells have reduced expression of the cholesterol
exporter, ATP-binding cassette transporter A1 (ABCA1).71 Similarly, transcriptome analysis of
macrophage marker-expressing, cholesterol-loaded, cultured SMCs results in impaired
phagocytosis and efferocytosis reducing the ability to clear necrotic debris and reduce cholesterol
levels within the plaque. Reduced expression of a number of ECM-related genes was also
observed in these cells suggesting an impaired ability to form plaque-stabilizing matrix.72
Mechanistic studies have shown that KLF4 is required for modulating phenotypic switching of
PDGF-BB- or oxidized phospholipid-treated SMCs (reviewed in Gomez and Owens, 2012).17
Given the paucity of studies examining the deficiency of KLF4 in the context of atherosclerosis,
the role of KLF4 in plaque stability remains unknown.
1.2 Mouse Models of Atherosclerosis
Researchers have utilized different animal models of atherosclerosis in order to study the
disease. Through use of diets, vessel injury or both, dog, guinea pig, hamster, mouse, rabbit and
swine have all been used to address questions regarding plaque development (reviewed in Getz
and Reardon).73 Of all these models, mice are the most commonly used in atherosclerosis
research. Small size, cost-effective, easy to maintain, short gestation, and a complete mapped
genome make mice an ideal research tool. For atherosclerosis research, plaques can develop as a
result of genetic manipulation (i.e. Apoe-/- and Ldlr-/-), diet, physical injury (i.e. wire-injury),
hormone treatment, or a combination of one or more of these. Use of genetic models can be
14
particularly advantageous given the versatility of transgenesis such as gene knockin or knockout
and conditional knockouts which can be controlled spatially or temporally.
Molecular mechanisms of atherosclerosis can also be elucidated through genetic models which
can alter expression of one or more genes simultaneously.74 This section will focus on the
atherogenic diet-induced and Apoe-/- models of atherosclerosis.
1.2.1 Atherogenic Diet-Induced Model of Atherosclerosis
High-cholesterol diets are used to induce atherosclerosis in mice. Mice are regularly
maintained on a diet composed of 5-6% fat (w/w) and 0.02%-0.03% cholesterol (w/w). To
induce atherosclerosis, mice are given diets that contain 21% fat (w/w) and 0.15%-1.25%
cholesterol (w/w).75 In some cases, cholic acid is added to increase inflammation and exacerbate
plaque progression.76 Cholic acid supplementation is not required for plaque development and
may induce toxic side-effects.77A review of various diets used in atherosclerosis research can be
found in Getz and Reardon.78 Diet-induced alone mouse models have a number of disadvantages.
In one study conducted by Paigen et al, mice fed an atherogenic diet for either 14 weeks or 9
months resulted in 1 or 8% (respectively) of plaque burden along en face preparations of the
descending aorta.79 When mice are supplemented with an atherogenic diet for 15-22 weeks,
plaques from the aortic root lack features associated with complex human atherosclerosis such as
a prominent necrotic core and fibrous cap as well as minimal intimal SMCs. Instead they appear
as human fatty streaks composed of macrophage foam cells.80 Diet supplementation in
combination with a transgenic mouse provides a more physiologically relevant mouse model of
atherosclerosis.
15
1.2.2 Apolipoprotein E-deficient Mouse
The Apoe-/- mouse is the most widely used mouse model of atherosclerosis. ApoE is a 34
kDa glycoprotein associated with very low density lipoproteins (VLDLs), intermediate density
lipoproteins (IDLs) and chylomicrons, and is important in the clearance of these lipoproteins
from the blood stream.81 Clearance is facilitated through LDLR as well as LDLR like related
protein (LRP).82 In wild-type mice, the majority of plasma cholesterol is situated in the (high
density lipoprotein) HDL fractions while in humans the majority remains in LDL. A high
HDL:LDL ratio is considered to be atheroprotective. In Apoe-/- mice, plasma cholesterol
concentrations shift from HDL fractions to VLDL fractions resulting in plaque development.83
Plaques in these mice develop spontaneously, under normal chow diet conditions with plasma
cholesterol levels ranging between 300 to 500mg/dl.84 Atherosclerosis can be accelerated in
these animals upon supplementation with an atherogenic diet (0.2% cholesterol and 21% milk
fat) which can raise plasma cholesterol levels to >1000mg/dl. Plaques from these animals
localize to similar regions of the arterial tree as in humans, at lesser curvatures and vessel branch
points.85 Morphology is also quite similar to complicated human plaques. Plaques from Apoe-/-
mice contain a true lipid necrotic core enriched with macrophages and foam cells along with a
fibrous cap rich in SMCs and collagen.86 These mice do not normally undergo fatal
complications of atherosclerosis such as plaque rupture; only 4-10% show any signs of a
thrombotic event due to plaque rupture.87 Researchers however, assess for morphological or
histological signs of plaque instability including broken fibrous caps and buried fibrous caps.88-90
(see section 1.3.4 and Chapter 3). Despite its limitations, the Apoe-/- mouse model of
atherosclerosis remains an important genetic tool for studying the molecular mechanisms of
atherosclerosis.
16
1.3 Extracellular Matrix Components and Remodelling in
Atherosclerosis
ECM remodelling occurs during the progression of atherosclerosis and can effect cellular
behaviour, plaque size and susceptibility to rupture. Matrix composition can vary due to the
levels of secretion from cells in the plaque (predominantly SMCs) or expression and activity of
matrix degrading enzymes. Many matrix molecules are up-regulated and remodelled during
plaque development. This section will focus on the most abundant matrix molecules,
proteoglycans and glycoproteins, elastin and collagen followed by a review of matrix
remodelling and how it results in plaque vulnerability.
1.3.1 Glycoproteins and Proteoglycans in Atherosclerosis
Glycoproteins are proteins that are covalently linked to carbohydrate moieties either at
the amido group of asparagine (N-glycosidic bond) or the hydroxyl group of 5-hydroxy-L-
proline, 5-hydroxy-L-lysine, L-serine and L-threonine (O-glycosidic bond) (reviewed in Lee et
al).91 Several glycoproteins are up-regulated during atherogenesis and play a number of diverse
roles including scaffolding, bridging and assembly of matrix molecules, facilitating migration
and proliferation of SMCs, and acting as a chemotactic factor for monocytes.92 Microfibrillar
network-forming glycoproteins such as fibrillin aid in the deposition and assembly of elastic
fibers.93 In the context of atherosclerosis, mutations in the fibrillin-1 gene result in elastin fiber
fragmentation and formation of unstable plaques.94 Adhesive glycoproteins such as fibronectin95
and laminin96 bind to both cells (via integrins) and other matrix proteins such as collagens and
proteoglycans. Studies of fibronectin in atherosclerosis have revealed that it has a dual function
17
with respect to plaque stability. Soluble plasma fibronectin increases plaque size, burden and
lipid levels. This is partly due to increased ICAM-1 expression in endothelial cells exposed to
soluble fibronectin which subsequently leads to increased macrophage adhesion and
accumulation in plaques, as well as increased lipid retention. Soluble plasma fibronectin also
may protect against plaque rupture given that it promotes SMC migration. Mice deficient in
plasma fibronectin had reduced collagen deposition and expression, fibrous cap thickness, and
SMCs and increased macrophage accumulation as well as increased gelatinase expression.97 The
glycoprotein secreted protein, acidic and rich in cysteine (SPARC) is involved in the release and
incorporation of procollagen I in the extracellular matrix.98 Thrombospondin-1 has been shown
to have atheroprotective effects by stimulating macrophage phagocytosis. Deletion results in
increased necrotic core formation, inflammation and MMP-9 mediated elastin degradation.99
Proteoglycans (PGs) are abundant in the ECM within the medial layers of the artery wall.
They are hydrophilic molecules composed of one or more glycosaminoglycan (GAG) side-
chains linked to a protein core.100 PGs mediate a number of processes during atherosclerotic
plaque progression. One hypothesis that remains highly prevalent in the literature is the
“response to retention hypothesis” which states that PG up-regulation during the initial phase of
atherosclerosis results in the retention of LDL and oxLDL in the intimal layer of the vessel
(reviewed in Willams and Tabas).33 This binding process is facilitated through positively charged
regions of the LDL-bound apolipoprotein B (ApoB)-100 protein interacting with the negatively
charged GAG, chondroitin sulfate.101 Other functions of PGs involve the migration and
proliferation of SMCs. In mouse models, overexpressing the small leucine-rich PG biglycan
results in increased proliferation and migration in SMCs of the aorta and renal vasculature when
used in combination with angiotensin II.102 This study showed that in vitro, SMC treatment with
18
biglycan resulted in increased proliferation, dependent upon an increase in cyclin-dependent
kinase (cdk)-2 and decrease in p27. In the rabbit balloon-catheter injury model, decorin, a PG
known to bind growth factors such as transforming growth factor (TGF)-β and PDGF, was
shown to inhibit PDGFR phosphorylation. Treatment of cultured SMCs with decorin as well as
decorin overexpression via adenoviral transfection revealed inhibition of SMC proliferation and
migration as well as intimal thickening.103 Lastly, PGs may also play a role in regulating
inflammation. For example, soluble biglycan binds TLR2/4 resulting in NF-κB activation.104
This results in increased secretion of a number of pro-inflammatory cytokines (reviewed in Frey
et al).105 Decorin binds TLR2/4 and increase the secretion of proinflammatory cytokines TNFα
and IL-12 as well as inhibiting immunosuppressive TGFβ and IL-10.106 Taken together
glycoproteins and PGs mediate diverse functions during the development of atherosclerosis.
1.3.2 Elastin in the Progression of Atherosclerosis
Elastin is a hydrophobic, insoluble cross-linked polymer composed of individual
tropoelastin molecules linked by bifunctional lysinonorleucine, trifunctional merodesmosine and
tetrafunctional desmosine and isodesmosine cross-links.107 Cross-link formation is catalyzed by
copper-dependent lysyl oxidase (LOX).108 Elastin is a highly stable matrix molecule and
undergoes very little turnover. Consequently, proteolysis of elastin molecules is irreparable.109
Deletion of elastin in mice results in death early after birth from complete arterial occlusion. This
is caused by proliferation and migration of SMCs from the medial layer.110 Elastin is organized
into a series of concentric rings around the vessel wall that are responsible for maintaining
distention and recoil during the cardiac cycle.5
19
Elastin undergoes constant remodelling throughout the progression of atherosclerosis. It
is actively synthesized by SMCs and macrophages and ordered, mature elastic fibers can be
found in SMC rich regions of the atherosclerotic plaque such as the fibrous cap.111 Elastin
degradation is facilitated by at least three groups of elastases; serine proteases (i.e. neutrophil
elastase and cathepsin G), cysteine proteases (i.e. cathepsin L, S, K and V) and MMPs (i.e.
MMP-2, -7, -9, and -12) (reviewed in Hornebeck and Emonard).112 Degradation of elastin
increases the risk of aneurysm formation and plaque rupture. Elastin degradation results in
reduced vessel wall compliance, and the formation of elastin-derived peptides that have a
number of effects on the progression of atherosclerosis. For example, in endothelial cells these
peptides have been shown to facilitate nitric oxide-dependent vasodilation.113 In leukocytes,
elastin-based peptides can act as a chemoattractant for monocytes114 and increase the deposition
of ROS leading to increased oxLDL formation.115 With respect to SMCs, elastin peptides have
been shown to increase SMC proliferation and migration which may play a role in mediating
plaque stability.116 In addition to this, these peptides have been shown to mediate SMC
phenotypic switching into an osteoblast-like state, suggesting a role in calcification.117 In a recent
study, elastin-derived peptides were found to increase atherosclerotic plaque formation through
signalling via the PI3Kγ pathway in myeloid-derived cells, which resulted in increased monocyte
migration and ROS production.118
1.3.3 Collagens and Collagen Receptors
Collagens are the most abundant protein in the human body.119 To date, 27 different types
of collagen and 42 distinct procollagen peptide chains have been identified.120 In the aorta at
least 17 different types of collagen have been found with the most abundant being types I, III,
20
IV, V and VI collagen.121 They are involved in a vast array of functions from providing tensile
strength, to cell adhesion and migration, scaffolding and repair of tissues, and a number of other
biological functions (i.e. angiogenesis and atherogenesis). Collagens are composed of three
peptide procollagen α-chains that form a one-residue staggered, right-handed supercoil.122 Each
chain is composed of a series of Glycine (Gly)-X-Y repeats, where X and Y can be any amino
acid but are predominantly proline and 4-hydroxyproline respectively. These procollagen α-
chains maintain their cohesion through hydrogen bonding.122 Depending on the type of collagen
molecule, chains can either form homotrimers or heterotrimers comprised of either one, two, or
three distinct types.123
1.3.3.1 Collagen Fibril Assembly
The formation of procollagen α-chains into complex fibrillar or non-fibrillar
macromolecules involves a number of post-translational modifications which take place in both
intracellular and extracellular spaces. These processes will be briefly described here, in the
context of the more abundant fibrillar collagens. Fibrillar procollagen α-chains are synthesized
bearing amino (N)- and carboxy (C)-terminal propeptides as well as a signal localization
sequence that directs the chain to the rough endoplasmic reticulum (RER). Within the RER, the
signal sequence is cleaved and specific proline and lysine amino acids become hydroxylated, via
enzymes such as prolyl 3/4-hydroxylase (C-P3/4H) and lysyl hydroxylase. Hydroxylation
promotes triple helical assembly of the α-chains and facilitates glycosylation.124 O-linked
glycosylation occurs at specific hydroxylysine residues via collagen galactosyltransferase or
glucosyltransferase.124 Completion of these post-translational modifications results in
trimerization of the procollagen α-chains beginning at the C-propeptide region.125 Addition and
21
reorganization of intramolecular and intermolecular disulphide bonds occur through protein
disulphide isomerase.126 Stabilization of the triple helix is also mediated by chaperone proteins
such as heat-shock protein (HSP) 47.127 Following this, the procollagen triple helix is
translocated to the Golgi bodies to be secreted to the extracellular space. Procollagen is further
processed and organized in Golgi to plasma membrane carriers and then deposited in protrusions
termed fibripositors.128 Processing and secretion of procollagen molecules is carried out through
proteins such as SPARC, which is believed to be involved in the uncoupling of procollagen from
the plasma membrane.98
Following secretion, the N- and C- terminal propeptides are removed. C-terminal
cleavage is mediated by bone morphogeneic protein (BMP) 1 as well as members of the tolloid-
like protein family and furin-like proprotein convertases.129 N-terminal cleavage is facilitated
through a disintegrin and metalloproteinase with thrombospondin motif (ADAMTS).130
Propeptide cleavage results in the initiation of mature collagen fibril self-assembly at the cell
surface.131 This results in the formation of characteristic D-periodic quarter-staggered array
which appears as a 67nm striation pattern under transmission electron microscopy (TEM).132
Wenstrup et al have shown that collagen molecules such as fibrillar type V collagen play a role
in assembly of the microfibrils of type I, II, and III fibrillar collagens through the N-terminal
propeptide region.133 Fibril-associated collagens with interrupted helices (FACIT) collagens134
and small leucine-rich proteoglycans135 help to organize more complex collagen fibril molecules
by binding to the surface of the microfibrils. In the final stage of collagen fibril assembly, a
series of intramolecular and intermolecular covalent crosslinks are introduced which provide
addition tensile strength to the fibril.136 This is facilitated through LOX which, via oxidative
deamination, converts lysine and hydroxylysine residues into semialdehydes that condense to
22
form cross-links.137 Cross-linking between these modified residues occurs between neighbouring
N- and C-terminals of the collagen microfibril and within the microfibril itself.138 These cross-
links help to withstand shear stress. Collagen assembly involves a number of biochemical
processes that must be tightly regulated in order to avoid pathological collagen deposition and
assembly.
1.3.3.2 Collagen Classification
Collagens can be organized based on their supramolecular structures into the following
categories: fibrillar collagens, FACITs, network forming collagens, beaded filaments, and
anchoring fibrils.123 The structure and assembly of fibrillar collagens has been discussed above
(see section 1.3.3.1). Collagen fibrils contain a characteristic 67nm D-periodic banding pattern
and can range in diameter from 12nm to over 500nm depending on the tissue type.139 At least 11
mammalian fibrillar collagen genes have been discovered.140 Most collagen fibrils in the body
are heterotypic, for example in cartilage collagen fibrils are composed of a combination of type
II and III.141 In the advanced fibrotic atherosclerotic plaque type I and III collagen are found in
abundance.142 Type I collagen provides tensile strength while type III provides elasticity.143 Type
V collagen is associated with banded collagen fibrils and increased in advanced atherosclerotic
lesions, however its role has not been elucidated.144
FACITs are collagens that contain interruptions in their triple helix and are relatively
short in comparison to other collagens.139 They are located along the surface of collagen fibrils
and may be involved in fibril bridging. For example, type XV collagen is found near the
basement membranes of renal, placental and intestinal tissue and forms a bridge to banded
fibrils.145 Of the network forming collagens, type IV is the most well-known. It forms a basement
23
membrane network through interactions between trimeric non-collagenous (NC) 1 domains. This
results in the formation of a hexamer that is stabilized through an S-hydroxylysine-methionine
covalent crosslink.146 Type IV collagen is highly prevalent in the basement membrane of
endothelial cells. It is up-regulated in the atherosclerotic plaque and is thought to maintain SMC
quiescence.147 Type VIII collagen, another network forming collagen, is the focus of this thesis
and will be discussed in section 1.4. Type X collagen is structurally similar to type VIII collagen
and is found in growth plate cartilage.148 Type VI collagen is the primary example of beaded-
filament collagens. It cross-links into tetramers that contain a 105nm beaded repeat region.139
Type VI collagen has been localized within the basement membrane of cells in the
atherosclerotic plaque.149 Lastly, anchoring fibrils such as type VII collagen play a role in
maintaining skin integrity by connecting the epidermal and dermal layers.150
1.3.3.3 Collagen Receptors: Integrins and Discoidin Domain Receptors
Collagen cell-matrix interactions are mediated by several different receptors. These
receptors regulate cellular activities such as proliferation, migration, adhesion, and immune
responses. Integrins are composed of α and β heterodimers that associate non-covalently.
Twenty-four distinct integrin molecules exist as a result of a combination of 18 α subunits and 8
β subunits. Each subunit contains a relatively large extracellular domain followed by a series of
transmembrane helices and a short cytoplasmic domain.151 In the I-domain at the top of the α
subunit is a magnesium ion metal ion-dependent adhesion site (MIDAS), critical for binding of
integrins to collagen.152 Integrins lack any intrinsic kinase activities but can mediate inside-out
signalling through cytosolic integrin-binding proteins such as Src, focal adhesion kinase (FAK),
paxillin, and talin (reviewed in Legate et al),153 or outside-in signalling by binding ECM
24
components. Integrins are responsible for mediating processes such as cellular adhesion and
phagocytosis. For example, studies conducted by the McCulloch lab show that phagocytosis of
collagen fibrils is dependent upon α2β1 integrin. This integrin-mediated uptake is driven by actin
polymerization, gelsolin, and is dependent on Rac1 activation.154, 155 Four β1 integrin
subfamilies function as triple helical-binding collagen receptors: α1β1, α2β1, α10β1, and α11β1.
They are expressed in a number of different tissue types but the most widely distributed are α1β1
and α2β1; which are the main integrin subtypes of the vessel wall.156 The α1β1 integrins
preferentially bind type IV collagen157 while α2β1 integrins bind fibrillar collagens such as types
I-III.158 Integrins α1β1 and α2β1 recognize the GFOGER, GASGER, and GLOGER binding
motifs on triple helical collagen.159 Collagen molecules contain GPOGD and RGD motifs that
serve as integrin adhesion sites.160 However, these sites, in particular RGD, are exposed upon
denaturation of the collagen molecule resulting in binding to the αVβ3 integrin.161
Studies examining the binding of α1β1 to type IV collagen162 have shown that this integrin
sub-type may play a role in binding non-fibrillar collagens however this topic requires further
investigation. In the context of atherosclerosis, α1β1 integrin is involved in plaque progression
and instability.163 In one study conducted by Schapira et al, deletion of α1 integrin resulted in
reduced plaque size and macrophage and T-cell accumulation as well as increased SMC and
collagen content.163 α1β1 integrin is upregulated in the neointima and has been shown to be
involved in collagen remodelling.164 α2β1 integrin has been shown to promote collagenase
expression, collagen gel contraction and collagen fibril assembly in SMCs.165 Cross-talk between
collagen-stimulated integrin α2β1 and PDGF-BB-stimulated PDGF receptor β (PDGFRβ) has
been shown to promote SMC proliferation.166 Other integrins such as αvβ3 are upregulated after
vascular injury and may play a role in atherogenesis.167 For example, in a hyperglycemic porcine
25
model of atherosclerosis, inhibition of αvβ3 integrin resulted in reduced atherosclerotic plaque
size compared to controls.168
The discoidin domain receptors (DDRs) are a family of receptor tyrosine kinases that
bind collagen. The name of this receptor class follows from the homology of the extracellular
domain to discoidin-1, a lectin present in the slime mold Dictyostelium discoideum. The
extracellular component of DDR consists of an N-terminal discoidin homology domain followed
by a globular domain present only in DDRs. A single pass transmembrane domain connects the
extracellular domain to the cytoplasmic domain. The cytoplasmic domain is composed of a ~150
amino acid juxtamembrane region followed by a C-terminal kinase domain.169 DDRs undergo
dimerization in order to facilitate binding to collagen substrates.170 The DDR family is comprised
of two distinct receptors: DDR1 and DDR2, each encoded by a separate gene. The Ddr2 gene
only has one product, while the Ddr1 gene has six different splice variants. DDR1a-c retain
kinase activity, while DDR1d and e lack kinase activity due to deletion of the kinase domain or
the ATP binding site, respectively.171 DDR1 has been shown to bind to collagen types I-VI and
VIII whereas DDR2 binds to collagen types I, III, and X.172-175 Both DDR1 and DDR2 recognize
the GVMGFO motif present in types I-III fibrillar collagen.176, 177 Triple helical confirmation of
the collagen molecule is required in order for DDRs to bind to their specific amino acid
sequences.178 Interestingly, DDR signalling as evidenced by autophosphorylation does not
require fully formed collagen fibrils, only triple helical peptides that contain the GVMGFO
motif.177
DDR signalling involves a number of pathways (reviewed in Vogel et al).179 Upon ligand
binding, DDR autophosphorylation occurs and can be sustained for up to 18 hours.175 Full DDR
activation requires phosphorylation by Src kinase.180 This in turn facilitates docking of
26
phosphotyrosine-binding and SH2-domain adaptor proteins such as the p85 subunit of PI3K,
ShcA or Nck2 to the cytoplasmic tail.169, 175, 181 DDRs signal through a number of pathways such
as the MAPK pathway. For example, in smooth muscle cells and in mesangial cells, DDR1 was
required for extracellular signal-regulated kinase (ERK) 1/2 activation or suppression,
respectively. 180, 182 In osteoblasts, DDR2 utilized p38 MAPK to activate runt-related
transcription factor (Runx) 2.183 DDRs have been shown to mediate cross-talk with integrins. For
example, activation or overexpression of DDRs increased α1β1 and α2β1 integrin activation
resulting in increased integrin mediated cell adhesion.184
In the context of atherosclerosis, although both DDR1 and DDR2 are expressed in
atherosclerotic plaque185, DDR1 has been studied far more extensively than DDR2. Studies
examining the role of DDR1 in atherosclerosis have mainly utilized DDR1-deficient mice which
are phenotypically dwarfed and contain defects in mammary gland development and placental
implantation.186 SMCs isolated from Ddr1-/- mice have reduced proliferation and migration as
well as reduced MMP-2 and -9 activity. Following wire-injury in the carotid artery, Ddr1-/- mice
had reduced neointimal hypertrophy and reduced collagen deposition compared to wild-type
mice.172 Studies conducted by Franco et al have elucidated the role of DDR1 in atherosclerotic
plaque progression by breeding Ddr1-/- mice on the Ldlr-/- background and supplemented with an
atherogenic diet. Ddr1-/-;Ldlr-/- mice fed an atherogenic diet showed a 50-60% reduction in
plaque size and an elevation in collagen and elastin levels compared to control. Plaques from
these animals displayed decreased macrophage accumulation, gelatinase activity, as well as
decreased monocyte chemoattractant protein (MCP) 1 and vascular cell adhesion molecule
expression (VCAM) 1 expression.187 Taken together, this study suggests that DDR1 not only
plays a role in fibrosis but also in the accumulation of macrophages into the plaque.
27
To further assess DDR1-dependent macrophage accumulation, chimeric mice with bone-
marrow specific deletion of DDR1 (Ddr1-/-+/+) were generated on the Ldlr-/- background and
given an atherogenic diet. Compared to controls, Ddr1-/-+/+ mice had a reduction in plaque size
due to a decrease in the number of donor-derived Ddr1-/- macrophages. No change in matrix
accumulation was detected. In vitro work suggests that the reduction in monocyte/macrophage
accumulation is due to decreased adhesion on a type IV collagen matrix and deceased response
to MCP-1.188
To characterize the role of DDR1 in SMCs during atherosclerotic plaque progression,
chimeric mice with host specific deletion of DDR1 (Ddr+/+-/-) were also generated on the Ldlr-/-
background and fed atherogenic diet. (Ddr+/+-/-) mice had increased plaque size due to an
increase in collagen, elastin, PG and fibronectin accumulation and fibrous cap thickness
compared to controls. Total cellular content was decreased in plaques from (Ddr+/+-/-) mice
however, there was an increase the proportion of vessel wall-derived SMCs relative to
macrophages. Additional in vitro studies confirmed that Ddr1-/- SMCs had increased
proliferation and migration relative to controls.189 Discrepancies in the difference in proliferation
and migration of SMCs in Ddr1-/- mice from Hou et al and Franco et al may be attributed to the
models implemented and the complexity of the matrix. In Hou et al, SMC proliferation and
migration was decreased in Ddr1-/- SMCs relative to wild-type upon culture with a matrix
composed of pure type I or type VIII collagen.172 Franco et al used a matrix pre-synthesized by
Ddr1-/- SMCs, and demonstrated that Ddr1-/- SMCs plated on this matrix showed an increase in
SMC proliferation and migration relative to Ddr1+/+ cells.189 This suggests that DDR1 may
signal and function differently depending on the matrix microenvironment it is placed in.
28
Several studies in different systems now suggest that DDR1 is involved in mediating
inflammatory responses. In atherosclerosis, DDR1 promotes macrophage accumulation in the
plaque and is associated with thinning of the fibrous cap.187-189 DDR1 has also been shown to
mediate inflammatory processes in lung fibrosis, hypertension-induced renal diseases and in
Alport syndrome in the kidney.190-192 Moreover, it is clear that DDR1 influences biological
processes related to formation of a stable fibrous cap in atherosclerosis. Retroviral
overexpression of DDR1 and DDR2 in human smooth muscle cells resulted in decreased
collagen production and increased MMP expression and activity.185 In vitro studies from
Agarwal and colleagues show that DDRs interfere with collagen fibril assembly. The
extracellular domain of DDR1 can prevent proper collagen fibril formation by binding at
overlapping or adjacent collagen molecules resulting in a locked and incomplete collagen fiber
lacking in proper D-periodicity.193-195 Similarly the DDR2 ECD reduces the rate of collagen
deposition and leads to reduced fibril diameter and D-periodicity in the collagen fiber.194 Finally,
DDRs stimulate the activity of a number of MMPs, in both macrophages and SMCs, responsible
for collagen degradation such as collagenases MMP-1 and -8185, 196 and gelatinases MMP-2 and -
9.197, 198 Activation of these enzymes could lead to destabilization of the plaque fibrous cap. The
role of DDRs in the progression of atherosclerosis has been recently reviewed in Ju et al.199
1.3.4 Vulnerable Plaque and the Involvement of Collagen Remodelling
1.3.4.1 Characteristics and Models of the Vulnerable Plaque
Atherosclerotic plaques that are likely to trigger a thrombotic event are termed rupture-
prone, instable, or vulnerable plaques. In the coronary system, plaque thrombosis occurs by three
29
means: presence of calcific nodules (occurs in 2-6% of plaques), plaque erosion (35% of
plaques) and the most frequently observed, plaque rupture which occurs in over 60% of all
plaques.200 Rupture of fibrous caps occurs at either the macrophage-rich shoulder regions of the
plaque or at the plaque apex. Differences in rupture site may be related to the activity of the
individual before death and the level of shear stress201 and local MMP activity202 within the
plaque.
In mouse models of atherosclerosis, researchers have utilized a number of histological
tools to assess features associated with plaque rupture or instability. Johnson et al have defined
markers of plaque rupture in the Apoe-/- mouse including buried fibrous caps, which are
analogous to fibrous caps in humans that have undergone rupture and subsequently healed,90
breaks or disruptions in the fibrous cap, and breaks in the elastic lamellae as surrogate markers
of elastin degradation89, a process involved in plaque instability.203 Carstairs stain, a stain which
labels fibrin deposition within atherosclerotic plaques has been used as a marker of plaque
thrombosis or intraplaque hemorrhage.89 Many groups that study atherosclerosis in mice and
humans describe plaques with a low ratio of SMCs to macrophages, low collagen (types I and
III) and elastin content, high levels of matrix degrading enzyme expression/activity, a large lipid-
filled necrotic core and a thin fibrous cap as vulnerable plaques.18 Mouse models of
atherosclerosis provide valuable tools for the study of mechanisms of formation of vulnerable
plaque. However an important limitation of the mouse models must be noted as myocardial
infarction (MI) and sudden cardiac death are rare in the mouse.
Researchers have utilized a number of experimental manipulations to study the biology of
atherosclerotic plaque rupture in the mouse. For example, matrix remodelling and degradation
have been studied through genetic alterations of MMPs and tissue inhibitors of matrix
30
metalloproteinases (TIMPs) in the Apoe-/- mouse (further discussed in section 1.3.4.2). The
plaque necrotic core is a source of proteases and oxidative species that can contribute to fibrous
cap degradation, plaque rupture and thrombosis. Mouse models of macrophage apoptosis in
advanced atherosclerotic plaque have shown how apoptosis can contribute to the progression and
growth of the necrotic core.204 In one study conducted by Thorp et al, deletion of the ER effector
C/EB-homologous protein (CHOP) in Apoe-/- mice given an atherogenic diet resulted in a 50%
reduction in plaque size and 35% reduction in plaque apoptosis.205
Genetic models that alter the synthesis or assembly of ECM molecules such as collagen
or elastin have shown how these molecules can contribute to atherosclerotic plaque stability.
Mutations in the fibrillin-1 gene impair the structural organization of elastin resulting in elastin
fragmentation, arterial stiffening, and plaque instability.94 A recent study examining a fibrillin-1
mutation in Apoe-/- mice revealed increased incidence of MI and stroke due to plaque rupture.203
Angiotensin II (AngII) is a peptide hormone that has been show to regulate a number of factors
that are involved in atherogenesis such as hypertension, oxidative stress, and monocyte
recruitment/activation.206-209 In one study conducted by Sato et al, AngII-infused Apoe-/- mice
given an atherogenic diet displayed a number of morphological features associated with plaque
instability.210 Taken together, these studies show that manipulation of biological processes that
regulate inflammation, apoptosis, hypertension and matrix degradation or assembly all have
dramatic consequences on plaque stability and are often interrelated.
1.3.4.2 Collagen Remodelling and the Vulnerable Plaque
Collagens are the most abundant proteins in the atherosclerotic plaque, constituting
approximately 60% of the total protein.211 Within the fibrous cap, the expression and integrity of
31
collagen plays an important role in atherosclerotic plaque stability. The process of collagen
remodelling is dependent on both synthesis and assembly mediated predominantly by SMCs, and
breakdown of collagen molecules, mediated by SMCs and macrophages through production of
MMPs.18 Conversely, different forms of collagen can regulate cell behaviour. Fibrillar type I
collagen has been shown to have anti-proliferative effects through stimulation of p27Cip1 and
p27Kip1, cyclin-dependent kinase (CDK) inhibitors.212 Conversely, soluble type I collagen has
been shown to promote SMC proliferation through stimulation of the phosphoinositiol-3-kinase
(PI3K) and phospholipase C pathway.213
Intimal SMCs predominantly secrete collagens type I and III which are required for
fibrous cap formation.18 Treatment of cultured SMCs with PDGF or transforming growth factor
(TGF)-β,214 or with atherogenic stimuli such as oxLDL,215 can increase collagen synthesis.
Collagen synthesis is also controlled by a multitude of inflammatory factors (reviewed in
Rekhter et al).216 For example IL-1 increases collagen synthesis, while IFNγ inhibits synthesis in
human SMCs.214 In the Apoe-/- mouse, deletion of IFNγ receptor results in increased collagen
deposition.217 In a mouse model with over-activated T-cells, the formation of mature collagen
fibers in the atherosclerotic plaque was reduced, secondary to reduction in LOX activity.218
Other important studies have associated LOX with plaque stability.
Increased LOX mRNA expression in human carotid endarterectomy samples has been
correlated with plaque stability and reduced incidence of myocardial infarction.219 Deletion of
IL-6 in the Apoe-/- mouse led to decreased LOX activity, and reduced plaque collagen content.220
Reduced expression or inhibition of LOX leads to immature collagen fibers that are more at risk
of MMP-mediated degradation,221 and may promote atherosclerotic plaque instability. Other
collagen modification enzymes have also been implicated in atherosclerotic plaque stability.
32
Increases in the expression of CP4Hα1 have been correlated with increased plaque stability.222 A
greater understanding of the mechanisms that promote mature collagen fiber maturation may
reveal therapeutic opportunities to reduce the likelihood of plaque rupture.
Collagen degradation contributes to plaque rupture. MMPs are abundant in the
atherosclerotic plaque. All 25 MMPs are characterized by the presence of a Zn+2 based catalytic
mechanism of degradation.223 MMPs can be classified into 5 groups: collagenases (MMP-1, -8,
and -13), gelatinases (MMP-2 and -9), stromelysins (MMP-3 and -7), membrane-bound MMPs
(such as MMP-14 to -17) and lastly Zn+2 and Ca+2-dependent endopeptidases (such as MMP-20).
