THE ROLE OF PYRUVATE DEHYDROGENASE KINASE 4 (PDK4) … · in the heart. Pyruvate Dehydrogenase (PDH) regulates the entry of pyruvate into the mitochondrial tricarboxylic acid (TCA)

THE ROLE OF PYRUVATE DEHYDROGENASE KINASE 4 (PDK4) GENE MUTATION IN THE IMPAIRMENT OF

METABOLIC FLEXIBILITY AND DEVELOPMENT OF DILATED CARDIOMYOPATHY

IN DOBERMAN PINSCHERS

By

LUIZ BOLFER

A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT

OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA

2018

© 2018 Luiz Bolfer

This work is dedicated to my wife, Lillian, who has been a constant source of support and encouragement during the challenges of graduate school and life. I am truly

thankful for having you in my life. This work is also dedicated to my parents, Jose Luiz and Elisabete, who have always loved me unconditionally and whose good examples

have taught me to work hard for the things that I aspire to achieve.

4

ACKNOWLEDGMENTS

I would like to first thank my primary advisors Dr. Amara Estrada, and Dr.

Christina Pacak, for their constant encouragement and support during this long road

and huge step on the development of my career.

I also would like to thank the University of Florida (UF) Veterinary Clinical

Sciences program, and Dr. Ammon Peck and Mrs. Sally O’Connell in the Office of

Graduate Studies and Research – I thank you for working to negotiate the logistics of

my program and for providing me with the support needed to see my dissertation

research through to completion.

Furthermore, I would like to thank each of my committee members, Drs. Barry

Byrne, Christina Pacak, Naohiro Terada, Peter Stacpoole, Thomas Conlon, and

Thomas Vickroy. I thank you all for the expertise, encouragement, and enduring

optimism every step of the way. Special thank you to Dr. Pacak for allowing me to

develop my project at her laboratory and for spending countless hours helping me

troubleshoot the methods – answering my questions at all hours of the days, and even

weekends. I cannot thank Dr. Pacak enough for the time and energy she devoted to

assisting with my research, and I thoroughly enjoyed being a part of her laboratory

team.

Many individuals at the University of Florida, College of Veterinary Medicine also

touched my life, both personally and professionally, and helped me get to where I am

today.

Lastly, I would like to thank my parents Jose Luiz and Elisabete, and my brother

Guilherme, and Sister Caroline. I am so grateful for the love and encouragement they

have always shown me and for their belief in my ability to achieve anything I put my

5

mind to. I also could not have achieved this accomplishment without the patient,

understanding, and loving support of my wife, Lillian. She helped to pull me through this

experience – sharing in my successes but also bearing the brunt of my stress and

frustrations. Lillian encouraged me to push forward and preserve and kept me focused

on the end result, and for lending her ear when I needed to vent, and for her snuggles

when it was time to procrastinate. Finally, I would like to thank my daughter Lydia, and

my son Leonardo, even though they are too young to understand what Daddy went

through, they have already changed completely the meaning of my life moving forward.

6

TABLE OF CONTENTS

ACKNOWLEDGMENTS ...................................................................................................... 4

LIST OF TABLES ................................................................................................................ 8

LIST OF FIGURES .............................................................................................................. 9

LIST OF ABBREVIATIONS ............................................................................................... 10

CHAPTER

1 INTRODUCTION ........................................................................................................ 13

Familial DCM in DPs ................................................................................................... 14

Similarities to Human DCM Have Led to Several Studies Looking for a Possible Causative Gene in Canines ........................................................................................ 15 Impaired Myocardial Energy Metabolism and Mitochondrial Dysfunction Has Been Associated with DCM in DPs ............................................................................ 16 The Pivotal Role of Pyruvate Dehydrogenase Kinase 4 in Myocardial Fatty Acid and Glucose Oxidation ............................................................................................... 17

Pyruvate Dehydrogenase and the Connection Between Cardiac Remodeling, Metabolic Activity Shift, and Heart Failure ................................................................. 20 Regulation of Pyruvate Dehydrogenase Complex in the Heart Is Dependent on PDK4 as well as PDK2 ............................................................................................... 22

2 A MUTATION IN THE PDK4 GENE LEADS TO A DECREASE GENE EXPRESSION OF EXONS 10 AND 11...................................................................... 25

Materials and Methods ............................................................................................... 29 Animals ................................................................................................................. 30 Inclusion Criteria ................................................................................................... 30 Exclusion Criteria ................................................................................................. 30

Echocardiography ................................................................................................ 31 Holter Recordings................................................................................................. 31 Harvesting of Fibroblasts ..................................................................................... 32 Extracting RNA for PCR ....................................................................................... 32 Quantitative PCR.................................................................................................. 32

Statistical Analysis................................................................................................ 33

Results ........................................................................................................................ 33 Signalment ............................................................................................................ 33 Cardiac Evaluations ............................................................................................. 33 PCR Results ......................................................................................................... 34

Discussion ................................................................................................................... 35

3 A MUTATION IN THE PDK4 GENE LEADS TO A DECREASED EXPRESSION OF PDK4 PROTEIN AND DISRRUPTION OF THE C-TERMINAL DOMAIN .......... 47

7

Materials and Methods ............................................................................................... 48 Enzyme-Linked Immunosorbent Assay (ELISA) ................................................. 48 Statistical Analysis................................................................................................ 49

Results ........................................................................................................................ 49 Discussion ................................................................................................................... 49

4 PYRUVATE DEHYDROGENASE COMPLEX PROTEIN EXPRESSION AND FUNCTION ARE ALTERED IN CANINES WITH PDK4 MUTATION ....................... 55

Materials and Methods ............................................................................................... 58

ELISA Assays ....................................................................................................... 58 Statistical Analysis................................................................................................ 59


5 PRIMARY SKIN FIBROBLAST ABUNDANCE, MORPHOLOGY AND CYTOSKELETAL STRUCTURE UPON STARVATION IN DIFFERENT PDK4 MUTANT CONDITIONS. ............................................................................................ 69

Materials and Methods ............................................................................................... 72 Fibroblast Isolation and Culture ........................................................................... 72

Viability Assays .................................................................................................... 72

Immunofluorescence ............................................................................................ 72 Data Processing ................................................................................................... 73


6 MITOCHONDRIA OF MUTANT DOBERMAN PINSCHERS HAVE LOWER METABOLIC POTENTIAL AND FUNCTION ............................................................. 80

Materials and Methods ............................................................................................... 84 Results ........................................................................................................................ 84

Discussion ................................................................................................................... 86

7 CONCLUSIONS, LIMITATIONS, AND FUTURE DIRECTIONS ............................... 96

APPENDIX

LIST OF REFERENCES .................................................................................................100

BIOGRAPHICAL SKETCH ..............................................................................................110

8

LIST OF TABLES

Table Page 2-1 Left Ventricular Diameter in systole (LVIDs).......................................................... 45

2-2 Primers used in this study for quantitative real-time PCR ..................................... 46

9

LIST OF FIGURES

Figure Page 2-1 Different splicing possibilities to yield mature mRNA ............................................ 39

2-2 Canines recruited for the study.. ............................................................................ 40

2-3 Quantitative RT-PCR of a target spanning from exon 10 to exon 11 of PDK4 .... 41

2-4 Quantitative RT-PCR of a product spanning from exon 8 to exon 9 of PDK4 ...... 42

2-5 RT-PCR and agarose gel electrophoresis of the exon 8-9 and 10-11 amplicon in individuals that were heterozygous carriers. ...................................... 43

2-6 RT-PCR and agarose gel electrophoresis of the exon 8-9 and 10-11 amplicon in individuals that were homozygous carriers ........................................ 44

3-1 ELISA using antibodies against PDK4................................................................... 54

4-1 Pyruvate Dehydrogenase (PDH) function ............................................................. 68

5-1 Images of primary fibroblasts that were kept in cell culture medium .................... 78

5-2 Number of primary fibroblasts in cell culture ......................................................... 79

6-1 Normalized Oxygen Consumption Rate (OCR) ..................................................... 90

6-2 Average basal respiration rates ............................................................................. 91

6-3 Average ATP-linked respiration rates. ................................................................... 92

6-4 Normalized Extracellular Acidification Rate (ECAR) ............................................. 93

6-5 Average non-glycolytic acidification rates .............................................................. 94

6-6 Average glycolytic reserve during a glycolysis stress test .................................... 95

10

LIST OF ABBREVIATIONS

ADP Adenosine Diphosphate

ATP Adenosine Triphosphate

DCM Dilated Cardiac Myopathy

del deletion

ELISA Enzyme-Linked Immunosorbent Assay

NAD Nicotine Amide Dinucleotide

PDC Pyruvate Dehydrogenase Complex

PDH Pyruvate Dehydrogenase

PDK1/2/3/4 Pyruvate Dehydrogenase Kinase 1/2/3/4

PGC Proliferator-activated receptor-Gamma Coactivator

PPAR Peroxisome Proliferator-Activated Receptor

TBS Tris Buffered Saline

TBST Tris Buffered Saline with Tween-20

wt wildtype

11

Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy

THE ROLE OF PYRUVATE DEHYDROGENASE KINASE 4 (PDK4) GENE MUTATION

IN THE IMPAIRMENT OF METABOLIC FLEXIBILITY AND DEVELOPMENT OF DILATED CARDIOMYOPATHY IN DOBERMAN PINSCHERS

By

Luiz Bolfer

December 2018

Chair: Amara H. Estrada Cochair: Christina Pacak Major: Veterinary Medical Sciences

Dilated Cardiomyopathy (DCM) is one of the most prevalent causes of heart

disease. Once diagnosed with DCM, both human and canines, such as Doberman

Pinschers (DPs), have poor prognoses. Previously, genes mediating cellular defense

mechanisms or stress responses were found to be upregulated in canines affected by

DCM, whereas genes mediating cell-cell signaling, tissue coherence, and metabolic

function were significantly downregulated.7-13 Moreover, the abundance of many

mitochondrial proteins was altered between healthy canines and those affected by

DCM.18 This suggests that DCM in DPs may be a result of impaired metabolic flexibility

in the heart. Pyruvate Dehydrogenase (PDH) regulates the entry of pyruvate into the

mitochondrial tricarboxylic acid (TCA) cycle and thus occupies a central position in

metabolic pathway determination for energy production. In myocardial tissue, PDH is

phosphorylated to an inactive state by Pyruvate Dehydrogenase Kinase 4 (PDK4).

Importantly, a splice site mutation that likely abolishes PDK4 activity has been linked to

DCM in DPs.14 Although previous work has indicated that fibroblasts from PDK4del/del

12

DPs undergo mitochondrial mediated apoptosis in response to glucose-free growth

conditions, studies designed to fully define the molecular and metabolic impact of this

PDK4 mutation are lacking. Here, we report the establishment of a primary cell culture

system that enables analysis of the molecular and biochemical basis of glucose and

fatty acid metabolism in this disorder. We demonstrate that a splice site mutation that

abolishes the kinase activity of PDK4 leads to changes in cellular abundance and

cytoskeletal architecture within primary fibroblasts. For the first time, we show that the

absence of PDK4 activity leads to an upregulation of PDH activity. By analyzing

mitochondrial function, we find strong evidence that the spare mitochondrial capacity is

significantly downregulated in mutant cells, while the theoretical maximum limit for

respiration in these organelles remains the same. In addition, the rate of mitochondrial

oxygen consumption in PDK4 mutant cells is downregulated, while glycolytic activity in

those cells is elevated. Taken together, we hypothesize that due to decreased

metabolic flexibility, PDK4 deficient DPs are unable to supply sufficient energy to the

myocardium when faced with elevated metabolic demand and that over time, this fuel

deficiency in the heart results in the development of DCM.

13

CHAPTER 1 INTRODUCTION

The Doberman Pinscher (DP) canine breed is affected by a specific form of

Dilated Cardiomyopathy (DCM), inherited as an autosomal trait1 similar to most human

DCM forms. The prevalence of the disease in this particular breed ranges from 45 to

63%.2,3 In humans and canines, DCM is the 2nd and 3rd most frequent type of heart

disease, respectively.4,5 In general, the prognosis of DCM in DPs is poor. DPs have a

very high mortality rate with mean survival times of less than 6 months following the first

episode of Congestive Heart Failure.3 Asymptomatic DPs with what is termed ‘occult’ or

pre-congestive DCM typically develop Congestive Heart Failure within 1 to 2 years of

diagnosis, despite aggressive and optimal medical therapy.6 The majority of children

and adults with DCM carry the idiopathic, non-ischemic, form of the disease with a

genetic base in more than 30 identified genetic mutations involved.7 The DP is affected

by a similar form of DCM, likely due to both clinical and pathological similarities8 to

human physiology and anatomy. However, several genes that encode for proteins

involved in cellular stability and tissue integrity, mutants of which are known to cause

the disease in humans, have thus far shown no causative effect in DPs.9-11

Recent microarray studies have identified several transcripts that are changed in

DCM affected DPs and other canines.12 These genes belong to various pathways with

physiological and cell biological significance. Genes that are responsible for mediating

cellular defense or stress responses are generally upregulated in DCM carriers,

whereas genes mediating cell-cell communication, inter and intracellular signaling,

tissue structure and metabolism were downregulated.12 Cardiac metabolism is of

particular interest in this canine breed, as prior studies have found quantitative and

14

qualitative differences in protein expression within the mitochondria of DPs affected by

DCM when compared to healthy canines with normal cardiac evaluation.13

A recent study reported a high proportion (82%) of DPs diagnosed with DCM had

an associated 16-base pair splice site deletion in the Pyruvate Dehydrogenase Kinase 4

(PDK4) gene. PDK4 is a mitochondrial protein intimately involved in cardiac

metabolism.14 The test for this deletion is now available, and it can be used to identify

animals which are both heterozygous or homozygous positive for the mutation. This

introduction details the role of PDK4 in normal myocardial metabolism and the

consequences related to its up- and downregulation that could lead to DCM. It also

provides an overview of the knowledge base acquired to date regarding genetics and

molecular biology of DCM in DPs.

Familial DCM in DPs

Veterinary clinicians have long suspected that DPs can suffer from an inherited

genetic mutation leading to DCM. Studies have demonstrated that the disease appears

to be inherited in an autosomal dominant manner with equal numbers of males and

females affected, male-male transmission, and the mating of two affected individuals

producing unaffected offspring.1 Since the phenotype of the disease often does not

present until the canines are several years old, it would be highly desirable to identify

genetic markers that correlate with DCM, so that at-risk canine populations can be

excluded from the breeding pool. Three loci were identified to be associated with DCM

in the breed, a single nucleotide polymorphism on chromosome 5, a splice site mutation

on chromosome 14, and most recently a mutation involving cytoskeletal component that

is currently under investigatrion.14,15

15

Similarities to Human DCM Have Led to Several Studies Looking for a Possible Causative Gene in Canines

DCM involves macroscopic changes in heart morphology, which can be caused

by small scale changes within cellular morphology. If individual cells are not strong

enough to withstand the macroscopic forces that impinge on the heart muscle, the

ventricle can dilate. Therefore, mutations that weaken cytoskeletal components may be

linked to DCM. Many of the genes that are linked to human DCM encode for proteins

that are part of the cytoskeleton, or are closely associated with the cytoskeleton.

Several investigators have tested a correlation between mutations in structural proteins

and DCM in DPs.9 A mutation is likely to affect the function of a protein if it is introducing

a premature stop codon or a missense mutation that changes a conserved amino acid

into an amino acid with different side chain. Prior studies have evaluated exons and

splice sites in several genes associated with the human form of DCM, such as Troponin

C, Lamin A/C, Cysteine and Glycine rich protein 3, cardiac Troponin T, Phospholamban

and beta-Myosin Heavy Chain. However, there were no significant base pair changes

detected between DCM affected DPs and control animals. Changes of amino acids

such as Threonine, Alanine and Lysine within Cysteine Rich protein, Troponin T and

Myosin Heavy Chain were detected in DCM affected DPs as well as unaffected

Labrador Retrievers.1,10 If there is no clear correlation between mutations in cytoskeletal

genes and DCM, gene expression levels may be altered. Western Blots of myocardial

protein samples were evaluated for the abundance of Dystrophin, alpha-Sarcoglycan

and beta-Dystroglycan, three eminent components of the cytoskeleton that give the

heart structure and stability and help transduce forces. These proteins have been

implicated in human DCM, and they are also affected in muscular dystrophies. Prior

16

investigation of these cytoskeletal proteins as possible links to the disease in canine

patients with DCM did not find any detectable differences between healthy canine

patients and those affected by DCM.16 These studies either point to the notion that the

genes that cause DCM in humans have no clear impact on heart structure and function

in canines, or that the affected embryos die in utero. However, some forms of DCM in

canine breeds do seem to affect heart structure, including a wave-like appearance of

heart muscle tissue or large lipid deposits and a disrupted mitochondrial structure.17

This suggests that affected canines either have mutations in cytoskeletal genes different

from humans, or that other processes, such as lipid or carbohydrate metabolism, may

lie at the source of the problem for dogs.

Impaired Myocardial Energy Metabolism and Mitochondrial Dysfunction Has Been Associated with DCM in DPs

Studies have demonstrated that mitochondria in DPs expressing symptoms of

DCM were dysfunctional, suggesting a difference in energy balance as potential

causative effect for the disease. Oyama and Chittur12 found that in DCM carrying DPs

hundreds of transcripts putatively involved in cellular energy production were

downregulated. In these studies, multiple components involved in oxidative

phosphorylation, glucose and fatty acid oxidation were reduced. Another study18 found

differences in the protein expression levels of several components in the mitochondrial

electron transport chain, once again suggesting that alterations in energy generation

may be underlying DCM in canines. In the same study, it was found that in DCM

affected individuals, multiple components of the electron transport chain and oxidative

phosphorylation cascades were selectively affected.18 These studies suggest that

changes in energy balance, rather than cytoskeletal structure, underlie DCM in DPs.

