THE ROLE OF PLANT MEMBRANE PROTEINS

IN LEGUME-RHIZOBIA SYMBIOSIS

A DISSERTATION

SUBMITTED TO THE DEPARTMENT OF BIOLOGY

AND THE COMMITTEE ON GRADUATE STUDIES

OF STANFORD UNIVERSITY

IN PARTIAL FULFILLMENT OF THE REQUIREMENTS

FOR THE DEGREE OF

DOCTOR OF PHILOSOPHY

Cara Helene Haney

December 2010

http://creativecommons.org/licenses/by-nc/3.0/us/

This dissertation is online at: http://purl.stanford.edu/yn410td6337

© 2011 by Cara Helene Haney. All Rights Reserved.

Re-distributed by Stanford University under license with the author.

This work is licensed under a Creative Commons Attribution-Noncommercial 3.0 United States License.

ii

I certify that I have read this dissertation and that, in my opinion, it is fully adequatein scope and quality as a dissertation for the degree of Doctor of Philosophy.

Sharon Long, Primary Adviser

I certify that I have read this dissertation and that, in my opinion, it is fully adequatein scope and quality as a dissertation for the degree of Doctor of Philosophy.

Dominique Bergmann

I certify that I have read this dissertation and that, in my opinion, it is fully adequatein scope and quality as a dissertation for the degree of Doctor of Philosophy.

David Ehrhardt

I certify that I have read this dissertation and that, in my opinion, it is fully adequatein scope and quality as a dissertation for the degree of Doctor of Philosophy.

Suzanne Pfeffer

Approved for the Stanford University Committee on Graduate Studies.

Patricia J. Gumport, Vice Provost Graduate Education

This signature page was generated electronically upon submission of this dissertation in electronic format. An original signed hard copy of the signature page is on file inUniversity Archives.

iii

iv

ABSTRACT

Symbiotic nitrogen fixation occurs when rhizobia bacteria infect the roots of legume

plants, resulting in the formation of a specialized organ called a nodule. In this

mutualistic symbiosis, bacteria provide the plant with nitrogen, and the plant provides

the bacteria with carbon sources. This metabolic exchange occurs inside the root

nodules where bacteria reduce (or “fix”) molecular dinitrogen to ammonia, a form of

nitrogen that plants can use to synthesize amino acids and proteins.

Legume-rhizobia symbiosis initiates with plant recognition of the bacterial

signaling molecule Nod Factor (NF). After plant perception of NF, bacteria infect

plant roots through host-derived infection threads and are eventually endocytosed into

host cells. Inside the host cell, the bacteria remain surrounded by a host membrane

and differentiate into their nitrogen-fixing form. A great deal is known about NF

perception and signaling, but the mechanisms by which infection threads form and by

which bacteria are endocytosed into host cells remain elusive.

To identify genes required for infection or bacterial endocytosis, I used a

candidate gene approach in the model legume Medicago truncatula. I searched the

M. truncatula genome for regions with homology to endocytosis and membrane

shaping genes in plants and other organisms. I identified two M. truncatula flotillin-

like genes, FLOT2 and FLOT4, which are up-regulated in response to the M.

truncatula symbiont, Sinorhizobium meliloti. Flotillins in animals have been

implicated in actin polymerization, maintenance of cell-cell contacts, membrane

trafficking and pathogenesis. I silenced FLOT2 and FLOT4 using RNAi and

amiRNAs and found a non-redundant requirement for both genes in symbiosis. When

FLOT4 was silenced, infection threads typically aborted in root hairs. FLOT2-silenced

plants formed fewer nodules and infection threads. This work implicates plant

flotillins in legume-rhizobia symbiosis and suggests that flotillins in plants and

animals may have a common function.

NF recognition in M. truncatula requires the receptors NFP and LYK3. Each

receptor is required for separate downstream responses: NFP is necessary for all

v

known responses to bacteria, while LYK3 is required for infection. A leucine-rich

repeat receptor-like kinase DMI2 acts downstream of NFP. Using GFP-tagged

proteins, I localized the symbiotic receptor kinases DMI2 and LYK3. Both proteins

had punctate distributions associated with root hair plasma membranes. After

bacterial inoculation, both LYK3:GFP and DMI2:GFP were present on intracellular

vesicles. LYK3:GFP persisted in infected cells and localized to infection thread

membranes. The DMI2:GFP signal was nearly absent by one day post inoculation.

These data are consistent with a role for LYK3 in infection and a role for DMI2 in

signaling.

I found that like LYK3 and DMI2, GFP-tagged FLOT4 is associated with the

plasma membrane and has a patchy distribution. Upon inoculation with S. meliloti,

FLOT4:GFP puncta become more diffuse and redistribute to form a cap at the tips of

elongating root hairs. I investigated the dependence of FLOT4 distribution on NF

perception and signaling via symbiotic receptors NFP, LYK3, and DMI2. I found that

FLOT4:GFP has a decrease in puncta density specific to the putative dead kinase

allele of LYK3, hcl-1. I co-expressed LYK3:GFP and FLOT4:mCherry and found that

in buffer-treated root hairs, there is little co-distribution of the two proteins, and

tagged LYK3 puncta are dynamic while FLOT4 is relatively stable. After inoculation,

I found an increase in LYK3:GFP and FLOT4:mCherry co-localization and that

LYK3:GFP shares the stable distribution shown by FLOT4:mCherry. The similarities

in mutant phenotypes, protein localization, and protein dynamics suggest that FLOT4

and LYK3 may be components of a shared complex.

This work indicates that protein arrangement within plant membranes is

complex and is altered by perception of a symbiotic bacterium. This work suggests

that redistribution of plant membrane proteins upon signal perception may serve to

compartmentalize cellular processes.

vi

PREFACE

Publication of chapters and role of author

Chapter 2 is reprinted from Proceedings of the National Academy of Sciences,

Volume 107, C. H. Haney

The transgenic Medicago truncatula lines used in Chapters 3 and 4 were generated

by Brendan Riely using a protocol developed by David Tricoli in Doug Cook’s Lab at

University of California, Davis. I performed all experiments and generated all remaining

materials.

and S. R. Long, “Plant flotillins are required for infection

by nitrogen-fixing bacteria”, pp 478-483. © Haney and Long, 2010. Reprinted with

permission from S. R. Long.

vii

Acknowledgements

I am grateful to the many people who have supported, encouraged, and tolerated me

during my Ph.D. years.

I would first like to thank Sharon for giving me the opportunity to work in her

lab. Sharon allowed me the freedom to pursue my own interests and to make my own

mistakes, which in the end allowed me to discover how much I love science. She is an

endless source of insight and wisdom about scientific methods and scientific integrity.

Sharon is an extraordinary mentor, filled with a rare combination of alarming

brilliance and quiet grace. It has been a privilege to learn from her.

I doubt on any planet, in any galaxy, in all the universe, that there is a place

quite like the Long Lab. The lab is filled with exceptional people who are both smart

and kind. The unique aura of the Long lab is largely a consequence of Bob Fisher,

who is much nicer than he lets on. I’ve been lucky enough to share a bay with Bob for

the past few years, and consequently have learned about everything from cloning to

Schadenfreude. I’m glad to have found a partner in crime, the lab’s “junior” graduate

student, Alisa Lehman, who always listened when daily ice cream was not sufficient to

alleviate the grad-school blues. Cindy Smith is the coolest roller skating, mystery

novel writing, plant biologist I’ve ever met. She has also been the best conference

travel buddy a girl could ask for and has been an unending source of support, plant

expertise, and perspective. I’m thankful to Melanie Barnett for sharing her

encyclopedic knowledge of microbes, and to Carol Toman for her kindness, generosity

and eternal willingness to streak out a strain. I’m grateful to Michelle Diodati for

being sweet and genuine and for teaching me about the many wonders of bacteria.

I’m grateful to Dong Wang for taking my side in most battles of Good vs. Bob. And

I’m thankful for the two newest postdocs in the lab, Claus Lang and Hiro Ichida, for

sharing late night ice cream. Alex Bloom and Janet Ladner have helped navigate the

day to day labyrinth of university administration.

I am also in debt to three former Long Lab postdocs. Joel Griffitts’s infectious

excitement was truly inspiring during my early days in the lab. Adriana Rightmyer

gave me endless help and sympathy when experiments were troublesome and was an

viii

example in patience and thoroughness. Esther Chen shared a bay with me during my

early years in the lab and it is hard to imagine how I would have navigated those years

without her. I am grateful to Esther for believing in me and helping me see myself as

a scientist. Esther is a phenomenal scientist, an exceptional teacher, and as time has

revealed, one of my dearest friends.

I have also been lucky enough to work with two extremely talented

undergraduate students, Quynh Anh Nguyen and Elizabeth Xiao. Quynh Anh began

helping me when I was still getting my own feet wet, and contributed several valuable

tools to the lab. Elizabeth’s patience and steady hands allowed me to take on a

profoundly labor intensive project. A great deal of that labor was done by Elizabeth,

who never once complained.

I owe a great deal to David Ehrhardt who, for the latter part of my thesis, has

been like a second adviser. He has gone beyond the call of duty of any committee

member and spent many patient hours teaching me about microscopy and helping with

data analysis and interpretation. My thesis and scientific interests would look very

different if it weren’t for David’s influence. I am also in dept to Ryan Gutierrez for

his willingness to act as a surrogate David when microscopes were troublesome. I am

grateful to have found a fellow flotillin-enthusiast in Guido Grossman who, if

possible, loves flotillins more than I do. I am also in debt to Wolf Frommer and the

rest of the Carnegie Institute for allowing me to use their microscopes, and for being a

second home at Stanford.

I’d also like to thank the Long Lab’s neighbors, the Mudgett and Bergmann

labs, for shared advice and reagents. I am particularly grateful to Dominique for

advice about science and life in general. Dominique sees things with clarity that is

frequently disarming, but I am a better scientist thanks to her perspectives. I am also

grateful to my classmate Cora MacAlister who would have been my friend even if our

first names were not nearly identical, as she was kind enough to show me her

sporulating Physcomitrella and share meditations on the adorableness of cats.