Four TIMPs (TIMPs 1-4) inhibit the activity of MMPs and prevent excessive substrate
degradation.224 The role of MMPs in the progression of atherosclerosis has been extensively
studied in humans and in mouse models of atherosclerosis.66, 225 In three separate studies, Galis
et al showed that in human plaques, matrix degrading collagenases (MMP-1), gelatinases (MMP-
2 and -9), and stromelysin (MMP-3), along with their inhibitors (tissue inhibitors of matrix
metalloproteinases [TIMP]-1 and -2) are expressed in the shoulder regions of advanced plaques
where they are prone to rupture.226-228 The collagenases MMP-1, -8 and -13 were found near
foamy macrophages or SMCs. These collagenases also co-localized with an epitope that
identifies collagenase-cleaved collagen which was prevalent in vulnerable plaques.202, 229 Studies
of MMP-1 in mouse models of atherosclerosis suggest that it may have an atheroprotective
effect, in that overexpression of MMP-1 in macrophages resulted in smaller plaques, however
these plaques exhibited reduced fibrillar collagen content consistent with plaque instability.230
The gelatinases MMP-2 and -9 play complex roles in plaque pathogenesis. Human
vascular SMCs upregulate MMP-2 and -9 and TIMP-1 and -2 expression in response to
inflammatory mediators. 227, 231, 232 MMP-2 and 9 are upregulated in response to arterial injury in
33
vivo, and treatment with broad spectrum MMP inhibitors reduces SMC migration and neointimal
formation.233-235 . Deletion of MMP-2236 or 9237 in Apoe-/- mice results in reduced plaque size as
well as reduced accumulation of SMCs and macrophages. Macrophage-derived MMP-9 has been
shown to promote plaque destabilization, possibly through activation of pro-inflammatory
cytokines.89 Taken together these studies suggest that these MMPs play complex roles in
atherosclerosis: they are required for SMC infiltration in plaque and therefore formation of a
stable fibrous cap, however, increased activity of these MMPs within the fibrous cap, might
contribute to matrix degradation and promote plaque rupture.238
Mouse models used to assess the role of the neutrophil elastase MMP-12 in
atherosclerosis have shown that it promotes atherosclerotic plaque progression. Deletion of
MMP-12 in Apoe-/- mice reduces plaque size, increases the ratio of SMCs to macrophages and
reduces the number of buried fibrous caps.90 Similarly, inhibition of MMP-12 through use of the
phosphinic peptide RXP470.1 in Apoe-/- mice decreased plaque size and increased the level of
fibrosis compared to vehicle treated mice.239 Interestingly, other studies have shown that MMP-
12-mediated cleavage of N-cadherin in lipid-laden SMCs increases apoptosis which promotes
formation of the necrotic core.240 Overall, these studies and others have illustrated the diverse
role of MMPs in plaque vulnerability and collagen remodelling.
1.4 Type VIII Collagen
The focus of this thesis is centered on elucidating the expression and functions of type
VIII collagen in atherosclerosis. Several groups, including ours, have demonstrated that this
molecule is upregulated in vascular diseases including atherosclerosis and it is implicated in a
number of processes that relate to it. In this section a review of the structure, expression and
34
localization of type VIII collagen will be made, followed by a brief description of the type VIII
collagen binding receptors. A review of the functional effects of type VIII collagen will also be
made, ending with a description of how these functions pertain to vascular disease and
atherosclerosis.
1.4.1 Structure, Expression and Localization
Type VIII collagen is part of the short chain, network-forming family of collagens and is
composed of two chains, procollagen α1(VIII) and procollagen α2(VIII), which are encoded by
two separate genes, Col8a1 and Col8a2, respectively. In humans, the Col8a1 gene is found on
chromosome 3,241 while the Col8a2 gene is found on chromosome 1.242 In mice, the Col8a1 gene
is located on chromosome 16 and the Col8a2 gene is located on chromosome 4.243 The Col8a1
gene contains four exons of which the first and second consist of 5’ untranslated sequence. The
third exon encodes the majority of the 5’ end of the non-collagenous (NC) 2 domain while the
fourth exon encodes the rest of the NC2 domain, the collagenous triple helical domain, the NC1
domain and the 3’ untranslated sequence.244 The collagenous domain of the α1(VIII) chain which
consists of a Gly-X-Y repeating motif contains 8 imperfections that instead form a Gly-X-Gly
sequence.245 In the Col8a2 gene, a single exon encodes for the NC1 domain and triple helical
domain which also has the same 8 imperfections in the triple helix and at similar locations to the
α1(VIII) gene.242
Each molecule is composed of 3 α-chains which can form either homotrimers or
heterotrimers composed of α1(VIII) and/or α2(VIII) chains in vivo,246 and in vitro.247 The chains
assemble to form a non-fibrillar molecule 160 nm in length. Two-thirds consist of a collagenous
domain that is flanked at the N- and C- termini by the remaining one-third composed of globular
35
NC domains.245 Stephan et al further characterized the supramolecular structure of recombinant
type VIII collagen through a combination of rotary shadowing electron microscopy and atomic
force microscopy. Assemblies of collagen molecules were observed to branch at angles of 114°
resulting in the formation of a hexagonal lattice. The length of the α-chain measures 134nm. The
authors propose a model where formation of the hexagonal lattice structure is due to interactions
between the NC termini of tetrahedral-shaped type VIII collagen molecules.248 Indeed,
crystallography studies of the NC1 domain of α1(VIII) chains have shown that this domain
contains three hydrophobic strips bearing exposed aromatic residues that are thought to help in
the assembly of type VIII collagen into a hexagonal lattice network. The NC domains are also
believed to play roles in formation of the trimers.249 It is worth noting that the structure of type
VIII collagen is quite similar to that of type X collagen, which is a component of the ECM of
hypertrophic cartilaginous chondrocytes.244
Type VIII collagen is found in several tissues at various levels of expression. The
molecule was first identified in bovine aortic endothelial cell culture media.250 Descemet’s
membrane, a basement membrane of the cornea, contains high levels of type VIII collagen along
with type V collagen,251 and has provided an exogenous source of the molecule used in a number
of studies.252-255 In humans, type VIII collagen is expressed in brain parenchyma256 as well as the
arterioles of the kidney and in the intima of large arteries.257 Additional animal studies have
shown type VIII collagen expression in the brain, lung, thymus, heart and placental capillaries of
embryonic mice,258 as well as in the brain optic nerve sheath and perichondrium of fetal
bovines.259 Type VIII collagen is also expressed during embryonic cardiac development in the
mouse and chicken,243 as well as in notochordal sheath tissue in zebrafish.260 Pathological studies
have revealed that type VIII collagen is upregulated after mechanical vascular injury in both
36
rats261 and rabbits262 and is expressed by endothelial cells, SMCs and macrophages in
atherosclerotic Apoe-/- mice.263, 264 Studies of humans have revealed that it is expressed in
cultured neonatal and adult SMCs265 and macrophages266 as well as human plaque tissue.
1.4.2 Receptors for Type VIII Collagen
Type VIII collagen has been shown to bind to both α1β1 and α2β1 integrin receptors as
well as DDR1. Hou et al found that treatment of rat SMCs with a blocking antibody against β1
integrin resulted in an 83% decrease in SMC adhesion to type VIII collagen relative to control
IgG. In human SMCs, treatment with blocking antibodies against α1 and α2 integrins decreased
adhesion to type VIII collagen by 29% and 77%, respectively.254 Endothelial cells,267 and
platelets268 bind to type VIII collagen using the α2β1 integrin. Type VIII collagen likely binds to
integrins via the GLOGER motif.159 Type VIII collagen has been shown to bind to activate
DDR1. A study in our lab has shown that in HEK293 cells overexpressing DDR1, type VIII
collagen was able to bind and activate the receptor, suggesting that it plays a role in cell
signalling.172 The GVMGFO motif to which DDRs bind to fibrillar collagens is absent in both
mouse and human type VIII collagen (UniProt entry identifier: P27658, P25067, P25318 and
Q00780) therefore, DDR1 likely binds to an alternative sequence within the molecule.
1.4.3 Functions of Type VIII Collagen
Type VIII collagen mediates a number of different functions. Mutations within the
Col8a2 gene are linked to a family of human corneal dystrophies including Fuch’s corneal
dystrophy and posterior polymorphous dystrophy.269-271 Patients with a leucine to tryptophan
mutation (L450W) in α2 (VIII) chain have a thickened Descemet’s membrane comprised of
37
misassembled type VIII collagen deposited in blebs and refractile strands. The anterior banded
layer of the cornea is three times thicker than normal.270 In recent studies using a knock-in mouse
model of Fuch’s corneal dystrophy, researchers generated and characterized mice with L450W
or Q455W mutations, both of which have been found in human patients with the condition.269, 270
These mice exhibited up-regulation of genes associated with the unfolded protein response as
well as Dram1, a marker of autophagy. TEM analysis of the corneal endothelium revealed
dilated rough endoplasmic reticulum (RER), a feature associated with the unfolded protein
response, and confocal microscopy revealed the presence of guttae within the corneal
endothelium that increased in number over time.272 Taken together this suggests that mutations in
type VIII collagen are linked to autophagy and dysmorphogenesis of the endothelium.
Type VIII collagen is upregulated in pathologies of the nervous system. Increased
expression was observed in human brain tumors273 and by astrocytes both in vivo and in vitro in
a mouse model of brain injury.256 Hirano et al showed that astrocytes adhere to type VIII
collagen through metal ion-bound receptors, consistent with previous studies showing integrin
binding (see section 1.4.2). Furthermore, this study demonstrated that astrocytes were able to
migrate much further on a type VIII collagen matrix as compared to type I, IV, or V collagen or
fibronectin.256 Conversely, type VIII collagen has been shown to be an adhesive substrate for
endothelial cells. Increased endothelial cell adhesion and spreading on a matrix composed of the
α2 (VIII) chain was observed in comparison to glass or fibronectin. Adhesion and spreading
were mediated through α2β1 integrin.267 Similar studies have demonstrated that type VIII
collagen mediates endothelial cell spreading during capillary tube formation.258 Type VIII
collagen may act as an antithrombotic substrate, since platelet adhesion was substantially
reduced in comparison to other collagen types.268
38
Type VIII collagen-deficient mice provide a valuable tool for functional studies such as
some of those listed above. Hopfer et al examined the effect of single deletion of either Col8a1
or Col8a2 genes or both (Col8-/-).274 Col8a1-/- mice had increased Col8a2 mRNA expression in
the heart but decreases in all other organs analyzed. Conversely, Col8a2-/- mice show decreased
expression of Col8a1 in most organs and elevated expression in the heart and aorta. This
suggests that in the cardiovascular system deletion of one chain compensates for the other. Col8-
/- mice have no observable gross abnormalities. Hopfer et al did note however abnormalities in
the anterior segment of the eye such as a thinned Descemet’s membrane and corneal stroma as
well as increased distance between the lens and corneal endothelium. Thinned corneal stroma
maybe explained by in vitro experiments showing that corneal endothelial cells isolated from
Col8-/- mice have decreased proliferation but increased cell size. Whether or not vision was
impacted in these mice was not assessed.274
1.4.3.1 Type VIII Collagen in Diabetic Nephropathy
A number of studies have shown that type VIII collagen is involved in the progression of
diabetic nephropathy. Gerth et al demonstrated that in the normal kidney, expression of type VIII
collagen is quite low and localized only to blood vessels. In patients with diabetic nephropathy,
type VIII collagen is upregulated and localized to glomerular mesangial cells and
tubulointerstitium.275 In streptozotocin (STZ)-induced diabetic models, mice with a deficiency in
both Col8a1 and Col8a2 genes were protected against increased glomerular cellularity and tuft
area (due to mesangial cell expansion and increased type IV collagen and laminin),276 fibrosis
and ECM production.277 Deletion of type VIII collagen attenuated albuminuria.276, 277 Type VIII
collagen was required for interstitial myofibroblast accumulation and deletion resulted in
39
reduced expression of mesenchymal markers SMA and fibroblast specific protein-1 (FSP1) in
these cells, relative to diabetic wild type mice. Additionally, loss of type VIII collagen prevented
a reduction in epithelial markers including zonula occluding (ZO)-1 and E-cadherin in tubular
epithelial cells, suggesting a role of type VIII collagen in mediating the epithelial to
mesenchymal transition.277 High glucose and growth factors such as PDGF-BB, TGF-β1 and
bFGF are involved in the pathogenesis of diabetic nephropathy and these factors induced the
expression of Col8a1 in mesangial cells. Studies using Col8-/- mouse mesangial cells as well as a
mouse mesangial Col8a1 overexpression model revealed that type VIII collagen increased the
proliferation of these cells through activation of ERK1/2 (pp42/44) and suppression of p27Kip1
expression.276 In relation to this study, type VIII collagen has been shown to modulate the
effects of TGF-β1 on mesangial cells. TGF-β1 treatment reduces proliferation of high glucose-
treated mesangial cells278 through induction of p27Kip1.279 Loeffler et al showed that deletion of
type VIII collagen in TGF-β1 treated mouse mesangial cells results in increased proliferation,
cell cycle progression and decreased apoptosis. These effects were mediated through the MAPK
and PI3K/Akt pathways.280 This discrepancy in the effects of type VIII collagen on mesangial
cell proliferation and MAPK pathway activation are likely the result of the different treatments
applied. In experiments conducted by Hopfer et al, Col8-/- mouse mesangial cells were treated
with high glucose or PDGF-BB276, whereas Loeffler et al treated cells with TGF-β1.280 This
suggests that depending on the local environment, type VIII collagen mediates different
responses. The receptor by which type VIII collagen facilitates this is unknown however, DDR1
is a possible candidate given studies involving its role in mesangial cell proliferation and MAPK
pathway activation.182
40
1.4.3.2 Type VIII Collagen in the Expression and Organization of Fibrillar
Collagens
Type VIII collagen has been shown to associate with fibrillar collagens. For example,
Iruela-Arispe et al have shown that type VIII collagen co-localizes with type I collagen in
endothelial cells undergoing angiogenesis.281 Type VIII collagen promotes fibrosis in diabetic
nephropathy.276, 277 Recent studies suggest that type VIII collagen is involved in the expression
and organization of fibrillar collagens. Gray et al show that mutations in either the collagenous
domain or the NC1 domain of type VIII collagen in zebrafish results in disorganization of the
collagen-rich medial layer of the notochord extracellular sheath and in vertebral malformations.
Wild-type zebrafish had densely packed collagen fibers in an extracellular sheath that ran
parallel to the long axis of the fish. Type VIII collagen mutant fish had either interspersed
thinned regions of the extracellular sheath or conversely they were thickened. All mutants
contained highly disorganized collagen fibers, with some being densely packed and others
running non-parallel to the long axis. This study revealed that inhibition of LOX using β-
aminopropionitrile (BAPN) in the zebrafish phenocopied the effects of these mutations in type
VIII collagen.260 The study did not assess the structure of the notochord extracellular sheath in
BAPN-treated fish however, since LOX is required for collagen cross-linking,137 it is possible
that collagen fiber arrangement was disorganized in these animals.
Type VIII collagen has been show to influence fibrillar collagen expression and
organization in a model of heart failure induced by aortic banding (AB). 48 hours after AB,
expression of collagen types I and III were elevated in wild-type mice, but not in Col8-/- mice,
suggesting a role for type VIII collagen in modulating cardiac fibrosis. Collagen content was
reduced in the hearts of Col8-/- mice compared to wild-type mice at 6 weeks following AB. This
41
was accompanied by decreased expression and signalling of TGF-β in Col8-/- mice. In addition to
this, treatment of recombinant α1 (VIII) to soluble collagen increased soluble collagen fiber
formation as determined by TEM.282 These studies suggest that type VIII collagen mediates
fibrillar collagen expression, formation or both. To date, no studies have examined the role of
type VIII collagen in mediating fibrillar collagen formation in vascular disease. Studies
conducted in this thesis (see Appendix) will test the hypothesis that type VIII collagen affects the
expression and formation of fibrillar collagens in vascular SMCs.
1.4.4 Type VIII Collagen in Vascular Disease
Many studies have reported increased type VIII collagen expression in vascular disease.
Bendeck et al showed that type VIII collagen mRNA and protein was dramatically upregulated
after injury of the rat carotid artery. Expression peaked between 2 to 4 days after injury and this
coincided with the time course of SMC migration from the media to the intima.261 A similar
study conducted by Sibinga et al demonstrated up-regulation of type VIII collagen mRNA and
protein in the rat carotid balloon injury model. Expression of type VIII collagen was localized to
dedifferentiated SMCs within the vessel media and neointima. PDGF-BB treatment stimulated
type VIII collagen expression in cultured SMCs. This study demonstrated decreased adhesion of
SMCs on a type VIII collagen matrix relative to type I collagen,283 suggesting that type VIII
collagen facilitates SMC migration. Type VIII collagen is upregulated in aging and stiffening
arteries from primates. Studies from the Vatner group have demonstrated that aged male
monkeys have increased aortic stiffness and type VIII collagen expression compared to younger
male controls.284 In a recent related study, pulse wave velocity experiments revealed that type
VIII collagen was upregulated in stiff non-atherosclerotic human internal mammary arteries
42
compared to low-stiffness controls.285 Studies addressing type VIII collagen in plaque stiffness
will be presented in Chapter 3.
1.4.4.1 Type VIII Collagen in Smooth Muscle Cell Migration
Studies in our lab have shown that not only does treatment of SMCs with type VIII
reduce adhesion, but it acts as a chemotactic and haptotactic factor and regulates the expression
of MMP-2.252, 254, 286 In one study conducted by Adiguzel et al, type VIII collagen was shown to
modulate the growth and migration of SMCs.252 SMCs derived from Col8-/- mice displayed
increased adhesion, reduced migration and proliferation compared to cells from wild-type mice.
Addition of exogenous type VIII collagen to the Col8-/- cell cultures rescued the phenotype
resulting in decreased adhesion and increased migration and proliferation. Previous studies have
shown that the increase in expression of type VIII collagen in the injured carotid artery 261, 283
coincides with the increased expression of MMP-2 and -9.233 Adiguzel et al demonstrated via
gelatin zymography that conditioned media from Col8-/- SMCs had reduced activity of MMP-2
compared to wild-type SMCs.252 Taken together these studies suggest that SMC migration is
facilitated by a type VIII collagen dependent increase in MMP-2 activity.
Recent work in our lab has shed light on the mechanisms by which type VIII collagen
stimulates MMP-2 production and SMC migration.286 SMCs from Col8-/- mice display prominent
actin stress fibers, stable microtubules and numerous basal focal adhesions, indicative of a highly
adhesive phenotype. Addition of exogenous type VIII collagen reduced all of these features,
reduced adhesion, and promoted migration in these cells. Previous studies have shown that active
RhoA modulates changes in microtubule stability, stress fiber assembly and focal adhesion
formation287, 288 as well as MMP-2 expression.289 Adiguzel et al found that type VIII collagen
43
suppresses RhoA activity in a β1 integrin-dependent manner. Furthermore, inhibition of RhoA in
Col8-/- SMCs increased MMP-2 activity and partially rescued migration. This study presents a
novel mechanism as to how type VIII collagen regulates cytoskeletal configuration and MMP-2
expression to facilitate SMC migration. A summary can be found in Figure 1.1.
1.4.4.2 Type VIII Collagen in Atherosclerosis
We have recently reported that type VIII collagen expression is controlled by factors that
contribute to atherosclerosis. Cherepanova et al, showed that oxidized phospholipids stimulate
the expression of type VIII collagen by SMCs in vivo and in vitro.290 This was mediated by the
transcription factor KLF4, which is critical factor in the SMC phenotypic switch. Previous
studies have suggested that type VIII collagen plays roles in plaque development. Plenz et al
demonstrated an increase in type VIII collagen expression in plaques from rabbits supplemented
with a high cholesterol, atherogenic diet alone262, 291 or in combination with balloon catheter
injury.262 In the balloon catheter and atherogenic diet model, type VIII collagen was dramatically
upregulated and localized predominantly to SMCs in the vessel media, plaque shoulder and
fibrous cap region.262 Subsequent studies examining type VIII collagen expression in Apoe-/-
mice have shown by in situ hybridization that Col8a1 mRNA is localized to the fibrous cap
region, and that cultured SMCs isolated from plaque tissue express Col8a1 mRNA.263, 264
Although these studies demonstrate an association of type VIII collagen with SMCs in the
atherosclerotic plaque, the functional implications of this have not yet been determined. Work
presented in our lab has shown that type VIII collagen mediates migration of SMCs252, 254, 286
(see section 1.4.4.1), however this was not examined in the context of atherosclerosis. I
hypothesize that type VIII collagen functions to increase atherosclerotic plaque stability.
44
Using the Apoe-/- mouse model of atherosclerosis, studies in Chapter 2 will test if deletion
of type VIII collagen reduces SMC proliferation and migration in vessel-wall injured arteries and
fibrous cap formation in atherosclerosis. Studies in advanced human plaques have shown that
type VIII collagen is distributed in sites important in plaque stability such as the shoulder region,
fibrous cap and necrotic core.266, 292, 293 These studies did not however determine whether
expression of type VIII collagen in advanced plaques was associated with plaque rupture or
features linked to plaque rupture. Additionally, no animal studies to date have examined whether
type VIII collagen effects plaque stability in complicated plaques. Studies conducted in Chapter
3 will examine whether deletion of type VIII collagen results in complicated advanced
atherosclerotic plaques that are histologically and mechanically unstable and are therefore prone
to rupture.
Lastly, studies using in situ hybridization and immunohistochemistry have shown that
type VIII collagen not only co-localizes with monocytes/macrophages but is expressed by these
cells.266, 292, 293 Interestingly, type VIII collagen was shown to be expressed by macrophages in
culture, and treatment with lipopolysaccharide (LPS) or IFNγ results in decreased expression of
type VIII collagen.266 The functional significance of this expression in the in vivo progression of
atherosclerosis has yet to be determined. In Chapter 4, bone marrow transplantation studies will
be used to test the hypothesis that deletion of type VIII collagen in myeloid cells results in
decreased SMC and matrix accumulation in atherosclerotic plaques.
1.5 Hypothesis and Objectives
Previous studies have shown that type VIII collagen is upregulated in cardiovascular
disease, expressed by SMCs and macrophages, and they have investigated the functions of type
45
VIII collagen using in vitro models of SMC migration and proliferation. These studies suggest
that type VIII collagen acts as a provisional pro-migratory matrix molecule, and that the protein
is present in the fibrous cap of the atherosclerotic plaque. However the functions of type VIII
collagen in mediating cellular responses during atherosclerosis are not known. The purpose of
the studies described in this thesis was to investigate the role of type VIII collagen during the
formation of early and advanced atherosclerotic plaques. I have tested the following hypotheses:
Hypothesis 1: Deletion of type VIII collagen decreased SMC proliferation, migration, and
collagen deposition in injured arteries and in early atherosclerotic plaque formation.
Hypothesis 2: Deletion of type VIII collagen will result in the formation of mechanically
unstable atherosclerotic plaques with thin fibrous caps.
Hypothesis 3: Deletion of type VIII collagen in bone marrow derived cells results in decreased
SMC and matrix accumulation in atherosclerotic plaques.
These studies will provide insight as to how type VIII collagen affects atherosclerotic
plaque progression and stability. Analysis of cellular content, matrix content and remodelling, as
well as plaque morphology will be made. This work hopes to address a link between type VIII
collagen, fibrous cap formation and atherosclerotic plaque instability.
46
1.6 Figures
47
Figure 1.1 Type VIII collagen signalling promotes vascular SMC infiltration.
A simplified version of the role of type VIII collagen in promoting SMC migration is shown
above. Type VIII collagen signals through β1 integrin to repress RhoA which in turn increases
MMP-2 expression. This results in increased matrix degradation which promotes SMC
migration. In addition to this, suppression of RhoA reduces actin stress fiber formation,
microtubule stabilization and focal adhesion formation resulting in decreased SMC adhesion and
increased migration and contraction.
48
Chapter 2: Type VIII collagen promotes SMC migration and fibrous cap formation
Sections of this chapter have been reproduced from The American Journal of Pathology (Lopes
et al).294 with permission from the publisher. Figure and table 2.1 was conducted by E. Adiguzel
while figures 2.2 and 2.3 were conducted by the lab of Dr. R. Assoian.
49
2.1 Introduction
Expression of type VIII collagen is increased upon vascular injury or atherosclerotic
plaque development in a number of experimental animal models and humans.261-263, 265, 266, 283, 291
It is expressed by endothelial cells, SMCs and macrophages which all contribute to the biology
of plaque progression.263, 264, 266, 295 In vitro studies in our lab have shown that in SMCs it acts as
a chemotactic and haptotactic factor and facilitates proliferation, migration, collagen remodelling
as well as increased MMP-2 expression.252, 254, 286 In addition to this, cells from Col8-/- mice have
increased adhesion and reduced migration and MMP-2 expression on a type I collagen matrix
compared to cells from Col8-/- mice, and addition of exogenous type VIII collagen is able to
rescue adhesion, migration, proliferation and MMP-2 expression.252, 286 Type VIII collagen was
shown to facilitate many of these processes through binding and signalling via β1 integrin which
reduces RhoA activity and increases MMP-2 expression and activity.254, 286 These studies suggest
that type VIII collagen functions as a provisional matrix that facilitates the invasion of SMCs
during vascular injury. The functional consequences of this in vessel wall injury and the in vivo
progression of atherosclerosis have yet to be determined.
ApoE is a glycoprotein ribbon that facilitates the clearance of cholesterol ester rich
particles from the bloodstream,82 and promotes cholesterol efflux from macrophages.296 It has
also been shown to have a number of direct effects on SMCs such as reduction of SMC
proliferation via up-regulation of NO297 and prostacyclin298 Additionally, mice deficient in ApoE
have increased expression of Col8a1 relative to wild type,299 however whether ApoE directly
effects type VIII collagen expression has yet to be determined.
We hypothesize that type VIII collagen increases SMC proliferation, migration, and
collagen deposition in injured arteries and in early atherosclerotic plaque formation. Studies in
50
this Chapter show vessel wall thickening and outward remodeling of vessel diameter are reduced
after wire injury of the femoral artery in type VIII collagen knockout mice. A direct effect of
ApoE in suppression of type VIII collagen gene expression by SMCs is shown and consequently,
type VIII collagen gene expression is substantially increased in the Apoe-/- mouse. Deletion of
type VIII collagen in the Apoe-/- mouse results in impaired SMC proliferation and migration and
decreased type I collagen accumulation which results in thinning of the fibrous cap. These
studies point to an important role for type VIII collagen in mediating fibrous cap formation,
which stabilizes atheromas.
2.2 Materials and Methods
All products were purchased from Sigma-Aldrich, unless specified otherwise.
2.2.1 Femoral artery injury in Col8+/+ and Col8-/- mice
Mice with targeted deletion of both the Col8a1 and Col8a2 genes (Col8-/- mice)
backcrossed more than 10 generations in the C57BL/6 strain were generated in the laboratory of
Dr. Bjorn Olsen (Harvard Medical School), as previously described,274 and were provided for
these experiments. Animal experiments were approved by the local animal care committee at the
University of Toronto in accordance with the Guide for the Care and Use of Laboratory Animals
(NIH Publ No. 85-23, revised 1996). The University of Toronto is compliant with the NIH guide
(A5013-01). Before surgery, male mice were injected subcutaneously with 0.1 mg/kg
buprenorphine, then anesthetized via inhalation of 1.5% to 2% isofluorane in oxygen, 1.5 L/min.
Anesthesia was monitored by observation of breathing rate and pinching between the toes on the
paw. Wire injury of the femoral artery was performed by introducing a 0.38-mm diameter
51
straight spring wire into a small branch artery of the femoral artery and advancing it through the
femoral artery >5 mm toward the iliac artery. The wire was left in place for 1 minute to denude
the endothelium and dilate the artery.300 Mice were sacrificed at either 7 or 21 days after injury
via intraperitoneal injection of ketamine, 333 mg/kg body weight (Ayerst Veterinary
Laboratories; Guelph, ON, Canada), and xylazine, 67 mg/kg body weight (Bayer, Inc., Toronto,
ON, Canada). The entire circulatory system was perfused at constant physiologic pressure via a
catheter placed in the left ventricle, first with 0.9% saline solution (Baxter Corp., Mississauga,
ON, Canada) and then with 4% paraformaldehyde for 10 minutes. The femoral artery, extending
from the iliac artery to the ligated small branch artery, was removed, placed in 4%
paraformaldehyde for 2 hours, then transferred to phosphate buffered saline (PBS). The vessels
were bisected, then paraffin embedded. Cross-sections (4 µm) were cut from each bisected half
to obtain an accurate representation of injury along the length of the femoral artery, and analysis
was performed on cross-sections from the middle of the femoral arteries. Tissue processing was
performed by the Centre for Modeling Human Disease Pathology Core, the Toronto Centre for
Phenogenomics (Toronto, ON, Canada). With use of digital imaging (Simple PCI software
version 5.3; Compix, Inc., Mars PA), cross-sectional areas of the neointima and media and vessel
wall cell numbers and vessel diameters were measured in sections obtained at 21 days after
injury. Sections from uninjured femoral arteries served as controls. Cell proliferation was
detected by immunostaining for Ki67, and apoptosis by terminal deoxynucleotidyl transferase
dUTP nick end labelling (TUNEL) in sections obtained at 7 days after injury. Values from Col8-
/- mice were compared with those from Col8+/+ control mice.
Ki67 is a nuclear antigen associated with proliferation and is present during the cell cycle
but absent during the resting G0 phase. Sections were stained with a 1:200 dilution of rabbit anti-
52
Ki67 antibody (No. RM-9106-S; Lab Vision Corp., Fremont, CA), then with biotin-conjugated
goat anti-rabbit IgG secondary antibody (No. BA-1000; Vector Laboratories, Inc., Burlingame,
CA), and were visualized with 3,3’-diaminobenzidine and counterstained with hematoxylin. The
percentage of Ki67-labeled nuclei was measured in the medial layer of the vessel using an
Eclipse E600 microscope (Nikon Corp., Tokyo, Japan), a camera (Hamamatsu Photonics KK,
Hamamatsu City, Japan), and Simple PCI software (Compix).
A TUNEL assay was performed to measure the percentage of apoptotic cells, using a kit
from Millipore (Canada), Ltd. (Etobicoke, ON, Canada). Tissues were deparaffinized in a series
of xylene washes and rehydrated in ethanol. The tissue was digested with 0.02 mg/mL proteinase
K to inactivate nucleases. The slides were then pretreated with an equilibration buffer for 15
minutes, followed by incubation for 1 hour at 37°C in the terminal deoxynucleotidyl transferase
enzyme reaction mixture. Sections were treated with stop/wash buffer for 25 minutes, incubated
with a fluorescein-tagged anti-digoxigenin antibody for 30 minutes, and counterstained with 0.5
mg/mL propidium iodide. The percentage of TUNEL-positive cells in the medium was
determined using an Eclipse E600 microscope, DS-Fi1 camera, and NIS-Elements software (all
from Nikon).
2.2.2 mRNA isolation from male C57BL/6 or Apoe-/- mouse aortas
Aortas were isolated from 24-week-old male C57BL/6 or Apoe-/- mice. Aortas were
dissected, and extraneous tissue from the adventitial side was carefully removed. Aortas were
divided into arch (ascending) and thoracic (descending) regions and stabilized by submerging the
tissues in RNAlater (Qiagen GmbH, Hilden, Germany). Before isolating the total RNA, the
aortas were weighed, and approximately 10 mg aortic tissue was manually homogenized and
53
treated with 10 mg/mL proteinase K (Qiagen) at 55°C for 10 minutes. The homogenate was
clarified via centrifugation, and total RNA was isolated from the supernatant using RNeasy mini
columns (Qiagen).
2.2.3 Cell culture and lipoprotein treatment
Primary murine aortic SMCs were isolated from C57BL/6 mice and used between
passages 2 and 5. The SMCs were grown to 80% to 90% confluence and were serum-starved via
incubation in Dulbecco’s Minimum essential’s medium containing 1 mg/mL heat-inactivated
fatty acid-free bovine serum albumin for 48 hours. The quiescent cells were stimulated with 10%
fetal bovine serum in the absence or presence of 2 µmol/L recombinant apolipoprotein or 50
µg/mL lipoprotein (generous gift of Drs. Michael C. Phillips and Sissel Lund-Katz, Children’s
Hospital of Philadelphia) for 24 hours. Total RNA was isolated from cells lysed in Trizol reagent
(Invitrogen Corp., Carlsbad, CA) and analyzed using real-time quantitative RT-PCR (RT-qPCR),
as outlined in the following section.
2.2.4 Real-time RT-qPCR
Real-time RT-qPCR was performed as described,301 using 50 to 100 ng for reverse
transcription of total RNA isolated from cultured SMCs or aortas. A 10% aliquot of cDNA was
prepared using SYBR Green QPCR Master Mix (Applied Biosystems, Inc., Foster City, CA) to
qPCR with 900 nmol/L of the primer-probe sets mCOL8A1 (forward, 5’-
AGAGTGCACCCAGCCCCAGT-3’; reverse, 5’-TGGGTGGCACAGCCATCACATTT-
3’) and mCOL8A2 (forward, 5’-CCTGCAGGCTCTGCCTGTCC-3’; reverse, 5’-
CACTCTTGGCCCACACCCCA-3’). RT-qPCR results were calculated using 18S rRNA as the
54
reference for mRNAs. To detect mouse 18S rRNA, we used TaqMan Universal PCR Master Mix
(Applied Biosystems) with forward primer 5’-CCTGGTTGATCCTGCCAGTAG-3’, reverse
primer 5’-CCGTGCGTACTTAGACATGCA-3’, and probe 5’-
VICTGCTTGTCTCAAAGATTA-MGB-NFQ-3’. Each sample was analyzed in duplicate PCR
reactions, and mRNA expression was quantified against a standard curve using ABI PRISM
7000 SDS software (Applied Biosystems).Mean quantities and SD were calculated from
duplicate PCR reactions.
2.2.5 Generation of Col8-/-;Apoe-/- mice
Col8-/- mice were bred with Apoe-/- mice (both on C57BL/6 background) to generate mice
that were Col8-/-Apoe-/-. These were compared with either littermate control Col8+/+;
Apoe-/- mice or Apoe-/- mice (purchased from The Jackson Laboratory, Bar Harbor, ME).
Genomic DNA was extracted from ear clips, and genotyping was performed via PCR
amplification using the following primers: Col8a1 wild type: sense, 5’-
CGGGAGTAGGAAAACCAGGAGTGA-3’, and antisense, 5’-
GGCCCAAGAACCCCAGGAACA-3’; Col8a1 knockout: sense, 5’-
GTGGGGGTGGGGTGGGATTAGATA-3’, and antisense, 5’-
CTCGGCCCAAGAACCCCAGGAAC-3’; Col8a2 wild type: sense, 5’-
CCGGTAAAGTATGTGCAGC-3’, and antisense, 5’-CAAGTCCATTGGCAGCATC-
3’; Col8a2 knockout: sense, 5’-CAGCGCATCGCCTTCTATCGC-3’, and antisense identical to
wild-type Col8a2; Apoe wild type: sense, 5’-GCCTAGCCGAGGGAGAGCCG-3’, and
antisense, 5’-TGTGACTTGGGAGCTCTGCAGC-3’; Apoe knockout: sense, same as wild type,
and antisense, 5’-GCCGCCCCGACTGCATCT-3’. Beginning at age 8 to 12 weeks, male and
55
female mice of both genotypes were fed an atherogenic diet containing 40% kcal fat and 1.25%
cholesterol by weight (D12108; Research Diets, Inc., New Brunswick, NJ) for 6 or 12 weeks. On
the day when sacrificed, mice were euthanized via CO2 asphyxiation. The left ventricle was
cannulated, and animals were perfused at physiologic pressure (100mmHg), first with sterile
saline solution and then with 4% paraformaldehyde for 5 to 10 minutes. The aortic arch and
descending aorta to the iliac bifurcation were isolated, cleared of fat and surrounding tissues, and
used as described below to measure oil-red-o staining, immunohistochemistry, matrix staining
and plaque architecture, and in situ zymography. For analyses that required fresh-frozen tissues,
mice were perfused with sterile saline solution, and arterial tissues were immediately dissected in
PBS, embedded in OCT, and snap frozen in liquid nitrogen.