17

The Pivotal Role of Pyruvate Dehydrogenase Kinase 4 in Myocardial Fatty Acid and Glucose Oxidation

The heart is able to adapt to different metabolic demands by adjusting glucose or

fatty acid oxidation.19 Mitochondrial oxidative phosphorylation constitutes the

overwhelming majority of energy supply in healthy heart muscle. The heart continuously

uses the energy from newly created ATP and stores very little for later use. The high-

energy phosphate pool in the heart is relatively small and can be exhausted within a few

seconds. Therefore, cardiac work depends strongly on new generation of ATP, and

impairments in this process can rapidly induce contractile dysfunction. In a fasted state,

the heart utilizes fatty acids to generate 70 to 90% of its energy, the remaining 10 to

30% come from glucose, lactate, ketone bodies and amino acids. In a postprandial

state, when there is higher availability of glucose, the heart uses that energy source to a

higher degree than in the fasted state. However, because glucose levels are constantly

fluctuating dependent on meal schedule, dietary behaviors and the amount of activity

being performed, the heart has adapted to preferentially use fatty acids as more stable

source of energy.20

The heart is an enormously versatile organ and is not exclusively dependent on

its preferred source of energy, which enables continued function in times when

resources are low. Ketone bodies and amino acids can also be used to generate

energy. However, a permanent imbalance in the metabolic pathways used to convert

energy from fatty acids versus glucose can lead to long-term health problems, including

DCM.21

In order to be utilized by metabolic machinery, fatty acids must be taken up by

the cytosol, transported across the mitochondrial membrane, and oxidized. In the

18

process, NAD+ and FAD+ are reduced to NADH + H+ and FADH2, generating a proton

gradient across the mitochondrial membrane. This gradient can then be used to

generate energy in the form of ATP. Similar processes hold true for the utilization of

glucose, albeit large parts of the machinery mediating that process are different from

fatty acid metabolism.20

Fatty acids are transported across the plasma membrane utilizing Fatty Acid

Transporters such as CD36.22 They are linked to coenzyme-A to yield acyl-CoA. To

become transported, they get transesterified to form acylcarnitine, which can then be

transported by the Carnitine Palmitoyl Transferase I complex across the mitochondrial

membrane. An alternative pathway for coenzyme-A bound fatty acids is to become

fused to glycerin to be stored as triglycerides within the cytosol.23

Fatty acids are transported into the mitochondrial matrix become converted back

to acyl-CoA by Carnitine Palmitoyl Transferase II. Acyl-CoA is then split into multiple

copies of acetyl-CoA which feed into the Krebs/Tricarboxylic Acid (TCA) cycle. The

beta-oxidation of fatty acids is an exergonic process that yields several molecules of

NADH and FADH2. These molecules become reoxidized via the electron transport chain

in the inner mitochondrial membrane; the cytochromes within those complexes act as

electron acceptors, and the energy released during the oxidation of NADH + H+ and

FADH2 is transformed into a proton gradient across the mitochondrial membrane that

drives the generation of energy in the form of ATP.24

The transport of acylcarnitine across the mitochondrial membrane is an important

regulatory step in fatty acid metabolism and it can be inhibited by malonyl-CoA.

Malonyl-CoA is synthetized from acetyl-CoA via acetyl-CoA carboxylase. This

19

regulatory mechanism suggests that an overproduction of acetyl-CoA leads to a specific

reduction of fatty acid metabolism if the TCA cycle is overactive; excess citrate

transported into the cytosol is transformed by ATP-citrate lyase into acetyl-CoA and

oxaloacetate.25,26 This selective shutdown of fatty acid metabolism does not affect the

second metabolic pathway feeding into the TCA cycle: glucose oxidation.

Glucose becomes transported from the blood stream into the cytosol by the

Glucose Transporter 4 and phosphorylated to Glucose-6-phosphate, which can readily

enter glycolysis.27 Glycolysis is an anaerobic process that yields Pyruvate, 2 molecules

of NADH and 2 molecules of ATP per molecule of glucose. Pyruvate either remains in

the cytosol, where it is oxidized to lactate via lactate dehydrogenase,20 or it is

transported into the mitochondria, where the Pyruvate Dehydrogenase Complex (PDC)

transforms it into CO2 and acetyl-CoA. Acetyl-CoA then enters the Krebs cycle and is

oxidized in the course of the cycle. The energy released from that oxidation is used to

transform NAD+ and FAD+ into NADH + H+ and FADH2, respectively, which ultimately

drives the formation of ATP to be used immediately or to be stored.

The PDC is the enzyme that drives the transformation of pyruvate into CO2 and

acetyl-CoA. Pyruvate dehydrogenase kinase (PDK1 to 4) isoforms phosphorylate the

E1-subunit of PDC and thus block its activity. Since both fatty acids and glucose

independently feed into the TCA cycle via the intermediate molecule acetyl-CoA,

downregulation of PDC shifts the metabolism towards increased fatty acid oxidation and

decreased glucose oxidation.26 Chronic upregulation of PDK4 in the heart

downregulates PDC activity and glucose oxidation; likewise, enhanced PDK4

expression in skeletal muscle inhibits the entry of pyruvate into the TCA cycle and

20

enables fatty acids to provide acetyl-CoA to the TCA cycle.27 Furthermore, PDK4

upregulation induces transcriptional, metabolic, and post-transcriptional changes that all

contribute to the upregulation of fatty acid oxidation.21,28,29,30 Glucose oxidation does not

become upregulated in response to a downregulation of fatty acid oxidation during heart

failure, suggesting compensatory feedback mechanisms to ensure that the heart always

receives enough nutrients.31,32,33

Fatty acids may indirectly influence glucose oxidative activity through the

activation of Peroxisome Proliferator Activated Receptors (PPARs), which form part of a

feedback loop that regulates the transcription of proteins that regulate fatty acid uptake,

binding, cross membrane transport into the mitochondrion and beta oxidation.33-36

Pyruvate Dehydrogenase and the Connection Between Cardiac Remodeling, Metabolic Activity Shift, and Heart Failure

Defects in energy production and changes in the availability of various substrates

involved in basic cellular functions can result in remodeling of cell morphology or

physiological defects that the heart attempts to compensate for by expanding its overall

shape.20 In general, during hypertrophy and cardiac failure, the heart is not able to

produce enough ATP to consistently mediate contractile function, culminating in a

structure with impaired contractile function. For example, as in DCM, the heart attempts

to compensate the reduced metabolic function by increasing the chamber size, so that

in theory more blood can be transported with every contraction. However, without

restoring contractile function, the heart will not be able to sustain energetic requirements

of the body and eventually reach a state in which the heart size is too large to function,

leading to heart failure.

21

When glucose oxidation is upregulated, the relative contribution of fatty acid

oxidation decreases. Since glucose is a less reliable, steadily available and less efficient

energy source, a constitutive upregulation of glucose metabolism might lead to long-

term metabolic deficits for the heart leading to an overall deficit in ATP production. This

scenario is what we have hypothesized occurs in DPs with the PDK4 mutation.

Preliminary experimental results of PDK4 gene and protein expression in a cell model of

DCM revealed that PDK4 is minimally expressed in DPs that carry the mutation.

Furthermore, glucose starvation of this cell line did not increase the expression of

PDK4 in DPs carrying the mutation, which would be the expected physiological

response.37 This is consistent with the reduced mitochondrial electron transport activity

noted in DPs with DCM.38 Insufficient regulation of the PDC has also been observed in

DPs with DCM.39, 40

It has been noted that in DCM affected DPs with the PDK4 mutation, cardiac

mitochondria were disrupted in the affected tissue, forming megamitochondria or

scattered and “whorled” mitochondria, suggesting that cellular metabolism is disturbed

in PKD4 mutant canines.14 Mitochondrial function, assessed by means of oxygen

consumption rate of DPs with DCM and the PDK4 mutation, has been shown to be

altered, which suggest a strong association between the mutation and mitochondrial

dysfunction.41 In rats with reduced systolic function, similar to DCM affected DPs,

mitochondrial abundance is decreased and the organelle shape is abnormal. In this

model, several components of the electron transfer chain are reduced, suggesting

additional abnormalities in energy production,42 which is also observed in DPs.39

22

Regulation of Pyruvate Dehydrogenase Complex in the Heart Is Dependent on PDK4 as well as PDK2

The PDC is a multi-subunit complex that is localized in the mitochondrial matrix.

It is regulated through phosphorylation of three different serine residues within the E1

subunit of Pyruvate Dehydrogenase.43,44 In mammals, these serine residues become

phosphorylated by different pyruvate dehydrogenase kinase (PDK) isoforms. The two

most prominent in cardiac tissue are PDK2 and PDK4; while PDK2 is expressed

ubiquitously in all tissues, PDK4 mRNA and protein are more specific for the heart and

skeletal muscle.29,45 The result of PDC phosphorylation is a reduction in Pyruvate

Dehydrogenase activity, thus blocking the reaction of pyruvate, Coenzyme A and NAD+

into Carbon dioxide, NADH + H+ and acetyl-CoA, which becomes channeled into the

TCA cycle instead. Pyruvate accumulates and becomes transformed into lactate. PDK2

and PDK4 appear differentially regulated. Starvation or induced diabetic conditions via

streptozotocin leads to an upregulation of PDK4 protein in rat hearts, as shown by

Western Blotting. This increase is reversible, as insulin treatment or refeeding

decreased PDK4 levels back to control conditions. No such regulatory effects can be

observed for PDK2.46,47

Humans that follow high fat/low carbohydrate protein diet exhibit an increase in

PDK4 mRNA levels in skeletal muscle cells, further supporting the notion that the

physiological nutritional status regulates PDK4 levels.48 Preliminary results of a

fibroblast cell model of DCM in DPs with the PDK4 mutation revealed that those cells,

when submitted to glucose starvation, were not able to upregulate PDK4 expression.37

The regulation of PDK2 and PDK4 transcription by members of the PPAR pathways

appears to have functional significance, as the PPAR cofactor PGC-1 induces both

23

PDK2 and PDK4 transcription in hepatocytes and myocytes and is associated with the

PDK4 gene promoter in vivo.49 In juvenile visceral steatosis (JVS) mice that lack the

fatty acid transporter carnitine and are unable to import fatty acids into the mitochondria,

an upregulation of PDK4 mRNA in the cardiac muscle does not inhibit PDC activity.

PDK4 is upregulated through FoxO1 in right ventricular hypertrophy or in failing hearts

that are stimulated with a left ventricular assisting device, causing an increase in

glycolysis relative to glucose oxidation. The fate of fatty acid oxidation in these models

yet needs to be elucidated.50-52

One of the leading areas of research on PDK4 is the cardiomyopathy associated

with diabetes and metabolic inflexibility. One reaction of insulin in healthy individuals is

a downregulation of PDK4, allowing PDC activity to increase. However, if cells are

resistant to insulin, such as in diabetes, PDK4 levels will stay high, leading to an

insufficient metabolic response to enhanced glucose concentrations. This, in turn, leads

to diabetic cardiac dysfunction with decreased rates of myocardial glucose oxidation

and increased fatty acid oxidation.

Metabolic inflexibility, often accompanying cardiomyopathies, is one of the major

causes underlying heart failure.53 Angiotensin II can induce insulin resistance in the

heart, making the latter less efficient by a failure to downregulate PDK4, leading to

inefficient glucose metabolism. These changes have one thing in common: they induce

the preference of glucose over fatty acid oxidation through the up- or downregulation of

PDK isoforms as central regulators.54 Studies also show that stimulation of glucose

oxidation is accompanied by a parallel decrease in fatty acid oxidation. In DPs, a

mutation in PDK4 causes a 14-fold reduction in expression of PDK4 mRNA in cardiac

24

tissue. The resulted reduction affects the expression of exons 10 and 11 of PDK4.14

PDK4 gene exon 11 contains a highly conserved Aspartate-Triptophan motif which is

crucial for PDK4 phosphorylation activity.55

25

CHAPTER 2 A MUTATION IN THE PDK4 GENE LEADS TO A DECREASE GENE EXPRESSION

OF EXONS 10 AND 11

PDK4 is a central regulator of glucose and fatty acid metabolism in various

tissues, such as heart, muscle, and liver. PDK4 phosphorylates Pyruvate

Dehydrogenase, which is part of the PDC. The PDC is a central gatekeeper that

catalyzes the decarboxylation of pyruvate to Acetyl-CoA which subsequently enters the

citrate cycle. If the PDC becomes deactivated, fatty acids – instead of glucose –

become the source for Acetyl-CoA. Despite its central role in glucose metabolism, there

are not many disease conditions in which PDK4 is directly affected, pointing at the

possibility that PDK4 mutations are embryonic-lethal. Recent observations suggest that

a splice site mutation in PDK4 is correlated to the development of Dilated

Cardiomyopathy (DCM) in Doberman Pinschers (DPs). Using quantitative RT-PCR, our

observations suggest that this splice site mutation removes the exon that carries the

kinase domain of PDK4, suggesting an explanation for the link between the PDK4

mutation and the development of DCM.

The PDK4 gene mutation was discovered when searching for mutations in genes

that could cause DCM in DPs. Briefly, an Affymetrix Canine Genome array with nearly

50,000 Single Nucleotide Polymorphism (SNP) markers was tested with DNA from 48

healthy and 48 DCM affected DPs and a specific region on chromosome 14 was

identified; subsequent fine mapping identified one gene, PDK4 within the significant

region. Sequencing then revealed the 16 base pair deletion in DCM affected DPs.

Specifically, the mutation abolished the 5’ donor splice site plus an additional 14

base pairs downstream. Interestingly, the 3’ end of the deleted intronic sequence still

contains a sequence similar to the splice site before, albeit a less efficient one. Thus, it

26

is suspected that the deficiency replaces the original splice site with a cryptic site, which

still allows splicing to occur to a reduced extent.14

In general, splice site mutations abolish the recognition sequences at the

interface between exon and intron – either at the 5’ donor site, where an intron follows

an exon, as is the case here; or the 3’ acceptor site, where an exon follows an intron. In

the case of the PDK4 gene mutation, the deletion is thought to activate a downstream

cryptic splice site. Cryptic splice sites are sequences that could function as splice

acceptors or donors, but are usually not as strong as the splice site that gives rise to the

mature wildtype mRNA. However, cryptic splice sites may actually be functional,

although the resulting transcript is much less abundant than the main product. For the 5’

donor site in healthy canines, the sequence is 5’-AAG|GTATCC-3’, which has a higher

likelihood to be recognized as splice donor than the mutant sequence 5’-AAG|GTAGAA-

3’.14 There are several possible outcomes of a less efficient splice site. First, no splicing

could take place. That means the open reading frame extends from the exon into the

intron, leading to a changed mRNA sequence. As a result, the original amino acid

sequence becomes replaced with a shortened or non-functional sequence.

Alternatively, splicing could become imprecise, likewise leading to a premature stop-

codon in the resulting mRNA.

A third possibility is that the cryptic or less efficient splice donor site binds to a

different splice acceptor site, leading to exon skipping via alternative splicing. The

resulting coding sequence will lead to a protein with reduced functionality. Figure 2-1

gives an overview of the different possibilities.

27

Several splice site mutations have been found that are linked to heart diseases.

For example, changing a one base in the HCN4 gene (that encodes a

potassium/sodium gate protein) leads to familial bradycardia and impaired heart rate

responses.56,57 Another splice site mutation leads to a 45 base pair insertion of an

intronic sequence into the laminin- mRNA of affected individuals. This insertion does

not result in a premature stop codon, but adds 15 amino acids that transform the

original protein into a pathogenic one, causing progressive defects in cardiac

conduction and myopathy.56 Another splice site mutant that affects Myosin Heavy Chain

has been reported to underlie familial patent ductus arteriosus, a condition in which the

ductus arteriosus fails to close.58 These examples show that splice site mutations can

result in different types of defects, not all of which harbor premature stop codons. These

mutations can affect heart anatomy, function and development, and they can cause

changes in the heart structure and its pacemaker ability.

On the molecular level, the splice site mutation is located at the 5’ end of intron

10, adjacent to the 3’ end of exon 10. It deletes the donor part of the splice site and

additional 14 base within the intron; interestingly, the next base pairs after the deletion

are similar in sequence. The original splice site becomes replaced with another, ‘cryptic’

splice site which has a less efficient consensus sequence; probabilistic models reveal a

lower likelihood for successful splicing at the new splice site with 5’-…-AAG|GTAGAA-

…-3’ compared to the old one with 5’-…-AAG|GTATCC-…-3’.14

The less efficient splice site can have three different effects on splicing, yielding

different versions of mature mRNA (Figure 2-1). In case (a), replacing the old splice site

with a new one has no effect on splicing – wildtype mRNA is still used. In case (b), exon

28

10 is simply spliced out, likely because the 3’-splice acceptor site in intron 10 does not

interact with the changed 5’ splice site donor site in intron 10; instead, it interacts

directly with the 5’ splice donor site in intron 9. In case (c), there is simply no splicing

taking place between exon 10 and exon 11, leading to a retention of intron 10 in the

mature mRNA.

These cases can be readily distinguished by using quantitative RT-PCR with

exon-specific primers. If case (a) applies and the resulting mRNA is not changed, Exons

9 – 11 should have the same abundance in mutant vs. wildtype cells.

The same would be true for (c). In case (b), however, exon 10 should not be

present, while exon 9 still is. Importantly, sequence analysis reveals that retaining intron

10 would lead to a premature stop codon shortly after the mRNA sequence

corresponding to exon 10 has been read by the ribosome.

The principle of a quantitative RT-PCR is to first transcribe the target mRNA into

complementary DNA (cDNA), then use primers against the specific region that needs to

be amplified and run a Polymerase Chain Reaction (PCR), incorporating fluorescently

tagged nucleotides. The fluorescence can then be measured while the PCR reaction

proceeds. The more abundant the original template, the faster the fluorescence will

reach a certain detection threshold. For example, if the PCR reaction of a specific

template reaches this threshold after 10 cycles and the concentration of the template is

doubled, the threshold is now reached after 9 cycles. By comparing the cycles needed

to reach the threshold, one can then make a conclusion about the fold difference of

template abundance in different samples.

29

The primers used for assaying the presence of exons 9, 10 and 11 within the

PDK4 mRNA in wildtype vs. mutant conditions are directed against a sequence

overlapping exon 8 to exon 9 and another sequence from exon 10 to exon 11. The

product from Exon 8 to Exon 9 should not show any difference in wildtype vs. mutant

conditions, while the product from Exon 10 to Exon 11 should be missing when the

splice site mutation results in a mature mRNA lacking exon 10 (case b in Figure 2-1).

Using this assay, it is not possible to distinguish between wildtype mRNA (case a in

Figure 2-1) and an mRNA that retains intron 10 (case c in Figure 2-1).

Meurs et al. have shown that the abundance of exon 10 and 11 is indeed

strongly reduced compared to exon 9 in canines that are affected by the splice site

mutation;1 we therefore expected to see a reduced abundance of the exon 10 – exon 11

amplicon in our patients enrolled in this clinical trial. If, however, the analysis reveals

that exon 10 – exon 11 product is still present in mutant specimen, further analyses of

transcript length and PDK4 protein activity would be required, since the presence of

intron 10 (case c in Figure 2-1) would lead to a premature end of the translation of the

resulting mRNA.

Regardless, because the kinase domain is encoded within exon 10 and 11 of

PDK4, skipping exon 10 or retaining intron 10 would both lead to a PDK4 version with a

significantly compromised kinase activity.23

Materials and Methods

This study, and in the subsequent chapters, was conducted in accordance with

the guidelines of the Animal Care and Use Committee at the University of Florida.