Thanks to the student services office including Matt Pinheiro, Valerie Kiszka

and Jennifer Mason. They have made the logistics of a PhD as smooth and pain-free

ix

as possible. And thanks to the Stanford Biology Department for giving me a shot at a

PhD at Stanford.

I definitely wouldn’t be where I am today if it weren’t for my undergraduate

advisor Bill Fry who introduced me to plant pathology, encouraged me to work in his

lab, and gave me the crazy idea to apply to Stanford for grad school. I am also grateful

to Ralph Obendorf who taught me about carbohydrate biosynthesis, and that every

situation is what you make of it.

I have wonderful and supportive friends and family who deserve many thanks.

My best friend David Johnson has continued to be a friend and support, and has kept

me connected to the world outside of the lab. My younger brother Kenny was always

kind enough to ask how my “glowing plants” were doing. I’m grateful for long

conversations about our mutual love of plants, music, and Kenny’s continued

suggestions of how to merge those two passions. (I’m still working on that

photosynthetic fiddle-playing accompanist for you, Kenny.) I am grateful to my Aunt

Jessie and my Grandmother Lois, both of whom I lost during my years at Stanford, but

whose lives remembered were full and vibrant and serve as a reminder to cherish

family, friends and life. Jessie’s photography continues to be a reminder of how weird

and beautiful life is. My parents have both been examples of how to make a career out

of something that you are passionate about and taught me that the price of ambition

should never be happiness or integrity. I’m grateful to have a family that will always

be proud of me as long as I’m doing my best. And I’m glad to have inherited from my

maternal lineage, an X-linked obsessive compulsive plant gene.

Finally, I would like to thank Dirk, for support, fun and for being enough of a

nerd to think what I do is cool. Dirk has brought joy and balance to my life and has

been a partner through life’s ups and downs. I’m so grateful to have shared these

years with Dirk, and I look forward to our adventures to come.

x

TABLE OF CONTENTS

ABSTRACT .......................................................................................................................... iv

PREFACE ............................................................................................................................. vi

Publication of chapters and role of author ......................................................................... vi

Acknowledgements .......................................................................................................... vii

TABLE OF CONTENTS ....................................................................................................... x

LIST OF TABLES ............................................................................................................... xii

LIST OF FIGURES ............................................................................................................. xiii

CHAPTER 1: Introduction and contributions ............................................................... 1 Bacterial NF production and plant NF recognition ............................................................ 2

Plant requirements for infection ......................................................................................... 5

Bacterial invasion factors ................................................................................................... 6

A reverse genetics approach to identify genes required for infection ................................ 7

Flotillins and membrane rafts in animals ........................................................................... 7

Flotillins are conserved in plants ...................................................................................... 10

Contributions .................................................................................................................... 11

CHAPTER 2: Plant flotillins are required for infection by nitrogen-fixing bacteria ............................................................................................................................. 13

ABSTRACT ......................................................................................................................... 13

INTRODUCTION ................................................................................................................ 14

RESULTS............................................................................................................................. 17

Identification of flotillin-like genes in M. truncatula ....................................................... 17

FLOT2 and FLOT4 show NF-dependent upregulation during nodulation ....................... 19

FLOT2 and FLOT4 localize to membrane microdomains and FLOT4 becomes polarly localized in response to bacterial signals.......................................................................... 23

FLOTs are required for nodulation ................................................................................... 24

FLOT2- and FLOT4-silenced plants are defective in both nodule form and function ..... 29

FLOT silencing results in infection thread initiation and elongation defects ................... 30

FLOT4 localizes to infection thread membranes ............................................................. 30

DISCUSSION ...................................................................................................................... 32

A requirement for FLOT2 and FLOT4 for early nodulation events ................................. 32

xi

Flotillin-like genes are ubiquitous in plants ..................................................................... 33

MATERIALS AND METHODS ......................................................................................... 34

CHAPTER 3: Localization of the symbiotic receptor kinases LYK3 and DMI2 ..... 43 ABSTRACT ......................................................................................................................... 43

INTRODUCTION ................................................................................................................ 44

RESULTS............................................................................................................................. 45

Localization of symbiotic receptor kinases LYK3 and DMI2 ......................................... 45

LYK3:GFP localizes to intracellular vesicles and infection threads post inoculation ..... 52

DMI2:GFP localizes to intracellular vesicles post-inoculation ........................................ 55

DISCUSSION ...................................................................................................................... 58

MATERIALS AND METHODS ......................................................................................... 61

CHAPTER 4: Co-localization of flotillin protein FLOT4 with the symbiotic receptor LYK3 ................................................................................................................. 63

ABSTRACT ......................................................................................................................... 63

INTRODUCTION ................................................................................................................ 64

RESULTS............................................................................................................................. 66

A change in FLOT4 distribution is associated with rhizobia-triggered re-initiation of root hair growth ....................................................................................................................... 66

Over-expression of FLOT2 results in increased FLOT4 polarity .................................... 67

FLOT4 mis-localizes in a LYK3 mutant .......................................................................... 69

FLOT4 and LYK3 have increased co-localization after bacterial inoculation ................. 71

DISCUSSION ...................................................................................................................... 77

FLOT2 affects FLOT4:GFP distribution ......................................................................... 77

Plant membrane protein compartmentalization ................................................................ 77

MATERIALS AND METHODS ......................................................................................... 79

CHAPTER 5: Conclusions and Future Directions ....................................................... 81 Plant membrane protein compartmentalization ................................................................ 81

Plasma membrane protein compartmentalization during symbiosis ................................ 82

Possible functions for plant membrane protein compartmentalization during host-microbe interactions ....................................................................................................................... 85

REFERENCES ................................................................................................................... 87

xii

LIST OF TABLES

CHAPTER 2 Table 2-1.Summary of the FLOT gene family. ............................................................ 17Table 2-2. PCR and qPCR primers to monitor FLOT expression ............................... 39Table 2-3. RNAi Construct Primers ............................................................................ 40Table 2-4. amiRNA Construct Primers ....................................................................... 41Table 2-5. Vector Construction ................................................................................... 42 CHAPTER 3 Table 3-1. Transgenes complement LYK3 and DMI2 mutants .................................... 47

xiii

LIST OF FIGURES CHAPTER 2

Figure 2-1. Alignment of predicted FLOT amino acid sequences and arrangement of FLOT1-5 within a single BAC ..................................................................................... 19Figure 2-2. Expression of FLOTs during nodulation and in plant tissues ................... 20Figure 2-3. Up-regulation of FLOT2 and FLOT4 is dependent on NF and NF perception ..................................................................................................................... 21Figure 2-4. FLOT2 and FLOT4 are expressed in the root elongation zone and in the infection zone of nodules .............................................................................................. 22Figure 2-5. FLOT2 and FLOT4 localize to membrane-associated puncta .................. 23Figure 2-6. FLOTs localize to membrane-associated puncta and become polarly localized after inoculation ............................................................................................ 24Figure 2-7. Silencing FLOTs results in a decrease in nodule number, a decrease in infection events and nodules that do form are non-functional ..................................... 26Figure 2-8. Root and nodule phenotypes of FLOT-silenced roots .............................. 28Figure 2-9. FLOT4 localizes to infection thread membranes ...................................... 31 CHAPTER 3

Figure 3-1. LYK3 and DMI2 fusion proteins rescue mutant phenotypes ................... 46Figure 3-2. LYK3 has a punctate distribution in root hairs ......................................... 48Figure 3-3. LYK3:GFP has little overlap with a cytoplasmic marker in root hairs ..... 49Figure 3-4. LYK3:GFP signal stays with the membrane upon plasmolysis ............... 50Figure 3-5. DMI2 has a punctate distribution associated with root hair plasma membranes .................................................................................................................... 51Figure 3-6. LYK3 localizes to intracellular vesicles and infection threads post inoculation .................................................................................................................... 54Figure 3-7. LYK3:GFP is not visible on infection threads in interior nodule cells .... 55Figure 3-8. After bacterial treatment, DMI2:GFP localizes to intracellular vesicles .. 57Figure 3-9. DMI2:GFP is not visible on infection threads in interior nodule cells ..... 57

xiv

CHAPTER 4

Figure 4-1. Redistribution of FLOT4 during re-initiation of root hair tip growth ...... 66Figure 4-2. Co-expression of FLOT2:GFP and FLOT4:mCherry .............................. 69Figure 4-3. FLOT4 mis-localizes in roots carrying mutations in a symbiotic receptor

...................................................................................................................................... 71Figure 4-4. LYK3:GFP complements the decrease in FLOT4 puncta density in the hcl-1 mutant .................................................................................................................. 72Figure 4-5. LYK3 and FLOT4 co-localize in inoculated root hairs in 3-D space ....... 74Figure 4-6. After inoculation, LYK3 puncta shift from dynamic to stable ................. 75Figure 4-7. FLOT4:mCherry does not label LYK3:GFP intracellular vesicles .......... 76

1

CHAPTER 1: Introduction and contributions

Overview of legume-rhizobia symbiosis

Plants in the family Fabaceae (legumes) form symbiotic relationships with Gram

negative α-proteobacteria including the genera Sinorhizobium, Rhizobium,

Mesorhizobium, and Bradyrhizobium. These bacteria live in association with plant

roots inside morphologically unique structures called nodules. The interaction between

plant and bacterium is viewed as mutualistic: the bacteria reduce (or “fix”) molecular

dinitrogen to ammonia, a form of nitrogen that plants can utilize; in exchange, the

plants supply the bacteria with carbon sources. Through this intimate metabolic

partnership, both plant and bacteria benefit.