2.2.6 Mean arterial pressure
Mean arterial pressure was measured after 6 and 12 weeks of the atherogenic diet via
catheterization of the right common carotid artery using a 1.4F blood pressure probe (Millar
Instruments, Inc., Houston, TX). Mice were anesthetized using 3% isofluorane, the carotid artery
was catheterized, and blood pressure was allowed to stabilize for 3 minutes with 1% isofluorane.
Measurement of blood pressure was performed for 1 minute, and mean arterial pressure was
calculated using the following formula: Mean arterial pressure = 2/3 Diastolic
blood pressure + 1/3 Pulse pressure.
2.2.7 Plasma lipid analysis
Whole blood samples were collected at sacrifice via right ventricle puncture and placed
in heparinized 1.5-mL tubes. Blood samples were spun at 14,800 x g for 5 minutes at 4°C and
56
were stored at 4°C for a maximum of 2 days before analysis. Plasma samples were analyzed
using a multiplate spectrophotometer (Microskan; Titertek Instruments, Inc., Huntsville, AL) at
492 nm using enzymatic assays (Synchron; Beckman Coulter, Inc., Brea, CA) for triglycerides
(kit No. 445850) and total cholesterol (kit No. 467825).
2.2.8 Oil Red O staining
Atherosclerotic plaque burden in the descending aorta (downstream of the left subclavian
artery to the iliac bifurcation) was determined via Oil Red O staining. Aortas were incised
longitudinally, pinned en face to black silicone plates using 0.1-mm minuten pins, rinsed with
isopropanol, and stained with 18 mg/mL Oil Red O for 30 minutes at room temperature on a
shaker. Stained aortas were washed three or four times in 70% isopropanol and imaged using
a CoolPix digital camera (Nikon). The percentage of Oil Red O-positive plaque per total aortic
surface area was quantified using digital image analysis (NIS-Elements Basic Research; Nikon).
2.2.9 Immunohistochemistry, matrix staining, and plaque architecture
Paraformaldehyde-fixed, paraffin-embedded longitudinal sections of the mouse aortic
arch including the brachiocephalic and left carotid artery branchpoints were deparaffinised in
xylenes, rehydrated in an ethanol series, and blocked using 0.3% H2O2 in cold methanol,
followed by a 1% bovine serum albumin blocking solution (kit No. D12287; Invitrogen).
Primary antibodies directed against mouse SMA raised in goat (1:500) (A2547; Sigma; St.
Louis, MO), mouse Mac-2 raised in rat (1:100) (CL8942AP; Cedarlane Laboratories USA, Inc.,
Burlington, NC), or type I collagen raised in rabbit (1:200) (ab21286; Abcam plc, Cambridge,
MA) were used to stain for SMCs, macrophages, and type I collagen, respectively. Negative
57
controls included sections incubated without primary antibody. Slides were then incubated with
species-specific biotinylated secondary antibodies including anti-goat (1:4000) (B2763;
Invitrogen), anti-rat (1:200) (E0468; DakoCytomation Inc., Carpinteria, CA), and anti-rabbit
(1:1000) (B2770; Invitrogen), followed by incubation in streptavidin-horseradish peroxidase-
conjugated solution following the manufacturer’s instructions (kit No. D12287; Invitrogen).
Sections were then incubated in 3,3’-diaminobenzidine (kit No. D12287; Invitrogen), a
chromogenic substrate, followed by counterstaining with hematoxylin.
To analyze plaque area, serial sections were stained using Picrosirius Red (PSR) for
collagen and either Verhoeff-Van Gieson stain or Movat’s pentachrome stain for elastin.
Analysis of birefringent fibrillar collagen content was performed using polarized light
microscopy (PolScope; AbrioIM Imaging System; Cambridge Research and Instrumentation,
Inc., Woburn, MA). Whole plaques located on the lesser curvature of the arch and in the
brachiocephalic and left carotid artery branchpoints were measured. Plaque area was defined as
the region extending from the internal elastic lamina to the luminal edge of the plaque.
Thresholding of maximum and minimum color intensity was conducted using NIS-Elements
Basic Research software (Nikon), with positively stained regions expressed as a percentage of
plaque area. Fibrous cap thickness and necrotic core area were assessed using PSR-stained
longitudinal sections of lesser curvature plaques. Relative fibrous cap thickness was calculated
by dividing fibrous cap thickness by the maximum height of the plaque (from the internal elastic
lamina to the luminal edge). Necrotic core area was measured as a percentage of total plaque
area. The percentage of area stained positive for SMCs and collagen was assessed independently
in the plaque fibrous cap. Ki67 and TUNEL assays were performed as described (see 2.2.1
Femoral Artery Injury in Col8+/+ and Col8-/- Mice). PSR and Movat’s pentachrome-stained
58
plaque sections from the lesser curvature were ranked according to criteria established by
Virmani et al.302 The percentage of samples with plaques in each of the five categories (no
plaques, intimal xanthoma, pathologic intimal thickening, fibrous cap atheroma, and thin fibrous
cap atheroma) was plotted for Col8+/+;Apoe-/- and Col8-/-;Apoe-/- mice.
2.2.10 Fluorescence in situ zymography
In situ examination of gelatinase activity was performed using fluorescence-quenched
gelatin (DQ-Gelatin, No. D12054; Invitrogen). Gelatinase-catalyzed hydrolysis of the molecule
relieves the quenching, and the magnitude of the resultant fluorescence is proportional to the
extent of proteolytic digestion. Longitudinal cryosections (8 µm long) of mouse aortic arch were
washed in ISZ incubation buffer [50 mmol/L Tris-HCl (pH 7.8), 150 mmol/L NaCl, 5 mmol/L
CaCl2, and 0.2 mmol/L NaN3] and incubated overnight at 4°C in incubation buffer. The sections
were then counterstained for 10 minutes with Hoechst 33258 diluted 1:10,000 in incubation
buffer. A prewarmed solution of incubation buffer containing 0.1% agarose and 0.1 mg/mL
fluorescence-quenched gelatin was applied to the sections, which were then coverslipped and
incubated for 30 minutes at 37°C. Images of the lesser curvature plaque were acquired using an
E600 Epifluorescence Microscope using a filter set with excitation of 465 to 495 nm and
emission of 515 to 555 nm, and a DS-Fi1 camera with NIS-Elements software (all from Nikon),
with exposure time set to 2 seconds and gain set to 9.60. All sections were imaged under the
same conditions. Samples were ranked for gelatinase activity on a scale of 1 to 4.
2.2.11 Statistical analysis
All animal experiments were performed with the experimenter blinded to the genotype of
the mice. Data were analyzed using Student’s t-test (comparing two groups) or analysis of
59
variance (comparing multiple groups). After analysis of variance, Student-Newman-Keuls post
hoc tests were used to determine statistically significant differences between groups, with a
significance level of P ≤ 0.05. For data that did not fit a normal distribution and ranked data, the
nonparametric U-test was used to compare the means between two groups.
2.3 Results
2.3.1 Vessel wall thickening and outward remodeling is reduced in
Col8-/- mice after femoral artery injury
In previous studies, we and others have shown that type VIII collagen expression was up-
regulated after endothelial denuding injury261, 262, 283; however, these studies merely described a
correlation and did not address the functions of type VIII collagen in the injured vessel. To
investigate, we used a wire to denude the endothelium in the femoral arteries of Col8+/+ and
Col8-/- mice. In the absence of injury, there were no differences in medial SMC number, medial
area, or vessel diameter between Col8+/+ and Col8-/- mice (Table 2.1). The response to arterial
injury involves thickening of both intimal and medial layers and outward remodeling of vessel
diameter.300, 303 The response to injury in the Col8+/+ mice included thickening of the medial and
intimal layers and outward remodeling of arterial diameter. In contrast, these responses were
attenuated after injury of the femoral arteries from Col8-/- mice. Cross-sections of femoral
arteries obtained at 21 days after injury (Figure 2.1, A and B) showed a pronounced reduction in
vessel thickening and smaller vessel diameter in Col8-/- mice compared with Col8+/+ mice. Cell
numbers in the medial and intimal layers were reduced in Col8-/- mice compared with Col8+/+
mice (Figure 2.1C), as were cross-sectional area of the vessel wall (Figure 2.1D) and vessel
60
diameter (Figure 2.1E). The decreased vessel diameter is indicative of attenuated outward
remodeling of the vessel in Col8-/- mice.
The reductions in cell numbers in media and intima and the reduction in total vessel wall
area in Col8-/- mice could be the result of either decreased cell migration or proliferation, or the
result of increased apoptosis. We assessed SMC proliferation by immunostaining for Ki67
(Figure 2.1, H and I) and found that proliferation was increased in Col8-/- mice compared with
Col8+/+ mice (Figure 2.1F). TUNEL labeling revealed a trend toward increased apoptosis in the
Col8-/- mice (Figure 2.1G). Ki67- and TUNEL-labeled cells were distributed throughout the
media of the injured arteries. Considered together, the data suggest that reduced vessel wall
thickening in the Col8-/- mice was not due to a reduction in SMC proliferation but to a
combination of increased SMC apoptosis and decreased SMC migration to the intimal layer.
2.3.2 Type VIII collagen is up-regulated in Apoe-/- mice
The femoral injury model lacks many of the complications of atherosclerosis as there is
little inflammation and no lipid infiltration in the vessel wall. To investigate type VIII collagen in
a more complex model of vascular disease, we used the Apoe-/- mouse model of atherosclerosis.
First we used RT-qPCR to measure mRNA for the α1 and α2 chains of type VIII collagen in
isolated aortic arches and thoracic aortas from C57Bl/6 wild-type and Apoe-/- mice. This revealed
a five-fold increase in Col8a1 mRNA in Apoe-/- mice at age 24 weeks (Figure 2.2A). In contrast,
levels of mRNA for the Col8a2 chain were much lower and did not differ between wild-type and
Apoe-/- mice (Figure 2.2A). Moreover, we found that Col8a1 mRNA was elevated as early as age
8 weeks in the Apoe-/- mice (Figure 2.3A). To determine whether the changes in type VIII
collagen gene expression were the result of a direct effect of ApoE, primary mouse SMCs in
61
culture were treated with ApoE3, HDL, apolipoprotein A1 (ApoA1), or LDL. ApoE3 or HDL
suppressed Col8a1 mRNA, whereas ApoA1 or LDL (used as controls) had no effect (Figure
2.2B). In contrast, treatment with ApoE3 did not affect expression of mRNA for the Col8a2
chain, which was expressed at much lower levels than Col8a1 (Figure 2.3B).
2.3.3 Plaque size and burden of atherosclerosis is similar in Col8 -/-
;Apoe-/- and Col8+/+;Apoe-/- mice
To study the role of type VIII collagen in atherosclerotic plaque progression, we crossed
Col8+/+ and Col8-/- mice with Apoe-/- mice to generate mice that were either Col8+/+;Apoe-/- or
Col8-/-;Apoe-/-. To accelerate progression of atherosclerosis, all mice were fed an atherogenic
diet, starting at age 8 to 12 weeks and continuing for another 6 or 12 weeks. Body weight, heart
rate, mean arterial pressure, and plasma triglyceride concentrations do not differ between
genotypes (Table 2.2). There was a transient increase in plasma cholesterol concentration in the
Col8-/-;Apoe-/- mice compared with the Col8+/+;Apoe-/- mice at 6 weeks of the atherogenic diet;
however, this difference was resolved by 12 weeks (Table 2.2). Atherosclerotic plaque area was
measured on longitudinal sections taken from the lesser curvature of the aortic arch and at the
branch points of the brachiocephalic and left carotid arteries. Representative sections of aortic
arch plaques at 6 and 12 weeks are shown in Figure 2.4, A and B. At neither time point were
there differences in plaque area in the aortic arch (Figure 2.4C), brachiocephalic artery (Figure
2.4D), or left carotid artery (Figure 2.4E) between Col8+/+;Apoe-/- and Col8-/-;Apoe-/- mice. Total
plaque burden was measured along the length of the descending aorta by staining with Oil Red O
and imaging the aortas en face, then calculating the percentage of aortic surface area covered by
62
plaque. Plaque burden did not differ between genotypes at either time point measured (Figure
2.4F).
2.3.4 SMC accumulation is reduced in plaques from Col8-/-;Apoe-/-
mice
SMCs and macrophages are the main cell types present in the plaques of Apoe-/- mice,
and previous in vitro studies have demonstrated that both cell types are able to produce and
respond to type VIII collagen.304 To determine whether SMC or macrophage accumulation
within the plaques was affected by deletion of type VIII collagen, sections were immunostained
using antibodies against SMA and Mac-2. Representative 12-week plaque sections are shown in
Figure 2.5, A and B. Accumulation of SMCs was reduced in Col8-/-;Apoe-/- mice compared with
Col8+/+;Apoe-/- mice after ingestion of an atherogenic diet for 6 or 12 weeks (Figure 2.5C). In
contrast, accumulation of macrophages did not differ between genotypes at either time point
(Figure 2.5D). Most of the foam cells in the plaque stained positive for Mac-2, which suggests
that these cells were derived from plaque macrophages. We performed Ki67 and TUNEL
labeling to measure cell proliferation and apoptosis, respectively. At 6 weeks, there was a
decrease in cell proliferation in plaques from the Col8-/-;Apoe-/- mice; however, by 12 weeks,
there was no difference between genotypes (Figure 2.5E). In contrast, there were no genotype-
dependent differences in apoptosis at either time point (Figure 2.5F). This suggests that
decreased SMC accumulation in the plaques of Col8-/-;Apoe-/- mice was due to decreased
proliferation and migration, not to increased apoptosis.
63
2.3.5 Collagen and elastin accumulation are reduced in Col8-/-;Apoe-/-
mice
Extracellular matrix composition was assessed by staining sections of aortic arch with
PSR, which binds to collagen, or Verhoeff-Van Gieson stain, which stains elastin fibers black.
Representative 12-week plaque sections stained with PSR or Verhoeff-Van Gieson stain are
shown in Figure 2.6, A and B, respectively. Total collagen content was reduced in plaques from
Col8-/-;Apoe-/- mice compared with Col8+/+;Apoe-/- mice at both 6 and 12 weeks (Figure 2.6C).
Analysis of fibrillar collagen content and organization in the lesions was performed by
measuring collagen fiber birefringence using the PolScope. There was a decrease in fibrillar
collagen in plaques from Col8-/-;Apoe-/- mice at both time points (Figure 2.6D). Images from the
PolScope show this reduction in organized fibrillar collagen in the 12-week plaques from Col8-/-
;Apoe-/- mice (Figure 2.7, A and B). Immunostaining revealed a reduction in type I collagen in
plaques from Col8-/-;Apoe-/- mice (Figure 2.7, C-E). Elastin content was reduced in plaques from
Col8-/-;Apoe-/- mice compared with Col8+/+;Apoe-/- mice at 6 weeks; however, by 12 weeks, there
was no difference between the genotypes (Figure 2.6E).
2.3.6 Plaques from Col8-/-;Apoe-/- mice exhibit thin fibrous caps and
increased necrotic core size
The decreases in matrix and SMC accumulation in the Col8-/-;Apoe-/- mice gave the
appearance of thinner fibrous caps, and indeed we showed that relative fibrous cap thickness was
decreased in Col8-/-;Apoe-/- mice compared with Col8+/+;Apoe-/- mice at 12 weeks (Figure 2.6F).
Conversely, the percentage of plaque occupied by necrotic core was increased in plaques from
Col8-/-;Apoe-/- mice (Figure 2.6G). SMC content in the fibrous cap was decreased from (means ±
64
SD) 27.2% ± 3.1% in Col8+/+;Apoe-/- mice to 14.2% ± 3.4% in Col8-/-;Apoe-/- mice (P ≤ 0.05).
Collagen content of the fibrous cap was decreased from 39.5% ± 5.7% in Col8+/+;
Apoe-/- mice to 23.4% ± 4.0% in Col8-/-;Apoe-/- mice (P ≤ 0.05). There were no changes in
macrophage content in the fibrous cap (data not shown). Considered together, these data indicate
that SMC infiltration to form the fibrous cap was decreased, as was the amount of matrix
deposited in the cap.
We classified plaque pathologic findings according to a scale developed by Virmani et
al.302 In the Col8-/-;Apoe-/- mice, there were greater percentages of plaques with features of
intimal xanthomas (38%), pathologic intimal thickening (12%), and thinned fibrous caps (19%)
than in the Col8+/+;Apoe-/- mice (20%, 7%, and 13%, respectively) (Figure 2.6H). Conversely,
the percentage of plaques with thick fibrous caps was greater in the Col8+/+;Apoe-/- mice (47%)
than in the Col8-/-;Apoe-/- mice (12%). These data suggest that plaques in Col8-/-;Apoe-/- mice
might be vulnerable to rupture.
2.3.7 Gelatinase activity is decreased in plaques from Col8-/-;Apoe-/-
mice
In atherosclerotic plaque, both SMCs and macrophages produce proteinases that facilitate
cell migration but may also thin the fibrous cap by degrading matrix.305 In the Col8-/-;Apoe-/-
mice, SMC accumulation was attenuated in the absence of a change in macrophage content.
Therefore, development of plaques with thin fibrous caps could be due to reduced SMC
migration and proliferation to populate the cap and synthesize matrix, or to increased degradation
of matrix in the cap by the relatively abundant macrophages. To differentiate these possibilities,
we assessed plaque gelatinase activity using in situ zymography. Frozen sections were overlaid
65
with fluorescence-quenched gelatin substrate, which exhibits bright green fluorescence when
cleaved. Gelatinase activity was prominent in the fibrous cap of plaques from Col8+/+;Apoe-/-
mice (Figure 2.8A). In contrast, gelatinase activity in the fibrous cap was markedly reduced in
plaques from Col8-/-;Apoe-/- mice (Figure 2.8B). We quantified this by ranking plaques on a scale
of 1 to 4 (with 4 indicative of the highest fluorescence) and found that activity was substantially
reduced in plaques from Col8-/-;Apoe-/- mice (Figure 2.8C). This shows that gelatinase activity is
decreased in the plaques from Col8-/-;Apoe-/- mice despite the relative abundance of
macrophages. Furthermore, since the decrease in gelatinase activity parallels the decrease in
SMCs, it suggests that type VIII collagen stimulated gelatinases are important for SMC
migration to the fibrous cap.
2.4 Discussion
This study illustrates that type VIII collagen plays an important role in mediating
atherosclerotic plaque stability through the formation of the fibrous cap. Herein we show that,
type VIII collagen functions to modulate SMC migration, survival and proliferation and type I
collagen deposition. This work suggests that type VIII collagen acts as an endogenous means of
preventing plaque rupture.
Type VIII collagen has been shown to be expressed in neointimal cells undergoing
migration and within the first layer of the media in a number of animal models of endothelial
denudation283, 306. Wire-injury of the femoral artery of mice deficient in type VIII collagen
resulted in decreased vessel wall thickening, cell number, and vessel diameter compared to
Col8+/+ mice. Further experiments revealed that both SMC proliferation and apoptosis were
increased in Col8-/- mice. This data suggests that type VIII collagen contributes to vessel
66
thickening by protecting SMCs from apoptosis and stimulating their migration. Col8-/- mice have
less increase in vessel diameter as compared to wild-type. This suggests that type VIII collagen
also plays a significant role in promoting vessel outward remodelling.
These studies are the first to demonstrate the potential of ApoE to regulate type VIII
collagen expression. SMCs treated with either recombinant ApoE or ApoE-containing
lipoproteins such as HDL decrease Col8a1 mRNA expression relative to controls. Additionally,
in Apoe-/- mice, type VIII collagen expression is dramatically increased relative to wild-type.
Other studies have shown that components of lipoprotein particles such as oxLDL can regulate
type VIII collagen expression.290 The mechanism by which ApoE regulates type VIII collagen is
still unknown, however previous studies have shown that it modulates the function of the
prostacyclin and cyclooxygenase-2 pathway in vascular SMCs.298, 307 Given the effect of
recombinant ApoE on type VIII collagen expression, it is important to note that these effects are
likely independent of its role as a cholesterol-transporter. Many studies have shown that ApoE
has a number of cholesterol independent effects297 including protection against atherosclerotic
plaque development.308
In the Apoe-/- mouse, deletion of type VIII collagen resulted in decreased SMC
accumulation, fibrillar type I collagen content and subsequently, a thinned fibrous cap. Size of
the plaque necrotic core was also markedly increased relative to control Col8+/+;Apoe-/- mice.
This is likely due to fact that macrophage content was unchanged between genotypes, despite a
similar plaque size. Therefore, plaques from Col8-/-;Apoe-/- mice, had proportionately more foam
cells, macrophages and necrotic debris relative to controls. Many of the features listed are
associated with plaques that are likely to rupture and trigger a clinical event.18, 200 Further
67
assessment of the role of type VIII collagen in promoting plaque stability in more advanced
plaques will be presented in Chapter 3.
Deletion of type VIII collagen resulted in decreased intimal SMC content in both the
femoral artery wire-injury model and Apoe-/- mouse model of atherosclerosis. Previous studies in
our lab have shown that type VIII collagen functions as a provisional matrix and facilitates the
migration of SMCs in part through the stimulation of MMP-2 expression and activity (see
section 1.4.4).252, 254, 286 This likely explains the observations of reduced intimal SMC content
observed in both models. Although we did not directly measure the effect of type VIII collagen
on MMP-2 expression we did find that plaques from Col8-/-;Apoe-/- mice have reduced
gelatinolytic activity compared to controls. MMP-2 has been shown to mediate the infiltration of
SMCs in the context of vascular disease such as atherosclerosis (see section 1.3.4.2).236
Therefore, the reduced fibrous cap thickness observed in Col8-/-;Apoe-/- mice is due in part to the
impaired ability of SMCs to migrate into the atherosclerotic plaque and synthesize a fibrillar
collagen matrix which would contribute to plaque stability. In agreement with this, reduced
fibrillar type I collagen content is observed in plaques from Col8-/-;Apoe-/- mice as determined by
decreased PSR-positive staining, birefringence and immunolabelling of type I collagen.
Type VIII collagen likely alters the expression of fibrillar collagens through the TGF-β
signalling pathway. Recent studies have shown that in cardiac fibroblasts282 and mesangial
cells280, type VIII collagen modulates TGF-β signalling and promotes fibrosis. Our lab has
shown that integrin α1β1 and α2β1 are known receptors for type VIII collagen in SMCs.254 It is
probable that binding of type VIII collagen to the aforementioned integrins results in cross-talk
with the TGF-β signalling pathway that promotes fibrosis in vascular SMCs.309 In addition to
signalling, type VIII collagen may mediate the extracellular assembly or scaffolding of fibrillar
68
collagens. Mutations in type VIII collagen have been shown to alter the arrangement of collagen
fibrils in the notochord extracellular sheath of zebrafish.260 Addition of recombinant type VIII
collagen to soluble collagen promotes fiber formation.282 Since type VIII is a network-forming
non-fibrillar collagen shown to co-localize with ECM components, it likely scaffolds these
molecules.148 This helps to maintain ECM integrity in response to mechanical stressors.
There were differences in SMC responses comparing the wire injury and atherosclerosis
models. Deficiency of type VIII collagen in the wire injury model, resulted in increased cell
proliferation and apoptosis, whereas in the atherosclerosis model decreased cell proliferation was
noted. Type VIII collagen has been shown to mediate a number of effects on proliferation
depending on the context of insult. For example, Col8-/- mesangial cells treated with TGF-β1
show increased proliferation compared wild-type TGF-β1 treated cells. This increase was
mediated through activation of the MAPK and PI3K/Akt pathways.280 However, when treated
with high glucose or PDGF-BB, Col8-/- mesangial cells, show reduced proliferation through the
same MAPK pathway. As in mesangial cells, a difference in proliferation in response to different
cytokines or growth factors may also be occurring in SMCs. This response of increased
proliferation in SMCs may result from a mechanism to compensate for the physical injury that
came about from distention of the vessel wall.310, 311 The atherosclerosis model of vascular injury
is accompanied by inflammatory cell infiltration, which is not as pronounced as in the wire-
injury model. Type VIII collagen has not only been shown to be expressed by macrophages both
in vitro and in vivo, but also is found associated with macrophages in the atherosclerotic
plaque.262, 266, 293 It is therefore possible that type VIII collagen increases the expression of
cytokines and chemokines which promote the proliferation and infiltration of SMCs into the
atherosclerotic plaque.
69
Type VIII collagen has been shown to be expressed by macrophages in vitro,266 and in
situ hybridization experiments have confirmed type VIII collagen mRNA is co-localized with
plaque macrophages in animal models and human atherosclerosis.262, 266 Although there were no
differences in macrophage accumulation in Col8+/+ and Col8-/- mice, one cannot rule out the
possibility that macrophage-specific production of type VIII collagen results in a paracrine effect
that stimulates SMC infiltration into the vessel intima. This topic will be addressed in Chapter 4.
This study has shown that type VIII collagen facilitates outward vessel remodelling and
increased vessel wall hypertrophy in the mouse femoral artery injury model. Additionally, a
novel role of ApoE-mediated regulation of type VIII collagen was discovered. Lastly, in the
context of atherosclerosis, type VIII collagen was found to mediate the infiltration of SMCs into
the atherosclerotic plaque and subsequently the deposition of fibrillar type I collagen. This in
turn resulted in the formation of a stable atherosclerotic plaque. Therefore, in the context of
stenotic SMC-rich vasculopathies, inhibition of type VIII collagen might be beneficial to reduce
the level of vascular occlusion. However, in the context of atherosclerosis, decreased type VIII
collagen expression may result in reduced integrity of the fibrous cap potentially resulting in
plaque rupture.
Acknowledgements
We thank Dr. Bjorn Olsen for providing mice, Hangjun Zhang for measurement of mean
arterial pressure and heart rate, Drs. Michael C. Phillips and Sissel Lund-Katz for providing
lipoprotein, and Graham Maguire and Dr. Phil Connelly for the plasma lipid analysis.
70
2.5 Tables and Figures
71
Figure 2.1
72
Figure 2.1 Vessel wall thickening, cell number, and vessel diameter are reduced, but apoptosis and proliferation are increased after injury of the femoral artery in Col8-/- mice.
A and B: Representative cross-sections of injured femoral arteries from Col8+/+ and Col8-/- mice,
respectively, at 21 days after injury. Black circles show the location of the internal elastic
lamina. Scale bars: 200 µm. C: Cell number in the media (black bars) and intima (gray bars) and
total cell number (sum of black and gray bars) in Col8+/+ (n = 14) and Col8-/- (n = 12) mice at 21
days after injury. *P ≤ 0.05, significant difference in medial cell number between genotypes. †P
≤ 0.05, difference in total cell number between genotypes. D: Vessel wall medial and neointimal
area at 21 days after wire injury. E: Vessel diameter at 21 days after wire injury. F: Cell
proliferation in the media measured at 7 days after injury via Ki-67 immunostaining of sections
from Col8+/+ (n = 3) and Col8-/- (n = 4) mice. G: Apoptosis was quantified by measuring the
percentage of TUNEL-positive cells in the media at 7 days in Col8+/+ (n = 3) and Col8-/- (n = 3)
mice. D-G: Black bars represent the values from Col8+/+ mice, and white bars represent the
values from Col8-/- mice. *P ≤ 0.05. H and I: Representative cross-sections of injured femoral
arteries from Col8+/+ mice (H) and Col8-/- mice (I), respectively, at 7 days after injury, stained
for Ki-67. Scale bars: 100 µm.
73
Figure 2.2 Expression of Col8a1 mRNA is suppressed by ApoE and HDL.
A: mRNA levels for the a1 chain of type VIII collagen (Col8a1) were increased in the aortic arch
(Arch) and thoracic aorta (TA) of Apoe-/- mice (hatched bars) compared with wild-type C57BL/6
mice (black bars). mRNA levels for the a2 chain of type VIII collagen (Col8a2) were low and
did not differ between genotypes. All values are expressed as a fold change compared with levels
of mRNA for Col8a1 in wild-type aortic arch. *P ≤ 0.05 compared with corresponding wild-type
aorta; n = 4 samples of aortic segments pooled from 3 to 4 mice each. B: Primary mouse SMCs
were incubated in 10% FBS in the absence or presence of ApoE3, ApoA1, HDL, or LDL.
mRNA expression for Col8a1 was measured using RT-qPCR and is expressed as a percentage of
FBS control. *P ≤ 0.05 compared with FBS control; n = 4 experiments.
74
Figure 2.3 A: Expression of Col8a1 mRNA is increased at age 8 weeks in aortic arch (Arch) and
thoracic aorta (TA) of the Apoe−/− mouse (hatched bars) compared with wild-type C57Bl/6 mice
(black bars). n = 2 samples of aortic segments pooled from 3 to 4 mice each. *P ≤ 0.05 compared
with corresponding wild-type aorta. B: Primary mouse SMCs were incubated in 10% FBS in
absence or presence of ApoE3. mRNA levels for Col8a1 were decreased with ApoE3 treatment,
whereas levels for Col8a2 were much lower than α1 and were not affected by ApoE3
treatment. n = 2 experiments. *P ≤ 0.05 compared with FBS control.
75
Figure 2.4
76
Figure 2.4 Atherosclerotic plaque size and total plaque burden does not differ between Col8+/+;Apoe-/- and Col8-/-;Apoe-/- mice.
Representative longitudinal sections of aortic arches from Col8+/+;Apoe-/- and Col8-/-;Apoe-/-
mice after 6 weeks (A) or 12 weeks (B) of an atherogenic diet. C: Plaque area was measured in
the lesser curvature of the aortic arch after an atherogenic diet at 6 weeks in Col8+/+;Apoe-/-v(n =
13) and Col8-/-;Apoe-/- (n = 17) mice or at 12 weeks in Col8+/+;Apoe-/- (n = 13) and Col8-/-;Apoe-/-
(n = 15) mice. D: Plaque area was measured in the brachiocephalic artery at 6 weeks in
Col8+/+;Apoe-/- (n = 8) and Col8-/-;Apoe-/- (n = 12) mice or at 12 weeks in Col8+/+;Apoe-/- (n =
11) and Col8-/-;Apoe-/- (n = 6) mice. E: Plaque area was measured in the left common carotid
artery at 6 weeks in Col8+/+;Apoe-/- (n = 9) and Col8-/-;Apoe-/- (n = 9) mice or at 12 weeks in
Col8+/+;Apoe-/- (n = 10) and Col8-/-;Apoe-/- (n = 6) mice. Horizontal lines indicate the group
mean. F: The percentage of descending aorta surface area occupied by plaque was measured at 6
weeks in Col8+/+;Apoe-/- (n = 14) and Col8-/-;Apoe-/- (n = 13) mice or at 12 weeks in
Col8+/+;Apoe-/- (n = 11) and Col8-/-;Apoe-/- (n = 16) mice. Black bars represent values from
Col8+/+;Apoe-/- mice, and hatched bars represent values from Col8-/-;Apoe-/- mice.
Values are given as means ± SEM. Scale bars: 100 µm
77
Figure 2.5
78
Figure 2.5 SMC accumulation and proliferation are reduced in Col8-/-;Apoe-/- mice.
Representative longitudinal sections of the lesser curvature of the aortic arch after 12 weeks of
an atherogenic diet and stained with antibody against a-smooth muscle actin (A) or antibody
against Mac-2 to label macrophages (B), along with their respective negative controls. C:
Percentage of plaque area stained positive for SMA at 6 weeks in Col8+/+;Apoe-/- (n = 11) and
Col8-/-;Apoe-/- (n = 10) mice or at 12 weeks in Col8+/+;Apoe-/- (n = 9) and Col8-/-;Apoe-/- (n = 8)
mice. *P ≤ 0.05 comparing genotypes at the same time point. D: Percentage of plaque area
stained positive for Mac-2 at 6 weeks in Col8+/+;Apoe-/- (n = 13) and Col8-/-;Apoe-/- (n = 13)
mice or at 12 weeks in Col8+/+;Apoe-/- (n = 7) and Col8-/-;Apoe-/- (n = 8) mice. E: Percentage of
proliferating cells at 6 weeks in Col8+/+;Apoe-/- (n = 8) and Col8-/-; Apoe-/- (n = 11) mice or at 12
weeks in Col8+/+;Apoe-/- (n = 13) and Col8-/-;Apoe-/- (n = 7) mice. *P ≤ 0.05 comparing
genotypes at the same time point. F: Percentage of apoptotic cells at 6 weeks in Col8+/+;Apoe-/-
(n = 7) and Col8-/-;Apoe-/-(n = 12) mice or at 12 weeks in Col8+/+;Apoe-/- (n = 9) and Col8-/-
;Apoe-/- (n = 8) mice. Black bars represent values from Col8+/+;Apoe-/- mice, and hatched bars
represent values from Col8-/-;Apoe-/- mice. Values are given as means ± SEM. Scale bars:
100µm.
79
Figure 2.6
80
Figure 2.6 Matrix accumulation and fibrous cap thickness are decreased, and plaque necrotic core size is increased in plaques from Col8-/-;Apoe-/- mice.
Representative longitudinal sections of plaques from the lesser curvature of the aortic arch after
12 weeks of an atherogenic diet and stained with PSR to label collagen (A) or Verhoeff-van
Gieson to label elastin (B). C: Percentage of plaque area stained positive with PSR at 6 weeks in
Col8+/+;Apoe-/- (n = 12) and Col8-/-;Apoe-/- (n = 13) mice or at 12 weeks in Col8+/+;Apoe-/- (n =
9) and Col8-/-;Apoe-/- (n = 8) mice. D: Fibrillar collagen content, measured as birefringence via
PolScope at 6 weeks in Col8+/+;Apoe-/- (n = 12) and Col8-/-;Apoe-/- (n = 13) mice or at 12 weeks
in Col8+/+;Apoe-/- (n = 9) and Col8-/-;Apoe-/- (n = 8) mice. E: Percentage of elastin-positive
plaque area at 6 weeks in Col8+/+;Apoe-/- (n = 7) and Col8-/-;Apoe-/- (n = 15) mice or at 12 weeks
in Col8+/+;Apoe-/- (n = 8) and Col8-/-;Apoe-/- (n = 7) mice. F: Relative fibrous cap thickness in
Col8+/+;ApoE-/- (n = 11) and Col8-/-;Apoe-/- (n = 8) mice at 12 weeks. G: Percentage of plaque
occupied by necrotic core in Col8+/+;Apoe-/- (n = 12) and Col8-/-;Apoe-/- (n = 10) mice at 12
weeks. Black bars represent values from Col8+/+;Apoe-/- mice, and hatched bars represent values
from Col8-/-;Apoe-/- mice. Values are given as means ± SEM. C-G: *P ≤ 0.05 comparing
genotypes at the same time point. H: Classification of lesions found at 12 weeks in
Col8+/+;Apoe-/- (n = 15) and Col8-/-;Apoe-/- (n = 16) mice. Scale bars: 100 µm.