Written consent authorizing study participation was obtained from each owner of DPs.

30

Animals

The study population, for this experiment, an all experiments in the subsequent

chapters, consisted of sixty-four (64) client-owned DPs that were screened for the

presence of DCM between 2014 and 2015. A total of eight (8) canines were excluded

due to the presence of degenerative mitral valve disease (DMVD). Each canine was

assessed by a 5-minute ECG, 24-hour ECG (Holter) examination, and

echocardiography. Participant canines were also genetically tested for the presence of

the PDK4 gene mutation via buccal mucosal swab. Samples were submitted to North

Carolina State College of Veterinary Medicine – Veterinary Cardiac Genetics Laboratory

(Figure 2-2). The canines were assigned to different groups based on their PDK4

mutation status (PDK4wt/wt - control, PDK4wt/del - heterozygous, and PDK4del/del –

homozygous). The participant canines were followed for a period of 2 years after initial

screening.

Inclusion Criteria

Enrollment was restricted to purebred DPs only. Canines of either sex were

included if they were aged between 2 and 10 years. The canines were assigned to three

(3) different groups. Group 1 canines were negative for the PDK4 gene mutation

(wildtype canines – PDK4wt/wt). Group 2 canines were heterozygous positive for the

PDK4 gene mutation (heterozygous canines – PDK4wt/del), and Group 3 canines were

homozygous positive for the PDK4 gene mutation (homozygous canines – PDK4del/del).

Exclusion Criteria

DPs that owners described as exhibiting clinical symptoms (e.g., syncope,

exercise intolerance, coughing, dyspnea caused by CHF) which could be attributed to

DCM, that were treated with cardiac drugs prior to screening evaluations, or had

31

concomitant diseases present were not included in the study. Canines with equivocal

screening evaluations were also not included in the study.

Echocardiography

Transthoracic 2-D, M-mode, and Doppler echocardiographic examinations were

performed by a board certified veterinary cardiologist. The right parasternal long-axis

and short-axis were used. Short-axis standard echocardiographic measurements of the

left ventricle during diastole and systole were obtained. A simultaneous ECG was

recorded during echocardiography. Dimensional measurements were obtained from 5

consecutive beats and averaged. Weight adjusted values of left ventricular internal

dimension in systole (LVIDs) (LVIDs equals 0.1402 × BW + 26.7 mm)6 were used to

screen canines for the presence of pcDCM. Canines with LVIDs equal or that exceeded

their weight adjusted value were considered affected (Table 2-1).

Holter Recordings

Holter recordings were obtained in the home environment in all Doberman

pinschers enrolled in the study. Owners were sent home with instructions for removal of

the holter monitor and advised to keep a patient diary in which activity periods were

noted. Manual adjustments and accuracy verification of the arrhythmias recognized by

the software (Forest Medical, LCC, Trillium Holter Analysis Software) were performed. A

cut-off value of >100 VPCs/24 hours on Holter examination was considered diagnostic

for cardiomyopathy. Fewer than 50 VPCs/24 hours were considered normal. Canines

with 50–100 VPCs were considered equivocal and excluded. Any combination of

couplets, triplets, runs and ventricular tachyarrhythmias were considered diagnostic to

pcDCM.

32

Harvesting of Fibroblasts

Skin biopsies from DPs were used to harvest fibroblasts in primary cell culture.

These fibroblast were used for all experiments in this and subsequenct chapters.

Canines were positioned in right lateral recumbency and a three millimeter skin biopsy

was obtained from their inguinal region. Fibroblast culture was performed with Dulbecco

modified Eagle medium containing 10% calf serum, penicillin-streptomycin, and

amphotericin B. After 3 passages, fibroblasts were frozen and stored at –80°C until all

samples had been collected.

Extracting RNA for PCR

Fibroblasts were grown in nutrient-containing medium to confluence, and RNA

for RT-PCR and subsequent qPCR was extracted using qiazol and purified using RNA

columns according to standard protocols.

Quantitative PCR

Extracted RNA was transformed into cDNA using the Applied Biosystems High

Capacity RNA-to-cDNA Kit. In brief, RT buffer and enzyme were combined into a

master mix and added to the RNA sample. As a negative control, the master mix

contained water instead of the Reverse Transcriptase. The final reaction volume was 20

µL, with no more than 2 µg RNA. The Reverse Transcriptase reaction was allowed to

proceed for one hour at 37 °C, followed by 5 min at 95 °C to denature the enzymes. The

resulting reaction mix contained the cDNA and was either kept at 4 °C until use a few

hours later or stored at – 20 °C overnight.

For the real-time quantitative PCR, the Applied Biosystem StepOne™

/StepOnePlus™ Real-Time PCR system was used. The run conditions were 2:00 min at

50 °C, followed by 10:00 min at 95 °C, and 40 cycles of 15 seconds at 95 °C and 1

33

minute at 60 °C. The reaction volume was 20 µL, containing the “TaqMan Gene

Expression Assay”, the “TaqMan Gene Expression Master Mix” and between 1 – 100 ng

of cDNA template from the previous Reverse Transcriptase reaction. PCR data was

analyzed using DataAssist™ software, based on the CT/ddCT method. Table 2-2 shows

the primer sequences used for the quantitative real-time PCR.

Statistical Analysis

Fold values from qPCR were tabulated and analyzed using Microsoft Excel 2011

and GraphPad Prism 7. The values were tested for significance using student’s t-test in

which p < 0.05 deemed as being significant. Values below the lower quartile minus 1.5

times the interquartile range or above the upper quartile plus 1.5 times the interquartile

range were excluded as outliers.

Results

Initially, a total of 64 canines was screened for this study; 8 animals were

excluded because of Degenerative Mitral Valve Disease (Table 2-1).

Signalment

There were 30 (53%) male and 26 (46%) female canines. Mean ±SD age at the

time of examination was 5.85 ±1.71 years; animals were 2.5 to 9 years old. The mean

age of the male canines (5.68 ±1.97 years, range 2.5 to 9 years) was not statistically

different from that of female canines (5.99 ±1.50 years, range 4.0 to 8.0 years).

Cardiac Evaluations

A total of 13 canines (23%) were diagnosed with pcDCM based on increased left

ventricular internal end-systolic dimension (LVIDs).

Ventricular premature complexes (VPCs) were detected in 23 of the 56 (41%)

animals. The average ±SD number of the premature complexes was 328 ±1132

34

(ranging from 0 to more than 7,000). Of the 23 canines with VPCs, 18 (78%) had

couplets and 3 (13%) had triplets. Six canines had runs of ventricular tachycardia (26%)

and one canine had extensive SVT. Two canines had atrial premature complexes

(APCs). The likelihood of any number of couplets was correlated to the number of VPCs

in a statistically significant way (correlation coefficient: 0.57, with a significance of p <

0.05). The total number of canines with triplets was low, so the number was not tested

for statistically significant correlation. The average ±SD number of VPCs in the 5

canines without couplets or triplets was 308 ±236 (range 4 to 647), the average ±SD

number of VPCs in the 18 canines with couplets alone or with couplets and triplets was

965 ±1,913 (range 4 to 7,000). A total of 8 (35%) canines had <50 VPCs, 3 (13%) had

between 50 and 100 VPCs, 7 (30%) between 100 and 500 VPCs, 1 (4%) between 500

and 1,000 VPCs, and 4 (17%) had over 1,000 VPCs. In the 23 canines with VPCs, the

detection of couplets or triplets was not associated with echocardiographic signs of

pcDCM.

PCR Results

The results from the PCR amplifying a target that extends from exon 10 to exon

11 showed difference for expression of mRNA levels between wildtype animals,

heterozygous, and homozygous mutants (Figure 2-3). These differences are significant,

according to One-Way ANOVA and Tukey’s multiple comparison test (p < 0.01).

When analyzing the exon 8-9 amplification product, small differences were still

visible, yet in contrast to exon 10-11, these differences were not significant (Figure 2-4).

Even though the amplification product of exon 8-9 is progressively reduced from

wildtype via heterozygous to homozygous mutant, the differences are smaller than in

the case of exon 10-11 and not significant, neither according to One-Way ANOVA nor

35

Tukey’s multiple comparison tests (Figure 2-4; p > 0.05). These results support our

hypothesis that exon 10 is absent. It is also possible that both exon 10 and exon 11 are

lacking in the mutant PDK4 mRNA. With the experimental setup we employed here, it is

not possible to resolve whether only exon 10 or both exon 10 and 11 are missing in the

mutant mRNA. In either case, the resulting PDK4 protein will lack the kinase domain

and be thus non-functional.

The results shown in Figure 2-3 and 2-4 are confirmed by gel analysis of the

amplified cDNA, as can be seen in Figure 2-5 and 2-6. It shows that exon 10-11 still

becomes amplified in heterozygous individuals, yet to a much lower extent as exon 8-9,

suggesting that the abundance of exon 10-11 is significantly lower if the splice site

mutation is present. The differences become even more abundant when looking at

homozygous PDK4 splice site mutants, as Figure 2-6 shows. According these results,

the exon 10-11 amplicon is absent, while the exon 8-9 amplicon is still present, although

in seemingly lower levels than in heterozygous canines.

Discussion

There is a large number of different mutations that lead to DCM. Most of these

mutations affect proteins involved in contraction, such as myosin heavy chain; Calcium

binding, such as troponin and tropomyosin; and structure, such as actin, titin, vinculin or

dystrophin, next to numerous others. However, apart from proteins such as tafazzin and

flavoprotein, not many genes are known that regulate metabolism and cause DCM upon

their absense.59-61 Interestingly, splice site mutations are linked to heart defects in

canines and humans.62,63 For example, cryptic splicing leads to the insertion of 18

amino acids into the human ERG potassium channel, leading to defects in trafficking

and Long QT Syndrome.63 Other splice site mutations connected to DCM disrupt

36

cardiac expression of dystrophin, laminin-A, RNA-binding proteins.64-66 Splice site

mutations in a large number of genes that are involved in impulse transduction, ion flux

or cardiac structure may not disrupt the corresponding protein outright, yet partially

impede its function and increase the severity of the phenotype of other homozygous

mutations within the genome.65 In general, mutating the splice site at the 5’ end of an

intron often leads to the splice machinery skipping the exon downstream of the intron

altogether, leading to the excision of exons as suggested in Figure 2-1b.67

For the molecular biological experiments in this study, fibroblasts were the model

system of choice. To correlate gene expression and protein activity to canines that were

PDK4wt/wt, PDK4wt/del, or PDK4del/del, primary fibroblasts were generated through skin

biopsies. Importantly, PDK4 showed gene and protein (Chapter 3) expression levels in

fibroblasts that were comparable to heart cells, supporting our use of these cells for

analyzing PDK4 expression and activity. Skin fibroblasts from DPs have been used

before to analyze mitochondria function in PDK4 mutant DPs.41

The results in this study show a clear reduction of the abundance in exon 10-11

of PDK4 gene in PDK4 mutants, suggesting that abolishing the original 5’ donor splice

site on intron 10 leads to a splice product that lacks exon 10. Results from gel

electrophoresis (Figures 2-5 and 2-6) confirmed the RT-PCR results, which showed

significant differences between genotypes for amplification of exon 10-11, while the

differences for exon 8-9 were not significantly different. These observations suggest that

the results obtained by RT-PCR are trustworthy. Yet it is also important to note that

gathering data from more specimen is likely to improve the accuracy of the results.

37

Figure 2-3 shows that the exon 10-11 amplicon is five times as abundant in

wildtype compared to heterozygous specimen, and that it is undetectable in

homozygous mutants. These differences are significant, while the differences in exon 8-

9 amplicon abundance are much lower and not significant: 30% reduction from wildtype

to heterozygous carriers, and the PCR product is still present in homozygous mutants.

The reduction in the amount of expression for exon 8-9 in mutant canines could

be a sign that the splice site mutation reduces the overall stability of the PDK4 mRNA.

Indeed, when comparing Figure 2-5 and Figure 2-6, we can also see a reduction in

exon 8-9 amplification product between heterozygous and homozygous mutants. All

amplification results in Figure 2-3 and 2-4 are compared to the housekeeping genes

HPRT. HPRT is a well-accepted canine housekeeping gene that stands for

hypoxanthine phosphoribosyl transferase, a protein that is involved in nucleotide

synthesis and thus assumed to always be expressed in every cell independent from its

metabolic status.68

The PDK4 splice site mutation observed here has a high likelihood of being

associated with an outbreak of DCM; despite mutations in multiple other genes being

linked to this condition, previously, 54 of 66 affected canines (82%) were either

homozygous or heterozygous for the PDK4 splice site mutation. In non-affected

canines, significantly fewer individuals, namely 26 out of 66 (39%), carried the mutation.

The fact that not all canines positive for DCM carry the PDK4 mutation suggests that

mutations in other genes, as well as other non-genetic factors can also cause DCM in

DPs.

38

It is also not 100% sufficient to carry the mutation, since some PDK4 mutant

canines do not develop DCM.14 This could have several explanations. First, DCM is a

progressive disease that has a variable onset. It could be that some of the canines that

carry the mutation and do not show the condition are still destined to develop DCM later

on in life. Second, other genes, such as PDK2 (Chapter 3), could compensate for the

loss of PDK4 activity in the mutants. And third, the mutation may not be 100%

penetrant. Indeed, the 5’ donor site in a wildtype intron 10 is not a classical consensus

splice site. In mutants, a cryptic splice site replaces the original site which may still

exhibit some splicing activity. Correlating the abundance of exon 10-11 amplicon vs.

exon 8-9 amplicon with canines that have developed DCM vs. those that have not

yielded inconclusive results. It would be interesting to look at the correlation in larger

data sets, or to induce splice site mutations using CRISPR/Cas9 in vertebrate model

systems, such as mice or rats, and evaluate whether the splice site mutation results in

DCM phenotypes during the complete lifespan of the organism.69

39

Figure 2-1. Different splicing possibilities to yield mature mRNA in PDK4 with a less efficient splice site adjacent to exon 10. The red bar with an asterisk marks the replacement of the original splice site by a less efficient, ‘cryptic’ one.70

40

Figure 2-2. Canines recruited for the study. The graphic gives an overview about the initial recruitment of DPs and their distribution into different subgroups. DMVD – Degenerative Mitral Valve Disease; PDK4wt – wildtype canines (in general); PDK4mut – mutant canines (in general); PDK4wt/del - Heterozygous canines; PDK4del/del – Homozygous canines; DCM – Dilated Cardiomyopathy.

41

Figure 2-3. Quantitative RT-PCR of a target spanning from exon 10 to exon 11 of PDK4 in wildtype (PDK4wt/wt), heterozygous (PDK4wt/del) and homozygous (PDK4del/del). The graphic shows fold changes compared with wt/wt group in the amplification product normalized to HPRT. Differences between wt/wt and wt/del as well as between wt/wt and del/del are significant according to One-Way ANOVA and Tukey’s multiple comparison test (p < 0.01). Average bar represents values of triplicate reactions.

42

Figure 2-4. Quantitative RT-PCR of a product spanning from exon 8 to exon 9 of PDK4 in wildtype (PDK4wt/wt), heterozygous (PDK4wt/del) and homozygous (PDK4del/del). The graphic shows fold changes compared with wt/wt group in the amplification product normalized to HPRT. None of the values are significantly different according to One-Way ANOVA and Tukey’s multiple comparison test.

43

Figure 2-5. RT-PCR and agarose gel electrophoresis of the exon 8-9 and 10-11 amplicon in individuals that were heterozygous carriers for the PDK4 mutation. 18S and HRPT are selected housekeeping genes.

44

Figure 2-6. RT-PCR and agarose gel electrophoresis of the exon 8-9 and 10-11 amplicon in individuals that were homozygous carriers for the PDK4 mutation.

45

Table 2-1. Left Ventricular Diameter in systole (LVIDs) depending on the canine’s body weight as inclusion criteria (LVIDs = 0.1402 × BW + 26.7 mm).6

Body Weight in kg up to LVIDs (mm)

25 38.8 30 39.5 35 40.2 40 40.9 45 41.6 50 42.3

46

Table 2-2. Primers used in this study for quantitative real-time PCR. Sequences are shown in 5’-3’ direction. RPS18 primers were provided by Thermo Fisher. Primers for housekeeping gene HPRT are taken from Brinkhof et al.68. PDK4 primers were always taken from the 5’-end of the first exon to the 3’-end of the second exon. A forward slash in the sequence marks a boundary between two exons.

Primer Sequence (5’-3’) Location

RPS18 Forward CTCTCTTCCACGGGAGGCCCGCAC exon 3 RPS18 Reverse TTAGGTGTATAAACGATTTATTAA exon 4 HPRT Forward AGC/TTGCTGGTGAAAAGGAC exon 5/6

HPRT Reverse TTATAGTCAAGGGCATATCC exon 7 PDK4 Exon 8 Forward AATGCAATGAGGGCAACAGTTGAA 5’-end of exon 8 PDK4 Exon 9 Reverse GTTTCCTCGTAAGGCCCTTAATAG 3’-end of exon 9 PDK4 Exon 10 Forward GCTGGTTTTGGTTATGGCTTACCA 5’-end of exon 10 PDK4 Exon 11 Reverse AAAGGACAACATTATTTTATAA 3’-end of exon 11

47

CHAPTER 3 A MUTATION IN THE PDK4 GENE LEADS TO A DECREASED EXPRESSION OF

PDK4 PROTEIN AND DISRRUPTION OF THE C-TERMINAL DOMAIN

Pyruvate Dehydrogenase Kinase 4 (PDK4) is a mitochondrial kinase that

phosphorylates Pyruvate Dehydrogenase (PDH) within the Pyruvate Dehydrogenase

Complex (PDC). Phosphorylation of PDH reduces its activity, inhibiting the

decarboxylation of pyruvate to Acetyl-CoA.54 The PDC – functions as gatekeeper that

either allows or blocks the complete oxidation of glucose. PDC is regulated by

phosphorylation of three serine residues within the E1 subunit of PDH, which is

performed by Pyruvate Dehydrogenase Kinases (PDKs). The general principle is that

phosphorylation of PDH downregulates its activity, while dephosphorylation restores it.

Since PDH has such an important function in cellular metabolism, PDKs play a central

role in regulating the energy balance of the cell.

There are four different PDK isoforms. These isoforms differ with respect to their

affinity for PDH, their kinetics and their expression in various tissues.71 In rats, PDK4 is

found in high abundance within the heart and skeletal muscle and in medium large

amounts in the lung, liver and kidney.29 In the human body, it is upregulated in skeletal

muscle tissue of individuals with type II diabetes, impairing glucose oxidation. Similarly,

PDK4 is upregulated during starvation, which ensures that the major part of metabolic

flow originates in fatty acid oxidation.29

An increase in insulin levels leads to a downregulation of PDK4 activity,

stimulating glucose oxidation; conversely, fasted states with low insulin levels lead to an

upregulation of PDK4, which suppresses PDC activity.71-78 Further studies have found a

plethora of transcriptional pathways that impact PDK4 expression; underlining the

important role in organismal energy regulation and homeostasis.