Of all biologically-available fixed nitrogen in soil, about half is formed via

biological fixation (Zahran, 1999); nearly half of biological nitrogen fixation is

symbiotic (Werner and Newton, 2005). Naturally occurring forms of nitrogen are

insufficient to sustain agriculture at current levels of production and as a consequence,

use of synthetic ammonium fertilizer is necessary. Industrial fertilizer production is

costly and requires large inputs of fossil fuel. In 2008, nitrogen fertilizer production

was the eighth largest source of atmospheric carbon dioxide (E.P.A., 2010). Post-

production field application of synthetic fertilizers results in pollution in the form of

additional greenhouse emissions and fertilizer runoff. By understanding symbiotic

nitrogen fixation, biological nitrogen fixation may be improved and reduce the need

for synthetic nitrogen fertilizer.

In addition to its importance to agronomic sustainability, symbiotic nitrogen-

fixation provides a genetically tractable framework to study host-microbe interactions.

Several rhizobia-legume pairs have both genetic and molecular tools available

including microarrays, mutant libraries, and genome sequences. Model rhizobia-

legume pairs include (1) Medicago truncatula, a diploid relative of alfalfa, and its

bacterial symbiont Sinorhizobium meliloti and (2) Lotus japonicus and its symbiont

Mesorhizobium loti. Experiments in these model systems have elucidated some of the

2

genetic and molecular mechanisms by which bacteria communicate with and infect

eukaryotes.

Studies of legume-rhizobia symbioses have described developmental events

during the establishment of symbiosis. Symbiosis initiates with a signal exchange

between legumes and bacteria. Plant roots secrete flavonoids, which cause induction

of bacterial genes required for synthesis of a lipochitooligosaccharide called Nod

Factor (NF) (Peters et al., 1986). NFs act as species-specific signals to promote plant

nodule development (Debellé et al., 2001; Oldroyd et al., 2001b). In response to

bacteria or purified NF, specialized plant root epidermal cells, called root hairs, grow

to form a curl around a colony of bacteria (or spot of applied NF). Bacteria then enter

the plant root through plant-derived intracellular structures called infection threads.

Bacteria divide and penetrate nodules inside infection threads until eventually they are

released into host cells via an endocytosis-like event. Inside the plant host cell,

bacteria remain surrounded by a host-derived membrane and replicate only a few

times. Following a series of differentiation events, the bacteria (now called

“bacteroids”) synthesize nitrogenase enzyme allowing them to fix nitrogen.

Bacterial NF production and plant NF recognition

Purified NF is sufficient to induce plant morphological and transcriptional changes.

Within minutes of NF application, the root hair plasma membrane depolarizes

(Ehrhardt et al., 1992). Within the first hour after NF treatment, there are detectible

oscillations in nuclear calcium levels (called “calcium spiking”) in root hairs and

epidermal cells (Ehrhardt et al., 1996). A number of phenotypic changes occur in root

hairs following calcium spiking. First, actively elongating root hairs stop growing and

swell. The root hairs then reinitiate tip growth and grow to form a curl around a

bacterial colony. These events coincide with transcriptional changes that are largely

NF-dependent (Mitra et al., 2004a). When applied to some species such as M. sativa

(alfalfa), NF is sufficient to induce nodule formation, although these nodules are not

occupied by bacteria (Debellé et al., 2001).

3

The structure for NF and genes involved in its biosynthesis have been well

characterized (reviewed in Spaink et al., 1998). The NF backbone is a tetramer of β-

1,4-linked N-acetyl glucosamine (Roche et al., 1991a). Species-specific decorations

on the chitin backbone of S. meliloti NF include: (1) a C16:2 N-acylation on the

terminal non-reducing N-acetyl glucosamine residue, (2) an C6-O-acetylation on the

terminal non-reducing glucosamine, and (3) a C6-sulfate modification on the reducing

residue. Modified forms of S. meliloti NF alter host specificity and elicit altered host

responses. NodH mutants lack the sulfate modification and elicit no measurable plant

response (Roche et al., 1991b; Ehrhardt et al., 1995; Schultze et al., 1995). In contrast

nodF mutants (which have a modified acyl chain; Shearman et al., 1986; Demont et

al., 1993) and nodL mutants (which lack O-acetylation; Downie, 1989) trigger root

hair deformation but have reduced infection (Ardourel et al., 1994). NodFL double

mutants are completely unable to infect (Ardourel et al., 1994). NodH mutants fail to

induce calcium spiking on M. sativa while nodFL double mutants are able to trigger

calcium spiking (Wais et al., 2002). The observation that altering NF structure either

abolishes all plant responses, or specifically abolishes infection, led to a two-receptor

model in host NF perception where: (1) a less stringent “signaling” receptor controls

calcium spiking and transcription and (2) a highly stringent “entry” receptor controls

bacterial entry into root hairs (Ardourel et al., 1994).

The two-receptor model is supported by host genetics in M. truncatula which

have identified two putative NF receptor loci NFP and LYK3. Both encode LysM-

family receptors; LysM receptors binds chitin (Iizasa et al., 2010) so these are good

candidates for binding the chitin backbone of NF. Loss of function mutations in NFP

(in Medicago truncatula) and NFR1/NFR5 (homologues in Lotus japonicus) result in

complete insensitivity of plants to NF (Wais et al., 2002; Amor et al., 2003; Madsen et

al., 2003; Radutoiu et al., 2003). LYK3 mutants (also called hcl) undergo root hair

deformation in response to NF but do not form root hair curls (mutants were originally

called hcl for their root hair curling defect) or infection threads (Catoira et al., 2001;

Limpens et al., 2003; Smit et al., 2007). Hcl mutants undergo few or no cortical cell

divisions (Catoira et al., 2001). Weaker mutant alleles of LYK3 and LYK3 RNAi

4

plants form infection threads that fail to penetrate the root cortex (Limpens et al.,

2003; Smit et al., 2007). Based on these observations, NFP is alleged to encode the

low stringency receptor which controls calcium spiking and gene expression, and

LYK3 encodes the high stringency receptor which controls bacterial entry into root

hairs (Smit et al., 2007).

Forward genetics in the model legumes M. truncatula and Lotus japonicus

have identified what are likely the major components of the NFP signaling pathway.

The NFP receptor signals through a Leucine-rich repeat receptor-like kinase encoded

by DMI2 (in M. truncatula) and SymRK (L. japonicus) which are necessary for

calcium spiking in their respective species (Endre et al., 2002; Stracke et al., 2002).

Also necessary for calcium spiking are a putative nuclear ion channel DMI1 (in M.

truncatula) and CASTOR/POLLUX (L. japonicus) (Ané et al., 2004; Riely et al., 2007;

Charpentier et al., 2008) and the nucleoporins Nup85 and Nup133 (L. japonicus)

(Kanamori et al., 2006; Saito et al., 2007). Calcium spiking likely controls activity of

a calcium/calmodulin-dependent protein kinase (CCaMK) encoded by DMI3 (M.

truncatula) and Sym15 (L. japonicus) (Levy et al., 2004; Mitra et al., 2004b; Tirichine

et al., 2006). Gain of function alleles of CCaMK in both L. japonicus and M.

truncatula are sufficient for nodule organogenesis in the absence of bacteria (Gleason

et al., 2006; Tirichine et al., 2006). In response to NF signal transduction, CCaMK

phosphorylates two GRAS-family transcription factors NSP1 and NSP2 which form

heterodimers that directly bind the promoters of NF-responsive genes (Catoira et al.,

2000; Oldroyd and Long, 2003; Kaló et al., 2005; Smit et al., 2005; Heckmann et al.,

2006; Murakami et al., 2006; Hirsch et al., 2009). NSP1 and NSP2 are necessary for

all known NF-dependent transcriptional changes (Mitra et al., 2004a). A downstream

transcription factor ERN is required for a subset of NF-dependent gene expression and

CCaMK-dependent nodule formation (Middleton et al., 2007). These genes likely

represent the majority of components required for NF signal perception at the host cell

membrane and NF-induced signal transduction to activate gene expression and nodule

organogenesis.

5

Crosstalk between the NF signaling and entry pathway likely occurs, as plants

must coordinate infection with nodule formation. Crosstalk is supported by the

phenotypes of several mutants. M. truncatula NIN encodes a putative transcriptional

regulator (Schauser et al., 1999; Borisov et al., 2003; Schauser et al., 2005) and is

required for CCaMK-dependent nodule organogenesis and infection events but not

NF-dependent transcriptional changes suggesting that it may coordinate signals

through both NF receptors (Marsh et al., 2007). L. japonicus CCaMK is able to

phosphorylate CYCLOPS (Yano et al., 2008), a protein of unknown function which

contains a nuclear localization signal and a coiled-coil domain. CYCLOPS is

dispensable for CCaMK-dependent nodule organogenesis but not for infection and

may represent a branch point in NFP-signaling (Capoen and Oldroyd, 2008). The

mechanisms by which NIN, CYCLOPS and other genes mechanistically enable

crosstalk between nodule formation and infection pathways are a focus of ongoing

work.

Plant requirements for infection

The genetic requirements for infection and invasion are not as well defined as early

signaling events. A number of Fix- mutants (which form nodules but do not support

nitrogen fixation) have been characterized based on microscopic observation of the

progress of bacterial infection and monitoring nitrogen fixation (Utrup et al., 1993;

Schauser et al., 1998; Morzhina et al., 2000; Starker et al., 2006). These mutants can

be divided into two major groups (1) infection mutants that form nodules but have few

infection threads and no bacterial release or (2) invasion mutants that are able to

support bacterial infection and release but not nitrogen fixation. Genes required for

later symbiotic events are still in early stages of characterization; it unclear how they

fit together in pathways and how later events are affected by early signal transduction.