81
Figure 2.7 Fibrillar collagen content is decreased in the plaques from Col8−/−;Apoe−/− mice.
Representative images from the Abrio PolScope of plaques from Col8+/+;Apoe−/− mice (A)
and Col8−/−;Apoe−/−mice (B). The rainbow colored box is a heat map illustrating the degree of
retardance caused by birefringent fibrillar collagen. Images are pseudo-colored to indicate the
amount of retardance due to birefrigent fibrillar collagen, with blue corresponding to lower
retardance and red to higher retardance. The region of interest used for measurement is overlaid
with a red mask. C–E: Type I collagen was decreased in the plaques from Col8−/−;Apoe−/− mice.
Immunostaining for type I collagen at 12 weeks in plaques from Col8+/+;Apoe−/− mice (C)
and Col8−/−;Apoe−/− mice (D). C: Scale bar = 100 μm. E: Percentage of plaque area stained
positive for type I collagen at 12 weeks. Black bar represents values from Col8+/+;Apoe−/− mice,
and hatched bar represents values from Col8−/−;Apoe−/− mice. Values are given as means ± SEM.
*P ≤ 0.05 comparing genotypes.
82
Figure 2.8 Plaque in situ gelatinase activity is decreased in Col8-/-;Apoe-/- mice.
Representative longitudinal sections of plaques in the aortic arch from Col8+/+;Apoe-/- mice (A)
or Col8-/-;Apoe-/- mice (B) after 12 weeks of an atherogenic diet. Bright green fluorescence
represents the area of gelatinase activity (arrow in A). C: Average ranked score of gelatinase
activity in the plaques. Black bars represent values from Col8+/+;Apoe-/- mice (n = 6), and
hatched bars represent values from Col8-/-;Apoe-/- mice (n = 8). *P ≤ 0.05 comparing genotypes.
83
Table 2.1 Data for Uninjured Femoral Arteries
Variable Col8+/+ mice (n = 4) Col8−/− mice (n = 4)
Medial cell number
58.7 ± 10.3
54.2 ± 4.3
Medial area (μm2)
11849 ± 1087
10202 ± 665
Diameter (μm)
315.8 ± 9.5
312.8 ± 9.3
Values represent means ± SEM
84
Table 2.2 Systemic Variables for Mice Fed an Atherogenic Diet
Duration of atherogenic diet
6 Weeks 12 Weeks
Variable Col8+/+;Apoe-/- Col8-/-;Apoe-/- Col8+/+;Apoe-/- Col8-/-;Apoe-/-
Mean arterial
pressure (mmHg)
66.3 ± 3.6 (n = 8)
61.3 ± 2.1 (n = 8)
70.4 ± 2.8 (n = 8)
66.4 ± 2.1 (n = 8)
Heart rate
(beats/minute)
491 ± 19 (n = 8)
455 ± 14 (n = 8)
523 ± 28 (n = 8)
487 ± 14 (n = 8)
Body weight (g)
25.4 ± 1.1 (n = 15)
27.0 ± 0.9 (n = 18)
30.0 ± 1.1 (n = 13)
31.8 ± 1.3 (n = 17)
Plasma triglyceride
concentration
(mmol/L)
1.45 ± 0.16 (n = 9)
1.65 ± 0.19 (n = 12)
1.64 ± 0.09 (n = 10)
1.78 ± 0.16 (n = 13)
Plasma cholesterol
concentration
(mmol/L)
16.8 ± 1.2 (n = 9)
22.1 ± 1.3* (n = 12)
16.3 ± 1.0 (n = 10)
19.0 ± 1.2 (n = 13)
Values represent means ± SEM. Sample size is indicated in parentheses. *P ≤ 0.05
85
Chapter 3: Deficiency in type VIII collagen leads to atherosclerotic plaque instability
This work is being submitted for publication in August 2015 with the following title: “Type VIII
Collagen Reduces Inflammation and Plaque Instability and Promotes Plaque Stiffness in
Advanced Atherosclerosis”. The author list is as follows: Joshua Lopes BSc, Lindsay Davis
BSc, Gregory Raczkowski BSc, Hangjun Zhang MD, Guangpei Hou MD, Scott Heximer PhD,
Susan Lessner PhD and Michelle Bendeck PhD.
The experiments on plaque delamination (Figures 3.1 & 3.10 and Table 3.3) were conducted by
the lab of Dr. S. Lessner.
86
3.1 Introduction
Type VIII collagen is expressed in the fibrous cap and plaque shoulder region in animals
models of atherosclerosis and in human plaques. 262-264, 266 These regions are susceptible to
rupture. In the experiments reported in Chapter 2 of this thesis, the effects of type VIII collagen
in the in vivo progression of atherosclerosis were studied using a mouse deficient in both type
VIII collagen and apolipoprotein E (Col8-/-;Apoe-/-).294 Plaques from Col8-/-;Apoe-/- mice showed
reduced SMC accumulation and fibrillar type I collagen content. Additionally, plaques from
these mice exhibited reduced fibrous cap thickness and increased lipid-rich necrotic core area,
features common in plaques that are prone to rupture. It remains to be determined whether
plaques from Col8-/-;Apoe-/- mice progress to more complicated lesions exhibiting all features of
plaques which are prone to rupture.
Catastrophic plaque rupture is rare and difficult to detect in mouse models of
atherosclerosis.87 Consequently histological features such as reduced or cleaved collagen, low
SMC content, high macrophage content, large necrotic cores, thinned fibrous caps, breaks in the
fibrous cap or presence of buried fibrous caps are used as markers of plaque instabi lity in mice.18,
89, 90, 202 Other studies have assessed plaque instability by measuring the amount of mechanical
force required to delaminate plaques.312 Lessner and colleagues report a methodology for
measurement of the adhesive strength between the atherosclerotic plaque and the underlying
vessel wall, and for measurement of plaque stiffness.313 Energy release rates required to
delaminate plaques in Apoe-/- mice have been measured previously and are correlated with
plaque collagen content.314
We hypothesize that deletion of type VIII collagen results in the formation of
mechanically unstable atherosclerotic plaques. Work presented in this chapter show that features
87
such as elevated macrophage accumulation, thinned fibrous caps, increased collagen cleavage,
breaks in the elastic lamellae, and buried or broken fibrous caps were found in plaques from
Col8-/-;Apoe-/- mice on diet for 24 weeks. Using a plaque classification system based on Virmani
et al,302 the greatest percentage of plaques in Col8-/-;Apoe-/- mice contained features associated
with thin fibrous cap atheromas. This study shows that although energy release rate values
remained unchanged between genotypes, there is a reduction in plaque stiffness in Col8-/-;Apoe-/-
mice on diet for 26 weeks.
3.2 Materials and Methods
All animal experiments were conducted in compliance with the guidelines of the Canada
Council on Animal Care, and with the approval of the University of Toronto Animal Care
Committee. All products were purchased from Sigma-Aldrich, unless specified otherwise.
3.2.1 Generation of Col8+/+;Apoe-/- and Col8-/-;Apoe-/- Mice
Starting at 8-12 weeks of age, mice were fed an atherogenic diet consisting of 1.25%
cholesterol and 40% kCal of fat by weight (Research Diets Inc., D12108C)77 for another 24 or 26
weeks. Euthanasia, perfusion fixation and vessel isolation, measurement of mean arterial
pressure and plasma lipid analysis were conducted as described in chapter 2.
3.2.2 Histological assessment of atherosclerosis
Plaque burden in the descending aorta, immunolabeling for SMA and Mac2 in the aortic
arch were performed as described in chapter 2. Staining with picosiruis red, Movat’s
88
pentachrome, and Ki67, and TUNEL were performed, and plaque sectional area, fibrous cap
thickness, and necrotic core area were measured as described in chapter 2. Plaque morphological
characteristics were assessed using PSR, Movat’s, SMA, and Mac-2 stained longitudinal
sections. Buried fibrous caps as well as breaks in the fibrous cap and elastic lamina were
assessed in Movat’s pentachrome stained sections. Plaques were divided into 4 categories:
pathological intimal thickening, fibrous cap atheroma, thin fibrous cap atheroma, and
fibrocalcific plaque.
Detection of cleaved collagen in aortic arch sections was conducted using Col 2 3/4short
(1:100; #50-1035 Ibex Pharmaceuticals Inc., Mont Royal, QC) primary antibody. Slides were
then incubated in species specific biotinylated secondary antibodies (1:500, B2770 Invitrogen)
and developed as in section 2.2.9. For SMC or macrophage specific proliferation studies, aortic
arch samples were deparaffinised and rehydrated as above, followed by blocking in 1% BSA
(BioShop #9048-46-8). Samples were first incubated in primary antibodies directed against SMA
(1:250) or Mac2 (1:100) for 1 hour at room temperature, followed by incubation in anti-Ki67
antibody (1:50; ab15580 Abcam Inc.) overnight at 4°C. Slides were incubated in species specific
secondary antibody (SMA: 1:200 Alexa Flour 568, A11004, Invitrogen; Mac2: 1:200 Alexa
Fluor 568, A11077, Life Technologies; Ki67: 1:100 Alexa Fluor 488, Life Technologies).
Sections were then counterstained in Hoescht 33258 diluted 1:5000 in PBS, and mounted in
Prolong Gold Antifade (P36930, Invitrogen). Plaque images were analyzed using a Nikon E600
Epifluorescence Microscope using blue, red, and green channel filter sets with excitation of 340
to 380 nm and emission of 435 to 485 nm, excitation of 510 to 560 nm and emission of 590 nm,
and excitation of 465 to 495 nm and emission of 515 to 555 nm, respectively. Images were
acquired using a DS-Fi1 camera and exposure time set to 300ms and gain set to 1.00, or
89
exposure time set to 600ms and gain set to 1.00, or exposure time set to 800ms and gain set to
1.40, in the blue, red, and green channel, respectively. All measurements were performed by a
single individual blinded to the genotype of the mice.
3.2.3 Specimen preparation and plaque delamination experiments
These experiments were completed in collaboration with the laboratory of Dr. Susan
Lessner (University of South Carolina). Four Col8+/+;Apoe-/- and seven Col8-/-;Apoe-/- mice fed
an atherogenic diet for 26 weeks were used for this experiment. Animals were sacrificed via CO2
asphyxiation, perfused with heparinized normal saline for 5 minutes at physiological pressure
and dissected to expose the aorta. Plaques along the descending aorta were exposed by
longitudinal cutting of the vessel.
Experimental details and data processing can be found in Wang et al.313 Briefly, loading-
unloading peeling cycles were performed to acquire local energy release rate (G) values. These
G values are calculated by determining the energy required to delaminate a plaque in one peeling
cycle and dividing that by the newly exposed area uncovered during that cycle. Local G values
were collected stepwise from the proximal edge of the plaque as delamination continued. Once
delamination was complete, plaques were fixed in 10% neutral buffered formalin, embedded in
paraffin and transversely sectioned in 7µm increments. Plaque sections were subsequently
stained using Masson’s trichrome. Plaque stiffness was calculated by determining the slope of
the load-displacement curve at the linear region of the loading phase. Failure load was calculated
by measuring load after initiation of tearing (see Figure 3.1).
3.2.4 Statistical analysis
90
Sigmaplot 11.0 (SyStat Software Inc.) was used to carry out all statistical analyses.
Student’s t-test was performed to measure pairwise differences between the genotypes. The
Mann-Whitney U non-parametric test was used to analyze data that did not fit a normal
distribution. For plaque delamination data, a Shapiro-Wilk test was used to determine if data did
not fit a normal distribution.
3.3 Results
3.3.1 Plaque size and burden do not differ between genotypes
No differences in body weight, mean arterial pressure, plasma triglycerides or plasma
cholesterol levels were present between genotypes (Table 3.1). Atherosclerotic plaque area was
measured in longitudinal sections of the aortic arch along the lesser curvature between the
brachiocephalic and left subclavian artery branch points. No difference in plaque area was
observed in Col8-/-;Apoe-/- mice on diet for 24 weeks (Figure 3.2A). Total plaque burden was
measured along the length of the descending aorta by determining the percentage of aortic
surface area occupied by Oil Red O stained plaque. No difference in plaque burden was observed
between genotypes (Figure 3.2B). Representative images of Oil Red O stained descending aortae
are shown in Figure 3.2C.
3.3.2 Macrophage accumulation is increased in plaques from Col8-/-
;Apoe-/- mice
We previously showed that deletion of type VIII collagen in Apoe-/- mice on diet for 6
and 12 weeks reduced smooth muscle cell content (Chapter 2).294 To determine whether there
91
were differences in cellular composition of the lesions in Col8+/+;Apoe-/- and Col8-/-;Apoe-/- mice
at 24 weeks, we immunolabelled SMCs and macrophages using antibodies against SMA and
Mac2, respectively. Representative images are shown in Figure 3.3, A (SMCs) and B
(macrophages). Quantification of the images revealed that there was no difference in SMC
accumulation between genotypes (Figure 3.3C). By contrast macrophage accumulation was
increased 4-fold in plaques from Col8-/-;Apoe-/- mice compared to Col8+/+;Apoe-/- mice (P ≤
0.05) (Figure 3.3D). Ki67 is a nuclear antigen used to label proliferating cells. The percentage of
Ki67-positive cells was increased by 3-fold in plaques from Col8-/-;Apoe-/- mice compared to
Col8+/+;Apoe-/- controls (P ≤ 0.05) (Figure 3.3E). TUNEL labelling revealed no differences in
cell apoptosis between genotypes (Figure 3.3F).
To determine whether SMCs or macrophages were proliferating, dual immunolabelling
of SMA and Ki67 or Mac2 and Ki67 was performed. Representative images of dual SMA-Ki67
and Mac2-Ki67 are shown in Figure 3.4A and 3.5A, respectively. No difference in the number of
dual positive SMA-Ki67 cells was observed between genotypes (Figure 3.4B). There was a trend
towards an increase in dual Mac2-Ki67 positive cells in plaques from Col8-/-;Apoe-/- mice
compared to Col8+/+;Apoe-/- mice (Figure 3.5B). Negative control images are shown in Figure
3.6. Taken together this data suggests that the increase in macrophage accumulation is in part
due to increased macrophage proliferation.
3.3.3 Matrix content is similar in Col8+/+;Apoe-/- and Col8-/-;Apoe-/- mice
Our previous work showed that collagen content was reduced after 6 and 12 weeks on
atherogenic diet, and elastin content reduced after 6 weeks on diet in Col8-/-;Apoe-/- mice. To
measure extracellular matrix composition at late lesion time points, aortic arches were stained
92
with either PSR to label collagen fibers red (Figure 3.7A), or Movat’s pentachrome to label
elastin fibers black (Figure 3.7B). The percentage of plaque area stained positive for collagen
was not different between genotypes (Figure 3.7C). Fibrillar collagen content and organization
within plaques was assessed by measuring collagen fiber birefringence using PolScope. No
difference in birefringent fibrillar collagen content was observed comparing Col8+/+;Apoe-/- and
Col8-/-;Apoe-/- mice (Figure 3.7D). Similarly, no difference in elastin content was observed
comparing genotypes (Figure 3.7E).
3.3.4 Plaques from Col8-/-;Apoe-/- mice show reduced fibrous cap
thickness and increased breaks in the elastic lamellae
The presence of thinned fibrous caps, large necrotic cores, buried fibrous caps, breaks in
the fibrous cap, and breaks in the elastic lamellae are histological features that have been
validated as indicators of plaque instability.89, 90 There was a reduction in fibrous cap thickness
comparing Col8-/-;Apoe-/- mice to Col8+/+;Apoe-/- mice (Figure 3.7F). A 2-fold increase in the
number of breaks in the internal elastic lamella was noted in longitudinal sections of the aortic
arch of Col8-/-;Apoe-/- mice compared to Col8+/+;Apoe-/- mice (Table 3.2). No difference in the
numbers of buried fibrous caps and the numbers of breaks in the fibrous cap were observed
between genotypes (Table 3.2). No difference in necrotic core area was observed between
genotypes (Figure 3.7G).
3.3.5 Plaques from Col8-/-;Apoe-/- mice have increased cleaved
collagen
93
Increased collagen degradation by plaque macrophages is associated with plaque
instability.202 Plaques from Col8-/-;Apoe-/- mice after 24 weeks on high fat diet show greater
macrophage accumulation than Col8+/+;Apoe-/- mice (Figure 3.3D). Given this, we hypothesized
that plaques from these mice would contain greater levels of cleaved type I collagen. To assess
this we utilized an antibody that targets the epitope of collagenase cleaved type I collagen, Col 2
3/4short. Representative longitudinal sections of the aortic arch stained with Col 2 3/4short
antibody, along with negative controls (incubated in blocking solution only), are shown in Figure
3.8A. Plaques from Col8-/-;Apoe-/- mice show a 2-fold increase in the area stained positive for
cleaved collagen (Figure 3.8B).
3.3.6 The majority of plaques from Col8-/-;Apoe-/- mice are thin
fibrous cap atheromas
Plaque pathological assessment was carried out based on a classification system
described by Virmani et al.302 In Col8-/-;Apoe-/- mice, the greatest percentage of plaques had
features associated with thin fibrous cap atheromas (37.5%, versus 20% in Col8+/+;Apoe-/- mice).
Conversely, the greatest percentage of plaques in Col8+/+;Apoe-/- mice displayed features of
pathological intimal thickening (40%, versus 31.25% in Col8-/-;Apoe-/- mice) (Figure 3.9).
Plaques from Col8-/-;Apoe-/- mice had a reduced percentage of fibrocalcific plaque (6.25%)
compared to their control Col8+/+;Apoe-/- counterpart (20%) (Figure 3.9). Taken together this
data suggests that overall, plaques in Col8-/-;Apoe-/- mice might be more prone to rupture.
3.3.7 Stiffness is reduced in plaques from Col8-/-;Apoe-/- mice
94
A reduction in plaque stiffness was observed in Col8-/-;Apoe-/- mice (3.69 N/m) compared
to Col8+/+;Apoe-/- mice (4.65 N/m). No difference in failure load was reported between
genotypes. A histogram illustrating the distribution of G-values along with a scatterplot of
individual G-values and their corresponding total exposed area is shown in Figure 3.10A and B.
No difference in local energy release rate was observed between genotypes. A summary of the
G-values, plaque stiffness and failure load is shown in Table 3.3.
3.4 Discussion
In this chapter, it is reported that absence of type VIII collagen in Apoe-/- mice on
atherogenic diet for 24 weeks resulted in increased macrophage accumulation. No differences in
SMC content or extracellular matrix content were observed comparing plaques from
Col8+/+;Apoe-/- and Col8-/-;Apoe-/- mice on diet for 24 weeks. Interestingly, plaques from Col8-/-
;Apoe-/- mice on diet for 6 or 12 weeks displayed reduced SMC content and fibrillar type I
collagen content compared to controls (see Chapter 2).294 The difference in results between early
and late plaques could be explained by compensatory mechanisms that occur during
atherosclerotic plaque development which may contribute to increased SMC infiltration into the
lesions and subsequent matrix deposition. For example, elevated macrophage accumulation in
Col8-/-;Apoe-/- mice over time can result in elevated inflammatory cytokine levels, which could
subsequently lead to increased SMC accumulation in the intima.315
The increase in macrophage content in Col8-/-;Apoe-/- mice on diet for 24 weeks could be
due to an increase in macrophage proliferation, recruitment, or survival. Since no difference in
the number of TUNEL positive cells was observed between genotypes, reduced macrophage
apoptosis is unlikely to be the reason for the increase in macrophage accumulation observed in
95
plaques from Col8-/-;Apoe-/- mice. Elevated Ki67 positive cell counts are observed in plaques
from Col8-/-;Apoe-/- mice on diet for 24 weeks. Dual immunolabelling of Mac2-Ki67 revealed a
trend towards an increase in macrophage proliferation in plaques from Col8-/-;Apoe-/- mice.
Previous studies have confirmed that in advanced plaques, elevated macrophage accumulation is
due to local proliferation rather than recruitment from the bloodstream.52 Taken together, this
suggests that this increase in macrophage content is likely due to increased proliferation and not
recruitment. The reason for increased macrophage accumulation over time is still unknown
however, preliminary evidence presented in this thesis (see Appendix) and in other studies148, 260,
282 suggest that loss of type VIII collagen results in impaired collagen fiber formation. This in
turn may increase pro-inflammatory epitope exposure resulting in increased macrophage
recruitment or proliferation in the atherosclerotic plaques, similar to the development of certain
forms of arthritis.316 Although macrophages express type VIII collagen in vivo266 in the
atherosclerotic plaque, the functional significance of this expression has not been determined.
This is addressed in Chapter 4.
Fibrous cap thickness was reduced in plaques from Col8-/-;Apoe-/- mice on diet for 24
weeks. Accordingly, pathological assessment of plaques from Col8-/-;Apoe-/- mice also showed
that the greatest percentage of plaques were thin fibrous cap atheromas. SMC content and
fibrillar collagen content did not differ between genotypes. Therefore, the decrease in fibrous cap
thickness is not due to reduced SMC content or collagen content. Increased collagen degradation
is a probable explanation for thinning of the fibrous cap in Col8-/-;Apoe-/- mice. In accordance
with this, plaques from Col8-/-;Apoe-/- mice have increased levels of cleaved collagen which
localized to the fibrous cap region. High levels of cleaved collagen are the result of elevated
collagenolytic enzymes and are a feature of vulnerable plaques.202
96
Reduced fibrous cap formation is a characteristic feature observed in plaques from Col8-/-
;Apoe-/- mice at both 12 and 24 weeks on diet. The mechanism by which this occurs is quite
different between the two time points. Plaques from Col8-/-;Apoe-/- mice on diet for 12 weeks
show reduced fibrous cap development due to a decrease in SMC infiltration or extracellular
matrix expression. After 24 weeks on diet the increase in features associated with plaque
instability in Col8-/-;Apoe-/- mice may be due instead to an increase in macrophage accumulation
and subsequently an increase in matrix degrading enzymes (i.e. elastases and collagenases) 66, 317,
rather than lack of SMC infiltration.
Plaques from Col8-/-;Apoe-/- mice on diet for 24 weeks showed an increase in a number of
morphological features linked to plaque instability. There was an increase in the number of
breaks in the elastic lamellae, as well as a 1.5-fold trend towards increases in the number of
buried fibrous caps and breaks in the fibrous cap in plaques from Col8-/-;Apoe-/- mice. Johnson et
al report that buried fibrous caps are indicative of fibrous caps that have previously undergone
injury and subsequently healed.90 This is in line with the work presented in Chapter 2 showing
reduced fibrous cap formation in plaques from Col8-/-;Apoe-/- mice on diet for 12 weeks.294
Together, these data suggest that somewhere between the 12 and 24 week atherogenic diet time
point, fibrous cap integrity was lost more frequently in the Col8-/-;Apoe-/- mice compared to
control. Further examination of atherosclerotic plaques from Col8-/-;Apoe-/- mice on diet between
these two time points can draw insight into the failure mechanism of the fibrous cap in Col8-/-
;Apoe-/- mice.
Atherosclerotic plaque stability was assessed in Col8+/+;Apoe-/- and Col8-/-;Apoe-/- mice
on diet for 26 weeks using a validated method of plaque delamination to measure stiffness and
adhesion strength of the plaque. Stiffness was reduced in plaques from Col8-/-;Apoe-/- mice
97
compared to Col8+/+;Apoe-/- mice. Stiffness is the result of a combination of material properties
and plaque geometry (thickness and width). There was no change in plaque size between the two
genotypes. Reduced fibrous cap thickness, increased cleaved collagen content, as well as
increased breaks in the elastic lamella suggest that the reduction in plaque stiffness is due to a
change in these material properties of the plaque. Additionally, if type VIII collagen is
responsible for fibrillar type I or III collagen formation148, 260, 282 then this aberrant matrix
arrangement may be responsible for reduced plaque stiffness in the Col8-/-;Apoe-/- mice.
The adhesion strength between the plaque and (internal elastic lamina) IEL was
measured in the plaque delamination experiments, but no differences in energy release rates were
observed between genotypes. Previous studies conducted by Lessner and colleagues report
similar G-values of (mean ± SD) 19.2 J/m2 ± 15.6 J/m2 and 24.5 J/m2 ± 18.7 J/m2 in Apoe-/- mice
on diet for 8 months.313, 314 Therefore, the values reported in this study are in agreement with
those published from previous studies however, differences in time points as well as diet must be
noted.
This study shows that deletion of type VIII collagen in advanced atherosclerotic plaques
results in increased macrophage accumulation. This in turn results in an increase in a number of
histological features linked to plaque instability such as thinned fibrous caps, buried caps and
breaks in the cap, breaks in the elastic lamellae, and increased cleaved collagen. This work is the
first to show that deletion of type VIII collagen results in decreased plaque stiffness. This
reduction in stiffness is likely due to changes in the material composition of the plaque caused by
excess collagen degradation and/or improper assembly. Taken together this work suggests that
type VIII collagen protects against atherosclerotic plaque rupture in advanced plaque.
98
Acknowledgements
We would like to thank Dr. Bjorn Olsen for providing mice, Hangjun Zhang for
measurement of mean arterial pressure and heart rate, Graham Maguire and Dr. Phil Connelly for
the plasma lipid analysis, and Gregory Raczkowski, an undergraduate student working in our
laboratory, for histological analysis of the plaque data specifically Figure 3.3 C&D, and Figure
3.7 C-E.
99
3.5 Tables and Figures
100
Figure 3.1 A representative image of a raw load and displacement curve.
The area under the load-displacement curve represents the energy released during one
delamination cycle. The linear region depicted is used to determine the plaque stiffness for each
cycle. The failure load is the load at which tearing begins.
101
Figure 3.2 Total plaque size is slightly elevated in Col8-/-;Apoe-/- mice while plaque burden
remains unchanged between genotypes.
A: Total plaque area was measured along the lesser curvature of the aortic arch in Col8+/+;Apoe-
/- (n=11) and Col8-/-;Apoe-/- (n = 12) mice on diet for 24 weeks. B: Percentage of aortic surface
area occupied by Oil Red O-stained plaque was measured in the descending aortas of
Col8+/+;Apoe-/- (n=10) and Col8-/-;Apoe-/- (n = 11) mice on diet for 24 weeks. Black bars
represent values from Col8+/+;Apoe-/- mice and hatched bars values from Col8-/-;Apoe-/-mice.
Values are given as means ± SEM. Representative images of atherosclerotic plaque burden (C)
of Col8+/+;Apoe-/- and Col8-/-;Apoe-/- mice. Scale bar = 10 mm.
102
Figure 3.3
103
Figure 3.3 Macrophage accumulation and proliferation are increased in plaques from Col8-
/-;Apoe-/- mice.
Representative images of plaque from longitudinal sections of the aortic arch of Col8+/+;Apoe-/-
and Col8-/-;Apoe-/- mice on diet for 24 weeks stained using antibodies against SMA to label SMC
(A) or antibodies against Mac2 to label macrophages (B). Negative control sections incubated
without primary antibodies are also shown. C: Percentage of plaque area stained positive for
SMA in Col8+/+;Apoe-/- (n = 13) and Col8-/-;Apoe-/- (n = 12) mice on diet for 24 weeks. D:
Percentage of plaque area stained positive for Mac2 in Col8+/+;Apoe-/- (n = 12) and Col8-/-;Apoe-
/- (n = 15) mice on diet for 24 weeks. E: Percentage of Ki67-positive proliferating cells in
Col8+/+;Apoe-/- (n = 10) and Col8-/-;Apoe-/- (n = 12) mice on diet for 24 weeks. F: Percentage of
TUNEL-positive apoptotic cells in Col8+/+;Apoe-/- (n = 11) and Col8-/-;Apoe-/- (n = 8) mice on
diet for 24 weeks. Black bars represent values from Col8+/+;Apoe-/- mice and hatched bars values
from Col8-/-;Apoe-/-mice. Values are given as means ± SEM. Scale bar = 100µm. *P ≤ 0.05
comparing genotypes.
104
Figure 3.4 SMC proliferation does not differ between Col8+/+;Apoe-/- and Col8-/-;Apoe-/-
mice.
A: Representative images of plaque from longitudinal sections of the aortic arch of
Col8+/+;Apoe-/- and Col8-/-;Apoe-/- mice on diet for 24 weeks counterstained with Hoescht
(nuclei), stained with SM α-actin (SMC) and Ki67 (proliferating cells). Co-registered images are
also shown. Arrows indicate proliferating SMC, positive for Hoechst, SMA and Ki67. B:
Percentage of proliferating SMC from Col8+/+;Apoe-/- (n = 10) and Col8-/-;Apoe-/- (n=17) mice
on diet for 24 weeks. Black bars represent values from Col8+/+;Apoe-/- mice and hatched bars
values from Col8-/-;Apoe-/-mice. Values are given as means ± SEM. Scale bar = 100µm.
105
Figure 3.5 Macrophage proliferation slightly increased in plaque from Col8-/-;Apoe-/- mice.
A: Representative images of plaque from longitudinal sections of the aortic arch of
Col8+/+;Apoe-/- and Col8-/-;Apoe-/- mice on diet for 24 weeks counterstained with Hoescht
(nuclei), stained with Mac2 (macrophages) and Ki67 (proliferating cells). Co-registered images
are also shown. Arrows indicate proliferating macrophages, positive for Hoechst, Mac2 and
Ki67. B: Percentage of proliferating macrophages from Col8+/+;Apoe-/- (n = 13) and Col8-/-
;Apoe-/- (n=17) mice on diet for 24 weeks. Black bars represent values from Col8+/+;Apoe-/- mice
and hatched bars values from Col8-/-;Apoe-/-mice. Values are given as means ± SEM. Scale bar =
100µm.
106
Figure 3.6 Representative negative control images for dual SMA-Ki67 and Mac2-Ki67
immunolabelling.
The first two columns on the left are images of sections that stained positive for either SMA or
Mac2, along with the corresponding Ki67-positive section, and Hoescht counterstain. The last
column on the right shows the negative control sections along with the corresponding Hoescht
counterstain.
107
Figure 3.7
108
Figure 3.7 Fibrous cap thickness reduced in Col8-/-;Apoe-/- mice. Representative images of
plaque from longitudinal sections of the aortic arch of Col8+/+;Apoe-/- and Col8-/-;Apoe-/- mice on
diet for 24 weeks stained with picosirius red to label collagen (A) and Movat’s pentachrome to
label elastin (B). C: Percentage of plaque area stained positive for collagen in Col8+/+;Apoe-/- (n
= 12) and Col8-/-;Apoe-/- (n = 12) mice on diet for 24 weeks. D: Measurement of fibrillar
collagen content as determined by total birefringence in Col8+/+;Apoe-/- (n = 12) and Col8-/-
;Apoe-/- (n = 13) mice on diet for 24 weeks. E: Percentage of plaque area stained positive for
elastin in Col8+/+;Apoe-/- (n = 11) and Col8-/-;Apoe-/- (n = 11) mice on diet for 24 weeks. F:
Relative fibrous cap thickness in plaques from Col8+/+;Apoe-/- (n = 15) and Col8-/-;Apoe-/- (n =
19) mice on diet for 24 weeks. *P ≤ 0.05 comparing genotypes. G: Percentage of plaque area
occupied by necrotic core from Col8+/+;Apoe-/- (n = 13) and Col8-/-;Apoe-/- (n = 13) mice on diet
for 24 weeks. Black bars represent values from Col8+/+;Apoe-/- mice and hatched bars values
from Col8-/-;Apoe-/-mice. Values are given as means ± SEM. Scale bar = 100µm.
109
Figure 3.8 Increased cleaved collagen is observed in plaque from Col8-/-;Apoe-/- mice.
A: Representative images of plaque from longitudinal sections of the aortic arch of
Col8+/+;Apoe-/- and Col8-/-;Apoe-/- mice on diet for 24 weeks stained using an antibody against
cleaved collagen. Negative control sections incubated without primary antibody are also shown.
B: Percentage of plaque area stained positive for cleaved collagen in Col8+/+;Apoe-/- (n = 11) and
Col8-/-;Apoe-/- (n = 13) mice on diet for 24 weeks. *P ≤ 0.05 comparing genotypes. Black bars
represent values from Col8+/+;Apoe-/- mice and hatched bars values from Col8-/-;Apoe-/-mice.
Values are given as means ± SEM. Scale bar = 100µm.
110
Figure 3.9 Majority of plaques found in Col8-/-;Apoe-/- mice are thin fibrous cap atheromas.
Classification of plaques found along the aortic arch of for Col8+/+;Apoe-/- (n = 15) and Col8-/-
;Apoe-/- (n = 16) mice on diet for 24 weeks. Majority of plaques found in Col8+/+;Apoe-/- mice
were pathological intimal thickening (40%), while the majority of plaques found in Col8-/-;Apoe-
/- mice were thin fibrous cap atheromas (37.5%).
111
Figure 3.10 Local energy release rate remains unchanged between genotypes.
Distribution of local energy release rate, G, (A) for Col8+/+;Apoe-/- and Col8-/-;Apoe-/- mice. For
both genotypes, the distribution is positively skewed. Energy release rate, G, versus total
exposed area (B) for both Col8+/+;Apoe-/- (n = 17) and Col8-/- ;Apoe-/- (n = 22) mice. Each point
represents one delamination cycle. Mean G-value Col8+/+;Apoe-/- mice = 15.4 J/m2, mean G-
value Col8-/-;Apoe-/- mice = 16.2 J/m2. Grey values represents points from Col8+/+;Apoe-/- mice
and black values represent data from Col8-/-;Apoe-/-mice.
112
Table 3.1 Data for Mice Fed an Atherogenic Diet for 24 Weeks
Genotype Col8+/+;Apoe-/- Col8-/-;Apoe-/-
Mean Arterial Pressure
(mmHg)
82.43±4.28
(n=7)
73.13±2.66
(n=8)
Heart Rate (beats/min)
586.86±24.66
(n=7)
525.25±18.59
(n=8)
Body Weight (g)
30.87±1.08
(n=15)
32.38±0.95
(n=16)
Plasma triglyceride
concentration (mmol/L)
1.46±0.10
(n=13)
1.52±0.14
(n=13)
Plasma cholesterol
concentration (mmol/L)
15.63±1.25
(n=13)
17.96±1.60
(n=13)
Values indicate means ± SEM. Sample sizes are noted in parentheses.