48

Structural studies of PDKs have revealed that these kinases consist of two

distinct domains, the N- and the C-terminal domains.79-81 The N-terminal domain of PDK

consists of eight alpha-helices with a four-helix bundle-like structure forming the core.

The C-terminal domain contains the phosphotransferase catalytic site. Crystal structure

analyses suggest that a conserved DW (Asp-Try) motif close to the C-terminus of the

protein is required for PDK4 activity. The DW motif is conserved across all PDK

isoforms. Moreover, functional analyses of PDK4 forms in which the DW motif is deleted

show a significant decrease of kinase activity.55 Mechanistically, the DW motif is thought

to keep PDK4 complexes in the open configuration, from which ADP can easily

dissociate, allowing the completion of the transformation of ATP to ADP + Pi during the

phosphorylation of PDH.55 In Canis lupus familiaris PDK4, the DW motif is located close

to the C-terminus at amino acid position 394 and 395, and it is encoded by sequences

within exon 11. Figure 3-3 shows a schematic picture of the PDK4 crystal structure.


Canine cardiology evaluation, genotyping, and harvesting of fibroblasts were

performed as previously described in chapter 2.

Enzyme-Linked Immunosorbent Assay (ELISA)

For ELISA assays, a commercial kit was used (PDK4 ELISA Kit, abcam,

ab126582). The kit provided plates precoated with anti-PDK4 antibody; protein extracts

from different fibroblast samples were added to each well and incubated several hours

at room temperature, allowing PDK4 protein to bind to the antibodies. After washing the

wells, PDK4 primary antibody was applied to the wells to detect the bound PDK4

protein. The bound antibodies were then labeled with Horse Radish Peroxidase (HRP),

followed by the application of a colorimetric reagent. Color development was monitored

49

for 15 minutes at 600 nm and the concentrations calculated from the recorded

absorbance.


Absorption values from the ELISA assay were tabulated and analyzed using

Microsoft Excel 2011 and Graphpad Prism 7. The values were deemed significant for p

< 0.05.

Results

Chapter 2 showed via quantitative real time PCR that PDK4 is expressed in

fibroblasts. What was not yet known before is whether PDK4 protein is present in these

cells at physiological levels, and whether the protein undergoes the same upregulation

during starvation as it does in vivo.47 If this was indeed the case, fibroblasts could be

used as cellular model for the study of PDK4, PDH regulation, and mitochondria

function in animals with this gene mutation.

We therefore used ELISA with PDK4 specific antibodies to measure protein

levels in fibroblasts from PDK4wt/wt, PDK4wt/del and PDK4del/del canines that have been

incubated under normal conditions or starved, i.e. kept without glucose, for 24 hours.

The results are shown in Figure 3-1. We can appreciate that PDK4 protein levels are

downregulated in PDK4wt/del and PDK4del/del fibroblasts. Furthermore, PDK4 levels were

slightly upregulated after starvation of the cells (Figure 3-1).

Discussion

This is the first report showing PDK4 expression in skin fibroblasts of canines.

Fibroblasts have been isolated before from wildtype or PDK4 mutant DPs. The results

from these experiments were suggestive of the presence of PDK4 in skin fibroblasts, yet

PDK4 expression was never tested in these cells.41 It is important to remember that

50

PDK4 expression is not abundant across all different tissue types as a housekeeping

gene would be. Rather, PDK4 expression is tissue-specific.29 Therefore, to establish

primary fibroblasts as a model system for PDK4 mutant canines, PDK4 expression in

fibroblasts and its upregulation during starvation needed to be demonstrated. Our

results indicate that PDK4 is present in fibroblasts and is upregulated after withdrawal of

nutritional components in the cell culture medium. In addition, PDK4 is located within

mitochondria, and mitochondrial structure and function is disrupted in DCM. To be able

to address PDK4 function in the regulation of aerobic metabolism and to address the

impact of PDK4 in the switch between Glucose and Fatty Acid oxidation as primary

energy generating process, it must be possible to detect PDK4 proteins directly in

mitochondria; moreover, as mitochondrial function may be affected during the

development of DCM, it is important to be able to correlate the presence of PDK4 in

relation to the metabolic status of the cell directly within these organelles. Previous

studies have shown that mitochondrial membrane potential and thereby mitochondrial

function can be studied in fibroblast cell lines.85 Our results establish primary fibroblast

cell culture a suitable model systems to study the effects of PDK4 mutations on PDH

activity and mitochondria function in canines.

Pyruvate Dehydrogenase Kinase 4 (PDK4) is a protein that catalyzes the

phosphorylation of Pyruvate Dehydrogenase (PDH) within the PDC. Canines that carry

a splice site mutation at the 5’-end of intron 10 (Figure 2-1) lack exon 10 and 11 in their

mRNA.14 This likely impacts protein activity, since the C-terminus contains a conserved

Aspartate-Tryptophan (DW) motif at amino acid 394 – 395 that is essential for PDK4’s

ATPase function.55 PDK4 forms dimers in vivo, and the DW motif at the C-terminus of

51

subunit A of the PDK4 complex interacts with two more N-terminally situated amino

acids, Tyrosine (Y157’) and Arginine (R161’), in subunit B – and vice versa. Deleting the

DW motif or mutating Y157’ to F157’ and R161’ to A161’ leads to a significant reduction

of PDK4 activity, showing that the DW motif and its interaction with Y157’ and R161’ is

required for PDK4 activity. The precise function of the DW motif in the reaction

mechanism of PDK4 is not yet fully understood; however, without the DW motif, PDK4

exists predominantly in the closed, inactive conformation, suggesting that the DW-YR

interaction keeps the PDK4 dimer in the open conformation.55

The ELISA results from this study have confirmed several results published

before and revealed some interesting behaviors. First, starvation in fibroblasts from

canines that are wild type for PDK4 is correlated to an increased PDK4 protein level.

This suggests that as in humans and other mammals, low energy states induce the

expression of PDK4. Importantly, this starvation linked upregulation of PDK4 has not

been shown in fibroblasts before and is a further suggestion that primary fibroblast cell

culture is a suitable model system to address the function of PDK4 in regulating the

balance between Glucose and Fatty Acid Oxidation. Increased levels of PDK4 likely

lead to a downregulation of the PDH, leading to a downregulation of glucose oxidation

in favor of fatty acid oxidation. Our results suggest that in DPs, PDK4 is increased as a

response to starvation or low energy states. These results conform with earlier studies

in rats, where starvation increased PDK4 (and PDK2) levels in kidney, liver, adipose

tissue and the brain.47 In addition, starvation induced upregulation of PDK4 also

reduced its sensitivity for regulation through pyruvate. Normally, an increase in pyruvate

reduces PDK4 activity, allowing the PDH to respond positively to a raised supply of

52

precursors for Acetyl-CoA. By reducing the impact of that regulatory axis during

starvation, pyruvate becomes preserved for entry into the citrate cycle via anaplerosis.

This, in turn, keeps the cycle going and facilitates the entry of Acetyl-CoA from fatty

acids.86 The results in this study also show that there is indeed a basic level of PDK4 in

fibroblasts; so far, the expression levels of PDK4 in skin were not well understood.41

Interestingly, despite the presence of PDK4 mRNA in PDK4 mutants, PDK4

protein levels are strongly reduced in heterozygous mutants or completely absent in

homozygous mutants. This suggests that the splice site mutation reduced protein

stability.

Theoretically, without PDK4 activity, PDH will not be downregulated, resulting in

increased utilization of glucose oxidation to generate energy at the expense of fatty acid

metabolism. This would also mean that in mutant canines, the heart cannot react to a

lower supply of glucose, in turn becoming less efficient in utilizing fatty acids as an

energy source, possibly resulting in lipid deposits. The heart becomes less energy

efficient and reacts to the energy deficit by enlarging its ventricle. Canines affected by

DCM show a thinning of the ventricle wall, irregularities in muscle fiber assembly and

distorted mitochondria as well as lipid deposits in the cardiac muscle cells.

Interestingly, ectopic overexpression of PDK4 in hearts of mice, together with an

activated calcineurin-stress response pathway leads to an increase in thickness of the

ventricular wall, reminiscent of Hypertrophic Cardiomyopathy (HCM). It is possible that

forced utilization of fatty acid as the more efficient energy source results in enhanced

growth of cells. Results from both PDK4 loss and ectopic PDK4 activation show that the

type of energy source can have an impact on heart morphology.14 Evaluation of PDH

53

function in healthy canines and canines with PDK4 mutation would add another

valuable information about the overall cell metabolism.

54

Figure 3-1. ELISA using antibodies against PDK4 in non-starved (dark grey bars) and starved (light grey bars) fibroblasts from healthy canines and canines affected with DCM. Asterisks denote significant differences with p < 0.05.

55

CHAPTER 4 PYRUVATE DEHYDROGENASE COMPLEX PROTEIN EXPRESSION AND

FUNCTION ARE ALTERED IN CANINES WITH PDK4 MUTATION

The Pyruvate Dehydrogenase Complex (PDC) is located within the mitochondria,

where it uses Coenzyme A and NAD+ to oxidize pyruvate, the end product of glycolysis,

to Acetyl-Coenzyme A (Acetyl-CoA), Carbon Dioxide (CO2) and NADH + H+. It plays a

significant role in the cell’s energy flow.

The Pyruvate-Dehydrogenase complex consists of three catalytic subunits:

Pyruvate dehydrogenase (PDH) or E1, Dihydrolipoyl Transacetylase or E2, and

Dihydrolipoyl dehydrogenase or E3. PDC also contains two regulatory units: Pyruvate

Dehydrogenase Kinase (PDK) and Pyruvate Dehydrogenase Phosphatase (PDP).

The PDC is an enzyme conglomerate consisting of several dozen E1, E2 and E3

subunits and cofactors. Therefore, the activation status of the PDC, will always be an

equilibrium with several complexes more and several others less active - rather than a

simple on-off switch. In that way, PDC will always reflect the energy demands of the cell

in a gradual way, enabling Glucose Oxidation and Fatty Acid Oxidation to coexist at

different levels within the cell.87 Regulation of PDC works mainly through the

phosphorylation status of PDH, which is a tetramer consisting of two alpha- and two

beta-subunits. Pyruvate Dehydrogenase Kinases (PDKs) phosphorylate PDH at three

different serine residues within the -subunit.71

In mammalian organisms, there are four distinct PDK isoforms with different

expression profiles, substrate affinities and regulatory propensities.29 The common

result of E1 phosphorylation is the inactivation of the subunit and thus the whole

Pyruvate-Dehydrogenase Complex. Dichloro-Acetate (DCA), a PDK inhibitor, can be

56

used to activate the PDC in fibroblasts, while Sodium Fluoride (NaF), which blocks

PDPs, decreases PDC activity.88 In general, the balance between phosphorylated and

dephosphorylated versions of PDC regulate the activation status of the complex, with

the dephosphorylated form being active and the phosphorylated form being inactive.

PDK isoform activity itself can be regulated on the post-translational level through

several different metabolic substrates, enabling a plethora of feedback mechanisms that

allow for a fast fine tuning of metabolic activity. While Acetyl-CoA, NADH and ATP all

activate PDKs, pyruvate inhibits it. Since an activated PDK deactivates PDC and a

deactivated PDK elevates PDC activity, this suggests that an abundance on metabolic

products, signaling an energy surplus, reduces the generation of more energy from

PDC, while a surplus on entrants into the metabolic pathways downstream of PDC

stimulates the activity of this very enzyme.54 In addition, PDK can also be regulated

through transcriptional regulation, for example through phosphorylated FOXO

transcription factors, which are in turn targets of the PI3K/Akt pathway. Furthermore,

factors such as PPAR-alpha and receptors for estrogen-related hormones, thyroid

hormone and glucocorticoid hormones all stimulate the expression of PDKs.54

Given all the knowledge about Pyruvate Dehydrogenase Kinases, less is known

about the regulation of Pyruvate Dehydrogenase Phosphatase (PDP) and its impact on

PDC activity. There are two different isoforms, PDP1 and PDP2. Whereas PDP1 can be

predominantly found in mitochondria of skeletal muscle, PDP2 is exclusively present in

liver mitochondria. Furthermore, PDP1 is dependent on Ca2+ ions, whereas PDP2 is

not. The question how PDPs are regulated with regards to metabolic status is without

doubt an interesting avenue for further research, since the vast majority of previous

57

studies have looked exhaustingly into PDK regulation and its impact on PDC activity,

even though PDPs play an important role as well.89

A rapid adaption of the energy metabolism to nutrient availability is essential for

the heart, which does not have the capacity to store large amounts of glucose. Glucose

Oxidation (GO) is slightly more efficient than Fatty Acid Oxidation (FAO), with 15% more

ATP produced per molecule of O2. In times of starvation, however, the heart will still

prefer to generate its energy from fatty acids, since oxidation rates for the latter are

faster than for glucose.90 Insulin deficiency and an increase in lipid utilization are

connected to an upregulation of PDK activity, leading to phosphorylation and

downregulation of PDC. In turn, fatty acids, not glucose, form the main source for

Acetyl-CoA.90 Furthermore, a diet high in fat also leads to an upregulation of PDK

isoforms, boosting FAO relative to GO. However, the balance between Glucose and

Fatty Acid availability is not the only means by which PDC phosphorylation - via PDK

isoforms - is controlled. Recent studies suggest that additional physiological sources

regulate PDKs - hypoxia, PKCdelta isoforms that are sensitive to the redox status of the

organism, and transcriptional control through the lipid activated PPAR-alpha and the

insulin repressed phosphorylated FoxO.90 These controls lead to an upregulation of

PDK isoforms in response to enhanced fatty acid availability/starvation and insulin

deficiency/diabetes.46,87 Interestingly, when PDK4-/- knockout vs. wild type control mice

were fed fatty acids, Glucose Oxidation was inhibited in controls, but not in the mutant

animals, suggesting that fatty acids directly influence PDK4 activity.

Conversely, abolishing PDK4 activity should lead to an increase in PDC/PDH

activity, and increasing PDK4 activity should downregulate PDH activity. However,

58

these adverse effects of PDK4 activity on PDH activity should be more pronounced if an

organism is lacking PDK4 activity in the first place. One would therefore expect that

PDH activity in Doberman Pinschers (DPs) that are deficient in PDK4 is higher than in

animals that are heterozygous or wild type for PDK4. Conversely, adding PDK4 will

have a stronger effect on PDH suppression than it has in control animals. Therefore, to

test whether the PDK4 splice site mutation that leads to DCM in DPs has indeed an

effect on PDH activity, fibroblasts were isolated from adult DPs diagnosed with

preclinical DCM and from healthy canines, both tested for the presence of the PDK4

gene mutation, and PDH protein expression and function were evaluated.


Canine cardiology evaluation, genotyping, and harvesting of fibroblast were


ELISA Assays

For measuring both activity and quantity of Pyruvate Dehydrogenase (PDH), a

commercial kit was used (Pyruvate dehydrogenase (PDH) Combo (Activity + Quantity)

Microplate Assay Kit, abcam, ab110671). The kit contained 96-well-sized

microplates precoated with monoclonal antibodies against mammalian PDH. PDH

reduces NAD+ to NADH; NADH, in turn, reduces a reporter dye into its yellow form

which absorbs at 450 nm. Therefore, the activity of the immobilized PDH can be

determined through the analysis of optical density at 450 nm. To measure activity,

therefore, fibroblast protein extracts were loaded onto each well and incubated for 3

hours at room temperature to give PDH enough time to bind the antibodies. After

washing off the protein extract, assay solution containing the substrate was added to

each well, and the optical density was measured at 450 nm every 36 seconds. Changes

59

in optical density were then plotted against time to measure PDH activity. To address

the functional significance of the activity measurements, recombinant PDK4 was added

to the samples after 15 minutes; after 15 further minutes, Glutamate was added to the

sample and measured for an additional 15 minutes. To measure PDH quantities,

instead of adding a substrate solution and measure the changes in absorbance at 450

nm, anti-PDH antibodies were added to the immobilized PDH, incubated and detected

with a secondary antibody that was coupled to Horse Radish Peroxidase (HRP). HRP

changed a colorless development substrate into a blue version, the absorbance of

which was measured at 600 nm. The higher the absorption, the more PDH was initially

bound to the plate, enabling conclusions about the PDH content within fibroblasts.

Therefore, protein extracts were incubated on the precoated plates for 3 hours at room

temperature. To detect immobilized PDH, the wells were washed and incubated with

detector antibody solution 1 hour at room temperature; after additional washes, the

wells were incubated with HRP labeled antibody for an additional hour at room

temperature, HRP development solution was added and the blue color measured after a

fixed time interval of ca. 15 min.


Absorption values for PDH activity and quantity were tabulated and analyzed

using Microsoft Excel 2011 and Graphpad Prism 7. To assess PDH activity, absorption

values from the ELISA assay were plotted over time and tested for significance using

student’s t-test in Microsoft Excel with p < 0.01 deemed as being significant. For each

genotype, canines that expressed a DCM phenotype were pooled with those that did

not display a phenotype; separate analysis revealed that the fact whether a canine

60

developed a DCM phenotype made no significant difference for the overall average of

the values.

For PDH quantity determination, PDH values from fibroblasts before and after

starving were analyzed using student’s t-test in Microsoft Excel. PDH quantities in

samples from different genotypes were analyzed using One-Way ANOVA - one time for

fibroblast samples before starving, one time for samples after starving - in Graphpad

Prism 7.

Results

Figure 4-4 (A - D) shows the effects of PDK4 and glutamate addition on isolated

PDH from DP fibroblasts in the presence and absence of PDK4 activity. The reduction

of NAD+ to NADH + H+ is used as a proxy to determine PDH activity; NADH + H+ in turn

reduces a reporter dye, yielding a yellow substance, the absorption of which is

measured at 450 nm. As can be seen from the graphic, PDH from wild type canines

showed a slightly reduced absorption after PDK4 addition, which is restored after

Glutamate is added to the reaction. PDH from PDK4wt/del heterozygotic animals has a

slightly elevated absorption under control conditions compared to wild type animals. The

activity becomes reduced after PDK4 is added and restored after the addition of

Glutamate, yet it always stays slightly above wild type conditions. The biggest

difference, however, can be seen when using PDH from fibroblasts that carry the PDK4

homozygous deletion. One explanation for that behavior is that indeed without PDK4

activity, PDH activity is strongly elevated. Interestingly, addition of exogenous PDK4

brings the PDH activity levels down into values that are almost exactly identical to those

incurred during control conditions for PDK4wt/del heterozygous animals. Glutamate

61

restores the initial high absorption in PDK4del/del homozygous mutants. This suggests

that the deletion in PDK4 indeed is causative for increased PDH activity.