Genes required for infection are potential components of the LYK3 entry

pathway. The E3-ubiqutin ligase PUB1 negatively regulates infection likely by

targeting LYK3 for degradation (Mbengue et al., 2010). A second putative E3-

ubiquitin ligase LIN1 is required for infection, suggesting that protein degradation

6

both positively and negatively regulates infection (Kiss et al., 2009). A plant-specific

gene RPG encodes a nuclear-localized protein with a long coiled-coil domain and is

required for infection thread polar growth (Arrighi et al., 2008). Infection thread

growth in L. japonicus requires the genes NAP1 and PIR1, which are involved in actin

reorganization (Yokota et al., 2009). A plant-specific membrane protein, remorin, is

also required for infection (Lefebvre et al., 2010). While all of these genes appear to

be required for normal infection, how they work co-operatively and integrate signals

from the LYK3-dependent NF perception pathway remains to be seen.

After bacteria are endocytosed into their legume host cells, several genes

involved in protein secretion and vesicle trafficking are required for symbiosome

maturation. DNF1 encodes a nodule-specific signal peptidase required for secretion of

antimicrobial cysteine-rich peptides which control bacterial differentiation (Van de

Velde et al., 2010; Wang et al., 2010). The syntaxin SYP132 localizes to symbiosome

membranes (Catalano et al., 2007), and a RAB7 homologue is required for

symbiosome senescence in mature nodules (Limpens et al., 2009). These are few of

what will certainly be many proteins required for endocytosis, trafficking and

maintenance of symbiotic bacteria within their host cells.

Bacterial invasion factors

A number of bacterial genera in the α-proteobacteria can cause chronic infections of

mammals (Brucella, Bartonella and Rickettsia sp.), plants (Sinorhizobium,

Bradyrhizobium, and Agrobacterium sp.), and insects (Wolbachia sp.) (Sallstrom and

Andersson, 2005). Although these closely-related bacteria infect and persist in

different host environments, they share a number of genes required for infection

including production of the correct types and amounts of cell surface polysaccharides

(reviewed in Batut et al., 2004; Sallstrom and Andersson, 2005). Conserved

virulence factors suggest the possibility of conserved host targets.

7

A reverse genetics approach to identify genes required for infection

Forward genetics may be limited in its ability to uncover plant genes required for the

infection and invasion processes. This may occur if infection and invasion share

common mechanisms with essential host functions. Detailed electron microscopy

studies have described the cytology of rhizobia entry into legume root hairs

(Newcomb, 1976). We observed that invagination of the root hair plasma membrane

during infection thread initiation resembles a partial endocytosis event where the

membrane begins to bud but instead of pinching off, elongates through the cell. When

the infection thread reaches the end of the root hair cell, the bacteria release into the

intercellular space and a new membrane invagination occurs in the underlying cell

layers (reviewed in Gage, 2004). Like endocytosis and other membrane shaping

events, infection thread growth in Lotus has been shown to depend on actin

reorganization (Yokota et al., 2009). Other genes involved in infection may not be

revealed in forward genetic screens because they are essential, have pleiotropic

phenotypes, or have genetic redundancy.

We hypothesized that symbiotic infection thread formation and bacterial

endocytosis may have co-opted gene function normally involved in vesicle trafficking,

endocytosis and membrane shaping, and that these might represent common host

targets for intracellular bacteria. We employed a reverse genetics approach to identify

plant endocytosis and membrane-shaping genes required for bacterial infection and

invasion. We conducted a reverse genetics screen to identify genes that are (1)

associated with infection or survival of Brucella in animal cells, (2) conserved in

plants, (3) transcriptionally regulated during nodulation, and (4) expanded gene

families in legumes. M. truncatula flotillins met all of these criteria, so their role in

symbiosis was explored further (Chapters 2 and 4).

Flotillins and membrane rafts in animals

Flotillins were first identified in a search for membrane proteins that co-fractionate

with detergent insoluble membrane fractions (Bickel et al., 1997). At the same time,

they were identified as proteins upregulated during axon regeneration in zebra fish

8

retina and as a result, named Reggies (Schulte et al., 1997). Animals have two

flotillin/reggie-family proteins, FLOT1 and FLOT2, that are ~50% identical. Both

proteins have patchy distributions associated with cellular plasma membranes and

localize to several intracellular compartments (Solomon et al., 2002; Glebov et al.,

2006; Langhorst et al., 2007). FLOT1 and FLOT2 lack trans-membrane domains and

are membrane associated by N-terminal fatty acid modifications (Morrow et al., 2002;

Neumann-Giesen et al., 2004). The N-terminus of FLOT contains a

stomatin/prohibitin/flotillin/HflK (SPFH) domain (Browman et al., 2007). Several

SPFH domain-containing proteins can bind cholesterol (Huber et al., 2006), and it has

been proposed that by binding cholesterol, they may play a role in structuring the

plasma membrane (Browman et al., 2007). FLOT1 and FLOT2 co-localize

(Langhorst et al., 2007) and form hetero- and homo-oligomers which are mediated by

C-terminal coiled-coil domains (Neumann-Giesen et al., 2004; Solis et al., 2007).

FLOTs are frequently used as markers for the detergent resistant membrane

(DRM) fraction, a technique which for many years was used to prove that a protein

localized to “lipid rafts” (Lingwood and Simons, 2010). It was believed that proteins

closely associated with cholesterol and sphingolipids would be shielded from

detergents allowing them to be isolated from the remainder of the plasma membrane,

and that these lipid-rich regions of plasma membrane corresponded to functionally

active membrane rafts. However, it has been shown that detergent-based methods can

introduce artifacts, and the DRM fraction may not correlate with protein distribution in

a living cell (Munro, 2003; Lingwood and Simons, 2010). As a consequence, DRM

localization does not necessarily have functional implications and two proteins that co-

partition in the DRM fraction may not co-localize in a living cell. Membrane rafts (or

lipid rafts) are defined as “small (10-200 nm), heterogeneous, highly dynamic, sterol-

and sphingolipid-enriched domains that compartmentalize cellular processes” (Pike,

2006). Despite the controversy and confusion surrounding the DRM/membane raft

debate, the domains marked by FLOTs meet the criteria for membrane rafts. FLOT

puncta are small (50-100 nm; Stuermer et al., 2001) and likely cholesterol enriched

(shown by indirect means; Kokubo et al., 2003). FLOT puncta co-distribute with

9

many of their interaction partners and as such, FLOT-containing membrane puncta

can be said to compartmentalize cellular processes (see below).

Membrane puncta marked by FLOTs appear to be involved in

compartmentalization of cellular processes. FLOTs co-distribute and can interact with

cortical f-actin, Src kinases and the CAP adaptor protein (Liu et al., 2005). Via these

interactions, FLOTs mediate membrane shaping events including membrane budding,

actin-mediated neuronal differentiation, and filopodia formation (Baumann et al.,

2000; Neumann-Giesen et al., 2004; Frick et al., 2007; Langhorst et al., 2008a).

FLOTs co-localize with and are important for the function of several GPI-anchored

proteins (Stuermer et al., 2001; Deininger et al., 2003; Reuter et al., 2004; Stuermer et

al., 2004). FLOT1 and FLOT2 are both targets of the Fyn kinase which is required for

GPI protein signaling (Neumann-Giesen et al., 2007; Riento et al., 2009).

The molecular function of FLOTs in signaling remains elusive. It has been

suggested that FLOTs are required for receptor-mediated endocytosis of cholera toxin

and epidermal growth factor (EGF) and may define a clathrin-independent endocyotic

pathway (Glebov et al., 2006; Neumann-Giesen et al., 2007; Riento et al., 2009).

However, while FLOTs are required for receptor-mediated signaling in response to

many ligands, there are several examples where they are not required for endocytosis

of the receptor (Katanaev et al., 2008; Langhorst et al., 2008b; Pust et al., 2010).

There is evidence the role of FLOTs in receptor signaling may not be directly in

receptor-mediated endocytosis (Schneider et al., 2008; Pust et al., 2010). There is also

evidence that FLOTs are required for retrograde transport of bacterial toxins (Pust et

al., 2010). It has been proposed that FLOTs are involved in recruitment and assembly

of membrane proteins at plasma membrane cell-cell contacts or during tip growth

(Langhorst et al., 2007; Stuermer, 2010). However, not all receptors that require

FLOTs for their signaling also require FLOTs for their plasma membrane association

(Glebov et al., 2006). More experiments are required to elucidate the exact function

of FLOTs in signaling, and the existing models need to be refined to account for

emerging flotillin behaviors.

10

FLOTs in animals have been implicated in bacterial pathogenesis and toxin-

induced disease. Upon uptake into animal cells, Brucella is surrounded by a FLOT-

positive host membrane (Watarai et al., 2002; Arellano-Reynoso et al., 2005).

Silencing FLOT1 has been shown to inhibit clathrin-independent, receptor-mediated

endocytosis of cholera toxin (Glebov et al., 2006). FLOTs are also required for the

full toxicity of bacterial Shiga toxin and for the plant toxin ricin (Pust et al., 2010).

This suggests that pathogens may co-opt FLOT function, or the function of FLOT-

associated proteins, to gain entry into host cells and to cause disease.

Flotillins are conserved across kingdoms, although their low sequence

identity suggests FLOTs in diverse kingdoms may have adopted similar 3-dimensional

structures via convergent evolution (Rivera-Milla et al., 2006). The crystal structure

of an archael SPFH domain-containing protein is highly similar to animal FLOT2

(Yokoyama et al., 2008). Bacterial flotillins have been characterized and have a

punctate, membrane-associated distribution (Donovan and Bramkamp, 2009; Lopez

and Kolter, 2010); in Bacillus, flotillin mutants show a delay in sporulation (Donovan

and Bramkamp, 2009) and defects in signaling via a membrane-associated histidine

kinase (Lopez and Kolter, 2010). These results suggest that receptor signaling may be

a conserved function of SPFH domain-containing proteins.