113
Table 3.2 Morphological Data Taken from Plaques of Mice on Diet for 24 Weeks
Genotype
Number of Buried
Fibrous Caps per
Plaque
Number of Breaks in
Fibrous Cap per
Plaque
Number of Breaks in
the Elastic Lamellae
Col8+/+;Apoe-/-
1.11 ± 0.24
(n = 18)
0.28 ± 0.11
(n = 18)
2.11 ± 0.36
(n = 18)
Col8-/-;Apoe-/-
1.61 ± 0.29
(n = 18)
0.39 ± 0.14
(n = 18)
4.22 ± 0.50*
(n = 18)
Values indicate means ± SEM. Sample sizes are noted in parentheses.
*P ≤ 0.05
114
Table 3.3 Statistical Parameters for Energy Release Rate, Stiffness, and Failure Load
Values for Col8+/+;Apoe-/- and Col8-/-;Apoe-/- mice.
Statistical
Variable
Energy Release Rate (J/m2) Stiffness
(N/m)
Failure Load
(mN)
Col8+/+;Apoe-/- Col8-/-;Apoe-/- Col8+/+;Apoe-/- Col8-/-;Apoe-/- Col8+/+;Apoe-/- Col8-/-;Apoe-/-
Mean ± STD
15.4 ± 11.7
16.4 ± 18.8
4.65 ± 1.29
3.69* ± 1.51
6.37 ± 2.86
5.75 ± 2.63
*P ≤ 0.05
115
Chapter 4: The deletion of type VIII collagen in bone marrow derived cells attenuates the accumulation of
elastin in the atherosclerotic plaque
116
4.1 Introduction
Macrophages have diverse roles in the progression of atherosclerosis. In early plaques,
macrophages internalize native and modified lipoproteins retained in the subendothelium.
Oxidative stresses imposed on macrophages by these modified lipoproteins trigger activation of a
number of inflammatory pathways and cytokine production.51 For example, one recent study
showed that mitochondrial oxidative stress increases NF-κB activation leading to increased
MCP-1 production which results in elevated monocyte recruitment. In advanced atherosclerotic
plaque, modified lipids and lipoproteins retained in macrophages trigger apoptosis which further
contributes to growth of the necrotic core.53 Cytokines secreted by macrophages have been
shown to modulate a number of diverse pro- and anti-inflammatory responses on cells within the
vasculature (see Sit-Oufella et al).318 Inflammatory cytokine production by macrophages has
been shown to occur through activation of TLRs and NOD-like receptors.50 In addition to their
contribution to extracellular matrix degradation via MMPs for example319, they are able to
secrete extracellular matrix. In human atherosclerotic plaques, type VIII collagen was shown to
be localized to macrophages within the fibrous cap and plaque shoulder regions.262, 266, 292, 293
One study conducted by Weitkamp et al demonstrated that type VIII collagen is expressed by
macrophages in vitro and that treatment with lipopolysaccharide or IFNγ reduced expression of
type VIII collagen.266 Studies presented in chapters 2 and 3 of this thesis show that systemic
deletion of type VIII collagen resulted in no difference in macrophage accumulation in plaques
from Apoe-/- mice on diet for 6 or 12 weeks (see Chapter 2),294 however an increase in
macrophage accumulation was noted in plaques from Col8-/-;Apoe-/- mice on diet for 24 weeks
(see Chapter 3). This chapter will investigate the functional significance of type VIII collagen
expression by macrophages on atherosclerotic plaque progression.
117
We hypothesize that deletion of type VIII collagen in bone marrow derived cells results
in decreased SMC and matrix accumulation in atherosclerotic plaques. To address this, sex-
mismatched bone marrow transplantation experiments were performed. Atherosclerotic plaque
from chimeric mice with type VIII collagen-deficient bone marrow showed no differences in
plaque size, cellular content or collagen content. However, a reduction in elastin content was
observed. Using a separate set of chimeric mice, we show that absence of differences observed
between genotypes may be due to insufficient time post-transplantation to achieve proper re-
constitution of donor bone marrow.
4.2 Materials and Methods
All animal experiments were conducted in compliance with the guidelines of the Canada
Council on Animal Care, and with the approval of the University of Toronto Animal Care
Committee. All products were purchased from Sigma-Aldrich, unless specified otherwise.
4.2.1 Bone marrow transplantation and atherosclerotic plaque
analysis.
Bone marrow transplantation was performed using sex mismatched pairs of
Col8+/+;Apoe-/- and Col8-/-;Apoe-/- mice. Littermate female mice were lethally irradiated (2 doses
of 550 centigray (cGy) separated by 2-4 hours, Cs-137 source) and reconstituted after 4 hours via
tail vein with 3 million bone marrow cells from femurs of male donor mice. Subsequently
transplanted mice were housed in a sterile, pathogen-free facility. The experimental groups were
as follows: female Col8+/+;Apoe-/- hosts receiving male Col8+/+;Apoe-/- bone marrow (control:
118
Col8+/++/+ ), and female Col8+/+;Apoe-/- hosts receiving male Col8-/-;Apoe-/- bone marrow
(experimental: Col8-/-+/+ ).
Three weeks post-transplantation mice were placed on a sterile atherogenic diet
containing 1.25% cholesterol and 40% kCal of fat by weight (Research Diets Inc., D12108) for
12 weeks. The aortic sinus was embedded in paraffin and cut into 5µm sections. Plaque area was
assessed using PSR stained-sections. Mean arterial pressure measurement and plasma lipid
analysis, immunohistochemical labelling of smooth muscle cells, macrophages, and Ki67
positive cells, as well as matrix content was conducted as described in Chapter 2. Atherosclerotic
plaque present on aortic valve leaflets was excluded from analysis.
4.2.2 Assessment of male:female chimerism and flow cytometry
Assessment of bone marrow reconstitution was conducted via genomic DNA isolation
(PureLink, Life Technologies, #K1820-01) from peripheral blood leukocytes. Total DNA was
assayed by PCR amplification using primers for the marker of Y chromosomes, Sry (forward: 5’-
CGTGGTGAGAGGCACAAGT-3’ and reverse: 5’-AACAGGCTGCCAATAAAAGC-3’). PCR
reactions for the Sry gene were performed as follows: after 1 minute at 95°C, the reaction was
cycled 35 times at 94°C for 45 seconds, 55°C for 50 seconds and at 72°C for 1 minute.
In a separate set of experiments, bone marrow reconstitution was also assessed via flow
cytometric analysis in order to determine chimerism at 3, 6, and 8 weeks post-transplantation.
Three host CD45.2 female Apoe-/- mice were lethally irradiated and re-constituted with donor
CD45.1 male Apoe-/- mice as described in section 4.2.1. Saphenous vein bleeds were collected
from transplanted CD45.2 female Apoe-/- mice 3, 6, and 8 weeks post-transplantation and sent for
flow cytometric analysis (Robbins, C. University Health Network, Toronto, ON). Erythrocytes
119
were lysed using BD fluorescence-activated cell sorting (FACS) lysing solution (BD
Biosciences). Peripheral blood leukocytes were stained using the following staining scheme:
GFP-FITC, CD3-phycoerythrin (T-cells), B220 peridinin chlorophyll protein complex (PerCP)-
Cy5.5 (B-cells), CD115-allophycocyanin (APC) (monocytes), Ly6C-pecy (monocyte sub-
populations), Ly6G-APCcy7 (neutrophils), CD45.2-ef450, CD45.1-a700. All antibodies were
used at a 1:100 dilution. Labelling was detected using a LSRII cytometer (BD Biosciences).
Flow cytometric analysis was conducted using FlowJo v8.8.6 software (Tree Star Inc.). Separate
vials were collected at each time point for peripheral leukocyte counts using a haemocytometer.
4.2.3 Statistical analysis.
Sigmaplot 11.0 (SyStat Software Inc.) was used to carry out all statistical analyses.
Student’s t-test was performed to measure pairwise differences between genotypes. The Mann-
Whitney U non-parametric test was used to analyze data that did not fit a normal distribution.
4.3 Results
4.3.1 Plaque area was similar in Col8+/++/+ and Col8-/-+/+ mice
Type VIII collagen is synthesized by macrophages both in vitro and in vivo.266 Type VIII
collagen deletion did not affect macrophage accumulation after 12 weeks on atherogenic diet
(Chapter 2)320 however, the data presented in Chapter 3 show an increase in macrophage
accumulation in plaques of Col8-/-;Apoe-/- mice on diet for 24 weeks. Also, it is possible that of
type VIII collagen production via macrophages exerts a paracrine effect on smooth muscle cells
to facilitate their infiltration into atherosclerotic lesions. To address this, we have generated bone
marrow chimeric mice re-constituted with either type VIII collagen deficient macrophages (Col8-
120
/-+/+ ) or control type VIII collagen expressing macrophages (Col8+/++/+ ). No differences in
body weight, mean arterial pressure, heart rate, plasma triglycerides or plasma cholesterol levels
were noted between the two groups (Table 4.1). No difference in plaque area was observed
between groups (Figure 4.1).
4.3.2 Cellular composition of the plaque was similar in Col8+/++/+ and
Col8-/-+/+ mice
Immunohistochemical labelling of SMCs and macrophages within plaques from
Col8+/++/+ and Col8-/-+/+ mice is shown in Figure 4.2. SMA positive staining was
predominantly observed within the fibrous cap and vessel media of both groups (Figure 4.2A).
No differences in the percentage of SMA positive plaque area were observed between groups
(Figure 4.2C). Mac-2 positive staining was localized to the plaque shoulder region and fibrous
cap for both groups (Figure 4.2B). No differences in the percentage of Mac2 positive plaque area
were observed between groups (Figure 4.2D). Quantification of the percentage of Ki67-positive
cells revealed no difference in the number of proliferating cells between groups (Figure 4.2E).
4.3.3 Elastin content was reduced in plaques from Col8-/-+/+ mice
compared to Col8+/++/+ mice
To assess matrix content within aortic sinus plaque from Col8+/++/+ and Col8-/-+/+ mice,
PSR and Movat’s pentachrome staining were conducted. Representative PSR-stained aortic sinus
plaques from Col8+/++/+ and Col8-/-+/+ mice are shown in Figure 4.3A. Collagen content, as
measured by the area of PSR staining viewed under white light, was not different between
genotypes (Figure 4.3C). Representative Movat’s pentachrome stained aortic sinus plaques from
121
Col8+/++/+ and Col8-/-+/+ mice are shown in Figure 4.3B. Elastin content as measured by the
area of black fiber staining was reduced in the plaques from Col8-/-+/+ mice. Proteoglycan
content, as measured by the area of blue-green stain, was not different between genotypes
(Figure 4.3E).
4.3.4 Donor bone marrow engraftment increases over time post-
transplant
In the experiments conducted here, mice began the 12-week atherogenic diet 3 weeks
post-transplantation. Previous myelo-ablation studies in our lab have used the same timing
scheme.188, 189 However, other studies using bone marrow transplantation to assess the role of
genetically modified myeloid-derived cells in atherosclerosis have waited 6 to 8 weeks post-
transplantation before beginning dietary manipulations.321, 322 It is possible that 3 weeks post-
transplantation is insufficient time to allow donor bone marrow cells to properly re-constitute. To
address this, our lab in collaboration with Dr. Clint Robbins (UHN, Toronto, ON) have generated
CD45.1 CD45.2 bone marrow chimeric Apoe-/- mice and assessed peripheral CD45.1 positive
leukocyte numbers at various time points post-transplantation. 3 weeks post-transplant, 86.57%
of total peripheral leukocytes isolated are donor CD45.1 positive (Table 4.2). After 6 and 8
weeks post-transplantation, the number of CD45.1 positive leukocytes increase to 90.80% and
94.33%, respectively (Table 4.2).
4.4 Discussion
The purpose of these studies was to determine whether type VIII collagen production by
macrophages affects macrophage accumulation or exerts a paracrine effect on SMCs and
122
stimulates their infiltration. Deletion of type VIII collagen in bone marrow derived cells resul ted
in no differences in size, SMC content, or macrophage content of the atherosclerotic plaque. A
reduction in elastin content was observed in Col8-/-+/+ mice, however no difference in collagen
or proteoglycan content was noted. Plaque from Col8-/-;Apoe-/- mice did show a reduction in
elastin content after 6 weeks on diet, however no difference in elastin content was noted between
genotypes after 12 and 24 weeks on diet. This discrepancy between Col8-/-+/+ and Col8-/-;Apoe-/-
mice may be explained by a difference in elastin production between Col8+/+ and Col8-/- SMCs.
It is possible that in advanced atherosclerotic plaque, Col8-/- SMCs secrete higher levels of
elastin compared to Col8+/+ SMCs. SMCs are the predominant cells within plaques that are
responsible for elastin production.323 Although SMC genotype remains the same between both
groups, it is possible that deletion of type VIII collagen in macrophages creates a paracrine,
cytokine environment that favours reduced elastin synthesis or increased degradation. Cytokines
such as TGF-β1 and insulin growth factor (IGF)-1 are known to promote tropoelastin expression
(reviewed in Sproul and Argraves, 2013).324 IGF-1 for example is highly upregulated during
atherogenesis and is temporally correlated with aortic elastogenesis and ECM production within
the atherosclerotic plaque.325 Conversely, pro-inflammatory cytokines such as TNF-α and IL-1β
have been shown to decrease tropoelastin expression.324 Future experiments examining the
cytokine expression profile in plaques from Col8+/++/+ and Col8-/-+/+ mice can address this.
Macrophages are implicated in the degradation of elastin in atherosclerosis.317 This
decrease in elastin content may be due to an elevation in elastase activity from Col8-/-
macrophages within the plaque. Accordingly in Chapter 2, decreased elastin content was
observed in plaques from Col8-/-;Apoe-/- mice on diet for 6 weeks however, this could be due to a
reduction in SMC content observed in these plaques. In Chapter 3, increased breaks in the elastic
123
lamellae were observed in advanced plaques from Col8-/-;Apoe-/- mice. Whether or not this was
due to elevated macrophage accumulation, or to the relative increase in elastase expression by
macrophages is still unknown. Further studies examining the expression of MMP-12, the
neutrophil elastase commonly expressed in plaque macrophages,326 in plaques from Col8-/-
;Apoe-/- and Col8-/-+/+ mice might help to explain these observations. Additionally, the levels of
elastin degradation products can be measured as a marker of elastin degradation.327 The
reduction in elastin content may also be due to the inability to form elastin fibers. Animal studies
have shown that type VIII collagen localizes to elastin microfibrils protruding from the internal
elastic lamina.291 It is possible that deletion of type VIII collagen near macrophage-rich sites,
impairs elastin formation and increases the likelihood of elastin degradation by macrophages.
The contribution of type VIII collagen from bone marrow derived cells in the vessel wall
is dependent upon the amount of type VIII collagen secreted by these cells relative to SMCs or
endothelial cells. Although Weitkamp et al showed that type VIII collagen is expressed by
macrophages, this study did not address the amount secreted.266 Future experiments designed to
determine absolute quantities of type VIII collagen production by macrophages relative to other
cells in the plaque can help to determine the contribution to plaque progression.
Given the small sample size used in these studies (n = 3-5) further animal studies will be
required in order to confirm the results shown here. The lack of differences between Col8+/++/+
and Col8-/-+/+ mice may be due to insufficient re-constitution of Col8-/- derived leukocytes into
the host animal, and therefore production of type VIII collagen by host macrophages. Analysis of
CD45.1 CD45.2 transplant mice showed that the levels of circulating peripheral donor
CD45.1-positive leukocytes increased from 86.57% at 3 weeks post-transplantation to 94.33% at
8 weeks post-transplantation. Therefore, we cannot rule out the possibility that due to less than
124
complete bone marrow reconstitution, there is still sufficient production of type VIII collagen by
host macrophages that could be masking the effects of donor type VIII collagen-deficient
macrophages. Further analysis of atherosclerotic plaques at 8 weeks post-transplant is required in
order to confirm this.
These studies suggest that deletion of type VIII collagen in bone marrow derived cells
does not affect the accumulation of SMCs or alter the accumulation of macrophages. However, a
reduction in elastin content is observed, suggesting that type VIII collagen produced by
macrophages, regulates the abundance of elastin in the plaque. Whether or not this influences
stability of the atherosclerotic plaque has yet to be determined.
Acknowledgements
We would like to thank Dr. Bjorn Olsen for providing mice, Hangjun Zhang for
measurement of mean arterial pressure and heart rate, Graham Maguire and Dr. Phil Connelly for
the plasma lipid analysis. We thank Sherine Ensan and Dr. Clint Robbins for the flow cytometry
analysis.
125
4.5 Tables and Figures
126
Figure 4.1 No difference in plaque area observed between Col8+/++/+ and Col8-/-+/+ mice
Measurement of total aortic sinus plaque area in chimeric Col8+/++/+ (n=4) and Col8-/-+/+ mice
(n=5). No differences were observed between genotypes. Filled dots represent means ± SEM.
127
Figure 4.2
128
Figure 4.2 No difference in plaque cellular content is observed between Col8+/++/+ and
Col8-/-+/+ mice
Representative aortic sinus cross-sections from chimeric Col8+/++/+ and Col8-/-+/+ mice stained
with antibody against smooth muscle alpha actin (SMA) (A) and Mac-2 (B). Scale bar = 100 µm.
Measurement of the percentage of plaque area stained positive for SMA (C) in Col8+/++/+ (n=4)
and Col8-/-+/+ mice (n=4). Measurement of the percentage of plaque area stained positive for
Mac-2 (D) in Col8+/++/+ (n=3) and Col8-/-+/+ mice (n=4). Measurement of Ki67 positive
proliferating cells (E) Col8+/++/+ (n=4) and Col8-/-+/+ mice (n=5). Filled dots represent means
± SEM.
129
Figure 4.3
130
Figure 4.3. Elastin content reduced in aortic sinus plaques from Col8-/-+/+ mice
Representative aortic sinus cross-sections from chimeric Col8+/++/+ and Col8-/-+/+ mice stained
with picosirius red (A) to label collagen and Movat’s pentachrome (B) to label elastin and
proteoglycans. Scale bar = 100 µm. Measurement of the percentage of plaque area stained
positive for collagen (C) in Col8+/++/+ (n=4) and Col8-/-+/+ mice (n=5). Measurement of the
percentage of plaque area stained positive for elastin (D) in Col8+/++/+ (n=4) and Col8-/-+/+
mice (n=5). *P ≤ 0.05 comparing chimeras. Measurement of the percentage of plaque area
stained positive for proteoglycans (E) in Col8+/++/+ (n=4) and Col8-/-+/+ mice (n=5). Filled
dots represent means ± SEM.
131
Table 4.1 Systemic Variables for Transplanted Mice
Chimeras Col8+/++/+ Col8-/-+/+
Mean Arterial Pressure
(mmHg)
80.50±1.50
(n=2)
81.25±3.97
(n=4)
Heart Rate (beats/min)
624.00±107.00
(n=2)
604.25±23.60
(n=4)
Body Weight (g)
25.00±0.41
(n=4)
23.70±0.89
(n=5)
Plasma triglyceride
concentration (mmol/L)
1.13±0.10
(n=4)
1.06±0.22
(n=4)
Plasma cholesterol
concentration (mmol/L)
22.46±0.76
(n=4)
24.32±1.15
(n=4)
Values indicate means ± SEM. Sample sizes are noted in parentheses.
132
Table 4.2 CD45.1 CD45.2 Bone Marrow Re-Constitution Data Post-Transplant
Condition (n = 3) Percent CD45.1 cells: Percent of CD45.2 cells:
3 Weeks Post-Transplant Average ± STD: 86.57 ± 4.61 13.43 ± 4.61
6 Weeks Post-Transplant Average ± STD: 90.80 ± 1.11 9.20 ± 1.11
8 Weeks Post-Transplant Average ± STD: 94.33 ± 0.61 5.67 ± 0.61
133
Chapter 5: General discussion and future directions
134
Collagens are an integral part of the ECM within atherosclerotic plaque. The remodelling,
assembly and synthesis of collagens occurs throughout plaque development and can affect
features such as plaque size, cellular composition, and mechanical stability which all contribute
to plaque vulnerability. Type VIII collagen is up-regulated during atherosclerotic plaque
progression. Studies have shown that it mediates SMC proliferation, migration, and gelatinase
expression. Recent work has suggested that it is implicated in the assembly of fibrillar collagens
(reviewed in Chapter 1). The purpose of this thesis was to determine the role of type VIII
collagen in the progression of atherosclerotic plaque. Using the Apoe-/- mouse model of
atherosclerosis we show that type VIII collagen facilitates plaque stability at different times
during atherogenesis.
At early time points, type VIII collagen increases the infiltration of SMCs into the intimal
layer of the vessel wall. This process is facilitated by the expression and activity of matrix
degrading gelatinases (i.e. MMP-2). Increased SMC content within the atherosclerotic plaque
contributes to the deposition of fibrillar type I collagen which is required for fibrous cap
formation (Figure 5.1A). In advanced atherosclerotic plaques, type VIII collagen reduced
macrophage accumulation, cleaved collagen content, and features associated with plaque
instability, as well as promoted fibrous cap formation (Figure 5.1B). Moreover, advanced
plaques from Col8-/-;Apoe-/- mice were less stiff than plaques in Col8+/+;Apoe-/- mice. This
increase in inflammation as well as other histological and mechanical features linked to plaque
instability may be due to the role type VIII collagen plays in mediated fibrillar collagen
expression and assembly (see section 1.4.3.2 and Appendix). Using a bone marrow
transplantation model, our studies show that bone marrow specific deletion of type VIII collagen
reduced elastin content in the plaque. These findings suggest a diverse and complex role for type
135
VIII collagen in the progression of atherosclerosis and provide a number of avenues for future
research. In the following section, the main findings of each chapter will be discussed and
possible areas for future research will be identified.
5.1 Type VIII collagen facilitates formation of the fibrous cap
in atherosclerosis
The experiments conducted in Chapter 2 show for the first time the role of type VIII
collagen in mediating vessel wall remodelling after arterial injury and in the progression of
atherosclerosis. Deficiency of type VIII collagen resulted in decreased outward vessel
remodelling and decreased hypertrophy. We show that in the context of development of early
atherosclerotic plaque, ApoE and ApoE-containing lipoproteins suppress the expression of type
VIII collagen. In the context of atherosclerosis, using the Apoe-/- mouse, deletion of type VIII
collagen decreased SMC infiltration, as well as fibrillar type I collagen content. A reduction in
gelatinase activity was observed in these mice suggesting that type VIII collagen facilitates the
expression of gelatinases that promote SMC migration. In addition to this a reduction in fibrous
cap thickness and increase in necrotic core area was observed in mice deficient in type VIII
collagen. This suggests that type VIII collagen increases the stability of the atherosclerotic
plaque. Work presented here provides a platform from which future studies designed to promote
expression of type VIII collagen within the plaque can lead to novel therapeutics that increase
plaque stability.
5.1.1 Type VIII collagen and fibrillar collagens
136
Our studies clearly demonstrate reduced total collagen content and reduced fibrillar
collagen in early and intermediate stages of plaque growth from Col8-/-;Apoe-/- mice. Since type
VIII collagen is a non-fibrillar collagen, its deletion does not contribute to decreased fibrillar
collagens. This suggests that the expression, assembly or degradation of other fibrillar collagens
is altered. Type VIII collagen has been shown to associate with fibrillar type I collagen,281, 282
and may facilitate its assembly. The results from preliminary studies investigating this are
presented in the Appendix of this thesis, and summarized here. Immunostaining for type I
collagen showed decreased amounts in plaques from Col8-/-;Apoe-/- mice at 12 weeks.
Transmission electron microscopic analysis of plaques from Col8-/-;Apoe-/- mice on diet for 12
weeks reveal that collagen fibers are more fragmented and less continuous compared to control
Col8+/+;Apoe-/- mice. In addition, there are reductions in the mRNA expression of types I and III
fibrillar collagen in SMCs cultured from Col8-/- mice. These preliminary studies suggest that
type VIII collagen regulates the expression of fibrillar collagens. This could be mediated through
the fibrotic cytokine TGF-, as previous studies have shown that type VIII collagen modulates
TGF-β in mesangial cells280 and in cardiac fibroblasts.282 In a mouse model of heart failure,
TGF-β expression, SMAD-2 phosphorylation and fibrillar collagen expression were reduced in
ventricles from Col8-/- mice.282 Future experiments assessing the expression of TGF-β in SMCs
from Col8+/+ and Col8-/- mice should be conducted. TGF-β expression can be assessed in Col8-/-
SMCs treated with exogenous type VIII collagen. Neutralizing antibodies against TGF-β can be
used to determine whether inhibition modulates fibrosis or collagen fiber formation in Col8+/+
and Col8-/- SMCs. Additional experiments should focus on measuring TGF-β signalling via
SMAD-2/3 phosphorylation.
137
Experiments involving transcriptional regulation of fibrillar collagens can be conducted
in Col8+/+ and Col8-/- SMCs. Transcription factors such as specificity protein 1 and nuclear
factor 1, as well as activator protein 1 and core binding factor have been shown to bind
regulatory elements within the promoter regions of procollagen α1 and α2 (I), respectively and
activate transcription.216 Chromatin immunoprecipitation assays combined with RT-qPCR in
SMCs can determine whether type VIII collagen signalling differentially regulates transcription
of fibrillar collagen genes.328 These studies can be extended to determine whether inhibition of
either integrins α1, α2, or β1 and DDR1, receptors shown to bind to type VIII collagen (see
section 1.4.2),172, 254 affect fibrillar collagen expression. Previous work has shown that both α1β1
integrin329 and DDR1187, 189 regulate collagen expression. In vitro experiments designed to
determine the link between these receptors, type VIII collagen and fibrosis would be an
important area for future research. Future studies addressing the formation of fibrillar collagens
would be an important avenue. TEM analysis of collagen fiber D-periodicity and diameter have
been used to assess formation of collagen fibers.134, 193, 195 Assessment of these characteristics in
plaques from Col8-/-;Apoe-/- mice can be carried out to determine if type VIII collagen affects
fibrillar collagen formation in plaque. AFM experiments in cultured SMCs from Col8+/+ and
Col8-/- mice or SMCs treated with type VIII collagen can be used to assess D-period depth330 and
arrangement of collagen monomers193 in vitro. In addition to this use of fluorescently-labelled
collagen monomers can be used to determine if type VIII collagen facilitates collagen fibril
assembly.165
Our preliminary studies show that no difference in the expression of collagen
modification enzymes, LOX and CP4H between Col8+/+ and Col8-/- SMCs. Similarly, Skrbic et
al observed no differences in LOX expression in failing hearts of Col8+/+ and Col8-/- mice.282
138
These studies however, did not directly examine enzyme expression within atherosclerotic
plaque from Col8-/- mice. To determine if type VIII collagen effects the expression of collagen
modification enzymes during atherosclerosis, mRNA analysis or immunohistochemical
experiments analyzing the expression of LOX or CP4H within plaque from Col8-/-;Apoe-/- mice
would be an important future study. Given that there are a multiple enzymes responsible for the
processing of fibrillar collagen (see section 1.3.3.1) microarray analysis of genes encoding
fibrillar collagen modification enzymes in plaque from Col8+/+ and Col8-/- mice would be a
valuable experiment to illuminate potential mechanisms as to how fiber formation is altered. In
addition to this, assays designed to measure LOX activity331 can also be measured in Col8+/+ and
Col8-/- SMCs. A summary of how type VIII collagen may regulate fibrosis and fibrous cap
formation is shown in Figure 5.2.
5.1.2 Type VIII collagen and matrix degradation
Results presented in Chapter 2 show that plaques from Col8-/-;Apoe-/- mice have reduced
gelatinase activity. In Chapter 3, it is demonstrated that plaques from Col8-/-;Apoe-/- mice have
increased breaks in the elastic lamellae as well as increased cleaved collagen content. This
suggests differences in the expression and activation of matrix remodeling enzymes dependent
upon presence or absence of type VIII collagen and stage of atherogenesis. Previous studies in
our lab have shown that type VIII collagen modulates the expression of MMPs in SMCs.252, 254,
286 Given the importance of matrix degradation in remodelling and stability of the fibrous cap,
experiments assessing the effect of type VIII collagen on the expression and activity of MMPs
within atherosclerotic plaque is an important future direction. Based on results presented here,
expression and activity of gelatinases (i.e. MMP-2 and -9), collagenases (i.e. MMP-1, -8 and -13)
139
and elastases (i.e. MMP-12) are likely modulated in plaques deficient in type VIII collagen. One
future experiment could be to assess mRNA expression levels of MMPs and their inhibitors
TIMPs in mouse atherosclerotic plaques using laser capture microdissection combined with RT-
qPCR as conducted in the Appendix. Unfortunately due to insufficient amounts of template,
these experiments could not be completed for this thesis. Another experiment would be to
immunohistochemically label the above MMPs and TIMPs at different stages of plaque
development in Col8-/- mice. In combination with gelatin or collagen zymography the level of
MMP activity can be measured. Alternatively, as presented in Chapter 3, levels of cleaved
collagen content or elastin-derived peptides (peptides that arise from elastase activity)332 can be
measured in plaque from Col8-/-;Apoe-/- mice at varying time points to determine changes in
plaque stability.
One alternative method for the assessment of MMP activity within atherosclerotic plaque
is a technique called fluorescence molecular tomography (FMT). This technique allows for
quantitative measurement of proteinase activity within plaques of live mice. It involves the
injection of enzyme-specific molecular probes conjugated with fluorochromes into the blood.333
Once internalized, these probes will permeate the vessel wall, become cleaved by specific
enzymes, and produce a fluorescent signal that can be detected by an external sensor. To help
determine the distribution and localization of atherosclerotic plaque in live imaging, FMT can be
combined with computed tomography (CT). Using FMT-CT enzymatic activity within plaque
can be repeatedly imaged at different time points without sacrificing the animal. MMP-specific
probes can be used to determine changes in activity in plaques from Col8-/-;Apoe-/- mice over
time. Unfortunately, signal resolution is not great enough to determine which regions of the
140
plaque are positive for MMP-mediated degradation, thus this technique would likely have to be
combined with in situ zymography.
5.2 Type VIII collagen and atherosclerotic plaque stability
In Chapter 3 we show for the first time that in advanced atherosclerotic plaques, deletion
of type VIII collagen reduces plaque stability. Plaques from Col8-/-;Apoe-/- mice on atherogenic
diet for 24 weeks have increased macrophage accumulation and proliferation compared to
control Col8+/+;Apoe-/- mice. In addition to this, increases in the number of breaks in the fibrous
cap, buried fibrous caps and breaks in the elastic lamellae were also observed in plaques from the
Col8-/-;Apoe-/- mice . Plaques from Col8-/-;Apoe-/- mice have thinner fibrous caps and increased
cleaved collagen content relative to Col8+/+;Apoe-/- mice. Taken together, this suggests that late
in the development of atherosclerotic plaques, expression of type VIII collagen should be
maintained in order to prevent atherosclerotic plaque instability.
Intraplaque hemorrhage and plaque rupture was not observed in the Col8-/-;Apoe-/- mice.
This is not surprising given the paucity of these events in the atherogenic diet Apoe-/- mouse
model.87 In the future it will be important to assess deficiency of type VIII collagen in a mouse
model which is known to undergo acute plaque rupture. For example, in a recent study using a
fibrillin-1 mutant crossed on an Apoe-/- background plaque rupture (as defined by fibrous cap
disruption and infiltration of red blood cells) was present in 70% and 50% of mutants in the
ascending aorta and brachiocephalic arteries respectively, compared to 10% and 0% in control
Apoe-/- mice. In addition to this, 70% of the fibrillin mutant mice experienced sudden cardiac
death, relative to 0% in control mice.203 The disadvantage of a model like this would be the
complexity required to generate and analyze a mouse model that has four genetic alterations (2 α
141
(VIII) chains, ApoE, and fibrillin-1) on a pure C57Bl6 background. Alternatively, plaque
instability can be induced by AngII infusion in Apoe-/- mice.210 No signs of direct plaque rupture
was reported in this model however, there is the advantage of not requiring any further genetic
manipulations.
Experiments reported in this thesis were the first to show that deletion of type VIII
collagen reduces plaque stiffness. In these studies, stiffness was assessed in a plaque
delamination model by determining the slope of the load-displacement curve just prior to the
tearing event (see section 3.3.7). This likely reflects changes in the material properties at the
plaque and vessel wall junction. TEM analysis has shown that type VIII collagen associates with
elastin microfibrils protruding from the internal elastic lamina.291 It is possible therefore that type
VIII collagen acts as a bridging molecule between the elastic lamina and the matrix at the base of
the plaque, strengthening the plaque. Type VIII collagen is also expressed within the plaque
fibrous cap.263, 264 Differences in the mechanical integrity of the fibrous cap and the stresses
applied to it can determine whether a plaque is likely to rupture. Atomic force microscopy has
been used to measure the stiffness of plaques in Apoe-/- mice in situ.334 Determining fibrous cap
stiffness via AFM in Col8-/-;Apoe-/- mice would allow for a greater understanding of how type
VIII collagen mediates fibrous cap formation and what regions are likely at risk of rupturing.
Additional experiments can involve treating these mice with BAPN, an inhibitor of LOX, and
determine whether LOX inhibition results in a similar reduction in plaque stiffness as deficiency
of type VIII collagen.
One other important future direction in assessing the role of type VIII collagen in plaque
stability is to determine the level of expression of type VIII collagen in human atherosclerotic
plaques. Previous studies have confirmed type VIII collagen expression in human SMCs as well
142
as human coronary artery plaques.265, 266, 292, 293 These studies did not however provide a link
between the degree of type VIII collagen expression and the likelihood of plaque rupture or
features of plaque instability. Analysis of type VIII collagen expression and localization in
different types of human atherosclerotic plaques (both stable and unstable) can provide insight
into this. These studies can also be combined with dual immunolabelling of type VIII collagen
and different plaque cell types in order to determine which cells are responsible for type VIII
collagen synthesis at different stages of plaque development.
5.3 The role of type VIII collagen in cytokine production and
cell-specific deletion
In Chapter 4, we show that myeloid specific deletion of type VIII collagen does not affect
SMC or macrophage accumulation, however, a reduction in elastin content was observed. This
suggests that type VIII collagen production by macrophages modulates elastin levels within
atherosclerotic plaque. As discussed in section 4.4, differences in the local cytokine milieu can
regulate expression of elastin.324 It is possible that type VIII collagen plays a role in modulating
cytokine expression within atherosclerotic plaque. Studies from Plenz et al have noted links
between differences in cytokine levels and type VIII collagen expression in human plaque. For
example, immunohistochemical and in situ hybridization analysis of type VIII collagen revealed
that it co-localized with cytokines such as M-CSF, GM-CSF and TGF-β. In early plaque, type
VIII collagen co-localized mainly with the CSFs however, in advanced plaques type VIII
collagen predominantly co-localized with TGF-β.292, 293 One future experiment to consider from
this work is to determine differences in cytokine production between Col8+/+ and Col8-/-
macrophages in vitro. This can be extended to co-culture experiments to determine paracrine
143
effects of the cytokines from these macrophages on ECM production by SMCs.