Interestingly, the quantities of Pyruvate Dehydrogenase also vary between

fibroblasts gained from canines with varying PDK4 levels. Figure 4-4 (E) shows PDH

quantities in PDK4wt/wt, PDK4wt/del and PDK4del/del fibroblasts. For that experiment,

fibroblasts from canines with the corresponding genotypes were grown in normal culture

medium with the addition of serum and glucose – depicted as “nsFB” or “non-starved

fibroblasts”. PDH quantities were measured using an ELISA assay and normalized

against the total protein content in the cells. Subsequently, the fibroblasts were starved

by growing them in medium without serum and glucose. Similarly, at the end of the

starvation period, PDH quantities were determined and normalized against total protein

levels. Figure 4-4 (E) shows that the PDH quantities were similar before and after

starvation; in addition, paired student’s t-tests show that there is no statistically

significant difference in PDH levels before and after starving. This suggests that

differences in metabolic status do not influence total PDH protein level within the time

frame of the experiment. This is important, as you would expect that PDH activity is

changed and likely downregulated upon withholding glucose as an energy source. In

addition, if we distinguish between individuals that have developed a DCM phenotype

vs. individuals that have not for any given genotype, we see that there are no significant

differences in PDH concentrations. This suggests that the differences in PDH levels are

not a secondary consequence of DCM.

Interestingly, PDH quantities are higher in PDK4wt/wt fibroblasts than in fibroblasts

from heterozygous and homozygous mutants. One-way ANOVA showed the differences

62

to be statistically significant across all three conditions in non-starved fibroblasts (p <

0.0001); in addition, Tukey’s multiple comparison’s test shows pairwise comparisons

are all statistically significant as well. Taken together, these results suggest that there is

no significant difference between PDH expression in non-starved vs. starved fibroblasts;

yet, there is a significant difference in PDH expression among different PDK4 genotypes

and thus likely between different PDK4 activities (since the PDK4 deletion studied here

reduces most likely PDK4 activity).

Discussion

Previous studies have suggested that in DPs affected with DCM, key metabolic

enzymes within the heart mitochondria are downregulated, reducing the efficiency of

energy generation.18,39,91 These studies saw downregulation of enzymes that were

mediating both glucose oxidation and fatty acid oxidation. For example, enzymes that

catalyze key steps of the electron transport chain in the mitochondrial membrane – for

example, ATP synthase and NADH dehydrogenase - were found to be significantly

downregulated in cardiac mitochondria of DPs suffering from DCM.91 Upregulation of

manganese superoxide dismutase – a mitochondrial attenuator of oxidative stress –

was found in both naturally occurring and pacing-induced DCM, further indicative of a

misregulation of oxidative phosphorylation in these animals.18 These studies also found

the E1 -subunit of Pyruvate Dehydrogenase (PDH) downregulated in naturally

occurring DCM, while the E1 -subunit was reported to be upregulated in induced DCM,

suggesting that the expression of PDH is regulated in a complex manner.18 These

studies analyzed PDH expression and found it was downregulated in the hearts of

canines suffering from DCM. However, since those studies were performed before the

63

discovered of a mutation on the PDK4 gene, they mainly focused on the effects of

metabolic intermediates and transcription factors on PDH expression. The function and

activity of PDH in DCM affected DPs has never been analyzed before. However, as

seen in Chapter 2, the presumed loss of PDK4 function and the reduction in expression

of mitochondrial PDK4 protein offers a unique possibility: to address whether a

modulation of PDH activity may lead to DCM.14,41,54

The experiments conducted on PDH activity from isolated DP fibroblasts (a)

show that the PDK4 region that is deleted in the analyzed specimen is indeed required

for the regulation of PDH and (b) confirm that an elevation of PDK4 activity

downregulates PDH, as established before (Figure 4-4).71 Under control conditions,

PDH activity from PDK4wt/del specimen is higher than that of WT embryos; PDK4del/del

homozygous fibroblasts show a drastically enhanced PDH activity. These differences

appear statistically significant, since the standard deviations of all three conditions –

wild type, heterozygotes and homozygotes – are not overlapping. This also suggests

that there is no dosage compensation for mutations that impede enzymatic activity of

PDK4, since otherwise, one would expect the PDH activity to be the same in PDK4wt/wt

and PDK4wt/del animals. Interestingly, addition of PDK4 to the reaction mix reduces PDH

activity in PDK4del/del homozygous mutants to control levels in PDK4wt/del heterozygotes,

suggesting that increasing PDK4 activity directly decreases PDH activity. There is also

a decrease in PDH activity upon addition of PDK4 to heterozygotic PDK4wt/del mutants.

Intriguingly, similar to the PDK4del/del mutants, where exogenous PDK4 brought the PDH

level down to those of heterozygous animals, exogenous PDK4 in heterozygous

animals brings the PDH level down to wild type control conditions. It seems as if

64

exogenous PDK4 can mimic the effect of an additional intact allele of PDK4, which adds

to the suggestion mentioned above that there is no dosage compensation for PDK4

mutant alleles, but that the resulting phenotype in a heterozygous PDK4 mutant is

intermediate. This may add to the metabolic flexibility of the PDC complex regulation41

and suggests that transcriptional inactivation of one PDK4 copy can be an additional

way for the organism to control its metabolism and PDH activity. Even addition of PDK4

to homozygous wild type embryos further reduces PDH activity, further providing

evidence that any further increase of PDK4 activity has an additive effect: if PDK4

expression and activity was controlled via dosage compensation, one would not expect

a further reduction of PDH activity when adding PDK4 to wild type embryos (Figure 4-4).

Glutamate is a precursor to -ketoglutarate, which is a substrate of the citrate

cycle. It becomes decarboxylated to yield oxaloacetate, which is a precursor for

gluconeogenesis. Newly synthetized glucose is broken down via glycolysis to yield

pyruvate, which blocks PDK4 activity, in turn elevating PDH activity. This is indeed what

can be observed in Figure 4-4 (A - D); upon glutamate addition, PDH activity returns to

an activity indistinguishable to its original activity, independent of the PDK4 genotype of

the analyzed specimen.

The results from the ELISA activity analysis clearly show that PDK4 has a

significant impact on PDH activity; if PDH activity in fibroblasts was regulated by an

isoform different from PDK4, one would not have expected to see such a strong

increase in PDH activity in PDK4 mutants compared to wild type embryos. Especially

the case of PDK4wt/del heterozygous specimen is interesting – if another PDK isoform

was mainly responsible for regulating PDH activity, there should not be such a strong

65

increase in PDH activity upon the loss of one PDK4 copy. The results also confirm that

the deleted region in PDK4 is indeed responsible for its activity concerning PDH

downregulation.

These observations also confirm fibroblasts to be a suitable model system for

PDK4 related changes in skeletal muscle and heart. As different isoforms are expressed

differentially across tissues and organs, these observations mark an important

validation of the chosen cell culture system – in addition to the findings of experimental

significance for the study.

One caveat of this experiment is that the genotype does not always predict

whether the corresponding canines were actually suffering from DCM. However, this

can be easily explained by the fact that the age by which DPs experience symptoms is

variable. In addition, DCM can have multiple causes. The experiments in this study seek

to uncover possible molecular conditions underlying the development of DCM in DPs,

and so far, there seems to be a clear connection between the reduction of PDK4 activity

and the upregulation of PDH activity, with potentially significant ramifications for the

affected canines.

Interestingly, while the metabolic status of the cell has an influence on PDH

activity, it does not seem to regulate PDH levels, as Figure 4-4 (E) suggests - PDH

concentrations in starved vs. non-starved fibroblasts are not significantly changed.

Interestingly, Lei et al. found that expression of the PDH E2-subunit was downregulated

in canines with pacing-induced heart-failure, while Lopes et al. showed that induced

heart failure did not alter the expression levels of the E1-subunit of Pyruvate

Dehydrogenase (PDH), which carries the serine residues, the phosphorylation of which

66

regulates the activity of the PDH enzyme complex.18,39 Indeed, comparisons in this

study show no statistically significant difference in PDH levels between canines with

normal hearts and canines with DCM affected hearts. These observations suggest that

cardiac alterations during heart failure do not change PDH expression levels, and that

any observed changes in PDH concentrations are not the secondary consequence of

DCM in diseased hearts. These observations are interesting, since they suggest that

PDK4 levels – which are elevated after starvation, in DCM affected hearts as well as

during induced heart failure may alter PDH activity, but have no effect on PDH levels,

suggesting that PDK4 activity does neither target PDH expression nor PDH

degradation.39,92,93

However, while neither starvation nor DCM appear to have an effect on PDH

levels, the presence of PDK4 activity has a significant influence on PDH levels. Average

PDH concentrations were reduced by 20% between fibroblasts of PDK4wt/wt and

PDK4wt/del canines and by ca. 70% between PDK4wt/wt and PDK4del/del fibroblasts. These

observations are in line with the study by Lopes et al., showing via 2D-gel

electrophoresis, followed by mass spectrometry, that in naturally occurring (not induced)

DCM, PDH is downregulated as well.18 While our results show no difference in PDH

levels in DCM affected vs. healthy canines, it points at the possibility that reduced PDH

levels can be linked to metabolic deficiencies that lead to heart failure. How does this fit

in with the observation that starvation or DCM phenotypes, both found to increase

PDK4 activity and levels, have no influence on PDH levels? One possible solution is

that PDK4 activity is necessary to establish PDH expression, but not sufficient to

increase it. In other words, PDK4 activity could activate transcription factors that enable

67

PDH expression, but once PDH is stably expressed, further increases in PDK4 level or

activity do not lead to further changes in PDH levels. Conversely, PDK4 could inhibit the

ubiquitin-mediated degradation of PDH.87 The application of drugs that inhibit

proteasomal degradation or transcriptional activation in the absence and presence of

PDK4 activity could help distinguish between both possibilities. In any case, the results

presented in Figure 4-4 (E) suggest that in addition to the feedback loop between PDK4

and PDH that influences PDH activity based on the metabolic status of the cells, there is

another role for PDK4 in the regulation of PDH concentration within the cell.

68

Figure 4-1. Pyruvate Dehydrogenase (PDH) function (A-D) and abundance (E) via

Enzyme-Linked Immuno-Sorbent Assay (ELISA) analysis in PDK4wt/wt (black), PDK4wt/del (blue), and PDK4del/del (red) fibroblasts. (A) PDH activity in control buffer, after addition of PDK4 and Glutamate. The y-axis shows the absorption at 450 nm. The x-axis shows the minutes elapsed. (B) Bar graph representation of PDH baseline activity in control buffer; the values from (A) have been averaged. (C) Bar graph representation of PDH activity after PDK4 addition; the values from (A) have been averaged. (D) Bar graph representation of PDH activity after PDK4 and Glutamate addition; the values from (A) have been averaged. (E) PDH abundance, normalized against total protein. Non-starved fibroblasts are depicted in solid bars, fibroblasts after starving are in checkered bars. (* p < 0.05).

69

CHAPTER 5 PRIMARY SKIN FIBROBLAST ABUNDANCE, MORPHOLOGY AND CYTOSKELETAL

STRUCTURE UPON STARVATION IN DIFFERENT PDK4 MUTANT CONDITIONS.

Research involving Doberman Pinschers (DPs) is strongly regulated by the

Institutional Animal Care and Use Committee (IACUC) in the United States; in addition,

DPs used in this study were family owned. This background precludes the utilization of

invasive protocols for tissue harvesting. In addition, there are currently no small animal

model systems or permanent cell lines available that would allow the study of the

molecular, biochemical and cellular mechanisms underlying the development of Dilated

Cardiomyopathy (DCM). For that reason, one of the central purposes of this paper was

the development of primary skin fibroblast culture as a platform to study the molecular

and cellular mechanisms underlying DCM. Skin fibroblasts are easily accessible using a

simple punch skin biopsy and can be harvested without greater distress to the animal

from which they are taken. In addition, skin fibroblasts have been used in many cases

as a model for a multitude of human genetic diseases, such as Parkinson’s Disease,

Alzheimer’s or Muscular Dystrophies, which can lead to DCM similarly to the condition

discussed in this paper.85,96-98 Fibroblasts can be easily grown in culture towards

amounts that allow for a thorough biochemical and cell biological study.99 Primary skin

fibroblasts have the same age and genetic background of the animal from which they

are taken and thus represent a model system directly related to the biological status of

the donor organism. This is important, as mitochondrial function varies with age.

Specifically, the older the organism, the lower mitochondrial oxygen consumption and

the more likely background mutations can occur in mitochondrial DNA that render the

organelle inefficient in terms of energy production. This is important especially in this

study, as the median age of DPs affected by DCM in this study is around 7.5 years.85

70

Importantly, primary skin fibroblasts have been successfully established before as

model for diseases such as Parkinson’s that involve cellular stress, energy deficits,

respiratory changes and mitochondrial dynamics. This suggests that these cell lines will

be well suited to the study of the mechanisms that underlie alterations in cellular

metabolism linked to DCM.96

Fibroblasts multiply in vitro until grown to confluence, as long as there is a rigid

substratum and serum around; serum contains FGF, EGF and MSA, which all have a

role in stimulating proliferation.100 Fibroblasts are motile and show a network of

microfilaments that is parallel to the substratum and oriented in line with their movement

direction; the network consists mostly of actin and myosin, which interact and contract in

the presence of ATP.101 The cytoplasmic network is attached to the substratum and

other cells via focal adhesions and adherens junctions, respectively, translating

contractile force to the environment, increasing cellular strength and enabling their

movement.100,102,103

Importantly, fibroblasts are dependent on an intact mitochondrial organelle

system to function. Studies with skin fibroblasts from Parkinson’s patients where

mutations in -Synuclein resulted in impaired energy production from mitochondria

showed a decrease in cellular proliferation.96,104 This suggests that fibroblasts can also

be a useful system to elucidate the molecular and biochemical base of the development

of DCM in canines with impaired PDK4 function, as the latter protein plays a key

regulatory role in mitochondrial energy production.54

Importantly, fibroblasts that are deprived of serum proteins start spreading their

cytoplasm and take on a less distinct shape, indicating reactions to the unfavorable

71

conditions. Interestingly, human foreskin fibroblasts show an elevation in lactate and

Lactate Dehydrogenase (LDH) levels, suggesting a metabolic switch to anaerobic

glycolysis with subsequent lactate fermentation similar to the Warburg effect observed

in tumor cells. One important hallmark of this metabolic switch is the deactivation of

entry into the mitochondrial TCA cycle.105,106

This research project is aimed at establishing primary skin fibroblasts as model

system to address the molecular basis of metabolic stress and mitochondrial

dysfunction linked to DCM in healthy and affected DPs. It will address both fibroblast

growth and proliferation as well as changes in cellular morphology and behavior in

fibroblasts from healthy canines and those that carry a mutation in the PDK4 gene,

which is a central regulator of cellular metabolism and mitochondrial function. To

accomplish this, this study will test the requirement of PDK4 for the cells’ adaptation to

unfavorable metabolic conditions, such as serum starvation.

We already confirmed that primary skin fibroblasts express PDK4, rendering

them a potentially useful model system in the investigation of the molecular basis of

PDK4-linked DCM (Chapter 3). This part of the study addresses the hypothesis that

fibroblasts from canines carrying a mutation in PDK4 display significantly different

phenotypic characteristics and exhibit a reduced capacity to adapt to unfavorable

metabolic conditions when compared to wild type canines. Specifically, fibroblast

abundance after varying intervals of starvation will be measured via traditional cell

counting methods, while cell shape and viability will be further elucidated by using

antibody staining on fixed cell cultures.

72




Fibroblast Isolation and Culture

Fibroblasts were harvested from canines through dermal biopsies according to

IACUC standards as previously described and cultured in standard cell culture medium

with or without serum. Fibroblasts from canines representing PDK4wt/wt, PDK4wt/del and

PDK4del/del genotypes were plated as necessary for each experiment. Cultures were

maintained in DMEM (Corning 10-013CV) + 20% Fetal Bovine Serum (FBS) and 1%

Pen/Strep at 37 °C and 5% CO2.

Viability Assays

Cells were counted using a hemocytometer, averaging over four 16-square

corners, and 50,000 cells were plated per well in a 24-well plate with 8 wells per

genotype. Media was changed after 4 hours, giving the cells ample time to adhere to

the substrate. Half of the cells were maintained in maintenance medium (unstarved),

while the other half was starved in FBS and glucose-free medium. To determine cell

count and viability after 24 hours, cells were detached using Trypsin, gently centrifuged

and suspended in fresh medium. To determine viability, they were mixed 1:1 (v/v) with a

0.4% Trypan Blue solution (Abcam) to distinguish dead cells – which become stained -

from living ones; they were then counted, and relative cell viability was determined by

dividing the live cell count by the total cell count.

Immunofluorescence

Representative fibroblasts form each condition were plated onto coverslips and

fixed for 10 minutes at room temperature in 4% methanol-free Paraformaldehyde (PFA)

73

in PBS. They were stained using PDK4 antibodies, phalloidin to visualize the actin

cytoskeleton and DAPI to visualize nuclei. To permeabilize the cells, the coverslips were

kept 3 – 5 minutes in acetone at – 20 °C, followed by several washes in PBST (PBS

with 0.1% Triton X-100). Cells were then kept for 1 h at room temperature in blocking

buffer - 1% Bovine Serum Albumin (BSA) in PBST – and subsequently stained with a

1:40 phalloidin solution in blocking buffer for 4 h at room temperature. After several

washes with blocking buffer alone, the cells were subjected to PDK4 primary antibody

(1:1000) in blocking buffer 4 h at room temperature, followed by several washes with

blocking buffer; secondary antibody in blocking buffer was applied over night at 4 °C.

The cover slips were washed several times with PBS alone and transferred into

mounting medium with DAPI to stain the nuclei (Fluoroshield Mounting Medium with

DAPI, Abcam ab104139). Fluorescence microscopy was used to visualize and record

the staining.

Used antibodies, manufacturers and concentrations were: CytoPainter

Phalloidin-iFluor 488 Reagent (abcam ab176753; 1:40); rabbit anti-human PDK4

(abcam ab38242; 1:500); and goat anti-rabbit IgG H&L Alexa Fluor-568 (abcam

ab175471; 1:500).

Data Processing

GraphPad Prism was used for a statistical analysis of the data (descriptive and

inferential) and the creation of graphs. Each condition had 4 biological replicates, and

each biological sample was tested in triplicate.