Flotillins are conserved in plants

Bioinformatic analysis predicts that plant flotillin-like proteins share some features

with animal FLOT2 including two N-terminal hydrophobic stretches, a palmitoylation

site at Cys-34, and a C-terminal coiled-coil domain (Rivera-Milla et al., 2006). Plant

flotillin-like genes are nearly all annotated as nodulins (a generic name for a gene that

is expressed uniquely in nodules). This annotation is due to the early identification of

a plant flotillin-like gene, GmNod53b, that is induced in soybean nodules (Winzer et

al., 1999). Proteomic analyses of the peribacteroid membranes in soybean and pea

nodules identified peptide sequences identical to GmNod53b (Panter et al., 2000;

Saalbach et al., 2002). An Arabidopsis flotillin is upregulated in roots in response to

fungal chitin and bacterial flagellin, both of which elicit a defense response (Millet et

11

al., 2010). These results indicate that flotillins are conserved in plants and likely have

a role in plant-microbe interactions.

Contributions

In Chapter 2, I describe the characterization of M. truncatula flotillins (FLOTs) in

symbiosis with S. meliloti. I found that FLOT2 and FLOT4 are required for symbiosis

and that FLOT4 has a unique requirement in infection thread elongation. This work is

the first demonstration that flotillins are required for bacterial infection of any

eukaryotic host. Additionally, these are the first functions ascribed to plant flotillin

homologues. I showed that like their animal and bacterial counterparts, GFP-tagged

M. truncatula FLOTs have a punctate, plasma membrane-associated distribution. This

suggests that compartmentalization of plant membrane proteins may have a function

during symbiosis.

I investigated the localization of receptor kinase proteins required for

symbiosis and found that like GFP-tagged FLOTs, GFP-tagged symbiotic receptors

have a patchy distribution associated with root hair plasma membranes. In Chapter 3,

I describe localization of tagged functional symbiotic receptor kinases LYK3 and

DMI2. I found that like FLOT4:GFP, LYK3:GFP localizes to infection threads in root

hairs. Localization of LYK3:GFP and DMI2:GFP is discussed in the context of their

proposed functions. These findings further implicate plant membrane

compartmentalization in perception and transduction of signals.

I observed that FLOT4:GFP puncta have a change in distribution during the

early events in symbiosis. Chapter 4 explores the localization of FLOT4:GFP in the

context of known signaling events. I found that FLOT4:GFP localization is strongly

affected in a lyk3 kinase mutant. This suggests that membrane proteins themselves

have a role in structuring protein distribution within plant membranes. I co-expressed

tagged FLOT4 and LYK3 in M. truncatula roots and found that in the absence of

bacteria, the two proteins have little co-distribution in space and time. Bacterial

inoculation triggers redistribution of both FLOT4:GFP and LYK3:GFP and increases

co-distribution of the two proteins. Based on the similarity in flot4 and lyk3

12

phenotypes, the dependence of FLOT4:GFP localization on LYK3, and the observation

that they co-localize after bacterial treatment, I propose that FLOT4 is a component of

the high stringency NF entry pathway previously defined by LYK3 and NIN. These

data demonstrate that changes in plant membrane protein distribution accompany root

hair morphological changes in response to symbiotic bacteria.

13

Chapter 2 CHAPTER 2: Plant flotillins are required for infection by nitrogen-fixing bacteria

ABSTRACT To establish compatible rhizobial-legume symbioses, plant roots support bacterial

infection via host-derived infection threads. Here we report the requirement of plant

flotillin-like genes (FLOTs) in Sinorhizobium meliloti infection of its host legume

Medicago truncatula. Flotillins in other organisms have roles in viral pathogenesis,

endocytosis and membrane shaping. We identified seven FLOT genes in the M.

truncatula genome and show that two, FLOT2 and FLOT4, are strongly upregulated

during early symbiotic events. This upregulation depends on bacterial NF and the

plant’s ability to perceive NF. Microscopy data show that M. truncatula FLOT2 and

FLOT4 localize to membrane microdomains. Upon rhizobial inoculation, FLOT4

uniquely becomes localized to the tips of elongating root hairs. Silencing FLOT2 and

FLOT4 gene expression reveals a non-redundant requirement for both genes in

infection thread initiation and nodule formation. FLOT4 is uniquely required for

infection thread elongation, and FLOT4 localizes to infection thread membranes. This

work is reveals a critical role for plant flotillins in symbiotic bacterial infection.

14

INTRODUCTION Symbiotic nitrogen-fixing rhizobial bacteria live in association with legume roots

inside developmentally unique structures called nodules. Bacteria penetrate nodules

via plant-derived structures called infection threads. Invagination of the root hair

plasma membrane during infection thread initiation resembles a partial endocytosis

event where the membrane begins to bud, but instead of pinching off, elongates

through the cell. As the infection thread finishes traversing the cell, the bacteria

release into the intercellular space. New membrane invagination and infection thread

formation take place in the underlying cell layers. Eventually, the bacteria are released

into host cells via an endocytosis-like event where they remain surrounded by a host-

derived membrane (Newcomb, 1976; Gage, 2004).

A bacterially-produced lipochitooligosaccharide called Nod Factor (NF) is a

species-specific rhizobial signal that is recognized by the legume host. NF promotes

nodule development (Debellé et al., 2001) and via signal transduction induces calcium

spiking and transcriptional changes (Ehrhardt et al., 1996; Mitra et al., 2004a).

Forward genetic studies in rhizobial-legume systems have revealed genes required for

host NF signal perception, signal transduction, and transcriptional changes (see

Oldroyd and Downie, 2008 and references therein). NF perception is mediated by

LysM-family receptor-like kinases NFP and LYK3 (in Medicago truncatula;

NFR1/NFR5 in Lotus japonicus). The NFP receptor induces calcium spiking via a

pathway that includes a leucine-rich repeat receptor-like kinase and a putative ion

channel. Calcium spiking appears to control activity of a calcium/calmodulin-

dependent protein kinase and two downstream GRAS-family transcription factors

NSP1 and NSP2 which interact in the plant nucleus and directly bind the promoters of

nodulation genes (Hirsch et al., 2009). NSP1 and NSP2 are necessary for all known

NF-dependent transcriptional changes (Mitra et al., 2004a).

A second “entry” pathway (controlling bacterial entry into root hair cells) has

been proposed that includes the high stringency receptor encoded by LYK3. Loss of

function lyk3 mutants undergo a small number of cortical cell divisions and form no

infection threads. An additional transcriptional regulator NIN is required for nodule

15

organogenesis and infection events but not NF-dependent transcriptional changes.

Current evidence suggests that NIN may coordinate signals through both the signaling

and entry pathways (Marsh et al., 2007). Components of the proposed NF entry

receptor pathway are currently limited to NIN and LYK3; how LYK3 signaling is

perceived and translated into infection thread initiation is unknown.

Sinorhizobium meliloti, the nitrogen fixing symbiont of Medicago (the alfalfa

genus), is a close relative of the animal pathogen Brucella. Sinorhizobium and

Brucella have common genes required for infection and invasion of their hosts (Batut

et al., 2004). Given these common features, we asked whether required eukaryotic

host-cell factors might also be shared across kingdoms.

Upon uptake into host cells, Brucella is surrounded by a flotillin-positive

membrane (Watarai et al., 2002; Arellano-Reynoso et al., 2005) . Flotillins were

initially used as markers for cholesterol-rich, detergent-resistant, membrane

microdomains called “lipid rafts”, and are now believed to define a clathrin-

independent, caveolin-independent endocytic pathway (Glebov et al., 2006). By

interacting with effectors that can bind actin, flotillins mediate membrane shaping

events including membrane budding, actin-mediated neuronal differentiation, and

filopodia formation (Baumann et al., 2000; Frick et al., 2007; Neumann-Giesen et al.,

2007; Langhorst et al., 2008a). Flotillins are also responsible for secretion and spread

of long-range signaling forms of Wingless and Hedgehog in Drosophila, for insulin-

stimulated glucose transport, and for epidermal growth factor signaling (Baumann et

al., 2000; Neumann-Giesen et al., 2007; Katanaev et al., 2008).

Due to the importance of flotillins in pathogenesis, we investigated whether

plant flotillin-like proteins might be candidates for symbiotic events from infection

thread initiation and elongation to hormone transport to the final endocytosis of

bacteria into their host cells. Seventeen flotillin-like proteins in 10 different plant

species were identified by sequence similarity to mammalian flotillin-1 (Rivera-Milla

et al., 2006). Plant flotillin-like proteins are predicted to have many features of animal

flotillins including two N-terminal hydrophobic stretches, a palmitoylation site at Cys-

34, and a C-terminal coiled-coil domain (Rivera-Milla et al., 2006). At the start of

16

this work, plant flotillin-like genes were annotated as nodulins (a generic name for a

gene that is expressed uniquely in nodules). The nodulin annotation was due to the

early identification of a plant flotillin-like gene, GmNod53b, which is induced in

soybean nodules (Winzer et al., 1999). Proteomic analyses of the peribacteroid

membranes in soybean and pea nodules identified peptide sequences identical to

GmNod53b (Panter et al., 2000; Saalbach et al., 2002). An Arabidopsis flotillin gene

was among the most strongly up-regulated genes in response to root application of

flagellin peptide Flg22 (Millet et al., 2010). A flotillin was identified in the detergent-

resistant microsomal fraction of Arabidopsis leaf cells (Borner et al., 2005). These

results imply that flotillins are conserved between plants and animals. The conserved

sub-cellular localization suggests the possibility of conserved function(s). In this work

we employ a reverse genetics approach to investigate the role of the Medicago

truncatula flotillin-like gene family (FLOTs) in symbiosis. We demonstrate that two

family members, FLOT2 and FLOT4 are required for early symbiotic events and have

non-redundant functions.