Immunohistochemical or in situ hybridization studies assessing the expression of cytokines such
as TGF-β, IGF-1, TNF-α, IL-1β, and CSFs within plaque from Col8-/-+/+ mice and Col8-/-;Apoe-
/- mice might give insight as to how type VIII collagen modulates changes in plaque cel lular
composition or matrix content.
One limitation of the bone marrow transplant studies was the possibility of incomplete
bone marrow reconstitution (see Table 4.2). A future experiment that can address this issue and
provide a valuable research tool for future studies is to generate conditional type VIII collagen
knockout mice using the Cre recombinase system.335 In this system, cell-specific deletion of type
VIII collagen can be achieved by driving the Cre recombinase enzyme with either a SMC- (i.e.
SM-MHC)336 or macrophage- (i.e. M lysozyme)337 specific promoter. LoxP-flanked sites are
needed for both genes encoding type VIII collagen, Col8a1 and Col8a2. Direct assessment of
plaque fibrosis in SMCs deficient in type VIII collagen can be measured. Additionally, plaque
cytokine production in type VIII collagen deficient macrophages can also be assessed. These
experiments can be used to determine interactions between cells deficient in type VIII collagen.
For example, one could determine if production of type VIII collagen by endothelial cells, affects
SMC infiltration into the plaque.
5.4 Limitations
One potential limitation of this study is the use of the Apoe-/- mouse. We show that ApoE
is a negative regulator of type VIII collagen and that type VIII collagen is dramatically up-
regulated in Apoe-/- mice. Although type VIII collagen is increased in other animal models and in
human atherosclerosis (see section 1.4.4), in Apoe-/- mice it may be up-regulated to higher levels
144
which would not normally be found in other plaque models or in humans. Use of different mouse
models of atherosclerosis such as the Ldlr-/- or atherogenic diet-induced mouse338 combined with
Col8-/- mice can determine if there are any ApoE-independent effects of the role of type VIII
collagen in atherosclerotic plaque progression. It possible that in these models, expression of
type VIII collagen may not be as high as in the Apoe-/- mouse. Therefore, increased features of
plaque instability may be observed in the Ldlr-/- or atherogenic diet-induced mouse compared to
the Apoe-/- mouse.
Another limitation is that although there are number of similar features observed in both
plaque from Apoe-/- mice and humans,86 development of these plaques as well as the
complications that arise are quite different. In contrast to humans, the Apoe-/- mouse model
develops plaque within the aortic root but not in the first branches and segments of the coronary
arteries. Plaques do however develop in smaller intramyocardial arteries.339 In addition to this,
there are differences in the arterial anatomy at sites predisposed to atherosclerosis in mice and
humans. At disease onset, the mouse intimal layer consists only of a thin endothelium and some
underlying dendritic cells. Conversely, the intimal layer in humans contains SMCs and fibrous
tissue and can be as thick as the adjacent medial layer. As a result, human atherosclerotic plaques
tend to be much more fibrous in comparison to mice.340 Lastly, one of the major differences is
the low prevalence of plaque rupture with overlying thrombosis in Apoe-/- mice.87 Studies have
shown that plaques from Apoe-/- mice at 30 weeks of age do contain intraplaque hemorrhage
particularly at the base of the brachiocephalic artery. However, plaques at this site lack the
characteristic feature of human plaque rupture; disruption of the fibrous cap (resulting in
exposure of the necrotic core material to the bloodstream) resulting in overlying thrombosis.341
145
This type of plaque rupture does occur in Apoe-/- mice within coronary arteries albeit quite
rarely.340, 342
Differences in hemodynamics between mice and humans may explain the differences in
plaque localization. For example, the development of atherosclerosis in the aortic root of the
mouse is likely due to the increase in disturbed blood flow (as a result of an elevated murine
heart rate compared to humans) within the sinus of Valsalva.73 Alterations in the lipoprotein
profile can also explain differences in plaque development between the two species. In mice, the
predominant lipoprotein particle is HDL (reverse cholesterol transport) where as in humans it is
LDL (delivery of excess cholesterol to peripheral tissue).73 In addition to this, mRNA editing of
ApoB-100 to ApoB-48 in the mouse liver by APOBEC-1343 provides alternative mechanisms of
LDL clearance from the mouse bloodstream. High ApoB-48 levels within the LDL particle
results in increased ApoE content which mediates clearance of the LDL particle via LRP.344
Morphological differences between plaques from humans and mice became particularly
evident during the classification studies of intermediate and late stage plaques from
Col8+/+;Apoe-/- and Col8-/-;Apoe-/- mice (see figures 2.6H and 3.9). We found that individual
mouse atherosclerotic plaques often contained a high degree of heterogeneity that would have
satisfied two or more human plaque classification schemas. For example, plaque found along the
lesser curvature of the aortic arch had sites of a prominent necrotic core with thin overlaying
fibrous tissue (thin fibrous cap atheroma) as well as sites that were quite fibrous and contained
small areas of extracellular lipid, but no true necrotic core (pathological intimal thickening).
Another notable feature is that human plaques contain a more defined fibrous cap and necrotic
core region compared to mouse plaques. This difference can sometimes complicate plaque
146
categorization given the difficulty in assessment of the boundary between the necrotic core and
fibrous cap regions.
Another limitation is the hypercholesterolemic condition in Apoe-/- mice which may have
been exacerbated with the supplementation of a 1.25% cholesterol diet. Studies using this level
of cholesterol are typically used in the Ldlr-/- mouse.77 Future studies using the Col8-/-;Apoe-/-
mouse model should supplement a Western-type atherogenic diet (0.2% cholesterol) that is
commonly used for the Apoe-/- mouse.78 This can mitigate some of the complications due to
excess cholesterol such as xanthomas particularly within the skin and ulcerative dermatitis, as
well as xanthomas within the periarticular and peritendinous tissues.345
One final limitation that should be addressed in these studies is the use of the bone
marrow transplantation model. Lethal irradiation doses used for myeloablation affect the
progression of atherosclerotic plaque compared to non-treated mice. In the aortic arch, plaque
area is reduced in bone marrow-transplanted animals compared to non-transplanted controls.
Conversely, in the aortic root, plaque area is greater in bone marrow-transplanted animals
compared to controls. In addition to this, aortic root plaque from transplanted animals have lipid
cores and minimal collagen staining, while plaques from controls are largely collagenous.346
Differences are likely due to changes in endothelial integrity and damage upon radiation
exposure, as well as hemodynamic differences.346 Use of the Cre-lox recombinase conditional
knockout model can address the differences in atherosclerotic plaque progression between
irradiated and non-irradiated animals. Another limitation of this model is the 12 week time point.
Since the purpose of this study was to examine type VIII collagen and macrophage involvement
in atherosclerosis, the 12 week time point may be too late given the importance of monocyte-
derived macrophages in the initiation and early stages of the disease (see section 1.1.3). Future
147
studies should focus on analysis at various time points to have a greater understanding of disease
progression.
5.5 Closing comments
The work conducted for this thesis has enhanced our understanding of the functions of
type VIII collagen in atherosclerotic plaque vulnerability. In summary we showed that
expression of type VIII collagen confers plaque stability by mediating fibrous cap formation.
Future studies focusing on how type VIII collagen mediates fibrillar collagen assembly and
degradation will provide insight allowing the development of therapeutics that can prevent
plaque rupture. Additional experiments focussing on the biology of type VIII collagen within
different cell types can further broaden our understanding of how type VIII collagen functions in
other diseases and within our bodies.
148
5.6 Figures
149
Figure 5.1 Summary of the mechanism of type VIII collagen in the progression of
atherosclerosis.
Type VIII collagen is upregulated in early atherosclerotic plaques (A, left-hand side). Over time,
type VIII collagen promotes the proliferation and migration of SMCs from the medial layer into
the intimal layer. This is achieved through an increase in gelatinase (MMP-2) activity. In
intermediate stage atherosclerosis, this increase in SMC content results in an increase in fibrillar
type I collagen content, which contributes to the formation of the fibrous cap (A, right-hand
side). Type VIII collagen also increases the expression of fibrillar collagens which further
contribute to fibrous cap formation. In advanced atherosclerosis, type VIII collagen maintains
fibrous cap formation and integrity (B, left-hand side). Deletion of type VIII collagen results in
increased features associated with plaque instability such as increased macrophage content,
breaks in the IEL, buried fibrous caps, and collagen cleavage (B, right-hand side). This increase
in collagen degradation in Col8-/-;Apoe-/- mice may be due to the role of type VIII collagen in
mediating fibrillar collagen formation and organization.260, 282
150
Figure 5.2 The role of type VIII collagen in fibrosis and fibrous cap formation.
Type VIII collagen is upregulated in atherosclerosis and expressed within the fibrous cap region
of the atherosclerotic plaque (A). In addition to promoting SMC migration, type VIII collagen
may increase the expression of profibrotic enzymes, fibrillar collagens, or collagen modification
enzymes through signalling via DDR1, β1 integrin, TGF-β, or a cross-talk between β1 integrin
and TGF-β (B). Dashed arrows represent unknown mechanisms. Alternatively, type VIII
collagen may facilitate the assembly of fibrillar collagens (C) thereby increasing the structural
integrity of the plaque. TGFBR = TGF-β receptor.
151
Appendix: Type VIII collagen and fibrillar collagen expression
152
A1.1 Introduction
Collagen remodelling and organization is an important process in plaque stability. As
discussed in section 1.3.4.2, alterations in collagen formation218 or the enzymes that mediate it219,
222 are implicated in the progression and stability of atherosclerotic plaque. Type VIII collagen
associates with other ECM components such as proteoglycans, elastin, and collagen.148, 219, 281, 347
In atherosclerosis, type VIII collagen co-localizes with microfibrils extending from the internal
elastic lamina.291 Recent work has shown that type VIII collagen promotes the expression and
formation of fibrillar collagens (reviewed in section 1.4.3.2).260, 282 Studies in Chapter 2 show
that plaque from Col8-/-;Apoe-/- mice has reduced fibrillar type I collagen content. Studies
conducted in Chapter 3 illustrate that stiffness is reduced in plaque from Col8-/-;Apoe-/- mice and
that this is likely due to changes in plaque material properties. This work did not address whether
or not fibrillar collagen formation was altered.
Experiments conducted in this section were performed to test the hypothesis that type
VIII collagen reduces the expression and assembly of fibrillar collagens in vascular SMCs. TEM
analysis suggests that collagen fibers in the fibrous cap are disorganized in plaque from Col8-/-
;Apoe-/- mice. No difference in plaque procollagen α1 (I) and procollagen α1 (III) mRNA
expression was observed between genotypes. A reduction in procollagen α1 (III) mRNA
expression was observed in Col8-/- SMCs. No differences in collagen modification enzyme
expression was observed. Protein analysis of cultured Col8+/+ and Col8-/- SMCs showed no
difference in type I collagen content.
A1.2 Materials and Methods
153
All animal experiments were conducted in compliance with the guidelines of the Canada
Council on Animal Care, and with the approval of the University of Toronto Animal Care
Committee. All products were purchased from Sigma-Aldrich, unless specified otherwise.
A1.2.1 Transmission Electron Microscopy
For transmission electron microscopic analysis plaque from Col8+/+;Apoe-/- and Col8-/-
;Apoe-/- mice on diet for 12 weeks were analyzed. Mice were generated and supplemented with
diet as described in section 2.2.5. Samples were fixed using 4% paraformaldehyde, 1%
glutaraldehyde in phosphate-buffered saline, pH 7.4 overnight at room temperature. They were
then postfixed using 1% osmium tetroxide washed in buffer solution, dehydrated in a graded
alcohol series, and embedded in Epon 812 resin. 70nm sections were then cut using an RMC
MT-7000 ultramicrotome, stained with uranyl acetate and lead citrate, and examined in a Hitachi
8700 transmission electron microscope operated at 75kV and imaged using an AMT XR-60
digital camera.
A1.2.2 Laser capture microdissection of atherosclerotic plaque and
gene expression
Expression of mRNA in atherosclerotic plaques of Col8+/+;Apoe-/- and Col8-/-;Apoe-/-
mice on diet for 12 weeks was assessed using LCM (Arcturus) and quantitative real-time PCR
(qRT-PCR). 8μm thick longitudinal sections of the aortic arch were cut as described above in
section 2.2.9. 8 to 10 sections per slide were used. Slides were subsequently washed and stained
with Histogene (Arcturus) to aid in tissue visualization and subsequently dehydrated as per the
manufacturer’s instructions. Atherosclerotic plaque found along the lesser curvature was
154
captured onto thermolabile plastic caps (CapSure Macro LCM Caps, Arcturus). RNA was
isolated from each cap using the Picopure RNA isolation kit (Arcturus), treated with DNase I
(Qiagen) and reverse transcribed using the Superscript II cDNA synthesis kit (Invitrogen).
Isolated cDNA was diluted 1:5 in DNase/RNase free water and analyzed via RT-qPCR using the
following primers: procollagen α1 (I) forward, 5’- GATCTGTATCTGCCACAATGG -3’; and
reverse, 5’- TCGACTCCTACATCTTCTGAGT-3’; procollagen α1 (III) forward, 5’-
CAGCAGTCCAACGTAGATGAAT -3’; and reverse, 5’- GTCTAGTTGCTCCTCATCACA-
3’. Each gene expression profile was normalized to glyceraldehyde-3-phosphate dehydrogenase
(GAPDH) and expressed relative to Col8+/+;Apoe-/- plaques using the 2-∆∆Ct method.
A1.2.3 Cell culture
Mouse arterial SMCs were isolated from Col8+/+ and Col8-/- mice and cultured as
described previously.172 Cells were maintained in 10% fetal bovine serum and 1% penicillin-
streptomycin supplemented Dulbecco’s Modified Eagle Medium (DMEM) and used between
passages 4 and 8. Cells were also treated with 50 μg/ml of ascorbic acid. For POVPC treated
cells, 5000 cells per milliliter were placed in 6 well dishes and cultured in either 5 or 10 μg/ml of
POVPC for 3 days. Vehicle treated cells were treated with ethanol (the solvent used for
POVPC). These cells were used for mRNA expression as described below. For immunoblotting
experiments, 200 000 cells per milliliter were placed in 12 well culture dishes and cultured for 3
days prior to protein isolation.
A1.2.4 Real-time qPCR of cultured SMCs
155
Total RNA was isolated using spin column purification via the RNeasy Mini Kit (Qiagen
# 74014) and digested with DNase I (Invitrogen) as per the manufacturer’s instructions. Total
RNA was then reverse transcribed using the Superscript First-Strand Synthesis System for RT-
PCR with random primers (Invitrogen # 11904-018) according to the manufacturer’s
instructions. The isolated cDNA was analyzed using the following primers: procollagen α1 (I)
forward, 5’- CTTGATCTGTATCTGCCACAATGG -3’; and reverse,
5’- CCTCGACTCCTACATCTTCTGAGT-3’; procollagen α1 (III) forward,
5’- CAGCAGTCCAACGTAGATGAATTG-3’; and reverse,
5’- CAGTCTAGTTGCTCCTCATCACA- 3’; LOX forward, 5’-TGGTGCCCGACCCCTAC-
3’; and reverse 5’ –CAGGAGTACCGAGGGCG- 3’; CP4Hα1 forward,
5’- AAGGCTGAGCCGAGCTACA- 3’; and reverse
5’- GCCAAGCACTCTTAGATACTCTGTA- 3’; and CP4Hα2 forward,
5’- AGACAGGTGTCCTCACTGTTG- 3’; and reverse
5’- GCATCTTCGTCATCGCTCCT- 3’. Each gene expression profile was normalized to
GAPDH and expressed relative to vehicle treated Col8+/+ SMC using the 2-∆∆Ct method.
A1.2.5 Immunoblotting of cultured SMCs
Protein concentrations were determined using Bio Rad DC Protein Assay (Catalog #:
500-0116), and absorbance was measured using a spectrophotometer. 10 µg of protein were
loaded under reducing conditions into each well and resolved by performing SDS-
polyacrylamide gel electrophoresis (PAGE) (10% gel) followed by immunoblotting. Blots were
incubated with primary antibodies directed against mouse type I collagen (Col1) raised in rabbit
(1:500) (Abcam, ab21286), mouse lysyl oxidase (LOX) raised in rabbit (1:500) (L4669) and β-
156
actin raised in rabbit (Cell Signalling #4967) followed by washing and incubating with goat anti-
rabbit HRP-linked secondary antibody (1:10 000) (Cell Signalling #7074). Col1 and LOX blots
were stripped using Restore Western Blot stripping buffer (Thermo Scientific, #PI21059) as per
manufacturer’s instructions before re-probing for β-actin. Signalling was revealed using ECL
Plus reagents (Thermo Scientific, #32106). Band intensity was quantified using ImageJ software.
Briefly, the area under the curve for each band was measured three times and averaged.
A1.2.6 Statistical analysis
Sigmaplot 11.0 (SyStat Software Inc.) was used to carry out all statistical analyses.
Student’s t-test was performed to measure pairwise differences between both genotypes.
Experiments using POVPC treatment were analyzed using two-way ANOVA. The Mann-
Whitney U non-parametric test was used to analyze data that did not fit a normal distribution.
A1.3 Results
A1.3.1 Collagen fibers in the fibrous cap are disorganized in plaque
from Col8-/-;Apoe-/- mice
Transmission electron microscopy was used to examine collagen fiber content and
organization within the fibrous cap of plaques from Col8+/+;Apoe-/- (Figure A1.1A) and Col8-/-
;Apoe-/- (Figure A1.1B) mice on diet for 12 weeks. Plaques from Col8-/-;Apoe-/- mice show
reduced collagen fiber continuity and content compared to controls. In addition to this, collagen
fibers from Col8-/-;Apoe-/- mice appear more densely packed and fragmented compared to
Col8+/+;Apoe-/- mice.
157
A1.3.2 No difference in type I and III collagen expression in Apoe-/-
mice 12 weeks on diet
Studies presented in Chapter 2 showed that atherosclerotic plaques from Col8-/-;Apoe-/-
mice on diet for 12 weeks have reduced matrix accumulation.294 To determine whether this is
due to a reduction in matrix expression, mRNA levels of procollagen α1 (I) and (III) were
measured in microdissected plaques of Col8+/+;Apoe-/- and Col8-/-;Apoe-/- mice on diet for 12
weeks using RT-qPCR (Figure A1.2). No difference was observed between genotypes. (Figure
A1.2A and B).
A1.3.3 Cultured Col8-/- SMCs revealed a reduction in procollagen α1
(III) mRNA expression
SMCs are the primary cells responsible for matrix synthesis in the atherosclerotic
plaque.18 To determine whether expression of fibrillar collagens or collagen modification
enzymes is altered in Col8-/- SMCs, we assessed mRNA levels of procollagen α1 (I), procollagen
α1 (III), LOX, CP4Hα1 and CP4Hα2. Previous studies have shown that oxidized phospholipids
such as POVPC increase the expression of type VIII collagen.290 To determine whether increased
expression of type VIII collagen influences expression of the above targets, SMCs were treated
with 5 or 10μg/ml of POVPC. No difference in procollagen α1 (I) mRNA was observed between
genotypes (Figure A1.3A) however, a reduction in procollagen α1 (III) mRNA expression
(Figure A1.3B) was observed in vehicle Col8-/- SMCs. Upon treatment with POVPC, differences
were no longer observed between genotypes. No differences in LOX, CP4Hα1 and CP4Hα2
expression was observed in any of the treatments (Figure A1.3C-E, respectively).
158
A1.3.4 No difference in collagen protein and modification enzyme
expression in cultured SMCs
To further extend the evaluation of matrix expression and processing, protein levels of
type I collagen and LOX (Figure A1.4 and 1.5, respectively) was assessed in Col8+/+ and Col8-/-
SMCs. Immunoblotting analysis of type I collagen revealed no changes in procollagen α2 (I)
(160kDa) expression (Figure A1.4B). No difference in procollagen α1 (I) (~180kDa), C-terminal
bound procollagen (I) (~125kDa) and collagen α1 (I) (~110kDa) (Figure A1.4A, C & D,
respectively) was observed between genotypes in cells cultured for 3 days. No difference in
proenzyme (~50kDa) and mature (~32kDa) LOX (Figure A1.5A & B, respectively) was
observed between genotypes.
A1.4 Discussion
Studies in this chapter were performed to test if type VIII collagen affects the expression
or formation of fibrillar collagens. Qualitative TEM analysis of atherosclerotic plaque from Col8-
/-;Apoe-/- mice on diet for 12 weeks revealed that collagen fibers were less continuous and
appeared more fragmented compared to fibers from Col8+/+;Apoe-/- mice. Chapter 2 showed that
plaques from Col8-/-;Apoe-/- mice of the same time point had reduced fibrillar collagen content.294
Although studies in chapter 2 did not assess the level of collagen degradation, work in chapter 3
did show increased cleaved collagen content in plaques from Col8-/-;Apoe-/- mice on diet for 24
weeks (see section 3.3.5). Future studies examining the level of cleaved collagen content and
collagenase expression in plaques from Col8-/-;Apoe-/- mice on diet for 12 weeks is required in
order to determine if collagen degradation is increased in these mice. In addition to collagen
159
degradation, fiber formation affects the level of fibrillar collagen content. Previous studies
assessing collagen fiber formation have examined characteristics such as collagen fiber D-
periodicity and diameter.134, 193, 195 Previous studies have shown that recombinant α1 (VIII)
collagen increased the formation of soluble collagen fibers and that no difference in diameter
was observed.282 However this study did not assess any other characteristics, and did not
examine fibers in an in vivo setting.
A reduction in fibrillar collagen expression may explain reduced fibrillar collagen content
in plaques from Col8-/-;Apoe-/- mice. Accordingly, a trend in the reduction of procollagen α1 (I)
and (III) was observed in plaques from Col8-/-;Apoe-/- mice on diet for 12 weeks. Given a low
sample size for these experiments however (5 or 6 animals per group), it is possible that we may
have missed differences between genotypes. Type I collagen is composed of a second
procollagen α2 chain. Expression of procollagen α2 (I) must be determined in order to
completely assess whether type VIII collagen affects type I collagen mRNA expression.
Since SMCs are the primary cell type responsible for ECM synthesis in the
atherosclerotic plaque,18 we sought to determine if fibrillar collagen expression was altered in
cultured SMCs from Col8+/+ and Col8-/- mice. In accordance with a trend in reduced procollagen
mRNA levels in plaque from Col8-/-;Apoe-/- mice, a trend in the reduction of procollagen α1 (I)
and a reduction in procollagen α1 (III) was observed in Col8-/- SMCs compared to control
Col8+/+ SMCs. Treatment with POVPC, an oxidized phospholipid known to increase type VIII
collagen expression,290 did not alter procollagen expression between genotypes. We observed an
increase in the number of dead cells in both groups upon treatment with POVPC (data not
shown), which may explain the lack of difference between genotypes. Future experiments should
focus on addition of exogenous type VIII collagen instead of POVPC. This will allow for direct
160
determination of type VIII collagen in fiber formation and avoid the toxic side-effects of
POVPC. No difference in the expression of collagen modification enzymes LOX or CP4H was
observed between genotypes. Additional assessment of the other 2 subunits of CP4H, α3 and β1
are required in order to fully assess if type VIII collagen affects the expression of CP4H. Protein
expression of LOX did not reveal any differences between genotypes however a decreasing trend
in type I collagen protein, particularly the N- and C-terminal cleaved band was noted in Col8-/-
SMCs. This suggests that type VIII collagen may affect the expression of collagen N-terminal
and C-terminal proteinases or other enzymes responsible for collagen modification (reviewed in
section 1.3.3.1). Taken together this preliminary data suggests that SMCs derived from Col8-/-
mice may be impaired in their ability to express fibrillar collagens that are required for fibrous
cap formation in atherosclerotic plaques.
Acknowledgements
We would like to thank Drs. Brent Steer and Philip Marsden for training on laser capture
microdissection.
161
A1.5 Tables and Figures
162
Figure A1.1 Reduced collagen fiber content and organization in the fibrous cap is observed in plaque from Col8−/−;Apoe−/− mice.
Representative transmission electron microscopy images of plaque from longitudinal sections of
the lesser curvature of the aortic arch from Col8+/+;Apoe-/- (A) and Col8-/-;Apoe-/- (B) mice on
diet for 12 weeks. Scale bar = 500nm. Collagen fibers in the fibrous cap are more organized and
continuous in plaque from Col8+/+;Apoe-/- mice compared to Col8-/-;Apoe-/- mice as indicated by
the black arrows.
163
Figure A1.2 Procollagen α1 (I) and (III) mRNA expression slightly reduced in plaques from Col8−/−;Apoe−/− mice.
Procollagen α1 (I) (A) and (III) (B) gene expression was analyzed in microdissected
atherosclerotic plaques of Col8+/+;Apoe-/- (n = 6) and Col8-/-;Apoe-/- (n = 5) mice on diet for 12
weeks. Black bars represent values from Col8+/+;Apoe-/- mice and hatched bars values from
Col8-/-;Apoe-/-mice. Values are given as means ± SEM.
164
Figure A1.3 Fibrillar collagen mRNA expression reduced in Col8-/- SMCs.
Expression of fibrillar collagens and collagen modification enzymes was assessed in cultured
Col8+/+ (n = 5) and Col8-/- (n = 4) SMCs treated with indicated concentrations of POVPC for 3
days. The mRNA expression of procollagen α1 (I) (A), procollagen α1 (III) (B), LOX (C),
CP4Hα1 (D) and CP4Hα2 (E) is shown. *P ≤ 0.05 comparing genotypes. Black bars represent
values from Col8+/+;Apoe-/- mice and hatched bars values from Col8-/-;Apoe-/- mice. Values are
given as means ± SEM.
165
Figure A1.4 Type I collagen expression slightly reduced in Col8-/- SMCs.
Type I collagen expression was assessed in Col8+/+ (n = 3) and Col8-/- (n = 3) SMCs cultured for
3 days. Representative 180kDa bands depicting procollagen α1 (I) are shown in A.
Representative 160kDa bands depicting procollagen α2 (I) are shown in B. Representative
125kDa bands depicting only C-terminal bound procollagen α1 (I) are shown in C.
Representative 110kDa bands depicting collagen α1 (I) are shown in D. All band intensities are
normalized to β-actin (42kDa). Black bars represent values from Col8+/+;Apoe-/- mice and
hatched bars values from Col8-/-;Apoe-/-mice. Values are given as means ± SEM.
166
Figure A1.5 No change in LOX protein expression is observed between genotypes.
LOX expression was assessed in Col8+/+ (n = 3) and Col8-/- (n = 3) SMCs cultured for 3 days.
Representative 50kDa bands depicting pro-enzyme LOX are shown in A. Representative 32kDa
bands depicting mature LOX are shown in B. All band intensities are normalized to β-actin
(42kDa). Black bars represent values from Col8+/+;Apoe-/- mice and hatched bars values from
Col8-/-;Apoe-/-mice. Values are given as means ± SEM.
167
Reference List
(1) Chiu JJ, Chien S. Effects of disturbed flow on vascular endothelium:
pathophysiological basis and clinical perspectives. Physiol Rev 2011
January;91(1):327-87.
(2) Deanfield JE, Halcox JP, Rabelink TJ. Endothelial function and dysfunction: testing
and clinical relevance. Circulation 2007 March 13;115(10):1285-95.
(3) Davis EC. Smooth muscle cell to elastic lamina connections in developing mouse aorta.
Role in aortic medial organization. Lab Invest 1993 January;68(1):89-99.
(4) Davis EC. Endothelial cell connecting filaments anchor endothelial cells to the
subjacent elastic lamina in the developing aortic intima of the mouse. Cell Tissue Res
1993 May;272(2):211-9.
(5) Wagenseil JE, Mecham RP. Vascular extracellular matrix and arterial mechanics.
Physiol Rev 2009 July;89(3):957-89.
(6) Berry CL, Sosa-Melgarejo JA, Greenwald SE. The relationship between wall tension,
lamellar thickness, and intercellular junctions in the fetal and adult aorta: its relevance
to the pathology of dissecting aneurysm. J Pathol 1993 January;169(1):15-20.
(7) Majesky MW, Dong XR, Hoglund V, Mahoney WM, Jr., Daum G. The adventitia: a
dynamic interface containing resident progenitor cells. Arterioscler Thromb Vasc Biol
2011 July;31(7):1530-9.
(8) Hu Y, Zhang Z, Torsney E et al. Abundant progenitor cells in the adventitia contribute
to atherosclerosis of vein grafts in ApoE-deficient mice. J Clin Invest 2004
May;113(9):1258-65.
(9) Ponticos M, Smith BD. Extracellular matrix synthesis in vascular disease: hypertension,
and atherosclerosis. J Biomed Res 2014 January;28(1):25-39.
(10) Murray CJ, Lopez AD. Measuring the global burden of disease. N Engl J Med 2013
August 1;369(5):448-57.
(11) Lim SS, Vos T, Flaxman AD et al. A comparative risk assessment of burden of disease
and injury attributable to 67 risk factors and risk factor clusters in 21 regions, 1990-
2010: a systematic analysis for the Global Burden of Disease Study 2010. Lancet 2012
December 15;380(9859):2224-60.
(12) Steinberg D, Glass CK, Witztum JL. Evidence mandating earlier and more aggressive
treatment of hypercholesterolemia. Circulation 2008 August 5;118(6):672-7.
(13) Wentzel JJ, Chatzizisis YS, Gijsen FJ, Giannoglou GD, Feldman CL, Stone PH.
Endothelial shear stress in the evolution of coronary atherosclerotic plaque and vascular
168
remodelling: current understanding and remaining questions. Cardiovasc Res 2012
November 1;96(2):234-43.
(14) Tabas I, Williams KJ, Boren J. Subendothelial lipoprotein retention as the initiating
process in atherosclerosis: update and therapeutic implications. Circulation 2007
October 16;116(16):1832-44.
(15) Hansson GK, Libby P. The immune response in atherosclerosis: a double-edged sword.
Nat Rev Immunol 2006 July;6(7):508-19.
(16) Stary HC, Chandler AB, Dinsmore RE et al. A definition of advanced types of
atherosclerotic lesions and a histological classification of atherosclerosis. A report from
the Committee on Vascular Lesions of the Council on Arteriosclerosis, American Heart
Association. Arterioscler Thromb Vasc Biol 1995 September;15(9):1512-31.
(17) Gomez D, Owens GK. Smooth muscle cell phenotypic switching in atherosclerosis.
Cardiovasc Res 2012 July 15;95(2):156-64.
(18) Finn AV, Nakano M, Narula J, Kolodgie FD, Virmani R. Concept of
vulnerable/unstable plaque. Arterioscler Thromb Vasc Biol 2010 July;30(7):1282-92.
(19) Glagov S, Weisenberg E, Zarins CK, Stankunavicius R, Kolettis GJ. Compensatory
enlargement of human atherosclerotic coronary arteries. N Engl J Med 1987 May
28;316(22):1371-5.
(20) Zarins CK, Giddens DP, Bharadvaj BK, Sottiurai VS, Mabon RF, Glagov S. Carotid
bifurcation atherosclerosis. Quantitative correlation of plaque localization with flow
velocity profiles and wall shear stress. Circ Res 1983 October;53(4):502-14.
(21) Slager CJ, Wentzel JJ, Gijsen FJ et al. The role of shear stress in the generation of
rupture-prone vulnerable plaques. Nat Clin Pract Cardiovasc Med 2005
August;2(8):401-7.
(22) Chatzizisis YS, Coskun AU, Jonas M, Edelman ER, Feldman CL, Stone PH. Role of
endothelial shear stress in the natural history of coronary atherosclerosis and vascular
remodeling: molecular, cellular, and vascular behavior. J Am Coll Cardiol 2007 June
26;49(25):2379-93.
(23) Li YS, Haga JH, Chien S. Molecular basis of the effects of shear stress on vascular
endothelial cells. J Biomech 2005 October;38(10):1949-71.
(24) Parmar KM, Larman HB, Dai G et al. Integration of flow-dependent endothelial
phenotypes by Kruppel-like factor 2. J Clin Invest 2006 January;116(1):49-58.
(25) McNally JS, Davis ME, Giddens DP et al. Role of xanthine oxidoreductase and
NAD(P)H oxidase in endothelial superoxide production in response to oscillatory shear
stress. Am J Physiol Heart Circ Physiol 2003 December;285(6):H2290-H2297.
169
(26) Tricot O, Mallat Z, Heymes C, Belmin J, Leseche G, Tedgui A. Relation between
endothelial cell apoptosis and blood flow direction in human atherosclerotic plaques.
Circulation 2000 May 30;101(21):2450-3.
(27) Cheng C, Tempel D, van HR et al. Shear stress-induced changes in atherosclerotic
plaque composition are modulated by chemokines. J Clin Invest 2007
March;117(3):616-26.
(28) Hansson GK, Robertson AK, Soderberg-Naucler C. Inflammation and atherosclerosis.
Annu Rev Pathol 2006;1:297-329.
(29) Nageh MF, Sandberg ET, Marotti KR et al. Deficiency of inflammatory cell adhesion
molecules protects against atherosclerosis in mice. Arterioscler Thromb Vasc Biol 1997
August;17(8):1517-20.
(30) Weber C, Belge KU, von HP et al. Differential chemokine receptor expression and
function in human monocyte subpopulations. J Leukoc Biol 2000 May;67(5):699-704.
(31) Ziegler-Heitbrock L, Ancuta P, Crowe S et al. Nomenclature of monocytes and
dendritic cells in blood. Blood 2010 October 21;116(16):e74-e80.
(32) Imanishi T, Ikejima H, Tsujioka H et al. Association of monocyte subset counts with
coronary fibrous cap thickness in patients with unstable angina pectoris.
Atherosclerosis 2010 October;212(2):628-35.
(33) Williams KJ, Tabas I. The response-to-retention hypothesis of early atherogenesis.
Arterioscler Thromb Vasc Biol 1995 May;15(5):551-61.
(34) de Villiers WJ, Smith JD, Miyata M, Dansky HM, Darley E, Gordon S. Macrophage
phenotype in mice deficient in both macrophage-colony-stimulating factor (op) and
apolipoprotein E. Arterioscler Thromb Vasc Biol 1998 April;18(4):631-40.
(35) Rajavashisth T, Qiao JH, Tripathi S et al. Heterozygous osteopetrotic (op) mutation
reduces atherosclerosis in LDL receptor- deficient mice. J Clin Invest 1998 June
15;101(12):2702-10.