Results

Upon starvation, fibroblasts switch to anaerobic glycolysis, producing lactate and

forgoing oxidative phosphorylation in the mitochondria.106 Under normal physiological

74

conditions, PDK4 phosphorylates and thus downregulates PDH, which reduces the

uptake of pyruvate into the mitochondria. This preserves glucose as energy source and

gears the metabolism towards utilizing Fatty Acid Oxidation.54 If, however, PDK4 activity

is reduced or completely abolished, PDC becomes constitutively active, so that the cell

continues to use glucose oxidation as primary source of energy. We therefore

hypothesized that fibroblasts that are heterozygous or homozygous for a mutation that

blocks PDK4 activity will not be able to switch their metabolism and perish under

prolonged starvation, suggesting that metabolic flexibility is impaired. We harvested

fibroblasts from wild type canines and canines that were heterozygous or homozygous

for a mutation that blocks PDK4 activity (Figure 5-1).14 Wildtype fibroblasts exhibit a

stretched morphology with clearly recognizable cell borders. Neither abundance nor

morphology exhibits any significant changes after 24 h or even 48 h of starving (Figure

5-1), and apoptotic or necrotic cells were rarely seen. In contrast, the cell shape of

fibroblasts that were heterozygous or homozygous for PDK4 was much more rounded,

and the cells exhibited less of a clear boundary, suggesting that these cells were more

spread out.

In addition, their numbers also appeared to be smaller than for their wild type

counterparts (Figure 5-2). After 24 h starvation, PDK4wt/del and PDK4del/del showed an

even more reduced cell number, while the number of dead cells was increased. These

effects were further enhanced after 48 h starvation (Figure 5-2). These observations

suggest that cells that carry a mutation in PDK4 stretch out more strongly on the

substrate; moreover, wild type cells survive starvation without a decrease in cell

75

number, while a significant amount of PDK4 mutant cells dies, either through apoptosis

or necrosis.

Fibroblasts have an elaborate cytoskeletal and dynamic network, which lets them

adhere to each other or the substrate and migrate; it also gives the cells stability

through the formation of actin stress fibers.100-103 To further elucidate whether the

difference in observed cell shape was accompanied by any changes in the cytoskeletal

structure, we stained fibroblasts that were starved for 24 or 48 h with phalloidin to

visualize actin (Figure 5-1). As seen before in the Elisa Assay (Figure 4-1), prolonged

starvation enhances PDK4 expression; yet does not change cell shape, as both after 24

h and 48 h starvation, fibroblasts kept their elongated shape and exhibited elongated

actin fibers. No obvious difference could be spotted between the cell shape after 24 h or

48 h of starvation. In contrast, PDK4wt/del fibroblasts had a much rounder shape. After 24

h starvation, actin was found in much shorter fibers, and assembled in round objects

inside the cells reminiscent of inclusion bodies. These observations were similar at 48 h

starvation. Homozygous PDK4del/del fibroblasts had a similar appearance to

heterozygous cells; in addition, at 48 h starvation, several fibroblasts seemed to have

built some broad, actin-dense contacts to neighboring cells. Overall, homozygous

PDK4del/del cells appeared even more strongly rounded than heterozygous PDK4wt/del

cells.

Discussion

We have previously documented the expression of PDK4 in primary skin

fibroblasts from healthy and PDK4 mutant canines. While PDK4 protein levels in wild

type fibroblasts are progressively increased after 24 h and 48 h starvation, neither

76

heterozygous nor homozygous PDK4 mutant cells exhibit a significant increase of PDK4

expression after starvation. As PDK4 phosphorylates PDH and decreases its activity,

the cell can switch to Fatty Acid Oxidation instead of Glucose oxidation as primary

energy source. Indeed, previous studies have shown that fibroblasts transform glucose

into lactate, suggesting pyruvate – the lactate precursor – never enters the

mitochondrion.105 Such a result indeed points at a downregulation of PDH activity as

molecular mechanism.54

Fibroblasts display diverse morphologies and take on different functions,

depending on their environments. The experiments in this study are aimed at evaluating

the effect of stressors on abundance, cellular structures and phenotypes in the

presence or absence of PDK4 function. The main goal is to determine if primary skin

fibroblasts can be used in experiments designed to evaluate phenotypic as well as

metabolic changes (i.e. fibroblast mitochondrial metabolism). We hypothesized

therefore that fibroblasts from PDK4 mutant canines exhibit significant differences in

cellular structure and morphology as well as a reduced ability to adapt to unfavorable

metabolic conditions compared to wild type canines. Previous studies showed that

serum starved fibroblast exhibit significantly higher proliferation rates when compared to

non-starved fibroblasts.105 As a reaction to starvation, fibroblasts increase cell surface

contacts with the substrate to optimize nutrient intake and spread out more strongly.105

Indeed, Figure 5-1 shows such behavior: starved cells appear more spread out.

Interestingly, such a behavior can be most strongly observed in PDK4 heterozygous

and homozygous cells, suggesting that those are more strongly affected by starvation

than wild type cells. In addition, mutant cells take on a more rounded shape, suggesting

77

an additional level of surface optimization, as the sphere provides the best surface to

volume ratio of all geometric forms. These results are in line with an inability of PDK4

mutant cells to adapt their metabolism to adverse environmental conditions.

In addition, the fibroblast abundance under mutant conditions was significantly

lower after starvation compared with the wild type counterpart (Figure 5-2); together

with the more rounded form of the fibroblasts, this could point at cells becoming

apoptotic, since their nucleus becomes condensed and the cytoskeleton is devoid of

stabilizing actin stress fibers (Figure 5-1). The failed increase of abundance after

refeeding mutant cells supports the hypothesis that PDK4 mutant cells have lost their

metabolic flexibility and become apoptotic instead of entering cell cycle and displaying

signs of regrowth. Based on these results we believe that PDK4 plays an important role

in the normal skin fibroblast metabolism, indicating that primary skin fibroblasts are a

suitable genetic model for changes in metabolism and morphology in animals suffering

from DCM.

78

Figure 5-1. Images of primary fibroblasts that were kept in cell culture medium serum for

24 hours (Starved 24h) or for 48 hours (Starved 48h). (A, C, E, G, I, K) Brightfield images. (B, D, F, H, J, L) Confocal images. The green channel marks actin fibers with phalloidin, the blue channel marks nuclei with DAPI. The cells were taken from PDK4wt/wt (A - D), PDK4wt/del (E - H) and PDK4del/del (I - L) animals.

79

Figure 5-2. Number of primary fibroblasts in cell culture with different genotypes and

different starvation times. Asterisks stand for significant differences with p < 0.05.

80

CHAPTER 6 MITOCHONDRIA OF MUTANT DOBERMAN PINSCHERS HAVE LOWER

METABOLIC POTENTIAL AND FUNCTION

Oxygen is consumed in mitochondria to produce ATP; however, this is a

multistep process that we can analyze by targeting each step using specific drugs and

simultaneously measuring the speed with which oxygen is used, the so-called Oxygen

Consumption Rate (OCR). In a mitochondrial stress test, the Seahorse XF analyzer

directly measures the mitochondrial OCR of cultured cells – in this case primary canine

skin fibroblasts - through optical sensors in real time. Modulators of the mitochondrial

electron transport chain (ETC) are then injected into the culture medium at specific time

points and the changes in OCR are recorded. Since these changes can be correlated to

specific mitochondrial functions, metabolic mutations can be pinpointed towards the

precise mitochondrial step that is affected.

Oligomycin inhibits ATP Synthase (Complex V), which specifically reduces the

part of the mitochondrial respiration that is correlated to ATP production, resulting in a

decrease in OCR. Therefore, Oligomycin induced reduction of the OCR can be used to

assess ATP synthesis based on aerobic metabolism.107 Carbonylcyanide-p-

trifluoromethoxyphenylhydrazone (FCCP) is a hydrophobic molecule that acts as a

weak acid. FCCP can integrate into the mitochondrial membrane and rapidly move

across the matrix, where it releases a proton. It short-circuits the H+ gradient across the

membrane that is used to drive ATP production and thus uncouples oxidation from

phosphorylation. This results in a maximum, uninhibited consumption of oxygen through

complex IV, as electron flow through the Electron Transport Chain (ETC) is

uninhibited.107 FCCP injection into the culture medium increases the OCR to its

maximum. Importantly, the difference between the OCR without any drugs – the basal

81

respiration rate – and the OCR after FCCP addition – the maximum respiration rate –

indicates the spare respiratory capacity. This parameter is the theoretical maximum

capacity a cell can mobilize to respond to increased oxygen demand.107 As last step

during the mitochondrial stress test, the injection of Rotenone and/or Antimycin A

completely abolishes any mitochondrial respiration by blocking Complex I and III,

respectively; therefore, the baseline contribution of non-mitochondrial oxidative

metabolism inside the cells can be established.107 Importantly, not all the oxygen that is

consumed by mitochondria is used for ATP production. Some of it just results in a

proton flux across the membrane uncoupled from ATP synthesis. As the basal OCR is

the sum of non-mitochondrial oxygen consumption, ATP coupled oxygen consumption

and proton-leak based oxygen consumption, the proton-leak OCR contribution can be

calculated from measuring the OCR after Oligomycin and Rotenone/Antimycin A

addition.107

Importantly, very similar principles can be used to test anaerobic, non-

mitochondrial metabolism, specifically glycolysis.107 In the same way the Seahorse

Assay measures OCR in real time, it can also measure parameters that are indicators of

glycolysis.107 Anaerobic breakdown of glucose in the cytosol generates two molecules

of pyruvate for every molecule of glucose. If these products do not enter the TCA cycle

via the PDC, they will be reduced to lactate via Lactate Dehydrogenase (LDH). There is

some discussion as to whether the production of lactate from pyruvate leads to a net

production of protons and increased acidity, as pyruvate and lactate both exist in their

basic form. Regardless, there is an overall increase in proton amount following

glycolysis as one molecule glucose produces two lactate ions with two protons.108,109

82

The central parameter of the Seahorse XF glycolysis stress test is the

Extracellular Acidification Rate (ECAR), which is measured in changes in pH over time.

The more glycolytically active the cell is, the more protons it produces in the cytosol,

ultimately increasing the acidification rate in the extracellular medium through the

extrusion of protons. The glycolysis stress test begins with a baseline ECAR

measurement in cells from which glucose has been withheld. Any changes in acidity in

the medium are due to acidification from processes unrelated to glycolysis.

Subsequently, the injection of a saturating concentration of glucose into the medium

results in an increase in glycolytic activity and an increase in the ECAR. This is

recorded as the glycolysis rate under standard conditions. However, the injected

glucose will also be utilized by the citrate cycle inside the mitochondria and prevents the

cell from utilizing its full glycolytic potential. Thus, the addition of Oligomycin will not only

block ATP synthesis based on glucose oxidation in mitochondria, it will also reveal the

maximum glycolytic capacity. Glycolytic reserve is then determined through subtraction

of the baseline glycolysis rate from the maximum glycolytic capacity. After Oligomycin

has been added, 2-Deoxy-Glucose (2-DG) is added to the system. As 2-DG is a

competitive inhibitor of hexokinase, its addition completely halts glycolysis, and ECAR is

reduced back to baseline levels. Taken together, the Seahorse system enables unique

insight into anaerobic and aerobic metabolism in real time in vivo and was used in this

study to test how the mutation in PDK4 activity affects glycolysis and mitochondrial

function in primary skin fibroblasts from Doberman Pinschers (DPs).

The affected DPs in this study carry a 16 base pair deletion affecting a splice site

at the 5’-end of intron 10, adjacent to the 3’ end of exon 10, shown to significantly

83

reduce the abundance of a PCR amplicon across exon 10 and exon 11, while not

affecting amplification products between exon 8 and exon 9 (Chapter 2). These

observations suggest that the 16 bp deletion removes the active site at the 5’ end of

PDK4 without affecting the overall abundance of pdk4 mRNA. As PDK4 phosphorylates

and downregulates PDH, which in turn regulates the entry of pyruvate into the

mitochondrial TCA cycle, we hypothesize that PDK4 mutant canines lack metabolic

flexibility. In addition, the PDK4 deletion mutation has been shown to be linked to the

development of DCM, and hearts affected by DCM show enhanced fat deposits and

mitochondria with abnormal shape, disturbed electron transport chain function and a

strong reduction in mitochondrial ATP production, suggesting that not only is the

balance between fatty acid oxidation and glucose oxidation disturbed in canines

suffering from DCM, but also, mitochondrial function may be directly impacted as well.

Initial experiments showed that fibroblasts mutant for PDK4 experience a reduction in

their OCR over time; further experiments suggest that the reduction in number of PDK4

mutant cells is due to mitochondria mediated cell death. These initial experiments reveal

that PDK4 is required for mitochondrial function. Thus far, however, experiments are

lacking that analyze the exact nature of PDK4’s influence on mitochondrial

function.14,18,41,110 Therefore, the purpose of this study was to establish which aspect/s

of glycolysis or mitochondrial function was affected by the PDK4 deletion mutation,

using primary skin fibroblasts from healthy controls and affected DPs as model system.

If mitochondrial function is affected, one would expect a reduction in the basic rate of

ATP production and/or a change in the reserve respiratory capacity. In addition, ECAR

may show higher baseline levels after glucose addition, as glucose is preferably utilized

84

via glycolysis. Alternatively, without PDK4 activity, PDH may be ectopically upregulated,

leading to preferred glucose consumption within the mitochondria.

As glycolysis, glucose oxidation, and fatty acid oxidation show intricate cross-

dependencies, precisely defining the aspects of oxidative phosphorylation and

glycolysis that are impacted by PDK4 downregulation will provide greater insights into

the regulatory functions of PDK4.




Stress assays were performed to measure ECAR and mitochondrial OCR using

the Seahorse Xfe 96 analyzer. The assay was performed 24 hours after the fibroblasts

were cultured and seeded onto a 96-well assay plate at a density of 10,000 cells/well.

On the day of the assay, Krebs-Henseleit buffer was prepared with 50 mM carnitine and

200 µm palmitate as the only source of energy. Fibroblasts were incubated in that buffer

for 1h at 37 °C then the assay was performed.

The analyzer sensor cartridge was loaded with oligomycin (1 µM), FCCP (1.5

µM) and rotenone/antinomycin A (1 µM). Assay plate and sensor cartridge were loaded

onto the extracellular flux analyzer to perform the mitochondrial stress test. Each

sample was tested in triplicate.

Results

The mitochondrial and glycolysis stress tests via Seahorse assay were

performed on primary fibroblasts from healthy control animals (PDK4wt/wt), heterozygous

carriers (PDK4wt/del) and homozygous mutants (PDK4del/del). Over the complete timeline

85

of the mitochondrial stress test, the Oxygen Consumption Rate (OCR) was highest in

PDK4wt/wt cells and lowest in cells from PDK4del/del animals; the PDK4wt/del fibroblasts

occupied a middle position. These differences were significant throughout, as shown by

One-Way ANOVA with p < 0.05 (Figure 6-1). Interestingly, the Basal Respiration Rate –

the difference between the measurements during the first three time points and the

measurements during the last three timepoints, after the addition of

Rotenone/Antinomycin is significantly higher in PDK4del/del mutants as compared to

PDK4wt/wt or PDK4wt/del cells (Figure 6-2A). Importantly, this does not seem to be due to

enhanced ATP-linked respiration, as there are no significant differences between

genotypes in the corresponding OCR measurements (Figure 6-3A). Rather, it may be

the result of a significantly lower rate of non-mitochondrial respiration (Figure 6-2B). In

addition, proton leaks are significantly different between all three genotypes (Figure 6-

2C).

Importantly, the spare respiratory capacity is significantly reduced in PDK4wt/del

and PDK4del/del mutants compared to PDK4wt/wt cells (Figure 6-2D), while the maximum

respiration rates between genotypes are not significantly different (Figure 6-3B). This

observation is in line with the notion that the basal respiration rate in PDK4del/del mutants

is significantly enlarged (Figure 6-2A). Functionally, the spare respiratory capacity

depends on the maximal and the basal respiration rate. As the maximal rates are not

changed between genotypes, the significantly higher basal rate in PDK4del/del cells

compared with PDK4wt/wt and PDK4wt/del cells explains the lower spare respiratory

capacity. Thus, as PDH activity is ectopically enhanced in PDK4 mutants, Glucose

becomes consumed and turned into energy in an elevated rate. Once the carbohydrate

86

fuel is exhausted, the cell needs to switch to Fatty Acid oxidation, yet cannot do this, as

PDH is still overactive. In summary, one can observe three major tendencies in the

mitochondrial stress test data sets: 1) The absolute OCR values are reduced in cells

harboring the PDK4 mutation (Figure 6-1); 2) the maximum respiratory rate – the sum

between the basal rate and spare respiratory capacity - is the same across genotypes,

while in PDK4del/del mutants, the basal rate is significantly higher and the spare capacity

significantly lower (Figures 6-2A,D, 6-3B); and 3) non-mitochondrial respiration rates are

also reduced in cells with the PDK4del/del genotype (Figure 6-2B).

In contrast to the OCR, the absolute values for Extracellular Acidification Rate

(ECAR) exhibited a strong variability and were not significantly different overall, as

confirmed by one-way ANOVA (Figure 6-4). However, several specific aspects of these

data were different indeed. For example, there was a small but significant difference in

the non-glycolytic acidification between PDK4wt/wt (higher) and PDK4del/del (lower)

fibroblasts (Figure 6-5A). In contrast, glycolytic acidification was significantly increased

in PDK4del/del mutant cells as compared to healthy controls (Figure 6-5B). As ECAR

measures changes in the pH value (the negative logarithm of the H+ concentration),

these data indicate that PDK4del/del mutants produced a 10 fold higher H+ concentration

from basal glycolysis than PDK4wt/wt cells. Other data indicate a significant, if somewhat

ambiguous increase in glycolytic capacity between wildtype and mutant cells (Figure 6-

5C) and the glycolytic reserve displays a trend of being reduced in cells with the

mutation, although the differences are not significant (Figure 6-6).