17

RESULTS Identification of flotillin-like genes in M. truncatula

A search of the M. truncatula genome sequence yielded 7 genomic regions with high

homology (E-value < 1e-151) to the amino acid sequence of the soybean flotillin

homologue GmNod53b, which we have designated FLOT1-7 (Table 2-1). All seven

predicted ORFs have >85% identity on the nucleotide level (Figure 2-1A). FLOT1-5

are located within a 30 kb region of chromosome 3 (Figure 2-1B). While all other

plant flotillin-like proteins described thus far have a conserved predicted

palmitoylation site at Cys-35 (Rivera-Milla et al., 2006), FLOT4 is predicted to have a

Tyr substitution at this residue (Figure 2-1A). FLOT5 has no obvious translational

start site and lacks a two-exon, one-intron structure. Only three FLOT genes are

present in the Arabidopsis genome (Rivera-Milla et al., 2006) implying an expansion

of the FLOT family in M. truncatula. Gene Name

EST (TIGR)

Affymetrix probe set (expressed?)

BAC ID (imgag, genbank)

Genomic location Chromosome (position cM)

Number of exons

Estimated spliced mRNA size

FLOT1 BF644444 Mtr.5691.1 (No) Mth2-115c19, CT009553

3 (71.8) 2 1434 bp

FLOT2 EX527915 Mth2-115c19, CT009553

3 (71.8) 2 1440 bp

FLOT3 TC139669 Mtr.45231.1 (Yes) Mth2-115c19, CT009553

3 (71.8) 2 1422 bp

FLOT4 TC133140, TC127236

Mtr.11786.1 (Yes), Mtr.42072.1 (Yes)

Mth2-115c19, CT009553

3 (71.8) 2 1425 bp

FLOT5 TC126348 Mth2-115c19, CT009553

3 (71.8) 5 ?

FLOT6 AW574030 Mtr.3447.1 (No) Mth2-193c3, AC161241

1 (49.4) 2 1416 bp

FLOT7 TC117648 Mtr.10214.1 (No) Mth2-135j6, AC151528

1 (43.9) 2-3 ?

FLOT7 Mth2-58k14, AC174291

Unanchored 2-3 ?

Table 2-1. Summary of the FLOT gene family Location, size, gene structure and available ESTs for putative M. truncatula flotillin-like genes are shown. Data were compiled from the Noble foundation (http://bioinfo.noble.org/gene-atlas ), GenBank (/ http://www.ncbi.nlm.nih.gov/ Genbank/), the International Medicago Genome Annotation Group (IMGAG, http://www.medicago.org/genome/IMGAG ) and the M.t. Gene Index (

/http://compbio.dfci.harvard.edu/tgi/cgi-bin/tgi/gimain.pl?gudb=medicago).

18

19

Figure 2-1. Alignment of predicted FLOT amino acid sequences and arrangement of FLOT1-5 within a single BAC (A) Sequences were aligned using CLUSTALW available from SDSC Biology Work Bench (http://workbench.sdsc.edu/

(B) Arrangement of FLOT1-5 BAC CT009553 (mth2-115c19) (IMGAG,

). Conserved residues between all FLOTs are highlighted blue, residues conserved between four or more sequences are yellow, and similar residues are green. Note change in FLOT4 Cys35 to Tyr (residue 37 as numbered).

http://www.medicago.org/genome/IMGAG/).

FLOT2 and FLOT4 show NF-dependent upregulation during nodulation

We assayed expression of M. truncatula FLOTs during nodulation by quantitative RT-

PCR at times corresponding to key events in nodule development (Starker et al.,

2006). FLOT2 and FLOT4 expression increases early in nodule formation (Figure 2-

2A). FLOT2 is up-regulated for the entire 21-day developmental time course while

FLOT4 expression returns to baseline by 7 days post inoculation (dpi). In contrast,

neither FLOT1 nor FLOT3 expression changes during nodule development. We

explored expression of FLOTs in diverse plant organs and found that FLOT4

expression is largely limited to roots and nodules, while FLOT2 has highest

expression in flowers and green pods, and FLOT1 and FLOT3 expression was detected

in all plant organs (Figure 2-2B). We did not detect expression of FLOT5 or FLOT7

in any plant tissue including roots and nodules. FLOT6 expression was occasionally

detected in roots and nodules at levels so low that it could not be consistently detected

even in the same sample. The roles of FLOT5-7 in nodulation were therefore not

explored further.

20

A small group of plant transcripts is up-regulated in the first 24 hours of

symbiosis; NF is necessary and sufficient for the majority of these early transcriptional

changes (Mitra et al., 2004a). We asked if NF was required for up-regulation of

FLOT2 and FLOT4 at 24 hours post inoculation (hpi). An S. meliloti mutant unable to

synthesize NF (ΔnodD1-nodABC) failed to up-regulate FLOT2 and FLOT4 at 24 hpi

which implies NF is necessary, but purified NF was not sufficient for up-regulation

(Figure 2-3A). We wondered if a second bacterial component such as a cell surface

polysaccharide was also necessary for FLOT induction. Mutants deficient in synthesis

of succinoglycan (exoA:Tn5), lipopolysaccharide (lpsB:Tn5), cyclic β-1,2-glucan

(ndvB:Tn5) and a succinoglycan over-producer (exoX:Tn5) caused up-regulation of

Figure 2-2. Expression of FLOTs during nodulation and in plant tissues (A) FLOT1-4 expression was measured by quantitative RT-PCR in Rm1021 vs. buffer treated A17 roots at 1, 4, 7 14, 21 dpi. Each FLOT expression was normalized to an internal actin control. All data are the ratio of treated vs. buffer control of M. truncatula cv Jemalong A17 plants or mutant derivatives. Each data point is an average of three replicates; error bars indicate standard error of the ratio. (B) Semi-quantitative RT-PCR was conducted to monitor expression of FLOT1-7 in leaves, stems, flowers, green pods. Actin primers were used to monitor total input of cDNA. 25 PCR cycles were used to amplify actin, 30 cycles for FLOT2-4 and 35 cycles were used to amplify FLOT1. Expression of FLOT5,6, and 7 was not detectible after 35 cycles.

21

FLOT2 and FLOT4 (Figure 2-3A) suggesting that known cell surface polysaccharides

are not required.

Evidence suggests that NF effects are transduced via two pathways: a signaling

pathway and a distinct entry pathway (Oldroyd and Downie, 2008). The most

downstream component of the signaling pathway, transcription factor NSP2, is

required for up-regulation of FLOT2 and FLOT4 at 24 hpi (Figure 2-3B). The parallel

entry NF perception pathway, defined by LYK3, is also required for up-regulation of

FLOT2 and FLOT4 at 24 hpi (Figure 2-3B) as is the transcriptional regulator NIN,

which is common to both signaling and entry pathways (Figure 2-3B). However, ERN

(BIT1), an ERF-like transcription factor required for upregulation of a subset of early

nodulins but not for infection thread initiation (Middleton et al., 2007), is not required

(Figure 2-3B). Rit-1 contains a mutation in an unknown gene, and has a block in early

infection (Mitra and Long, 2004); FLOT2 and FLOT4 are not induced in the rit-1

mutant at 24 hpi. NF perception by both signaling and entry NF receptors and signal

transduction via NSP2 and NIN are required for up-regulation of FLOT2 and FLOT4 at

24 hpi.

Figure 2-3. Up-regulation of FLOT2 and FLOT4 is dependent on NF and NF perception (A) FLOT2 and FLOT4 expression was evaluated in response to bacterial mutants at 1 dpi using qRT-PCR. A17 plants were treated with NF, a ΔnodD1-nodABC (SL44) bacterial mutant, or with mutants altered in succinoglycan synthesis (exoA:Tn5 and exoX:Tn5), lipopolysaccharide biosynthesis (lpsB:Tn5), or cyclic β-1,2-glucan synthesis (ndvB:Tn5) (B) Plant mutants unable to perceive NF or unable to initiate subsets of NF-dependent gene transcription were treated with Rm1021 or buffer. Error bars show standard error of the ratio.

22

We asked whether FLOT2 and FLOT4 were up-regulated specifically in the

plant cells that become infected by S. meliloti. Using transcriptional fusions

consisting of FLOT promoters and the GUS reporter gene, we found that in

uninoculated roots, FLOT1-4 are primarily expressed in vascular tissue (Figure 2-4A),

and FLOT4 is also weakly expressed in elongating root hairs (Figure 2-4B). Upon

inoculation with Rm1021, FLOT2 and FLOT4 show an expansion of expression in the

root cortex in the region of elongating root hairs (Figure 2-4), which will eventually

become colonized by bacteria (Gage, 2004). In nodules, FLOT2 and FLOT4 are

expressed in the infection zone (Figure 2-4A, bottom panels). In contrast FLOT1 and

FLOT3 show little change in their spatial expression or in intensity of expression in

roots upon inoculation, and expression is limited to the nodule vascular tissue (Figure

2-4A).

Figure 2-4. FLOT2 and FLOT4 are expressed in the root elongation zone and in the infection zone of nodules (A) A17 plants were transformed to generate hairy roots expressing FLOT1-4 promoter-GUS fusions; GUS activity is shown for the indicated strains and times. Ten transgenic lines were observed for each construct at each time point (scale bars: 1 mm); representative roots are shown. (B) FLOT2 and FLOT4 are expressed in inoculated root hairs. A17 plants were transformed to generate hairy roots expressing FLOT2 and FLOT4 promoter-GUS fusions; GUS activity is shown for buffer- and Rm1021-inoculated roots at 24 hpi. Ten transgenic lines were observed for each construct at each time point (scale bars: 30 nm); a representative sample at the indicated time points is shown.