(36) Smith JD, Trogan E, Ginsberg M, Grigaux C, Tian J, Miyata M. Decreased
atherosclerosis in mice deficient in both macrophage colony-stimulating factor (op) and
apolipoprotein E. Proc Natl Acad Sci U S A 1995 August 29;92(18):8264-8.
(37) Legein B, Temmerman L, Biessen EA, Lutgens E. Inflammation and immune system
interactions in atherosclerosis. Cell Mol Life Sci 2013 October;70(20):3847-69.
(38) Italiani P, Boraschi D. From Monocytes to M1/M2 Macrophages: Phenotypical vs.
Functional Differentiation. Front Immunol 2014;5:514.
(39) Cheng C, Tempel D, van HR et al. Atherosclerotic lesion size and vulnerability are
determined by patterns of fluid shear stress. Circulation 2006 June 13;113(23):2744-53.
170
(40) Cuhlmann S, Van der Heiden K, Saliba D et al. Disturbed blood flow induces RelA
expression via c-Jun N-terminal kinase 1: a novel mode of NF-kappaB regulation that
promotes arterial inflammation. Circ Res 2011 April 15;108(8):950-9.
(41) Monaco C, Andreakos E, Kiriakidis S et al. Canonical pathway of nuclear factor kappa
B activation selectively regulates proinflammatory and prothrombotic responses in
human atherosclerosis. Proc Natl Acad Sci U S A 2004 April 13;101(15):5634-9.
(42) Mantovani A, Sica A, Sozzani S, Allavena P, Vecchi A, Locati M. The chemokine
system in diverse forms of macrophage activation and polarization. Trends Immunol
2004 December;25(12):677-86.
(43) Wolfs IM, Donners MM, de Winther MP. Differentiation factors and cytokines in the
atherosclerotic plaque micro-environment as a trigger for macrophage polarisation.
Thromb Haemost 2011 November;106(5):763-71.
(44) Seneviratne A, Hulsmans M, Holvoet P, Monaco C. Biomechanical factors and
macrophages in plaque stability. Cardiovasc Res 2013 July 15;99(2):284-93.
(45) Stoger JL, Gijbels MJ, van d, V et al. Distribution of macrophage polarization markers
in human atherosclerosis. Atherosclerosis 2012 December;225(2):461-8.
(46) Porta C, Rimoldi M, Raes G et al. Tolerance and M2 (alternative) macrophage
polarization are related processes orchestrated by p50 nuclear factor kappaB. Proc Natl
Acad Sci U S A 2009 September 1;106(35):14978-83.
(47) Khallou-Laschet J, Varthaman A, Fornasa G et al. Macrophage plasticity in
experimental atherosclerosis. PLoS One 2010;5(1):e8852.
(48) Tavakoli S, Asmis R. Reactive oxygen species and thiol redox signaling in the
macrophage biology of atherosclerosis. Antioxid Redox Signal 2012 December
15;17(12):1785-95.
(49) Hazen SL. Oxidized phospholipids as endogenous pattern recognition ligands in innate
immunity. J Biol Chem 2008 June 6;283(23):15527-31.
(50) Fessler MB, Parks JS. Intracellular lipid flux and membrane microdomains as
organizing principles in inflammatory cell signaling. J Immunol 2011 August
15;187(4):1529-35.
(51) Glass CK, Witztum JL. Atherosclerosis. the road ahead. Cell 2001 February
23;104(4):503-16.
(52) Robbins CS, Hilgendorf I, Weber GF et al. Local proliferation dominates lesional
macrophage accumulation in atherosclerosis. Nat Med 2013 September;19(9):1166-72.
(53) Andres V, Pello OM, Silvestre-Roig C. Macrophage proliferation and apoptosis in
atherosclerosis. Curr Opin Lipidol 2012 October;23(5):429-38.
171
(54) Cominacini L, Garbin U, Mozzini C et al. The atherosclerotic plaque vulnerability:
focus on the oxidative and endoplasmic reticulum stress in orchestrating the
macrophage apoptosis in the formation of the necrotic core. Curr Med Chem
2015;22(13):1565-72.
(55) Wigren M, Nilsson J, Kolbus D. Lymphocytes in atherosclerosis. Clin Chim Acta 2012
October 9;413(19-20):1562-8.
(56) Jongstra-Bilen J, Haidari M, Zhu SN, Chen M, Guha D, Cybulsky MI. Low-grade
chronic inflammation in regions of the normal mouse arterial intima predisposed to
atherosclerosis. J Exp Med 2006 September 4;203(9):2073-83.
(57) Liu P, Yu YR, Spencer JA et al. CX3CR1 deficiency impairs dendritic cell
accumulation in arterial intima and reduces atherosclerotic burden. Arterioscler Thromb
Vasc Biol 2008 February;28(2):243-50.
(58) Nickel T, Schmauss D, Hanssen H et al. oxLDL uptake by dendritic cells induces
upregulation of scavenger-receptors, maturation and differentiation. Atherosclerosis
2009 August;205(2):442-50.
(59) Goossens P, Gijbels MJ, Zernecke A et al. Myeloid type I interferon signaling promotes
atherosclerosis by stimulating macrophage recruitment to lesions. Cell Metab 2010
August 4;12(2):142-53.
(60) Niessner A, Sato K, Chaikof EL, Colmegna I, Goronzy JJ, Weyand CM. Pathogen-
sensing plasmacytoid dendritic cells stimulate cytotoxic T-cell function in the
atherosclerotic plaque through interferon-alpha. Circulation 2006 December
5;114(23):2482-9.
(61) Yilmaz A, Lochno M, Traeg F et al. Emergence of dendritic cells in rupture-prone
regions of vulnerable carotid plaques. Atherosclerosis 2004 September;176(1):101-10.
(62) Majesky MW. Developmental basis of vascular smooth muscle diversity. Arterioscler
Thromb Vasc Biol 2007 June;27(6):1248-58.
(63) Haimovici H, Maier N, STRAUSS L. Fate of aortic homografts in experimental canine
atherosclerosis. II. Study of fresh abdominal aortic implants into abdominal aorta. AMA
Arch Surg 1959 February;78(2):239-45.
(64) Haimovici H, Maier N. Experimental coronary atherosclerosis in the dog. Bull Soc Int
Chir 1962 November;21:634-41.
(65) Alexander MR, Owens GK. Epigenetic control of smooth muscle cell differentiation
and phenotypic switching in vascular development and disease. Annu Rev Physiol
2012;74:13-40.
(66) Libby P. Collagenases and cracks in the plaque. J Clin Invest 2013
August;123(8):3201-3.
172
(67) Ross R, Glomset JA. Atherosclerosis and the arterial smooth muscle cell: Proliferation
of smooth muscle is a key event in the genesis of the lesions of atherosclerosis. Science
1973 June 29;180(4093):1332-9.
(68) Feil S, Fehrenbacher B, Lukowski R et al. Transdifferentiation of vascular smooth
muscle cells to macrophage-like cells during atherogenesis. Circ Res 2014 September
12;115(7):662-7.
(69) Iwata H, Manabe I, Fujiu K et al. Bone marrow-derived cells contribute to vascular
inflammation but do not differentiate into smooth muscle cell lineages. Circulation
2010 November 16;122(20):2048-57.
(70) Caplice NM, Bunch TJ, Stalboerger PG et al. Smooth muscle cells in human coronary
atherosclerosis can originate from cells administered at marrow transplantation. Proc
Natl Acad Sci U S A 2003 April 15;100(8):4754-9.
(71) Allahverdian S, Chehroudi AC, McManus BM, Abraham T, Francis GA. Contribution
of intimal smooth muscle cells to cholesterol accumulation and macrophage-like cells
in human atherosclerosis. Circulation 2014 April 15;129(15):1551-9.
(72) Vengrenyuk Y, Nishi H, Long X et al. Cholesterol loading reprograms the microRNA-
143/145-myocardin axis to convert aortic smooth muscle cells to a dysfunctional
macrophage-like phenotype. Arterioscler Thromb Vasc Biol 2015 March;35(3):535-46.
(73) Getz GS, Reardon CA. Animal models of atherosclerosis. Arterioscler Thromb Vasc
Biol 2012 May;32(5):1104-15.
(74) Combadiere C, Potteaux S, Rodero M et al. Combined inhibition of CCL2, CX3CR1,
and CCR5 abrogates Ly6C(hi) and Ly6C(lo) monocytosis and almost abolishes
atherosclerosis in hypercholesterolemic mice. Circulation 2008 April 1;117(13):1649-
57.
(75) Xiao Q. Genetically manipulated models of atherosclerosis in mice. Methods Mol Med
2001;52:15-26.
(76) Nishina PM, Verstuyft J, Paigen B. Synthetic low and high fat diets for the study of
atherosclerosis in the mouse. J Lipid Res 1990 May;31(5):859-69.
(77) Lichtman AH, Clinton SK, Iiyama K, Connelly PW, Libby P, Cybulsky MI.
Hyperlipidemia and atherosclerotic lesion development in LDL receptor-deficient mice
fed defined semipurified diets with and without cholate. Arterioscler Thromb Vasc Biol
1999 August;19(8):1938-44.
(78) Getz GS, Reardon CA. Diet and murine atherosclerosis. Arterioscler Thromb Vasc Biol
2006 February;26(2):242-9.
(79) Paigen B, Morrow A, Holmes PA, Mitchell D, Williams RA. Quantitative assessment
of atherosclerotic lesions in mice. Atherosclerosis 1987 December;68(3):231-40.
173
(80) Stewart-Phillips JL, Lough J. Pathology of atherosclerosis in cholesterol-fed,
susceptible mice. Atherosclerosis 1991 October;90(2-3):211-8.
(81) Mahley RW, Weisgraber KH, Huang Y. Apolipoprotein E: structure determines
function, from atherosclerosis to Alzheimer's disease to AIDS. J Lipid Res 2009
April;50 Suppl:S183-S188.
(82) Brown MS, Goldstein JL. A receptor-mediated pathway for cholesterol homeostasis.
Science 1986 April 4;232(4746):34-47.
(83) Sehayek E, Shefer S, Nguyen LB, Ono JG, Merkel M, Breslow JL. Apolipoprotein E
regulates dietary cholesterol absorption and biliary cholesterol excretion: studies in
C57BL/6 apolipoprotein E knockout mice. Proc Natl Acad Sci U S A 2000 March
28;97(7):3433-7.
(84) Zhang SH, Reddick RL, Piedrahita JA, Maeda N. Spontaneous hypercholesterolemia
and arterial lesions in mice lacking apolipoprotein E. Science 1992 October
16;258(5081):468-71.
(85) Nakashima Y, Plump AS, Raines EW, Breslow JL, Ross R. ApoE-deficient mice
develop lesions of all phases of atherosclerosis throughout the arterial tree. Arterioscler
Thromb 1994 January;14(1):133-40.
(86) Smith JD, Breslow JL. The emergence of mouse models of atherosclerosis and their
relevance to clinical research. J Intern Med 1997 August;242(2):99-109.
(87) Calara F, Silvestre M, Casanada F, Yuan N, Napoli C, Palinski W. Spontaneous plaque
rupture and secondary thrombosis in apolipoprotein E-deficient and LDL receptor-
deficient mice. J Pathol 2001 September;195(2):257-63.
(88) de NR, Verkleij CJ, von der Thusen JH et al. Lesional overexpression of matrix
metalloproteinase-9 promotes intraplaque hemorrhage in advanced lesions but not at
earlier stages of atherogenesis. Arterioscler Thromb Vasc Biol 2006
February;26(2):340-6.
(89) Gough PJ, Gomez IG, Wille PT, Raines EW. Macrophage expression of active MMP-9
induces acute plaque disruption in apoE-deficient mice. J Clin Invest 2006
January;116(1):59-69.
(90) Johnson JL, George SJ, Newby AC, Jackson CL. Divergent effects of matrix
metalloproteinases 3, 7, 9, and 12 on atherosclerotic plaque stability in mouse
brachiocephalic arteries. Proc Natl Acad Sci U S A 2005 October 25;102(43):15575-80.
(91) Lee KB, Loganathan D, Merchant ZM, Linhardt RJ. Carbohydrate analysis of
glycoproteins. A review. Appl Biochem Biotechnol 1990 January;23(1):53-80.
174
(92) Raines EW. The extracellular matrix can regulate vascular cell migration, proliferation,
and survival: relationships to vascular disease. Int J Exp Pathol 2000 June;81(3):173-
82.
(93) Reinhardt DP, Chalberg SC, Sakai LY. The structure and function of fibrillin. Ciba
Found Symp 1995;192:128-43.
(94) Van Herck JL, De Meyer GR, Martinet W et al. Impaired fibrillin-1 function promotes
features of plaque instability in apolipoprotein E-deficient mice. Circulation 2009
December 15;120(24):2478-87.
(95) Ruoslahti E. Fibronectin and its receptors. Annu Rev Biochem 1988;57:375-413.
(96) Timpl R, Brown JC. The laminins. Matrix Biol 1994 August;14(4):275-81.
(97) Rohwedder I, Montanez E, Beckmann K et al. Plasma fibronectin deficiency impedes
atherosclerosis progression and fibrous cap formation. EMBO Mol Med 2012
July;4(7):564-76.
(98) Rentz TJ, Poobalarahi F, Bornstein P, Sage EH, Bradshaw AD. SPARC regulates
processing of procollagen I and collagen fibrillogenesis in dermal fibroblasts. J Biol
Chem 2007 July 27;282(30):22062-71.
(99) Moura R, Tjwa M, Vandervoort P, Van KS, Holvoet P, Hoylaerts MF.
Thrombospondin-1 deficiency accelerates atherosclerotic plaque maturation in ApoE-/-
mice. Circ Res 2008 November 7;103(10):1181-9.
(100) Iozzo RV, Murdoch AD. Proteoglycans of the extracellular environment: clues from the
gene and protein side offer novel perspectives in molecular diversity and function.
FASEB J 1996 April;10(5):598-614.
(101) Camejo G, Olofsson SO, Lopez F, Carlsson P, Bondjers G. Identification of Apo B-100
segments mediating the interaction of low density lipoproteins with arterial
proteoglycans. Arteriosclerosis 1988 July;8(4):368-77.
(102) Shimizu-Hirota R, Sasamura H, Kuroda M, Kobayashi E, Hayashi M, Saruta T.
Extracellular matrix glycoprotein biglycan enhances vascular smooth muscle cell
proliferation and migration. Circ Res 2004 April 30;94(8):1067-74.
(103) Nili N, Cheema AN, Giordano FJ et al. Decorin inhibition of PDGF-stimulated vascular
smooth muscle cell function: potential mechanism for inhibition of intimal hyperplasia
after balloon angioplasty. Am J Pathol 2003 September;163(3):869-78.
(104) Schaefer L, Babelova A, Kiss E et al. The matrix component biglycan is
proinflammatory and signals through Toll-like receptors 4 and 2 in macrophages. J Clin
Invest 2005 August;115(8):2223-33.
175
(105) Frey H, Schroeder N, Manon-Jensen T, Iozzo RV, Schaefer L. Biological interplay
between proteoglycans and their innate immune receptors in inflammation. FEBS J
2013 May;280(10):2165-79.
(106) Merline R, Moreth K, Beckmann J et al. Signaling by the matrix proteoglycan decorin
controls inflammation and cancer through PDCD4 and MicroRNA-21. Sci Signal
2011;4(199):ra75.
(107) Mithieux SM, Weiss AS. Elastin. Adv Protein Chem 2005;70:437-61.
(108) Kagan HM, Cai P. Isolation of active site peptides of lysyl oxidase. Methods Enzymol
1995;258:122-32.
(109) Shapiro SD, Endicott SK, Province MA, Pierce JA, Campbell EJ. Marked longevity of
human lung parenchymal elastic fibers deduced from prevalence of D-aspartate and
nuclear weapons-related radiocarbon. J Clin Invest 1991 May;87(5):1828-34.
(110) Li DY, Brooke B, Davis EC et al. Elastin is an essential determinant of arterial
morphogenesis. Nature 1998 May 21;393(6682):276-80.
(111) Krettek A, Sukhova GK, Libby P. Elastogenesis in human arterial disease: a role for
macrophages in disordered elastin synthesis. Arterioscler Thromb Vasc Biol 2003 April
1;23(4):582-7.
(112) Hornebeck W, Emonard H. The cell-elastin-elastase(s) interacting triade directs
elastolysis. Front Biosci (Landmark Ed) 2011;16:707-22.
(113) Faury G, Ristori MT, Verdetti J, Jacob MP, Robert L. Effect of elastin peptides on
vascular tone. J Vasc Res 1995 March;32(2):112-9.
(114) Senior RM, Griffin GL, Mecham RP, Wrenn DS, Prasad KU, Urry DW. Val-Gly-Val-
Ala-Pro-Gly, a repeating peptide in elastin, is chemotactic for fibroblasts and
monocytes. J Cell Biol 1984 September;99(3):870-4.
(115) Fulop T, Jr., Larbi A, Fortun A, Robert L, Khalil A. Elastin peptides induced oxidation
of LDL by phagocytic cells. Pathol Biol (Paris) 2005 September;53(7):416-23.
(116) Mochizuki S, Brassart B, Hinek A. Signaling pathways transduced through the elastin
receptor facilitate proliferation of arterial smooth muscle cells. J Biol Chem 2002
November 22;277(47):44854-63.
(117) Simionescu A, Simionescu DT, Vyavahare NR. Osteogenic responses in fibroblasts
activated by elastin degradation products and transforming growth factor-beta1: role of
myofibroblasts in vascular calcification. Am J Pathol 2007 July;171(1):116-23.
(118) Gayral S, Garnotel R, Castaing-Berthou A et al. Elastin-derived peptides potentiate
atherosclerosis through the immune Neu1-PI3Kgamma pathway. Cardiovasc Res 2014
April 1;102(1):118-27.
176
(119) Di Lullo GA, Sweeney SM, Korkko J, Ala-Kokko L, San Antonio JD. Mapping the
ligand-binding sites and disease-associated mutations on the most abundant protein in
the human, type I collagen. J Biol Chem 2002 February 8;277(6):4223-31.
(120) Myllyharju J, Kivirikko KI. Collagens, modifying enzymes and their mutations in
humans, flies and worms. Trends Genet 2004 January;20(1):33-43.
(121) Kelleher CM, McLean SE, Mecham RP. Vascular extracellular matrix and aortic
development. Curr Top Dev Biol 2004;62:153-88.
(122) Brodsky B, Persikov AV. Molecular structure of the collagen triple helix. Adv Protein
Chem 2005;70:301-39.
(123) Ricard-Blum S. The collagen family. Cold Spring Harb Perspect Biol 2011
January;3(1):a004978.
(124) Myllyharju J. Intracellular post-translational modifications of collagens. Top Curr
Chem 2005;247:115-47.
(125) Boudko SP, Engel J, Bachinger HP. The crucial role of trimerization domains in
collagen folding. Int J Biochem Cell Biol 2012 January;44(1):21-32.
(126) Ellgaard L, Ruddock LW. The human protein disulphide isomerase family: substrate
interactions and functional properties. EMBO Rep 2005 January;6(1):28-32.
(127) Widmer C, Gebauer JM, Brunstein E et al. Molecular basis for the action of the
collagen-specific chaperone Hsp47/SERPINH1 and its structure-specific client
recognition. Proc Natl Acad Sci U S A 2012 August 14;109(33):13243-7.
(128) Canty EG, Lu Y, Meadows RS, Shaw MK, Holmes DF, Kadler KE. Coalignment of
plasma membrane channels and protrusions (fibripositors) specifies the parallelism of
tendon. J Cell Biol 2004 May 24;165(4):553-63.
(129) Hopkins DR, Keles S, Greenspan DS. The bone morphogenetic protein 1/Tolloid-like
metalloproteinases. Matrix Biol 2007 September;26(7):508-23.
(130) Porter S, Clark IM, Kevorkian L, Edwards DR. The ADAMTS metalloproteinases.
Biochem J 2005 February 15;386(Pt 1):15-27.
(131) Hulmes DJS. Building collagen molecules, fibrils, and suprafibrillar structures. J Struct
Biol 2002;137:2-10.
(132) Schmitt FO, Hall CE, Jakus MA. Electron microscope investigations of the structure of
collagen. J Cell Comp Physiol 1942;20:11-33.
(133) Wenstrup RJ, Florer JB, Brunskill EW, Bell SM, Chervoneva I, Birk DE. Type V
collagen controls the initiation of collagen fibril assembly. J Biol Chem 2004 December
17;279(51):53331-7.
177
(134) Kadler KE, Holmes DF, Trotter JA, Chapman JA. Collagen fibril formation. Biochem J
1996 May 15;316 ( Pt 1):1-11.
(135) Kalamajski S, Oldberg A. The role of small leucine-rich proteoglycans in collagen
fibrillogenesis. Matrix Biol 2010 May;29(4):248-53.
(136) Eyre DR, Weis MA, Wu JJ. Advances in collagen cross-link analysis. Methods 2008
May;45(1):65-74.
(137) Rucker RB, Murray J. Cross-linking amino acids in collagen and elastin. Am J Clin
Nutr 1978 July;31(7):1221-36.
(138) Orgel JP, Wess TJ, Miller A. The in situ conformation and axial location of the
intermolecular cross-linked non-helical telopeptides of type I collagen. Structure 2000
February 15;8(2):137-42.
(139) Kadler KE, Baldock C, Bella J, Boot-Handford RP. Collagens at a glance. J Cell Sci
2007 June 15;120(Pt 12):1955-8.
(140) Huxley-Jones J, Robertson DL, Boot-Handford RP. On the origins of the extracellular
matrix in vertebrates. Matrix Biol 2007 January;26(1):2-11.
(141) Wu JJ, Weis MA, Kim LS, Eyre DR. Type III collagen, a fibril network modifier in
articular cartilage. J Biol Chem 2010 June 11;285(24):18537-44.
(142) Voss B, Rauterberg J. Localization of collagen types I, III, IV and V, fibronectin and
laminin in human arteries by the indirect immunofluorescence method. Pathol Res
Pract 1986 October;181(5):568-75.
(143) Silver FH, Horvath I, Foran DJ. Viscoelasticity of the vessel wall: the role of collagen
and elastic fibers. Crit Rev Biomed Eng 2001;29(3):279-301.
(144) Katsuda S, Okada Y, Minamoto T, Oda Y, Matsui Y, Nakanishi I. Collagens in human
atherosclerosis. Immunohistochemical analysis using collagen type-specific antibodies.
Arterioscler Thromb 1992 April;12(4):494-502.
(145) Amenta PS, Scivoletti NA, Newman MD, Sciancalepore JP, Li D, Myers JC.
Proteoglycan-collagen XV in human tissues is seen linking banded collagen fibers
subjacent to the basement membrane. J Histochem Cytochem 2005 February;53(2):165-
76.
(146) Vanacore RM, Friedman DB, Ham AJ, Sundaramoorthy M, Hudson BG. Identification
of S-hydroxylysyl-methionine as the covalent cross-link of the noncollagenous (NC1)
hexamer of the alpha1alpha1alpha2 collagen IV network: a role for the post-
translational modification of lysine 211 to hydroxylysine 211 in hexamer assembly. J
Biol Chem 2005 August 12;280(32):29300-10.
178
(147) Okada Y, Katsuda S, Matsui Y, Watanabe H, Nakanishi I. Collagen synthesis by
cultured arterial smooth muscle cells during spontaneous phenotypic modulation. Acta
Pathol Jpn 1990 March;40(3):157-64.
(148) Sutmuller M, Bruijn JA, De HE. Collagen types VIII and X, two non-fibrillar, short-
chain collagens. Structure homologies, functions and involvement in pathology. Histol
Histopathol 1997 April;12(2):557-66.
(149) Kittelberger R, Davis PF, Stehbens WE. Type VI collagen in experimental
atherosclerosis. Experientia 1990 March 15;46(3):264-7.
(150) Gordon MK, Hahn RA. Collagens. Cell Tissue Res 2010 January;339(1):247-57.
(151) Hynes RO. Integrins: bidirectional, allosteric signaling machines. Cell 2002 September
20;110(6):673-87.
(152) Emsley J, King SL, Bergelson JM, Liddington RC. Crystal structure of the I domain
from integrin alpha2beta1. J Biol Chem 1997 November 7;272(45):28512-7.
(153) Legate KR, Wickstrom SA, Fassler R. Genetic and cell biological analysis of integrin
outside-in signaling. Genes Dev 2009 February 15;23(4):397-418.
(154) Arora PD, Manolson MF, Downey GP, Sodek J, McCulloch CA. A novel model system
for characterization of phagosomal maturation, acidification, and intracellular collagen
degradation in fibroblasts. J Biol Chem 2000 November 10;275(45):35432-41.
(155) Arora PD, Glogauer M, Kapus A, Kwiatkowski DJ, McCulloch CA. Gelsolin mediates
collagen phagocytosis through a rac-dependent step. Mol Biol Cell 2004
February;15(2):588-99.
(156) Popova SN, Lundgren-Akerlund E, Wiig H, Gullberg D. Physiology and pathology of
collagen receptors. Acta Physiol (Oxf) 2007 July;190(3):179-87.
(157) Kern A, Eble J, Golbik R, Kuhn K. Interaction of type IV collagen with the isolated
integrins alpha 1 beta 1 and alpha 2 beta 1. Eur J Biochem 1993 July 1;215(1):151-9.
(158) Tulla M, Pentikainen OT, Viitasalo T et al. Selective binding of collagen subtypes by
integrin alpha 1I, alpha 2I, and alpha 10I domains. J Biol Chem 2001 December
21;276(51):48206-12.
(159) Siljander PR, Hamaia S, Peachey AR et al. Integrin activation state determines
selectivity for novel recognition sites in fibrillar collagens. J Biol Chem 2004
November 12;279(46):47763-72.
(160) Bella J, Humphries MJ. Calpha-H...O = C hydrogen bonds contribute to the specificity
of RGD cell-adhesion interactions. BMC Struct Biol 2005;5:4.
179
(161) Yamamoto M, Yamato M, Aoyagi M, Yamamoto K. Identification of integrins
involved in cell adhesion to native and denatured type I collagens and the phenotypic
transition of rabbit arterial smooth muscle cells. Exp Cell Res 1995 July;219(1):249-56.
(162) Eble JA, Golbik R, Mann K, Kuhn K. The alpha 1 beta 1 integrin recognition site of the
basement membrane collagen molecule [alpha 1(IV)]2 alpha 2(IV). EMBO J 1993
December;12(12):4795-802.
(163) Schapira K, Lutgens E, de FA et al. Genetic deletion or antibody blockade of
alpha1beta1 integrin induces a stable plaque phenotype in ApoE-/- mice. Arterioscler
Thromb Vasc Biol 2005 September;25(9):1917-24.
(164) Gotwals PJ, Chi-Rosso G, Lindner V et al. The alpha1beta1 integrin is expressed
during neointima formation in rat arteries and mediates collagen matrix reorganization.
J Clin Invest 1996 June 1;97(11):2469-77.
(165) Li S, Van Den Diepstraten C, D'Souza SJ, Chan BM, Pickering JG. Vascular smooth
muscle cells orchestrate the assembly of type I collagen via alpha2beta1 integrin,
RhoA, and fibronectin polymerization. Am J Pathol 2003 September;163(3):1045-56.
(166) Hollenbeck ST, Itoh H, Louie O, Faries PL, Liu B, Kent KC. Type I collagen
synergistically enhances PDGF-induced smooth muscle cell proliferation through
pp60src-dependent crosstalk between the alpha2beta1 integrin and PDGFbeta receptor.
Biochem Biophys Res Commun 2004 December 3;325(1):328-37.
(167) Bendeck MP, Irvin C, Reidy M et al. Smooth muscle cell matrix metalloproteinase
production is stimulated via alpha(v)beta(3) integrin. Arterioscler Thromb Vasc Biol
2000 June;20(6):1467-72.
(168) Maile LA, Busby WH, Nichols TC et al. A monoclonal antibody against alphaVbeta3
integrin inhibits development of atherosclerotic lesions in diabetic pigs. Sci Transl Med
2010 February 10;2(18):18ra11.
(169) Vogel W. Discoidin domain receptors: structural relations and functional implications.
FASEB J 1999;13 Suppl:S77-S82.
(170) Mihai C, Chotani M, Elton TS, Agarwal G. Mapping of DDR1 distribution and
oligomerization on the cell surface by FRET microscopy. J Mol Biol 2009 January
16;385(2):432-45.
(171) Alves F, Saupe S, Ledwon M, Schaub F, Hiddemann W, Vogel WF. Identification of
two novel, kinase-deficient variants of discoidin domain receptor 1: differential
expression in human colon cancer cell lines. FASEB J 2001 May;15(7):1321-3.
(172) Hou G, Vogel W, Bendeck MP. The discoidin domain receptor tyrosine kinase DDR1
in arterial wound repair. J Clin Invest 2001 March;107(6):727-35.
180
(173) Leitinger B, Kwan AP. The discoidin domain receptor DDR2 is a receptor for type X
collagen. Matrix Biol 2006 August;25(6):355-64.
(174) Shrivastava A, Radziejewski C, Campbell E et al. An orphan receptor tyrosine kinase
family whose members serve as nonintegrin collagen receptors. Mol Cell 1997
December;1(1):25-34.
(175) Vogel W, Gish GD, Alves F, Pawson T. The discoidin domain receptor tyrosine kinases
are activated by collagen. Mol Cell 1997 December;1(1):13-23.
(176) Konitsiotis AD, Raynal N, Bihan D, Hohenester E, Farndale RW, Leitinger B.
Characterization of high affinity binding motifs for the discoidin domain receptor
DDR2 in collagen. J Biol Chem 2008 March 14;283(11):6861-8.
(177) Xu H, Raynal N, Stathopoulos S, Myllyharju J, Farndale RW, Leitinger B. Collagen
binding specificity of the discoidin domain receptors: binding sites on collagens II and
III and molecular determinants for collagen IV recognition by DDR1. Matrix Biol 2011
January;30(1):16-26.
(178) Leitinger B. Molecular analysis of collagen binding by the human discoidin domain
receptors, DDR1 and DDR2. Identification of collagen binding sites in DDR2. J Biol
Chem 2003 May 9;278(19):16761-9.
(179) Vogel WF, Abdulhussein R, Ford CE. Sensing extracellular matrix: an update on
discoidin domain receptor function. Cell Signal 2006 August;18(8):1108-16.
(180) Lu KK, Trcka D, Bendeck MP. Collagen stimulates discoidin domain receptor 1-
mediated migration of smooth muscle cells through Src. Cardiovasc Pathol 2011
March;20(2):71-6.
(181) Koo DH, McFadden C, Huang Y, Abdulhussein R, Friese-Hamim M, Vogel WF.
Pinpointing phosphotyrosine-dependent interactions downstream of the collagen
receptor DDR1. FEBS Lett 2006 January 9;580(1):15-22.
(182) Curat CA, Vogel WF. Discoidin domain receptor 1 controls growth and adhesion of
mesangial cells. J Am Soc Nephrol 2002 November;13(11):2648-56.
(183) Lin KL, Chou CH, Hsieh SC, Hwa SY, Lee MT, Wang FF. Transcriptional
upregulation of DDR2 by ATF4 facilitates osteoblastic differentiation through p38
MAPK-mediated Runx2 activation. J Bone Miner Res 2010 November;25(11):2489-
503.
(184) Xu H, Bihan D, Chang F, Huang PH, Farndale RW, Leitinger B. Discoidin domain
receptors promote alpha1beta1- and alpha2beta1-integrin mediated cell adhesion to
collagen by enhancing integrin activation. PLoS One 2012;7(12):e52209.
(185) Ferri N, Carragher NO, Raines EW. Role of discoidin domain receptors 1 and 2 in
human smooth muscle cell-mediated collagen remodeling: potential implications in
181
atherosclerosis and lymphangioleiomyomatosis. Am J Pathol 2004 May;164(5):1575-
85.
(186) Vogel WF, Aszodi A, Alves F, Pawson T. Discoidin domain receptor 1 tyrosine kinase
has an essential role in mammary gland development. Mol Cell Biol 2001
April;21(8):2906-17.
(187) Franco C, Hou G, Ahmad PJ et al. Discoidin domain receptor 1 (ddr1) deletion
decreases atherosclerosis by accelerating matrix accumulation and reducing
inflammation in low-density lipoprotein receptor-deficient mice. Circ Res 2008 May
23;102(10):1202-11.
(188) Franco C, Britto K, Wong E et al. Discoidin domain receptor 1 on bone marrow-
derived cells promotes macrophage accumulation during atherogenesis. Circ Res 2009
November 20;105(11):1141-8.
(189) Franco C, Ahmad PJ, Hou G, Wong E, Bendeck MP. Increased cell and matrix
accumulation during atherogenesis in mice with vessel wall-specific deletion of
discoidin domain receptor 1. Circ Res 2010 June 11;106(11):1775-83.
(190) Avivi-Green C, Singal M, Vogel WF. Discoidin domain receptor 1-deficient mice are
resistant to bleomycin-induced lung fibrosis. Am J Respir Crit Care Med 2006 August
15;174(4):420-7.
(191) Flamant M, Placier S, Rodenas A et al. Discoidin domain receptor 1 null mice are
protected against hypertension-induced renal disease. J Am Soc Nephrol 2006
December;17(12):3374-81.
(192) Gross O, Girgert R, Beirowski B et al. Loss of collagen-receptor DDR1 delays renal
fibrosis in hereditary type IV collagen disease. Matrix Biol 2010 June;29(5):346-56.
(193) Agarwal G, Mihai C, Iscru DF. Interaction of discoidin domain receptor 1 with
collagen type 1. J Mol Biol 2007 March 23;367(2):443-55.
(194) Blissett AR, Garbellini D, Calomeni EP, Mihai C, Elton TS, Agarwal G. Regulation of
collagen fibrillogenesis by cell-surface expression of kinase dead DDR2. J Mol Biol
2009 January 23;385(3):902-11.
(195) Flynn LA, Blissett AR, Calomeni EP, Agarwal G. Inhibition of collagen fibrillogenesis
by cells expressing soluble extracellular domains of DDR1 and DDR2. J Mol Biol 2010
January 22;395(3):533-43.
(196) Afonso PV, McCann CP, Kapnick SM, Parent CA. Discoidin domain receptor 2
regulates neutrophil chemotaxis in 3D collagen matrices. Blood 2013 February
28;121(9):1644-50.
182
(197) Chen SC, Wang BW, Wang DL, Shyu KG. Hypoxia induces discoidin domain
receptor-2 expression via the p38 pathway in vascular smooth muscle cells to increase
their migration. Biochem Biophys Res Commun 2008 October 3;374(4):662-7.
(198) Hou G, Vogel WF, Bendeck MP. Tyrosine kinase activity of discoidin domain receptor
1 is necessary for smooth muscle cell migration and matrix metalloproteinase
expression. Circ Res 2002 June 14;90(11):1147-9.