Discussion

Measurements of OCR and ECAR from mitochondrial and glycolysis stress tests

reveal several distinct differences between healthy cells and those with the PDK4 splice

87

site mutation. First, the absolute OCR values are significantly different throughout the

stress tests between PDK4wt/wt, PDK4wt/del and PDK4del/del fibroblasts, suggesting a

connection between the presence of the PDK4 splice site mutation and the efficiency of

mitochondrial metabolism in affected cells. This is what one would expect given the role

of PDK4 in regulating the activity of the mitochondrial PDC; without PDK4, Pyruvate

Dehydrogenase (PDH), the main enzyme within the PDC, is ectopically activated, as

demonstrated in ELISA assays before (Figure 4-1). There is a curious reduction in

overall OCR in PDK4 affected cells (Figure 6-1). As all data were normalized to protein

content, any discrepancies in cell number between healthy and PDK4 affected lines

were accounted for. Thus, the reduction in OCR represents a reduction in metabolic

function in PDK4 deficient cells. One reason for this could be the significant reduction of

non-mitochondrial respiration from PDK4wt/wt to PDK4wt/del and PDK4del/del cells (Figure

6-2B), as this parameter forms the baseline for the mitochondrial stress test. One

potential reason for the differences in non-mitochondrial respiration is the presence of

cytosolic oxidases or, alternatively, a partial breakdown of mitochondria in mutant cells,

releasing radical oxidative species into the cytoplasm.107

However, the overall OCR was not the only property that changed upon mutation

of PDK4. There were several characteristic and significant differences in various

aspects of mitochondrial function. First, the basal respiration rate was significantly

higher in PDK4del/del fibroblasts than wildtype or heterozygous fibroblasts.

Importantly, the spare respiratory capacity is significantly reduced in PDK4wt/del

and PDK4del/del mutants compared to PDK4wt/wt cells (Figure 6-2D), while the maximum

respiration rates between genotypes are not significantly different (Figure 6-3B).

88

Functionally, the maximum respiration rate is the sum of basal respiration rate and

spare respiratory capacity. If the basal rate increases, the spare capacity must decrease

as long as the maximum respiration rate stays constant. On the biochemical or

molecular level, a reduction in PDK4 activity will result in ectopic activation of PDH,

which may result in an elevated basic mitochondrial metabolism, as Glucose oxidation

becomes increased. Once the stored Glucose is used up, however, PDH cannot be

downregulated due to the absence of PDK4 activity. As a result, the mitochondrion

cannot switch to Fatty Acid oxidation, resulting in a reduced spare respiratory capacity.

This hypothesis is in line with the observation that dogs that carry the PDK4 mutation

can live without symptoms for several years before they develop DCM, as their

metabolism is probably not always challenged to its full capacity. PDH, despite its

ectopic activation, does not readily deplete the glucose storages. However, once the

dog starts exerting itself more physically, the mitochondria cannot keep up with

enhanced metabolic demands, so the heart starts compensating the lack of energy by

enlarging the ventricle, resulting in DCM.

It may be useful to repeat the study with defined model systems where mutations

can be introduced in a targeted way. For example, a dog cell line such as MDCK could

be treated with CRISPR/Cas9 technology, and a ‘clean’ PDK4 splice site mutation can

be introduced. This would show us the effect of the PDK4 mutation by itself; in an

enhancer/suppressor screen, further mutations can be found that change mitochondrial

function.111,112

Concerning the Extracellular Cytoplasmic Acidification Rate (ECAR), overall

differences in absolute values are much smaller than for the OCR. The basal rate of

89

non-glycolytic acidification, recorded at the beginning of the experiment shows a small

but significant decrease between PDK4wt/wt and PDK4del/del fibroblasts. As carbon

dioxide from oxidative phosphorylation is one source of non-glycolytic acidification, a

reduction in mitochondrial metabolism in mutant cells (Figure 6-1) may explain this

decrease in non-glycolytic acidification. The largest significant change in the glycolysis

stress test between wildtype and mutant cells can be observed in the measurement of

glycolysis-based acidification. PDK4del/del fibroblasts have a two - threefold increase in

this parameter (Figure 6-5B). This may appear counterintuitive, as low PDK4 activity

leads to an upregulation of PDH activity (Figure 4-1). An enhanced PDH-activity turns

more pyruvate into Acetyl-CoA instead of lactate. Therefore, an increase in the rate of

mitochondrial glucose oxidation should reduce glycolysis based acidification. However,

it may simply be that enhancing the rate of glucose oxidation also enhances the rate of

glycolysis based H+ production, as the cells are upregulating glucose consumption in

general. This also suggests that there is some feedback regulation between glucose

oxidation and glycolysis.

90

Figure 6-1. Normalized Oxygen Consumption Rate (OCR) during a mitochondrial stress test in PDK4wt/wt, PDK4wt/del and PDK4del/del primary fibroblasts. The differences between genotypes are significant with p < 0.05 as determined via One-Way ANOVA. Arrows denote the times when Oligomycin (Oligo), FCCP and Antimycin have been added.

91

Figure 6-2. Average basal respiration rates (A), non-mitochondrial respiration rates (B), proton leak (C) and spare respiratory capacity (D) during a mitochondrial stress test in PDK4wt/wt, PDK4wt/del and PDK4del/del primary fibroblasts. The values are normalized to total protein content. Asterisks (*) demark significant differences (p < 0.05).

92

Figure 6-3. Average ATP-linked respiration rates (A) and maximum respiration rates (B) during a mitochondrial stress test in PDK4wt/wt, PDK4wt/del and PDK4del/del primary fibroblasts. The values are normalized to total protein content. None of the values are significantly different (p > 0.05).

93

Figure 6-4. Normalized Extracellular Acidification Rate (ECAR) during a glycolysis stress test in PDK4wt/wt, PDK4wt/del and PDK4del/del primary fibroblasts. Differences across genotypes are not significantly different in a One-Way ANOVA analysis (p > 0.05).

94

Figure 6-5. Average non-glycolytic acidification rates (A), glycolytic acidification rates (B) and glycolytic capacity (C) during a glycolysis stress test in PDK4wt/wt, PDK4wt/del and PDK4del/del primary fibroblasts. The values are normalized to total protein content. Asterisks (*) demark significant differences (p < 0.05).

95

Figure 6-6. Average glycolytic reserve during a glycolysis stress test in PDK4wt/wt,

PDK4wt/del and PDK4del/del primary fibroblasts. The values are normalized to total protein content. None of the values are significantly different (p > 0.05).

96

CHAPTER 7 CONCLUSIONS, LIMITATIONS, AND FUTURE DIRECTIONS

As seen in Chapter 5, fibroblasts display diverse morphologies and function in

response to their environments. The experiments in this work evaluated the effect of

metabolic stress on abundance, cellular structures, and phenotypes in the presence or

absence of PDK4 function. It is possible that PDK4 deficient fibroblasts exhibit

significant differences in cellular structure and morphology as well as a reduced ability

to adapt to unfavorable metabolic conditions as compared to healthy cells. In general, in

response to starvation, fibroblasts increase cell surface contacts with the substrate to

optimize nutrient intake and take on a rounded shape to optimize surface-to-volume

ratios.100 Indeed, the observations show just such a behavior: starved cells appear more

spread out and are therefore less well recognizable in bright field microscopy.

Interestingly, this spreading behavior is more dramatic in PDK4wt/del and PDK4del/del cells,

suggesting that those are more strongly affected by starvation than PDK4wt/wt cells.

These results are in line with an inability of PDK4wt/del and PDK4del/del cells to adapt their

metabolism to adverse environmental conditions.

Mitochondrial and glycolysis stress test analyses provide further support for our

hypothesis that PDK4 affected dogs suffer from a lack of metabolic flexibility. These

experiments revealed three major tendencies: 1) The absolute Oxygen Consumption

Rate (OCR) values are reduced in cells harboring the PDK4 mutation, 2) the maximum

respiratory rate – the sum between the basal rate and spare respiratory capacity - is the

same across genotypes, while in PDK4del/del mutants, the basal rate is significantly

higher and the spare capacity significantly lower; and 3) non-mitochondrial respiration

97

rates are also reduced in cells with the PDK4del/del genotype. Functionally, the spare

respiratory capacity depends on the maximal and the basal respiration rate. As the

maximal rates are not changed between genotypes, the significantly higher basal rate in

PDK4del/del cells compared with PDK4wt/del and healthy control cells explains the lower

spare respiratory capacity. Thus, as PDH activity is ectopically enhanced in PDK4

mutants, glucose is consumed as a fuel source at an elevated rate. Once glucose levels

are exhausted, the cell needs to switch to an alternative fuel source, yet PDK4 deficient

cells cannot do that due to extremely overactive PDH. According to this model, even if

glucose stores are low, PDH activity is not diminished, which completely depletes the

stores – resulting in a loss of energy that the heart has to compensate for by developing

an enlarged ventricle and eventually DCM.

In sum, this study links PDK4 function to the development of DCM via

constitutive activation of PDH and strongly suggests that DCM in these dogs is the

result of impaired cardiac metabolic flexibility. In the absence of PDK4 function, cells

show strongly increased PDH activity and require glucose to survive; this is in line with

an impaired ability to utilize fatty acids under conditions of starvation. Reduced spare

respiratory rates observed in PDK4wt/del or PDK4del/del mitochondria suggest that these

organelles are unable to respond to glucose deprivation and metabolic stress as easily

as healthy PDK4wt/wt mitochondria. This is in line with the observation that DCM affects

DPs later in adulthood. In the short term, the effects of the PDK4 mutation might be

manageable through modified diets rich in carbohydrates. However, as there will always

be periods of sustained activity that place long-term energetic demands on the heart

muscle, DCM might not be manageable in the long run.

98

Future studies should elucidate how the absence of PDK4 activity can affect

heart morphology in vivo. For example, CRISPR/Cas9 could be used to specifically

abolish cardiac PDK4 activity in mice and observe changes in heart morphology over

time.113 In addition, such a model could be used to elucidate whether other PDK

isoforms, for example PDK2, have a mitigating or exacerbating effect on any DCM

phenotype in the absence of PDK4.

In addition, while dog breeders should avoid propagating PDK4 mutations in their

populations, this study may also encourage field tests to identify treatment regimen,

such as a high-fat or ketogenic diet low in carbohydrates, that are simple to implement.

As ectopically active PDH does not block fatty acid oxidation, feeding a diet devoid of

carbohydrates could adjust the metabolism to exclusively derive energy from fats. Thus,

mitochondria could still utilize that source of energy, and cells would be trained to

regulate fatty acid oxidation according to the energy needs of the heart and the

organism. Dogs that are fed carbohydrate-less diets, for example, a ketogenic medium

chain triglyceride diet (MCTD) as a treatment of ADHD-like behavior and idiopathic

epilepsy, can survive well, suggesting that dogs can function normal on a ketogenic

diet.114 However, such a diet may have to be modulated towards the type of activity a

dog is doing; as cardiac muscle normally only stores a small amount of glucose, it is

likely intended as a short-term energy source for sudden bursts of activities. Dogs on a

ketogenic diet may have to be trained to avoid such activities. Other studies have

suggested that deficiencies in taurine, an amino acid that uses a sulfonic acid instead of

a carboxy group, can contribute to the development of DCM in cats.115 The mechanisms

behind this observation are not well understood, though research suggests that food

99

rich in fibers, such as lamb, beet pulp or rice, can lead to the excretion of large amounts

of bilic acid, which bind a significant amount of taurin.116 This, in turn, depletes the

organism of this amino acid and thus exacerbates the development of DCM.

Importantly, a ketogenic diet would also avoid depletion of taurine, as it would not

contain any grains.

The energy requirements of the developing heart are quite different from those of

the adult heart. The latter relies more on fatty acid as a general energy source, while the

former utilizes aerobic glucose metabolism to generate enough energy and basic

biological building blocks to grow.117 This model would fit with the observation that DCM

as a result of PDK4 mutation predominantly occurs in adult dogs, as ectopic PDH

activity favors glucose oxidation and is thus in line with the energy profile of juvenile

hearts. Furthermore, even if increased PDH activity in those hearts leads to the

premature depletion of cardiac glucose stores and an energy deficit, the resulting

cardiac hypertrophy would simply stimulate cardiac growth – which is exactly what

happens during early development anyway. However, during adulthood, the enhanced

cardiac hypertrophy needs to be mitigated.

Clearly, more research into the effects of ketogenic diets on the development of

DCM needs to be done; the splice site mutation introduced here that blocks PDK4

activity without reducing its expression and the fibroblast culture provide powerful

models in this endeavor.

100

LIST OF REFERENCES

1. Meurs KM, Fox PR, Norgard M, et al. A prospective genetic evaluation of familial dilated cardiomyopathy in the Doberman pinscher. J Vet Intern Med 2007;21:1016-1020.

2. Hazlett MJ, Maxie MG, Allen DG, et al. A retrospective study of heart disease in doberman pinscher dogs. Can Vet J 1983;24:205-210.

3. O'Grady MR, Minors SL, O'Sullivan ML, et al. Effect of pimobendan on case fatality rate in Doberman Pinschers with congestive heart failure caused by dilated cardiomyopathy. J Vet Intern Med 2008;22:897-904.

4. Hazebroek M, Dennert R, Heymans S. Idiopathic dilated cardiomyopathy: possible triggers and treatment strategies. Neth Heart J 2012;20:332-335.

5. Monnet E, Orton EC, Salman M, et al. Idiopathic dilated cardiomyopathy in dogs: survival and prognostic indicators. J Vet Intern Med 1995;9:12-17.

6. Summerfield NJ, Boswood A, O'Grady MR, et al. Efficacy of pimobendan in the prevention of congestive heart failure or sudden death in Doberman Pinschers with preclinical dilated cardiomyopathy (the PROTECT Study). J Vet Intern Med 2012;26:1337-1349.

7. Hershberger RE, Morales A, Siegfried JD. Clinical and genetic issues in dilated cardiomyopathy: a review for genetics professionals. Genet Med 2010;12:655-667.

8. Smucker ML, Kaul S, Woodfield JA, et al. Naturally occurring cardiomyopathy in the Doberman pinscher: a possible large animal model of human cardiomyopathy? J Am Coll Cardiol 1990;16:200-206.

9. Meurs KM, Magnon AL, Spier AW, et al. Evaluation of the cardiac actin gene in Doberman Pinschers with dilated cardiomyopathy. Am J Vet Res 2001;62:33-36.

10. Stabej P, Imholz S, Versteeg SA, et al. Characterization of the canine desmin (DES) gene and evaluation as a candidate gene for dilated cardiomyopathy in the Dobermann. Gene 2004;340:241-249.

11. Stabej P, Leegwater PA, Imholz S, et al. The canine sarcoglycan delta gene: BAC clone contig assembly, chromosome assignment and interrogation as a candidate gene for dilated cardiomyopathy in Dobermann dogs. Cytogenet Genome Res 2005;111:140-146.

12. Oyama MA, Chittur S. Genomic expression patterns of cardiac tissues from dogs with dilated cardiomyopathy. Am J Vet Res 2005;66:1140-1155.

101

13. O'Sullivan ML, O'Grady MR, Pyle WG, et al. Evaluation of 10 genes encoding cardiac proteins in Doberman Pinschers with dilated cardiomyopathy. Am J Vet Res 2011;72:932-939.

14. Meurs KM, Lahmers S, Keene BW, et al. A splice site mutation in a gene encoding for PDK4, a mitochondrial protein, is associated with the development of dilated cardiomyopathy in the Doberman pinscher. Hum Genet 2012;131:1319-1325.

15. Mausberg TB, Wess G, Simak J, et al. A locus on chromosome 5 is associated with dilated cardiomyopathy in Doberman Pinschers. PLoS One 2011;6:e20042.

16. Spier AW, Meurs KM, Coovert DD, et al. Use of western immunoblot for evaluation of myocardial dystrophin, alpha-sarcoglycan, and beta-dystroglycan in dogs with idiopathic dilated cardiomyopathy. Am J Vet Res 2001;62:67-71.

17. Tidholm A, Jonsson L. Histologic characterization of canine dilated cardiomyopathy. Vet Pathol 2005;42:1-8.

18. Lopes R, Solter PF, Sisson DD, et al. Characterization of canine mitochondrial protein expression in natural and induced forms of idiopathic dilated cardiomyopathy. Am J Vet Res 2006;67:963-970.

19. Zhao G, Jeoung NH, Burgess SC, et al. Overexpression of pyruvate dehydrogenase kinase 4 in heart perturbs metabolism and exacerbates calcineurin-induced cardiomyopathy. Am J Physiol Heart Circ Physiol 2008;294:H936-943.

20. Doenst T, Nguyen TD, Abel ED. Cardiac metabolism in heart failure: implications beyond ATP production. Circ Res 2013;113:709-724.

21. Nakatani K, Watabe T, Masuda D, et al. Myocardial energy provision is preserved by increased utilization of glucose and ketone bodies in CD36 knockout mice. Metabolism 2015;64:1165-1174.

22. Glatz JF, Luiken JJ, Bonen A. Involvement of membrane-associated proteins in the acute regulation of cellular fatty acid uptake. J Mol Neurosci 2001;16:123-132; discussion 151-127.

23. Lopaschuk GD, Ussher JR, Folmes CD, et al. Myocardial fatty acid metabolism in health and disease. Physiol Rev 2010;90:207-258.

24. Banke NH, Wende AR, Leone TC, et al. Preferential oxidation of triacylglyceride-derived fatty acids in heart is augmented by the nuclear receptor PPARalpha. Circ Res 2010;107:233-241.

25. Burke AC, Huff MW. ATP-citrate lyase: genetics, molecular biology and therapeutic target for dyslipidemia. Curr Opin Lipidol 2017;28:193-200.

102

26. Crewe C, Kinter M, Szweda LI. Rapid inhibition of pyruvate dehydrogenase: an initiating event in high dietary fat-induced loss of metabolic flexibility in the heart. PLoS One 2013;8:e77280.

27. Sugden MC, Lall HS, Harris RA, et al. Selective modification of the pyruvate dehydrogenase kinase isoform profile in skeletal muscle in hyperthyroidism: implications for the regulatory impact of glucose on fatty acid oxidation. J Endocrinol 2000;167:339-345.

28. Randle PJ, Garland PB, Hales CN, et al. The glucose fatty-acid cycle. Its role in insulin sensitivity and the metabolic disturbances of diabetes mellitus. Lancet 1963;1:785-789.

29. Bowker-Kinley MM, Davis WI, Wu P, et al. Evidence for existence of tissue-specific regulation of the mammalian pyruvate dehydrogenase complex. Biochem J 1998;329 ( Pt 1):191-196.

30. Hue L, Taegtmeyer H. The Randle cycle revisited: a new head for an old hat. Am J Physiol Endocrinol Metab 2009;297:E578-591.

31. Wolfe RR. Metabolic interactions between glucose and fatty acids in humans. Am J Clin Nutr 1998;67:519S-526S.

32. Sugden MC. In appreciation of Sir Philip Randle: the glucose-fatty acid cycle. Br J Nutr 2007;97:809-813.

33. Finck BN, Kelly DP. Peroxisome proliferator-activated receptor alpha (PPARalpha) signaling in the gene regulatory control of energy metabolism in the normal and diseased heart. J Mol Cell Cardiol 2002;34:1249-1257.

34. Huss JM, Kelly DP. Nuclear receptor signaling and cardiac energetics. Circ Res 2004;95:568-578.

35. An D, Rodrigues B. Role of changes in cardiac metabolism in development of diabetic cardiomyopathy. Am J Physiol Heart Circ Physiol 2006;291:H1489-1506.