23

FLOT2 and FLOT4 localize to membrane microdomains and FLOT4 becomes

polarly localized in response to bacterial signals

To study the localization and dynamics of FLOT2 and FLOT4 during nodulation, we

constructed FLOT:GFP fusions using the FLOT genomic sequence (promoter and

intron). FLOT2:GFP was not visible under control of its native promoter so we

expressed FLOT2 using the CaMV 35S promoter. In root cells, signals from both

FLOT2:GFP and FLOT4:GFP appear punctate and co-localize with FM4-64, a plasma

membrane marker (Figure 2-5). In the absence of bacteria, FLOT4:GFP and

FLOT2:GFP puncta are evenly distributed in the plasma membrane of root hair cells

(Figure 2-6). Upon inoculation with S. meliloti, FLOT4:GFP accumulates in the tips

of elongating root hairs while FLOT2:GFP puncta remain evenly distributed

throughout root hair plasma membranes (Figure 2-6). FLOT2:GFP is polarly

localized in uninoculated and inoculated epidermal cells while FLOT4:GFP is not

(Figure 2-6).

Figure 2-5. FLOT2 and FLOT4 localize to membrane-associated puncta We generated A17 hairy roots expressing 35S:FLOT2::GFP or FLOT4p:FLOT4:GFP. Transgenic roots were visualized using a spinning disk confocal microscope (scale bars: 15 μm). At least six transgenic lines were observed for each treatment. Representative images are shown. (A) 35S:FLOT2:GFP in root cells is punctate. (B) FM4-64 membrane-associated dye. (C) Co-localization of FLOT2:GFP puncta (green) and FM4-64 (red).

24

Figure 2-6. FLOTs localize to membrane-associated puncta and become polarly localized after inoculation We generated A17 hairy roots expressing 35S:FLOT2:GFP or FLOT4:GFP driven by its native promoter. Transgenic roots were visualized using a spinning disk confocal microscope (scale bars: 15 μm). FLOT4:GFP and FLOT2:GFP are visibly punctate and evenly distributed in the membranes of uninoculated root hair cells. FLOT4:GFP puncta localize to root hair tips by 24 hpi while the localization of FLOT2:GFP does not change upon inoculation. FLOT2:GFP is weakly polar in uninoculated epidermal cells (arrows) and remains polar on inoculation. FLOT4:GFP is evenly distributed in epidermal cell membranes in inoculated and uninoculated roots. At least fifteen transgenic lines were observed for each treatment. Representative images are shown. Root hair images are maximum intensity projections of 100 sections, taken at 0.2 μm increments.

FLOTs are required for nodulation

We tested FLOT function using RNA interference (RNAi) or artificial micro RNAs

(amiRNAs) to silence FLOT expression and found that FLOTs are required for

symbiosis (Figures 2-7 and 2-8). We targeted FLOT2 and FLOT4, which are

regulated during nodulation, and the constitutively expressed FLOT3 as a control

25

(FLOT1 was also silenced and gave similar nodulation results as FLOT3). We

confirmed efficacy of silencing by qRT-PCR at 24 dpi, a time point when no FLOTs

are significantly up-regulated in inoculated hairy roots (Figure 2-8C). Constructs are

designated by their primary target gene (greater than 50 percent reduction in

expression); numbers in parentheses show genes that have partial reduction in

expression due to cross silencing. The most dramatic phenotype of the FLOT-silenced

lines was observed when FLOT2,3, and 4 are silenced as a group (FLOT2,3,4 RNAi,

Figure 2-7B; this construct also silences FLOT1 (Figure 2-8A,B)). Roots transformed

with the empty vector formed nodules 87 percent of the time while only half of the

FLOT2,3,4 RNAi roots formed nodules. Pink nodules were observed on control

plants more than 25 percent of the time compared to only 2.5 percent for FLOT2,3,4

RNAi roots. On average control roots formed around 6 nodules while FLOT2,3,4

RNAi root formed an average of only 2 nodules. FLOT2,3,4 RNAi roots also had

altered morphology including a decrease in primary root length, an increase in the

number of primary and secondary lateral roots (Figure 2-8A) and reduction in root

weight (Figure 2-8D). These results indicate that FLOTs are required for symbiosis

and normal root development.

26

Figure 2-7. Silencing FLOTs results in a decrease in nodule number, a decrease in infection events and nodules that do form are non-functional (A) Expression of FLOT2,3, and 4 in individual hairy roots expressing the indicated RNAi or amiRNA construct was assessed using qRT-PCR, normalized to an internal actin control, and then to expression in plants transformed with the empty vector (average of at least 10 roots). Constructs are designated by their primary target gene(s) (*>50 percent reduction in expression); numbers in parentheses show genes that have partial but significant (#P< 0.05) reduction in expression due to cross silencing. (B) Nodulation phenotypes were assayed from a minimum of three biological replicates representing 50-100 plants per construct. (C) Acetylene reduction assays were performed at 21 dpi to determine the efficacy of nodules that form (14-20 plants were assayed per silenced line). (D) Hairy roots were stained for Rm1021 expressing phemA:lacZ and stained for lacZ activity at 7 dpi to visualize infection events. Infection events and nodules were scored on ten transformed plants per amiRNA or RNAi and normalized to root weight (Figure 2-8D). Between 104 (FLOT2,3,4 RNAi) and 371 (empty vector) total infection events were observed per line.

27

(E) Progression of infection threads on silenced roots (from Figure 2-4C). Infection threads were scored as aborting in the root hair, penetrating the hypodermal/cortical cell layers but not releasing bacteria into cortical cells, or releasing bacteria into cortical cells. Release was inferred by diffuse blue staining in the nodule cortex. (A-E) Error bars represent ±SEM ; *#P < 0.05 (F-I) Abortive infection threads in plants transformed with the FLOT4 amiRNA construct (F and G) compared to control infection threads (H and I) (scale bars: 15 μm). (J) Linear regressions were conducted on plants described in (A) to determine if a correlation exists between expression of FLOTs and nodule number. FLOT2 expression level has a strong linear relationship with nodule number (y = 5.1x + 2.7; Pintercept = 0.005; Pslope = 3x10-5); FLOT4 expression level has a weaker but statistically significant correlation (y = 2.0x + 5.8; Pintercept = 3x10-8; Pslope = 0.02). FLOT3 expression does not correlate with nodule number (Pslope = 0.6). FLOT2 and FLOT4 expression have additive effects (y = 7.1x + 0.9; Pintercept = 0.003; Pslope = 3x10-10).

Silencing different combinations of FLOTs results in varying degrees of

nodulation and root morphological defects, although none as severe as FLOT2,3,4

RNAi roots (Figures 2-7 and 2-8). Silencing FLOT2 results in fewer nodules per

plant, an increase in Nod- plants, and a decrease in plants that form pink nodules.

Silencing FLOT2 resulted in a decrease in primary root length and long primary lateral

roots but no significant change in root weight. Plants silenced for FLOT4 expression

are significantly less likely to form pink nodules than roots transformed with the

vector control; FLOT4-silenced roots had an increase in numbers of secondary lateral

roots but no decrease in primary root length or root weight. The FLOT3(4) amiRNA

construct silences FLOT3 as completely as FLOT2,3,4 RNAi but these roots show no

significant nodulation defects compared to controls (this construct also targets

FLOT1—Figure 2-8B). We observed shorter roots and reduced root weight in lines

with the greatest reduction in FLOT3 expression. These data suggest that FLOT2 and

FLOT4 play the largest role in symbiosis and the symbiotic defects are separable from

the small root phenotype observed upon silencing FLOT2,3,and 4.

28

Figure 2-8. Root and nodule phenotypes of FLOT-silenced roots (A) A representative plant for amiRNA and RNAi constructs described in this study is shown. Nodules that formed in silenced lines were small and white (with the exception of FLOT1+3(4) amiRNA line). Note smaller overall roots in FLOT3-silenced lines, shorter primary roots in FLOT2-silenced lines and increase in short secondary lateral roots in FLOT4-silenced lines. (B) Silencing data including the data for FLOT1 and one additional construct that primarily targets FLOT1 (FLOT1(2) amiRNA). Gene expression of FLOTs in individual hairy roots expressing the indicated RNAi or amiRNA construct was assessed using qRT-PCR, normalized to an internal actin control and then to expression in control plants (average of at least 10 roots). Constructs are designated by their primary target gene(s); numbers in parentheses show genes that have partial but significant (P < 0.05) reduction in expression due to cross silencing. (C) Hairy root time course. Jemalong seedlings were transformed using A. rhizogenes with the amiRNA empty vector to generate hairy roots. Plants were

29

inoculated with S. meliloti Rm1021 or 1/2X BNM and harvested at the indicated time. QRT-PCR was performed to analyze expression of FLOT2 and FLOT4 at all time points; FLOT1 and FLOT3 expression were monitored at 21 dpi only. Expression of each gene is normalized to an actin internal control; the ratio of inoculated to uninoculated plants is shown. Error bars represent standard error of the ratio. (D) Average root weight of silenced lines. The ten plants per construct used to count infection events (Figure 2-7A to G) were weighed. Error bars represent ±SEM; *P <0.05. (E) Linear regressions were conducted on plants described in Figure 2-7B to determine if a correlation exists between expression of FLOTs and nodule number. FLOT1 expression does correlates with nodule number (Pslope = 0.9).

FLOT2- and FLOT4-silenced plants are defective in both nodule form and

function

Nodules that form in FLOT-silenced lines are predominantly small and white

suggesting that they are unable to fix nitrogen. We found that all silenced lines (with

the exception of FLOT3(4) amiRNA) had a significant decrease in their ability to

reduce acetylene, a reporter for nitrogen fixation (P < 0.01, Figure 2-7C).

To explore the individual contribution of each FLOT to nodule number, we

used the data set from Figure 2-7A to determine whether a correlation exists between

nodule number and the expression of a particular FLOT gene (each hairy root

transformation event results in a unique genomic insertion of the RNAi or amiRNA

construct and a different degree of gene silencing). We found that that FLOT2

expression has a strong linear correlation with nodule number while FLOT4

expression has a weaker but significant linear correlation with nodule number (Figure

2-7J). In contrast, FLOT1 and FLOT3 expression levels have no significant

correlation with nodule number (Figures 7J and 8E). To assess if FLOTs have

additive effects, we compared the pooled expression of different combinations of

FLOTs and found that the combination of FLOT2 and FLOT4 expression levels was

the only grouping that increased the strength of the correlation (Figure 2-7J). This is

consistent with a model in which FLOT2 and FLOT4 contribute independently to

nodule number.