(199) Ju GX, Hu YB, Du MR, Jiang JL. Discoidin domain receptors (DDRs): potential
implications in atherosclerosis. Eur J Pharmacol 2015 March 15;751:28-33.
(200) Virmani R, Burke AP, Kolodgie FD, Farb A. Vulnerable plaque: the pathology of
unstable coronary lesions. J Interv Cardiol 2002 December;15(6):439-46.
(201) Burke AP, Farb A, Malcom GT, Liang Y, Smialek JE, Virmani R. Plaque rupture and
sudden death related to exertion in men with coronary artery disease. JAMA 1999
March 10;281(10):921-6.
(202) Sukhova GK, Schonbeck U, Rabkin E et al. Evidence for increased collagenolysis by
interstitial collagenases-1 and -3 in vulnerable human atheromatous plaques.
Circulation 1999 May 18;99(19):2503-9.
(203) Van der Donckt C, Van Herck JL, Schrijvers DM et al. Elastin fragmentation in
atherosclerotic mice leads to intraplaque neovascularization, plaque rupture, myocardial
infarction, stroke, and sudden death. Eur Heart J 2015 May 1;36(17):1049-58.
(204) Tabas I. Consequences and therapeutic implications of macrophage apoptosis in
atherosclerosis: the importance of lesion stage and phagocytic efficiency. Arterioscler
Thromb Vasc Biol 2005 November;25(11):2255-64.
(205) Thorp E, Li G, Seimon TA, Kuriakose G, Ron D, Tabas I. Reduced apoptosis and
plaque necrosis in advanced atherosclerotic lesions of Apoe-/- and Ldlr-/- mice lacking
CHOP. Cell Metab 2009 May;9(5):474-81.
(206) Daugherty A, Manning MW, Cassis LA. Angiotensin II promotes atherosclerotic
lesions and aneurysms in apolipoprotein E-deficient mice. J Clin Invest 2000
June;105(11):1605-12.
(207) Ishibashi M, Egashira K, Zhao Q et al. Bone marrow-derived monocyte
chemoattractant protein-1 receptor CCR2 is critical in angiotensin II-induced
acceleration of atherosclerosis and aneurysm formation in hypercholesterolemic mice.
Arterioscler Thromb Vasc Biol 2004 November;24(11):e174-e178.
(208) Ni W, Kitamoto S, Ishibashi M et al. Monocyte chemoattractant protein-1 is an
essential inflammatory mediator in angiotensin II-induced progression of established
atherosclerosis in hypercholesterolemic mice. Arterioscler Thromb Vasc Biol 2004
March;24(3):534-9.
183
(209) Satoh K, Nigro P, Matoba T et al. Cyclophilin A enhances vascular oxidative stress and
the development of angiotensin II-induced aortic aneurysms. Nat Med 2009
June;15(6):649-56.
(210) Sato K, Nakano K, Katsuki S et al. Dietary cholesterol oxidation products accelerate
plaque destabilization and rupture associated with monocyte infiltration/activation via
the MCP-1-CCR2 pathway in mouse brachiocephalic arteries: therapeutic effects of
ezetimibe. J Atheroscler Thromb 2012;19(11):986-98.
(211) Smith EB. THE INFLUENCE OF AGE AND ATHEROSCLEROSIS ON THE
CHEMISTRY OF AORTIC INTIMA.2. COLLAGEN AND
MUCOPOLYSACCHARIDES. J Atheroscler Res 1965 March;5(2):241-8.
(212) Koyama H, Raines EW, Bornfeldt KE, Roberts JM, Ross R. Fibrillar collagen inhibits
arterial smooth muscle proliferation through regulation of Cdk2 inhibitors. Cell 1996
December 13;87(6):1069-78.
(213) Liu B, Itoh H, Louie O, Kubota K, Kent KC. The role of phospholipase C and
phosphatidylinositol 3-kinase in vascular smooth muscle cell migration and
proliferation. J Surg Res 2004 August;120(2):256-65.
(214) Amento EP, Ehsani N, Palmer H, Libby P. Cytokines and growth factors positively and
negatively regulate interstitial collagen gene expression in human vascular smooth
muscle cells. Arterioscler Thromb 1991 September;11(5):1223-30.
(215) Jimi S, Saku K, Uesugi N, Sakata N, Takebayashi S. Oxidized low density lipoprotein
stimulates collagen production in cultured arterial smooth muscle cells. Atherosclerosis
1995 July;116(1):15-26.
(216) Rekhter MD. Collagen synthesis in atherosclerosis: too much and not enough.
Cardiovasc Res 1999 February;41(2):376-84.
(217) Gupta S, Pablo AM, Jiang X, Wang N, Tall AR, Schindler C. IFN-gamma potentiates
atherosclerosis in ApoE knock-out mice. J Clin Invest 1997 June 1;99(11):2752-61.
(218) Ovchinnikova O, Robertson AK, Wagsater D et al. T-cell activation leads to reduced
collagen maturation in atherosclerotic plaques of Apoe(-/-) mice. Am J Pathol 2009
February;174(2):693-700.
(219) Ovchinnikova OA, Folkersen L, Persson J et al. The collagen cross-linking enzyme
lysyl oxidase is associated with the healing of human atherosclerotic lesions. J Intern
Med 2014 November;276(5):525-36.
(220) Schieffer B, Selle T, Hilfiker A et al. Impact of interleukin-6 on plaque development
and morphology in experimental atherosclerosis. Circulation 2004 November
30;110(22):3493-500.
184
(221) Woessner JF, Jr. Matrix metalloproteinases and their inhibitors in connective tissue
remodeling. FASEB J 1991 May;5(8):2145-54.
(222) Zhang K, Meng X, Kong J et al. Simvastatin increases Prolyl-4-Hydroxylase alpha1
expression in atherosclerotic plaque and ox-LDL-stimulated human aortic smooth
muscle cells via p38 MAPK and ERK1/2 signaling. J Mol Cell Cardiol 2013
December;65:43-50.
(223) Nagase H, Visse R, Murphy G. Structure and function of matrix metalloproteinases and
TIMPs. Cardiovasc Res 2006 February 15;69(3):562-73.
(224) Van Wart HE, Birkedal-Hansen H. The cysteine switch: a principle of regulation of
metalloproteinase activity with potential applicability to the entire matrix
metalloproteinase gene family. Proc Natl Acad Sci U S A 1990 July;87(14):5578-82.
(225) Newby AC. Metalloproteinases and vulnerable atherosclerotic plaques. Trends
Cardiovasc Med 2007 November;17(8):253-8.
(226) Galis ZS, Sukhova GK, Lark MW, Libby P. Increased expression of matrix
metalloproteinases and matrix degrading activity in vulnerable regions of human
atherosclerotic plaques. J Clin Invest 1994 December;94(6):2493-503.
(227) Galis ZS, Muszynski M, Sukhova GK et al. Cytokine-stimulated human vascular
smooth muscle cells synthesize a complement of enzymes required for extracellular
matrix digestion. Circ Res 1994 July;75(1):181-9.
(228) Galis ZS, Sukhova GK, Kranzhofer R, Clark S, Libby P. Macrophage foam cells from
experimental atheroma constitutively produce matrix-degrading proteinases. Proc Natl
Acad Sci U S A 1995 January 17;92(2):402-6.
(229) Herman MP, Sukhova GK, Libby P et al. Expression of neutrophil collagenase (matrix
metalloproteinase-8) in human atheroma: a novel collagenolytic pathway suggested by
transcriptional profiling. Circulation 2001 October 16;104(16):1899-904.
(230) Lemaitre V, O'Byrne TK, Borczuk AC, Okada Y, Tall AR, D'Armiento J. ApoE
knockout mice expressing human matrix metalloproteinase-1 in macrophages have less
advanced atherosclerosis. J Clin Invest 2001 May;107(10):1227-34.
(231) Cimmino G, Ragni M, Cirillo P et al. C-reactive protein induces expression of matrix
metalloproteinase-9: a possible link between inflammation and plaque rupture. Int J
Cardiol 2013 September 30;168(2):981-6.
(232) Doronzo G, Russo I, Mattiello L, Trovati M, Anfossi G. C-reactive protein increases
matrix metalloproteinase-2 expression and activity in cultured human vascular smooth
muscle cells. J Lab Clin Med 2005 November;146(5):287-98.
185
(233) Bendeck MP, Zempo N, Clowes AW, Galardy RE, Reidy MA. Smooth muscle cell
migration and matrix metalloproteinase expression after arterial injury in the rat. Circ
Res 1994 September;75(3):539-45.
(234) Bendeck MP, Conte M, Zhang M, Nili N, Strauss BH, Farwell SM. Doxycycline
modulates smooth muscle cell growth, migration, and matrix remodeling after arterial
injury. Am J Pathol 2002 March;160(3):1089-95.
(235) Zempo N, Kenagy RD, Au YP et al. Matrix metalloproteinases of vascular wall cells
are increased in balloon-injured rat carotid artery. J Vasc Surg 1994 August;20(2):209-
17.
(236) Kuzuya M, Nakamura K, Sasaki T, Cheng XW, Itohara S, Iguchi A. Effect of MMP-2
deficiency on atherosclerotic lesion formation in apoE-deficient mice. Arterioscler
Thromb Vasc Biol 2006 May;26(5):1120-5.
(237) Lessner SM, Martinson DE, Galis ZS. Compensatory vascular remodeling during
atherosclerotic lesion growth depends on matrix metalloproteinase-9 activity.
Arterioscler Thromb Vasc Biol 2004 November;24(11):2123-9.
(238) Rao VH, Kansal V, Stoupa S, Agrawal DK. MMP-1 and MMP-9 regulate epidermal
growth factor-dependent collagen loss in human carotid plaque smooth muscle cells.
Physiol Rep 2014 February 1;2(2):e00224.
(239) Johnson JL, Devel L, Czarny B et al. A selective matrix metalloproteinase-12 inhibitor
retards atherosclerotic plaque development in apolipoprotein E-knockout mice.
Arterioscler Thromb Vasc Biol 2011 March;31(3):528-35.
(240) Lyon CA, Johnson JL, Williams H, Sala-Newby GB, George SJ. Soluble N-cadherin
overexpression reduces features of atherosclerotic plaque instability. Arterioscler
Thromb Vasc Biol 2009 February;29(2):195-201.
(241) Muragaki Y, Mattei MG, Yamaguchi N, Olsen BR, Ninomiya Y. The complete primary
structure of the human alpha 1 (VIII) chain and assignment of its gene (COL8A1) to
chromosome 3. Eur J Biochem 1991 May 8;197(3):615-22.
(242) Muragaki Y, Jacenko O, Apte S, Mattei MG, Ninomiya Y, Olsen BR. The alpha
2(VIII) collagen gene. A novel member of the short chain collagen family located on
the human chromosome 1. J Biol Chem 1991 April 25;266(12):7721-7.
(243) Iruela-Arispe ML, Sage EH. Expression of type VIII collagen during morphogenesis of
the chicken and mouse heart. Dev Biol 1991 March;144(1):107-18.
(244) Yamaguchi N, Mayne R, Ninomiya Y. The alpha 1 (VIII) collagen gene is homologous
to the alpha 1 (X) collagen gene and contains a large exon encoding the entire triple
helical and carboxyl-terminal non-triple helical domains of the alpha 1 (VIII)
polypeptide. J Biol Chem 1991 March 5;266(7):4508-13.
186
(245) Yamaguchi N, Benya PD, van der Rest M, Ninomiya Y. The cloning and sequencing of
alpha 1(VIII) collagen cDNAs demonstrate that type VIII collagen is a short chain
collagen and contains triple-helical and carboxyl-terminal non-triple-helical domains
similar to those of type X collagen. J Biol Chem 1989 September 25;264(27):16022-9.
(246) Greenhill NS, Ruger BM, Hasan Q, Davis PF. The alpha1(VIII) and alpha2(VIII)
collagen chains form two distinct homotrimeric proteins in vivo. Matrix Biol 2000
February;19(1):19-28.
(247) Illidge C, Kielty C, Shuttleworth A. The alpha1(VIII) and alpha2(VIII) chains of type
VIII collagen can form stable homotrimeric molecules. J Biol Chem 1998 August
21;273(34):22091-5.
(248) Stephan S, Sherratt MJ, Hodson N, Shuttleworth CA, Kielty CM. Expression and
supramolecular assembly of recombinant alpha1(viii) and alpha2(viii) collagen
homotrimers. J Biol Chem 2004 May 14;279(20):21469-77.
(249) Kvansakul M, Bogin O, Hohenester E, Yayon A. Crystal structure of the collagen
alpha1(VIII) NC1 trimer. Matrix Biol 2003 April;22(2):145-52.
(250) Sage H, Pritzl P, Bornstein P. A unique, pepsin-sensitive collagen synthesized by aortic
endothelial cells in culture. Biochemistry 1980 December 9;19(25):5747-55.
(251) Tamura Y, Konomi H, Sawada H, Takashima S, Nakajima A. Tissue distribution of
type VIII collagen in human adult and fetal eyes. Invest Ophthalmol Vis Sci 1991
August;32(9):2636-44.
(252) Adiguzel E, Hou G, Mulholland D et al. Migration and growth are attenuated in
vascular smooth muscle cells with type VIII collagen-null alleles. Arterioscler Thromb
Vasc Biol 2006 January;26(1):56-61.
(253) Adiguzel E, Ahmad PJ, Franco C, Bendeck MP. Collagens in the progression and
complications of atherosclerosis. Vasc Med 2009 February;14(1):73-89.
(254) Hou G, Mulholland D, Gronska MA, Bendeck MP. Type VIII collagen stimulates
smooth muscle cell migration and matrix metalloproteinase synthesis after arterial
injury. Am J Pathol 2000 February;156(2):467-76.
(255) Kapoor R, Bornstein P, Sage EH. Type VIII collagen from bovine Descemet's
membrane: structural characterization of a triple-helical domain. Biochemistry 1986
July 1;25(13):3930-7.
(256) Hirano S, Yonezawa T, Hasegawa H et al. Astrocytes express type VIII collagen during
the repair process of brain cold injury. Biochem Biophys Res Commun 2004 April
30;317(2):437-43.
(257) Kittelberger R, Davis PF, Flynn DW, Greenhill NS. Distribution of type VIII collagen
in tissues: an immunohistochemical study. Connect Tissue Res 1990;24(3-4):303-18.
187
(258) Sage H, Iruela-Arispe ML. Type VIII collagen in murine development. Association
with capillary formation in vitro. Ann N Y Acad Sci 1990;580:17-31.
(259) Kapoor R, Sakai LY, Funk S, Roux E, Bornstein P, Sage EH. Type VIII collagen has a
restricted distribution in specialized extracellular matrices. J Cell Biol 1988
August;107(2):721-30.
(260) Gray RS, Wilm TP, Smith J et al. Loss of col8a1a function during zebrafish
embryogenesis results in congenital vertebral malformations. Dev Biol 2014 February
1;386(1):72-85.
(261) Bendeck MP, Regenass S, Tom WD et al. Differential expression of alpha 1 type VIII
collagen in injured platelet-derived growth factor-BB--stimulated rat carotid arteries.
Circ Res 1996 September;79(3):524-31.
(262) Plenz G, Dorszewski A, Breithardt G, Robenek H. Expression of type VIII collagen
after cholesterol diet and injury in the rabbit model of atherosclerosis. Arterioscler
Thromb Vasc Biol 1999 May;19(5):1201-9.
(263) Yasuda O, Zhang SH, Miyamoto Y, Maeda N. Differential expression of the alpha1
type VIII collagen gene by smooth muscle cells from atherosclerotic plaques of
apolipoprotein-E-deficient mice. J Vasc Res 2000 May;37(3):158-69.
(264) Yasuda O, Fukuo K, Maeda N, Ogihara T. Elevated expression of type VIII collagen
gene in the atherosclerotic plaque of the ApoE-deficient mouse. Ann N Y Acad Sci 2001
December;947:312-5.
(265) MacBeath JR, Kielty CM, Shuttleworth CA. Type VIII collagen is a product of
vascular smooth-muscle cells in development and disease. Biochem J 1996 November
1;319 ( Pt 3):993-8.
(266) Weitkamp B, Cullen P, Plenz G, Robenek H, Rauterberg J. Human macrophages
synthesize type VIII collagen in vitro and in the atherosclerotic plaque. FASEB J 1999
August;13(11):1445-57.
(267) Turner NJ, Murphy MO, Kielty CM et al. Alpha2(VIII) collagen substrata enhance
endothelial cell retention under acute shear stress flow via an alpha2beta1 integrin-
dependent mechanism: an in vitro and in vivo study. Circulation 2006 August
22;114(8):820-9.
(268) Saelman EU, Nieuwenhuis HK, Hese KM et al. Platelet adhesion to collagen types I
through VIII under conditions of stasis and flow is mediated by GPIa/IIa (alpha 2 beta
1-integrin). Blood 1994 March 1;83(5):1244-50.
(269) Biswas S, Munier FL, Yardley J et al. Missense mutations in COL8A2, the gene
encoding the alpha2 chain of type VIII collagen, cause two forms of corneal endothelial
dystrophy. Hum Mol Genet 2001 October 1;10(21):2415-23.
188
(270) Gottsch JD, Zhang C, Sundin OH, Bell WR, Stark WJ, Green WR. Fuchs corneal
dystrophy: aberrant collagen distribution in an L450W mutant of the COL8A2 gene.
Invest Ophthalmol Vis Sci 2005 December;46(12):4504-11.
(271) Gottsch JD, Sundin OH, Liu SH et al. Inheritance of a novel COL8A2 mutation defines
a distinct early-onset subtype of fuchs corneal dystrophy. Invest Ophthalmol Vis Sci
2005 June;46(6):1934-9.
(272) Meng H, Matthaei M, Ramanan N et al. L450W and Q455K Col8a2 knock-in mouse
models of Fuchs endothelial corneal dystrophy show distinct phenotypes and evidence
for altered autophagy. Invest Ophthalmol Vis Sci 2013 March;54(3):1887-97.
(273) Paulus W, Sage EH, Liszka U, Iruela-Arispe ML, Jellinger K. Increased levels of type
VIII collagen in human brain tumours compared to normal brain tissue and non-
neoplastic cerebral disorders. Br J Cancer 1991 March;63(3):367-71.
(274) Hopfer U, Fukai N, Hopfer H et al. Targeted disruption of Col8a1 and Col8a2 genes in
mice leads to anterior segment abnormalities in the eye. FASEB J 2005
August;19(10):1232-44.
(275) Gerth J, Cohen CD, Hopfer U et al. Collagen type VIII expression in human diabetic
nephropathy. Eur J Clin Invest 2007 October;37(10):767-73.
(276) Hopfer U, Hopfer H, Meyer-Schwesinger C et al. Lack of type VIII collagen in mice
ameliorates diabetic nephropathy. Diabetes 2009 July;58(7):1672-81.
(277) Loeffler I, Liebisch M, Wolf G. Collagen VIII influences epithelial phenotypic changes
in experimental diabetic nephropathy. Am J Physiol Renal Physiol 2012
September;303(5):F733-F745.
(278) Wolf G, Sharma K, Chen Y, Ericksen M, Ziyadeh FN. High glucose-induced
proliferation in mesangial cells is reversed by autocrine TGF-beta. Kidney Int 1992
September;42(3):647-56.
(279) Wolf G, Schroeder R, Zahner G, Stahl RA, Shankland SJ. High glucose-induced
hypertrophy of mesangial cells requires p27(Kip1), an inhibitor of cyclin-dependent
kinases. Am J Pathol 2001 March;158(3):1091-100.
(280) Loeffler I, Hopfer U, Koczan D, Wolf G. Type VIII Collagen Modulates TGF-{beta}1-
induced Proliferation of Mesangial Cells. J Am Soc Nephrol 2011 April;22(4):649-63.
(281) Iruela-Arispe ML, Diglio CA, Sage EH. Modulation of extracellular matrix proteins by
endothelial cells undergoing angiogenesis in vitro. Arterioscler Thromb 1991
July;11(4):805-15.
(282) Skrbic B, Engebretsen KV, Strand ME et al. Lack of collagen VIII reduces fibrosis and
promotes early mortality and cardiac dilatation in pressure overload in mice.
Cardiovasc Res 2015 April 1;106(1):32-42.
189
(283) Sibinga NE, Foster LC, Hsieh CM et al. Collagen VIII is expressed by vascular smooth
muscle cells in response to vascular injury. Circ Res 1997 April;80(4):532-41.
(284) Qiu H, Depre C, Ghosh K et al. Mechanism of gender-specific differences in aortic
stiffness with aging in nonhuman primates. Circulation 2007 August 7;116(6):669-76.
(285) Lyck HM, Beck HC, Irmukhamedov A, Jensen PS, Olsen MH, Rasmussen LM.
Proteome Analysis of Human Arterial Tissue Discloses Associations Between the
Vascular Content of Small Leucine-Rich Repeat Proteoglycans and Pulse Wave
Velocity. Arterioscler Thromb Vasc Biol 2015 June 11.
(286) Adiguzel E, Hou G, Sabatini PJ, Bendeck MP. Type VIII collagen signals via beta1
integrin and RhoA to regulate MMP-2 expression and smooth muscle cell migration.
Matrix Biol 2013 March 21.
(287) Palazzo AF, Cook TA, Alberts AS, Gundersen GG. mDia mediates Rho-regulated
formation and orientation of stable microtubules. Nat Cell Biol 2001 August;3(8):723-
9.
(288) Wen Y, Eng CH, Schmoranzer J et al. EB1 and APC bind to mDia to stabilize
microtubules downstream of Rho and promote cell migration. Nat Cell Biol 2004
September;6(9):820-30.
(289) Ispanovic E, Serio D, Haas TL. Cdc42 and RhoA have opposing roles in regulating
membrane type 1-matrix metalloproteinase localization and matrix metalloproteinase-2
activation. Am J Physiol Cell Physiol 2008 September;295(3):C600-C610.
(290) Cherepanova OA, Pidkovka NA, Sarmento OF et al. Oxidized phospholipids induce
type VIII collagen expression and vascular smooth muscle cell migration. Circ Res
2009 March 13;104(5):609-18.
(291) Plenz G, Dorszewski A, Volker W et al. Cholesterol-induced changes of type VIII
collagen expression and distribution in carotid arteries of rabbit. Arterioscler Thromb
Vasc Biol 1999 October;19(10):2395-404.
(292) Plenz G, Koenig C, Reichenberg S, Robenek H. Colony stimulating factors modulate
the transcription of type VIII collagen in vascular smooth muscle cells. Atherosclerosis
1999 May;144(1):25-32.
(293) Plenz G, Reichenberg S, Koenig C et al. Granulocyte-macrophage colony-stimulating
factor (GM-CSF) modulates the expression of type VIII collagen mRNA in vascular
smooth muscle cells and both are codistributed during atherogenesis. Arterioscler
Thromb Vasc Biol 1999 July;19(7):1658-68.
(294) Lopes J, Adiguzel E, Gu S et al. Type VIII collagen mediates vessel wall remodeling
after arterial injury and fibrous cap formation in atherosclerosis. Am J Pathol 2013
June;182(6):2241-53.
190
(295) Sage H, Trueb B, Bornstein P. Biosynthetic and structural properties of endothelial cell
type VIII collagen. J Biol Chem 1983 November 10;258(21):13391-401.
(296) Zhu Y, Bellosta S, Langer C et al. Low-dose expression of a human apolipoprotein E
transgene in macrophages restores cholesterol efflux capacity of apolipoprotein E-
deficient mouse plasma. Proc Natl Acad Sci U S A 1998 June 23;95(13):7585-90.
(297) Hui DY, Basford JE. Distinct signaling mechanisms for apoE inhibition of cell
migration and proliferation. Neurobiol Aging 2005 March;26(3):317-23.
(298) Kothapalli D, Fuki I, Ali K et al. Antimitogenic effects of HDL and APOE mediated by
Cox-2-dependent IP activation. J Clin Invest 2004 February;113(4):609-18.
(299) Kothapalli D, Liu SL, Bae YH et al. Cardiovascular protection by ApoE and ApoE-
HDL linked to suppression of ECM gene expression and arterial stiffening. Cell Rep
2012 November 29;2(5):1259-71.
(300) Sata M, Maejima Y, Adachi F et al. A mouse model of vascular injury that induces
rapid onset of medial cell apoptosis followed by reproducible neointimal hyperplasia. J
Mol Cell Cardiol 2000 November;32(11):2097-104.
(301) Klein EA, Yung Y, Castagnino P, Kothapalli D, Assoian RK. Cell adhesion, cellular
tension, and cell cycle control. Methods Enzymol 2007;426:155-75.
(302) Virmani R, Kolodgie FD, Burke AP, Farb A, Schwartz SM. Lessons from sudden
coronary death: a comprehensive morphological classification scheme for
atherosclerotic lesions. Arterioscler Thromb Vasc Biol 2000 May;20(5):1262-75.
(303) Zhu B, Kuhel DG, Witte DP, Hui DY. Apolipoprotein E inhibits neointimal hyperplasia
after arterial injury in mice. Am J Pathol 2000 December;157(6):1839-48.
(304) Plenz GA, Deng MC, Robenek H, Volker W. Vascular collagens: spotlight on the role
of type VIII collagen in atherogenesis. Atherosclerosis 2003 January;166(1):1-11.
(305) Deguchi JO, Aikawa M, Tung CH et al. Inflammation in atherosclerosis: visualizing
matrix metalloproteinase action in macrophages in vivo. Circulation 2006 July
4;114(1):55-62.
(306) Sinha S, Kielty CM, Heagerty AM, Canfield AE, Shuttleworth CA. Upregulation of
collagen VIII following porcine coronary artery angioplasty is related to smooth muscle
cell migration not angiogenesis. Int J Exp Pathol 2001 October;82(5):295-302.
(307) Ali K, Lund-Katz S, Lawson J, Phillips MC, Rader DJ. Structure-function properties of
the apoE-dependent COX-2 pathway in vascular smooth muscle cells. Atherosclerosis
2008 January;196(1):201-9.
191
(308) Thorngate FE, Yancey PG, Kellner-Weibel G, Rudel LL, Rothblat GH, Williams DL.
Testing the role of apoA-I, HDL, and cholesterol efflux in the atheroprotective action of
low-level apoE expression. J Lipid Res 2003 December;44(12):2331-8.
(309) Munger JS, Sheppard D. Cross talk among TGF-beta signaling pathways, integrins, and
the extracellular matrix. Cold Spring Harb Perspect Biol 2011
November;3(11):a005017.
(310) Bochaton-Piallat ML, Gabbiani F, Redard M, Desmouliere A, Gabbiani G. Apoptosis
participates in cellularity regulation during rat aortic intimal thickening. Am J Pathol
1995 May;146(5):1059-64.
(311) Han DK, Haudenschild CC, Hong MK, Tinkle BT, Leon MB, Liau G. Evidence for
apoptosis in human atherogenesis and in a rat vascular injury model. Am J Pathol 1995
August;147(2):267-77.
(312) Gonzalo N, Serruys PW, Okamura T et al. Relation between plaque type and
dissections at the edges after stent implantation: an optical coherence tomography
study. Int J Cardiol 2011 July 15;150(2):151-5.
(313) Wang Y, Ning J, Johnson JA, Sutton MA, Lessner SM. Development of a quantitative
mechanical test of atherosclerotic plaque stability. J Biomech 2011 September
2;44(13):2439-45.
(314) Wang Y, Johnson JA, Fulp A, Sutton MA, Lessner SM. Adhesive strength of
atherosclerotic plaque in a mouse model depends on local collagen content and elastin
fragmentation. J Biomech 2013 February 22;46(4):716-22.
(315) Louis SF, Zahradka P. Vascular smooth muscle cell motility: From migration to
invasion. Exp Clin Cardiol 2010;15(4):e75-e85.
(316) Luross JA, Williams NA. The genetic and immunopathological processes underlying
collagen-induced arthritis. Immunology 2001 August;103(4):407-16.
(317) Dollery CM, Owen CA, Sukhova GK, Krettek A, Shapiro SD, Libby P. Neutrophil
elastase in human atherosclerotic plaques: production by macrophages. Circulation
2003 June 10;107(22):2829-36.
(318) Ait-Oufella H, Taleb S, Mallat Z, Tedgui A. Recent advances on the role of cytokines
in atherosclerosis. Arterioscler Thromb Vasc Biol 2011 May;31(5):969-79.
(319) Moore KJ, Tabas I. Macrophages in the pathogenesis of atherosclerosis. Cell 2011
April 29;145(3):341-55.
(320) Lopes J, Adiguzel E, Gu S et al. Type VIII Collagen Mediates Vessel Wall Remodeling
after Arterial Injury and Fibrous Cap Formation in Atherosclerosis. Am J Pathol 2013
April 5.
192
(321) Bavendiek U, Zirlik A, LaClair S, MacFarlane L, Libby P, Schonbeck U.
Atherogenesis in mice does not require CD40 ligand from bone marrow-derived cells.
Arterioscler Thromb Vasc Biol 2005 June;25(6):1244-9.
(322) Pennings M, Hildebrand RB, Ye D et al. Bone marrow-derived multidrug resistance
protein ABCB4 protects against atherosclerotic lesion development in LDL receptor
knockout mice. Cardiovasc Res 2007 October 1;76(1):175-83.
(323) Tajima S, Wachi H, Hayashi A. Accumulation of tropoelastin by a short-term ascorbic
acid treatment in the culture medium of aortic smooth muscle cells in vitro. Keio J Med
1995 December;44(4):140-5.
(324) Sproul EP, Argraves WS. A cytokine axis regulates elastin formation and degradation.
Matrix Biol 2013 March 11;32(2):86-94.
(325) Conn KJ, Rich CB, Jensen DE et al. Insulin-like growth factor-I regulates transcription
of the elastin gene through a putative retinoblastoma control element. A role for Sp3
acting as a repressor of elastin gene transcription. J Biol Chem 1996 November
15;271(46):28853-60.
(326) Thomas AC, Sala-Newby GB, Ismail Y, Johnson JL, Pasterkamp G, Newby AC.
Genomics of foam cells and nonfoamy macrophages from rabbits identifies arginase-I
as a differential regulator of nitric oxide production. Arterioscler Thromb Vasc Biol
2007 March;27(3):571-7.
(327) Petersen E, Wagberg F, Angquist KA. Serum concentrations of elastin-derived peptides
in patients with specific manifestations of atherosclerotic disease. Eur J Vasc Endovasc
Surg 2002 November;24(5):440-4.
(328) Mukhopadhyay A, Deplancke B, Walhout AJ, Tissenbaum HA. Chromatin
immunoprecipitation (ChIP) coupled to detection by quantitative real-time PCR to
study transcription factor binding to DNA in Caenorhabditis elegans. Nat Protoc
2008;3(4):698-709.
(329) Gardner H, Broberg A, Pozzi A, Laato M, Heino J. Absence of integrin alpha1beta1 in
the mouse causes loss of feedback regulation of collagen synthesis in normal and
wounded dermis. J Cell Sci 1999 February;112 ( Pt 3):263-72.
(330) Wenger MP, Bozec L, Horton MA, Mesquida P. Mechanical properties of collagen
fibrils. Biophys J 2007 August 15;93(4):1255-63.
(331) Palamakumbura AH, Trackman PC. A fluorometric assay for detection of lysyl oxidase
enzyme activity in biological samples. Anal Biochem 2002 January 15;300(2):245-51.
(332) Blaise S, Romier B, Kawecki C et al. Elastin-derived peptides are new regulators of
insulin resistance development in mice. Diabetes 2013 November;62(11):3807-16.
193
(333) Ntziachristos V, Tung CH, Bremer C, Weissleder R. Fluorescence molecular
tomography resolves protease activity in vivo. Nat Med 2002 July;8(7):757-60.
(334) Tracqui P, Broisat A, Toczek J, Mesnier N, Ohayon J, Riou L. Mapping elasticity
moduli of atherosclerotic plaque in situ via atomic force microscopy. J Struct Biol 2011
April;174(1):115-23.
(335) Sternberg N, Hamilton D. Bacteriophage P1 site-specific recombination. I.
Recombination between loxP sites. J Mol Biol 1981 August 25;150(4):467-86.
(336) Regan CP, Manabe I, Owens GK. Development of a smooth muscle-targeted cre
recombinase mouse reveals novel insights regarding smooth muscle myosin heavy
chain promoter regulation. Circ Res 2000 September 1;87(5):363-9.
(337) Clausen BE, Burkhardt C, Reith W, Renkawitz R, Forster I. Conditional gene targeting
in macrophages and granulocytes using LysMcre mice. Transgenic Res 1999
August;8(4):265-77.
(338) Mukhopadhyay R. Mouse models of atherosclerosis: explaining critical roles of lipid
metabolism and inflammation. J Appl Genet 2013 May;54(2):185-92.
(339) Hu W, Polinsky P, Sadoun E, Rosenfeld ME, Schwartz SM. Atherosclerotic lesions in
the common coronary arteries of ApoE knockout mice. Cardiovasc Pathol 2005
May;14(3):120-5.
(340) Bentzon JF, Falk E. Atherosclerotic lesions in mouse and man: is it the same disease?
Curr Opin Lipidol 2010 October;21(5):434-40.
(341) Schwartz SM, Galis ZS, Rosenfeld ME, Falk E. Plaque rupture in humans and mice.
Arterioscler Thromb Vasc Biol 2007 April;27(4):705-13.
(342) Zhou J, Moller J, Danielsen CC et al. Dietary supplementation with methionine and
homocysteine promotes early atherosclerosis but not plaque rupture in ApoE-deficient
mice. Arterioscler Thromb Vasc Biol 2001 September;21(9):1470-6.
(343) Higuchi K, Kitagawa K, Kogishi K, Takeda T. Developmental and age-related changes
in apolipoprotein B mRNA editing in mice. J Lipid Res 1992 December;33(12):1753-
64.
(344) Veniant MM, Zlot CH, Walzem RL et al. Lipoprotein clearance mechanisms in LDL
receptor-deficient "Apo-B48-only" and "Apo-B100-only" mice. J Clin Invest 1998
October 15;102(8):1559-68.
(345) van Ree JH, Gijbels MJ, van den Broek WJ, Hofker MH, Havekes LM. Atypical
xanthomatosis in apolipoprotein E-deficient mice after cholesterol feeding.
Atherosclerosis 1995 January 20;112(2):237-43.
194
(346) Schiller NK, Kubo N, Boisvert WA, Curtiss LK. Effect of gamma-irradiation and bone
marrow transplantation on atherosclerosis in LDL receptor-deficient mice. Arterioscler
Thromb Vasc Biol 2001 October;21(10):1674-80.
(347) Sawada H, Konomi H. The alpha 1 chain of type VIII collagen is associated with many
but not all microfibrils of elastic fiber system. Cell Struct Funct 1991
December;16(6):455-66.