36. Sorokina N, O'Donnell JM, McKinney RD, et al. Recruitment of compensatory pathways to sustain oxidative flux with reduced carnitine palmitoyltransferase I activity characterizes inefficiency in energy metabolism in hypertrophied hearts. Circulation 2007;115:2033-2041.

37. Bolfer L, Estrada AH, Winter B, et al. The Role of the Pyruvate Dehydrogenase Kinase 4 (PDK4) Gene Mutation in the Development of Dilated Cardiomyopathy in Dobermanpinschers and Potential Application of Cardiac Gene Therapy. Molecular Therapy 2016;24:S70-S71.

103

38. Lopes R, Solter PF, Sisson DD, et al. Correlation of mitochondrial protein expression in complexes I to V with natural and induced forms of canine idiopathic dilated cardiomyopathy. Am J Vet Res 2006;67:971-977.

39. Lei B, Lionetti V, Young ME, et al. Paradoxical downregulation of the glucose oxidation pathway despite enhanced flux in severe heart failure. J Mol Cell Cardiol 2004;36:567-576.

40. Chambers KT, Leone TC, Sambandam N, et al. Chronic inhibition of pyruvate dehydrogenase in heart triggers an adaptive metabolic response. J Biol Chem 2011;286:11155-11162.

41. Sosa I, Estrada AH, Winter BD, et al. In vitro evaluation of mitochondrial dysfunction and treatment with adeno-associated virus vector in fibroblasts from Doberman Pinschers with dilated cardiomyopathy and a pyruvate dehydrogenase kinase 4 mutation. Am J Vet Res 2016;77:156-161.

42. Bugger H, Schwarzer M, Chen D, et al. Proteomic remodelling of mitochondrial oxidative pathways in pressure overload-induced heart failure. Cardiovasc Res 2010;85:376-384.

43. Kolobova E, Tuganova A, Boulatnikov I, et al. Regulation of pyruvate dehydrogenase activity through phosphorylation at multiple sites. Biochem J 2001;358:69-77.

44. Korotchkina LG, Patel MS. Site specificity of four pyruvate dehydrogenase kinase isoenzymes toward the three phosphorylation sites of human pyruvate dehydrogenase. J Biol Chem 2001;276:37223-37229.

45. Abbot EL, McCormack JG, Reynet C, et al. Diverging regulation of pyruvate dehydrogenase kinase isoform gene expression in cultured human muscle cells. FEBS J 2005;272:3004-3014.

46. Wu P, Sato J, Zhao Y, et al. Starvation and diabetes increase the amount of pyruvate dehydrogenase kinase isoenzyme 4 in rat heart. Biochem J 1998;329 ( Pt 1):197-201.

47. Wu P, Blair PV, Sato J, et al. Starvation increases the amount of pyruvate dehydrogenase kinase in several mammalian tissues. Arch Biochem Biophys 2000;381:1-7.

48. Chokkalingam K, Jewell K, Norton L, et al. High-fat/low-carbohydrate diet reduces insulin-stimulated carbohydrate oxidation but stimulates nonoxidative glucose disposal in humans: An important role for skeletal muscle pyruvate dehydrogenase kinase 4. J Clin Endocrinol Metab 2007;92:284-292.

104

49. Ma K, Zhang Y, Elam MB, et al. Cloning of the rat pyruvate dehydrogenase kinase 4 gene promoter: activation of pyruvate dehydrogenase kinase 4 by the peroxisome proliferator-activated receptor gamma coactivator. J Biol Chem 2005;280:29525-29532.

50. Lydell CP, Chan A, Wambolt RB, et al. Pyruvate dehydrogenase and the regulation of glucose oxidation in hypertrophied rat hearts. Cardiovasc Res 2002;53:841-851.

51. Razeghi P, Young ME, Ying J, et al. Downregulation of metabolic gene expression in failing human heart before and after mechanical unloading. Cardiology 2002;97:203-209.

52. Piao L, Sidhu VK, Fang YH, et al. FOXO1-mediated upregulation of pyruvate dehydrogenase kinase-4 (PDK4) decreases glucose oxidation and impairs right ventricular function in pulmonary hypertension: therapeutic benefits of dichloroacetate. J Mol Med (Berl) 2013;91:333-346.

53. Roche TE, Hiromasa Y. Pyruvate dehydrogenase kinase regulatory mechanisms and inhibition in treating diabetes, heart ischemia, and cancer. Cell Mol Life Sci 2007;64:830-849.

54. Zhang S, Hulver MW, McMillan RP, et al. The pivotal role of pyruvate dehydrogenase kinases in metabolic flexibility. Nutr Metab (Lond) 2014;11:10.

55. Wynn RM, Kato M, Chuang JL, et al. Pyruvate dehydrogenase kinase-4 structures reveal a metastable open conformation fostering robust core-free basal activity. J Biol Chem 2008;283:25305-25315.

56. Rogozhina Y, Mironovich S, Shestak A, et al. New intronic splicing mutation in the LMNA gene causing progressive cardiac conduction defects and variable myopathy. Gene 2016;595:202-206.

57. Hategan L, Csanyi B, Ordog B, et al. A novel 'splice site' HCN4 Gene mutation, c.1737+1 G>T, causes familial bradycardia, reduced heart rate response, impaired chronotropic competence and increased short-term heart rate variability. Int J Cardiol 2017;241:364-372.

58. LaHaye S, Corsmeier D, Basu M, et al. Utilization of Whole Exome Sequencing to Identify Causative Mutations in Familial Congenital Heart Disease. Circ Cardiovasc Genet 2016;9:320-329.

59. Parvari R, Levitas A. The mutations associated with dilated cardiomyopathy. Biochem Res Int 2012;2012:639250.

60. Simpson S, Edwards J, Ferguson-Mignan TF, et al. Genetics of Human and Canine Dilated Cardiomyopathy. Int J Genomics 2015;2015:204823.

105

61. McNally EM, Golbus JR, Puckelwartz MJ. Genetic mutations and mechanisms in dilated cardiomyopathy. J Clin Invest 2013;123:19-26.

62. Ward AJ, Cooper TA. The pathobiology of splicing. J Pathol 2010;220:152-163.

63. Caminsky N, Mucaki EJ, Rogan PK. Interpretation of mRNA splicing mutations in genetic disease: review of the literature and guidelines for information-theoretical analysis. F1000Res 2014;3:282.

64. Obler D, Wu BL, Lip V, et al. Familial dilated cardiomyopathy secondary to dystrophin splice site mutation. J Card Fail 2010;16:194-199.

65. Zaragoza MV, Fung L, Jensen E, et al. Exome Sequencing Identifies a Novel LMNA Splice-Site Mutation and Multigenic Heterozygosity of Potential Modifiers in a Family with Sick Sinus Syndrome, Dilated Cardiomyopathy, and Sudden Cardiac Death. PLoS One 2016;11:e0155421.

66. Macrae CA, McKenna WJ. Splicing and dilated cardiomyopathy one gene to rule them all? J Am Coll Cardiol 2009;54:942-943.

67. Talerico M, Berget SM. Effect of 5' splice site mutations on splicing of the preceding intron. Mol Cell Biol 1990;10:6299-6305.

68. Brinkhof B, Spee B, Rothuizen J, et al. Development and evaluation of canine reference genes for accurate quantification of gene expression. Anal Biochem 2006;356:36-43.

69. Jarrett KE, Lee CM, Yeh YH, et al. Somatic genome editing with CRISPR/Cas9 generates and corrects a metabolic disease. Sci Rep 2017;7:44624.

70. Eimon PM. Studying apoptosis in the Zebrafish. Methods Enzymol 2014;544:395-431.

71. Sugden MC, Holness MJ. Recent advances in mechanisms regulating glucose oxidation at the level of the pyruvate dehydrogenase complex by PDKs. Am J Physiol Endocrinol Metab 2003;284:E855-862.

72. Jeoung NH, Harris RA. Pyruvate dehydrogenase kinase-4 deficiency lowers blood glucose and improves glucose tolerance in diet-induced obese mice. Am J Physiol Endocrinol Metab 2008;295:E46-54.

73. Preble JM, Pacak CA, Kondo H, et al. Rapid isolation and purification of mitochondria for transplantation by tissue dissociation and differential filtration. J Vis Exp 2014:e51682.

74. Wu P, Inskeep K, Bowker-Kinley MM, et al. Mechanism responsible for inactivation of skeletal muscle pyruvate dehydrogenase complex in starvation and diabetes. Diabetes 1999;48:1593-1599.

106

75. Furuyama T, Kitayama K, Yamashita H, et al. Forkhead transcription factor FOXO1 (FKHR)-dependent induction of PDK4 gene expression in skeletal muscle during energy deprivation. Biochem J 2003;375:365-371.

76. Nahle Z, Hsieh M, Pietka T, et al. CD36-dependent regulation of muscle FoxO1 and PDK4 in the PPAR delta/beta-mediated adaptation to metabolic stress. J Biol Chem 2008;283:14317-14326.

77. Gross DN, van den Heuvel AP, Birnbaum MJ. The role of FoxO in the regulation of metabolism. Oncogene 2008;27:2320-2336.

78. Zhang L, Mori J, Wagg C, et al. Activating cardiac E2F1 induces up-regulation of pyruvate dehydrogenase kinase 4 in mice on a short term of high fat feeding. FEBS Lett 2012;586:996-1003.

79. Steussy CN, Popov KM, Bowker-Kinley MM, et al. Structure of pyruvate dehydrogenase kinase. Novel folding pattern for a serine protein kinase. J Biol Chem 2001;276:37443-37450.

80. Machius M, Chuang JL, Wynn RM, et al. Structure of rat BCKD kinase: nucleotide-induced domain communication in a mitochondrial protein kinase. Proc Natl Acad Sci U S A 2001;98:11218-11223.

81. Kato M, Chuang JL, Tso SC, et al. Crystal structure of pyruvate dehydrogenase kinase 3 bound to lipoyl domain 2 of human pyruvate dehydrogenase complex. EMBO J 2005;24:1763-1774.

82. Smith PK, Krohn RI, Hermanson GT, et al. Measurement of protein using bicinchoninic acid. Anal Biochem 1985;150:76-85.

83. Frier BC, Williams DB, Wright DC. The effects of apelin treatment on skeletal muscle mitochondrial content. Am J Physiol Regul Integr Comp Physiol 2009;297:R1761-1768.

84. Gallo-Oller G, Ordonez R, Dotor J. A new background subtraction method for Western blot densitometry band quantification through image analysis software. J Immunol Methods 2018;457:1-5.

85. Huang HM, Fowler C, Xu H, et al. Mitochondrial function in fibroblasts with aging in culture and/or Alzheimer's disease. Neurobiol Aging 2005;26:839-848.

86. Sugden MC, Kraus A, Harris RA, et al. Fibre-type specific modification of the activity and regulation of skeletal muscle pyruvate dehydrogenase kinase (PDK) by prolonged starvation and refeeding is associated with targeted regulation of PDK isoenzyme 4 expression. Biochem J 2000;346 Pt 3:651-657.

107

87. Holness MJ, Smith ND, Bulmer K, et al. Evaluation of the role of peroxisome-proliferator-activated receptor alpha in the regulation of cardiac pyruvate dehydrogenase kinase 4 protein expression in response to starvation, high-fat feeding and hyperthyroidism. Biochem J 2002;364:687-694.

88. Sheu KF, Hu CW, Utter MF. Pyruvate dehydrogenase complex activity in normal and deficient fibroblasts. J Clin Invest 1981;67:1463-1471.

89. Huang B, Wu P, Popov KM, et al. Starvation and diabetes reduce the amount of pyruvate dehydrogenase phosphatase in rat heart and kidney. Diabetes 2003;52:1371-1376.

90. Sugden MC, Holness MJ. Mechanisms underlying regulation of the expression and activities of the mammalian pyruvate dehydrogenase kinases. Arch Physiol Biochem 2006;112:139-149.

91. McCutcheon LJ, Cory CR, Nowack L, et al. Respiratory chain defect of myocardial mitochondria in idiopathic dilated cardiomyopathy of Doberman pinscher dogs. Can J Physiol Pharmacol 1992;70:1529-1533.

92. Han Z, Zhong L, Srivastava A, et al. Pyruvate dehydrogenase complex deficiency caused by ubiquitination and proteasome-mediated degradation of the E1 subunit. J Biol Chem 2008;283:237-243.

93. Hirner S, Krohne C, Schuster A, et al. MuRF1-dependent regulation of systemic carbohydrate metabolism as revealed from transgenic mouse studies. J Mol Biol 2008;379:666-677.

94. Holness MJ, Sugden MC. Regulation of pyruvate dehydrogenase complex activity by reversible phosphorylation. Biochem Soc Trans 2003;31:1143-1151.

95. Reed LJ. A trail of research from lipoic acid to alpha-keto acid dehydrogenase complexes. J Biol Chem 2001;276:38329-38336.

96. Auburger G, Klinkenberg M, Drost J, et al. Primary skin fibroblasts as a model of Parkinson's disease. Mol Neurobiol 2012;46:20-27.

97. Willer T, Lee H, Lommel M, et al. ISPD loss-of-function mutations disrupt dystroglycan O-mannosylation and cause Walker-Warburg syndrome. Nat Genet 2012;44:575-580.

98. D'Amario D, Amodeo A, Adorisio R, et al. A current approach to heart failure in Duchenne muscular dystrophy. Heart 2017;103:1770-1779.

99. Bayreuther K, Francz PI, Gogol J, et al. Differentiation of primary and secondary fibroblasts in cell culture systems. Mutat Res 1991;256:233-242.

100. Abercrombie M. Fibroblasts. J Clin Pathol Suppl (R Coll Pathol) 1978;12:1-6.

108

101. Tojkander S, Gateva G, Lappalainen P. Actin stress fibers--assembly, dynamics and biological roles. J Cell Sci 2012;125:1855-1864.

102. Manso AM, Kang SM, Ross RS. Integrins, focal adhesions, and cardiac fibroblasts. J Investig Med 2009;57:856-860.

103. Ben-Ze'ev A. The role of changes in cell shape and contacts in the regulation of cytoskeleton expression during differentiation. J Cell Sci Suppl 1987;8:293-312.

104. Mak SK, Tewari D, Tetrud JW, et al. Mitochondrial dysfunction in skin fibroblasts from a Parkinson's disease patient with an alpha-synuclein triplication. J Parkinsons Dis 2011;1:175-183.

105. Golpour M, Fattahi S, Niaki HA, et al. Starved human fibroblasts secrete acidic proteins inducing post re-feeding proliferation and in vitro cell migration: a potential tool for wound healing. Biol Cell 2014;106:139-150.

106. Golpour M, Akhavan Niaki H, Khorasani HR, et al. Human fibroblast switches to anaerobic metabolic pathway in response to serum starvation: a mimic of warburg effect. Int J Mol Cell Med 2014;3:74-80.

107. Divakaruni AS, Paradyse A, Ferrick DA, et al. Analysis and interpretation of microplate-based oxygen consumption and pH data. Methods Enzymol 2014;547:309-354.

108. Robergs RA, Ghiasvand F, Parker D. Biochemistry of exercise-induced metabolic acidosis. Am J Physiol Regul Integr Comp Physiol 2004;287:R502-516.

109. Lindinger MI, Kowalchuk JM, Heigenhauser GJ. Applying physicochemical principles to skeletal muscle acid-base status. Am J Physiol Regul Integr Comp Physiol 2005;289:R891-894; author reply R904-910.

110. Taggart K, Estrada A, Thompson P, et al. PDK4 Deficiency Induces Intrinsic Apoptosis in Response to Starvation in Fibroblasts from Doberman Pinschers with Dilated Cardiomyopathy. Biores Open Access 2017;6:182-191.

111. Karlgren M, Simoff I, Backlund M, et al. A CRISPR-Cas9 Generated MDCK Cell Line Expressing Human MDR1 Without Endogenous Canine MDR1 (cABCB1): An Improved Tool for Drug Efflux Studies. J Pharm Sci 2017;106:2909-2913.

112. Terai H, Kitajima S, Potter DS, et al. ER Stress Signaling Promotes the Survival of Cancer "Persister Cells" Tolerant to EGFR Tyrosine Kinase Inhibitors. Cancer Res 2018;78:1044-1057.

113. Roman TS, Mohlke KL. Functional genomics and assays of regulatory activity detect mechanisms at loci for lipid traits and coronary artery disease. Curr Opin Genet Dev 2018;50:52-59.

109

114. Packer RM, Law TH, Davies E, et al. Effects of a ketogenic diet on ADHD-like behavior in dogs with idiopathic epilepsy. Epilepsy Behav 2016;55:62-68.

115. Torres CL, Backus RC, Fascetti AJ, et al. Taurine status in normal dogs fed a commercial diet associated with taurine deficiency and dilated cardiomyopathy. J Anim Physiol Anim Nutr (Berl) 2003;87:359-372.

116. Ko KS, Fascetti AJ. Dietary beet pulp decreases taurine status in dogs fed low protein diet. J Anim Sci Technol 2016;58:29.

117. Ritterhoff J, Tian R. Metabolism in cardiomyopathy: every substrate matters. Cardiovasc Res 2017;113:411-421.

110

BIOGRAPHICAL SKETCH

Dr. Luiz Bolfer was born in Curitiba, Paraná, Brazil in 1981, and naturalized at

the United States of America in 2012. He completed a professional degree in

Emergency Medicine and Surgery Technology in 2002. He went on to complete his

Doctor of Veterinary Medicine, with Honors, at Universidade Tuiuti do Paraná, College

of Veterinary Medicine in 2006. Dr. Bolfer then went to the Animal Medical Center, NY,

New York for a Senior Veterinary practice program and DVM diploma accreditation from

the Education for Foreign Veterinary Graduates, American Veterinary Medicine

Association (AVMA) in 2007. Dr. Bolfer then joined the University of Illinois, College of

Veterinary Medicine for an Internship in Small Animal Medicine and Surgery in 2011.

Following completion of his internship, he joined the University of Florida, College of

Veterinary Medicine for a Residency in Small Animal Emergency and Critical Care in

2014. Dr. Bolfer became a Diplomate of the Brazilian College of Veterinary Emergency

and Critical Care and Credentialed by the American College of Veterinary Emergency

and Critical Care. Dr. Bolfer stayed at the University of Florida to begin pursuit of his

Doctor of Philosophy with the University of Florida’s College of Veterinary Medicine,

veterinary medical sciences.

Documents

THE ROLE OF PYRUVATE DEHYDROGENASE KINASE 4 (PDK4) … · in the heart. Pyruvate Dehydrogenase (PDH) regulates the entry of pyruvate into the mitochondrial tricarboxylic acid (TCA)