30

FLOT silencing results in infection thread initiation and elongation defects

We used lacZ-staining of S. meliloti to visualize infection threads in silenced roots.

FLOT-silencing results in reductions in both the number of nodules and the number of

infection events (with the exception of FLOT3(4) amiRNA) (Figure 2-7D). The

decrease in the total number of infection events in FLOT2- and FLOT4-silenced roots

indicates that the decrease in nodule number observed may in part be due to an

infection thread initiation defect.

We wondered if the infection defects (Figure 2-7D) are limited to infection

thread initiation or if FLOT2- and FLOT4-silenced roots also have infection thread

elongation defects. We evaluated the progression of infection threads on silenced

roots and found that infection threads on FLOT4-silenced roots were significantly

more likely to abort in the root hair than control plants (Figure 2-7E). Infection

threads on roots silenced for FLOT4 and all FLOTs were also significantly less likely

to have bacterial release into cortical cells. FLOT2- and FLOT3-silenced roots

showed normal infection thread development (Figure 2-7E). Representative images of

the abortive infection threads observed on FLOT4-silenced roots are shown in Figure

2-7F and G (compare to controls in Figure 2-7H,I). This suggests that FLOT4, but not

other FLOTs, is required for normal infection thread elongation. It may suggest a

defect in bacterial release in FLOT4-silenced plants, or that infection threads fail to

reach the cell layers where release normally occurs.

FLOT4 localizes to infection thread membranes

Because silencing FLOT4 results in infection thread elongation defects (Figure 2-7E to

I), we explored whether FLOT4 localizes to infection threads. In infected root hair

cells, FLOT4:GFP localizes to infection thread membranes (Figure 2-8A). A section

through the infection zone of a 7 day old nodule revealed that FLOT4 is present in

infection thread membranes in the nodule (Figure 2-8B). In contrast, FLOT2 is not

present on infection thread membranes in root hairs (Figure 2-8C).

31

Figure 2-9. FLOT4 localizes to infection thread membranes (A-C) Transgenic roots expressing FLOT4p:FLOT4:GFP or 35S:FLOT2:GFP (green) are inoculated with S. meliloti Rm1021 expressing ptrp:mCherry (red) (Scale bars: 30 μm). (A) FLOT4:GFP localizes to infection thread membranes in root hair cells (stack of 50 images taken at 0.2 μm increments, arrows mark infection threads). (B) FLOT4:GFP localizes to infection thread membranes in the infection zones of maturing nodules (arrows). (C) FLOT2:GFP does not localize to infection thread membranes in root hair cells.

32

DISCUSSION A requirement for FLOT2 and FLOT4 for early nodulation events

Data presented in this study indicate that FLOT2 and FLOT4 have roles in early

nodulation. FLOT2 and FLOT4 are among a select group of plant genes up-regulated

at 24 hpi; this up-regulation is dependent on both the NF signaling and entry receptor

pathways, and on NIN (Figure 2-3B). The unexpected result that NF is insufficient for

induction of FLOT2 and FLOT4 suggests that a second bacterial factor may also be

required, although known surface polysaccharides are not apparently required (Figure

2-3A).

FLOT4 shows a prominent accumulation in the tips of elongating root hairs

upon inoculation with S. meliloti (Figure 2-6). Plant proteins with similar localizations

have been implicated in polar growth of root hairs and pollen tubes (Yang, 2008).

Upon silencing FLOT4, we did not observe an obvious defect in normal root hair

elongation or in curling around bacterial colonies, so it seems unlikely that FLOT4 is

required for root hair elongation or directional growth. It seems more likely that this

protein is involved in polar growth of the infection thread.

We observed that silencing FLOT2 and FLOT4 results in fewer infection

threads (Figure 2-7D) and silencing FLOT4 causes infection thread elongation defects

(Figure 2-7E). By analogy to flotillins in other organisms, one might predict that

FLOT2 and FLOT4 have a role in the initial invagination of infection threads into the

root hair and that FLOT4 additionally functions in elongation of the infection thread.

At is also possible that FLOTs coordinate infection thread initiation and nodule

organogenesis (as has been proposed for NIN; Marsh et al., 2007) or that FLOTs are

involved in endocytosis or trafficking of a signal involved in nodule organogenesis.

Further studies are needed to determine if, like their animal counterparts, plant

flotillins interact with the actin cytoskeleton to facilitate membrane rearrangements.

FLOTs were previously isolated from soybean and pea peribacteroid

membranes (Panter et al., 2000; Saalbach et al., 2002); however, we were unable to

detect either FLOT2:GFP or FLOT4:GFP on symbiosome membranes in M.

truncatula. This may be due to limitations in the sensitivity of our microscope or to an

33

absence of the proteins on the symbiosome membranes in this system. We found

evidence that FLOTs are required for later stages of nodulation: FLOT2-silenced

nodules were populated with infection threads that looked similar to wild type

infection threads (Figure 2-7E); however, these nodules were unable to fix nitrogen

(Figure 2-7C) indicating a defect post-infection. Future studies are needed to

determine if FLOTs have a role in endocytosis and trafficking of bacteria.

Flotillin-like genes are ubiquitous in plants

Possible roles for flotillin-like genes in general plant development may be suggested

by the root phenotypes of FLOT-silenced plants (Figure 2-8). We found that FLOT3-

silenced plants had a reduction in root weight, FLOT2-silenced plants had a decrease

in primary root length and FLOT4-silenced plants had an increase in secondary lateral

roots (Figure 3-8). These silencing phenotypes suggest that FLOTs may have a

normal role in plant growth and development and that legumes may have co-opted the

ancestral FLOT function for symbiosis.

Because plant membranes have different compositions than animal membranes

(reviewed in Zappel and Panstruga, 2008), it is likely that plant membrane

microdomains will have different properties than animal membrane microdomains.

Plant membranes contain little cholesterol but rather a mix of sterols that vary across

plant taxa. Most plants including the model Arabidopsis contain primarily sitosterol,

campesterol, and stigmasterol. Medicago has a less common membrane composition

consisting largely of spinasterol (Lefebvre et al., 2007). Determining how the

membrane microdomains defined by FLOTs are similar to and different from the

membrane microdomains defined by flotillins in other plants and other organisms will

give valuable insight into plant membrane microdomains and plant membrane

organization.

34

MATERIALS AND METHODS Plant growth and bacterial treatments

Medicago truncatula Gaertner cv Jemalong, cv Jemalong A17 (an inbred line of

Jemalong), nin-1 (Marsh et al., 2007) and bit1-1 (Middleton et al., 2007) were grown,

inoculated and harvested as described (Mitra and Long, 2004). S meliloti strain

Rm1021 is a streptomycin-resistant derivative of WT field isolate SU47 (Meade et al.,

1982). SL44 has a deletion of the nodD1-nodABC region (Fisher et al., 1988). The

exoA strain (Rm7031) is described in Leigh et al. (1985). The exoX (MB801), lpsB

(R1A6) and ndvB (B587) mutants are described in Griffitts et al. (2008) and Griffitts

and Long (2008). Bacteria were grown in liquid TY-medium or Luria-Bertani (LB)

medium supplemented with appropriate antibiotics. For inoculations, bacteria were

grown to an OD600 between 0.5 and 1. They were then pelleted and resuspended in

1/2X Buffered Nodulation Medium (BNM; Ehrhardt et al., 1992) at an OD600 of 0.05.

RNA sample preparation

RNA used for 24 hour time points (A17 inoculated with NF, or with SL44, or exoA

bacterial mutants and uninoculated and inoculated nps2-2 and hcl-1 plant mutants)

were the same RNA samples that were used in Mitra et al. (2004a). The RNA

samples from the A17 time course were the same samples used by Starker et al.

(2006) with the exception of the 21 dpi RNA samples which were prepared by

Adriana Parra-Rightmyer using methods described in Starker et al. (2006). Remaining

RNA samples were isolated using the TRIzol (Invitrogen) method previously

described by Mitra and Long (2004).

Quantitative RT-PCR

To ensure primer specificity, primers were designed to amplify the most divergent

region of each FLOT and to flank intron splice sites (Table 2-2). Primer pairs were

tested against a cloned genomic region containing FLOT1,2,3 or 4 to ensure that each

primer pair would only amplify its intended target. Primer pairs were also tested for

specificity using cDNA from uninoculated and inoculated M. truncatula cv Jemalong

35

and cv Jemalong A17. The resulting products were sequenced to ensure they were

from a single gene. Quantitative RT-PCR, data quantification and analysis were

performed as described in Mitra et al. (2004a).

To prepare template for qRT-PCR, RNA was DNAse treated using DNAse-

free turbo (Ambion). 35 PCR using actin-specific primers (Table 2-2) was used to

check for DNA contamination post DNAse treatment. The DNAse-treated RNA was

used in single stranded cDNA synthesis using Superscript III (Invitrogen) and

oligo(dT) primer (Invitrogen). 25 PCR cycles were used to check for successful

cDNA synthesis. Template concentration per reaction was determined empirically

based on relative abundance of the transcript of each FLOT; each template was run at

two different concentrations. Template quantification was done at the level of total

RNA; an internal actin control in each PCR controlled for differences in efficiency of

cDNA synthesis. Actin was amplified from cDNA made from 2.5 ng and 7.5 ng of

RNA; FLOT2, FLOT3, and FLOT4 were amplified from cDNA made from 7.5 and 25

ng RNA; FLOT1 was amplified using cDNA made from 25 and 75 ng total RNA.

qPCR was performed using DyNAmo Flash SYBR Green qPCR kit (Finnzymes,

Helsinki).

A. rhizogenes-mediated hairy root transformations

Plasmids were transformed into A. rhizogenes Arqua1 (Quandt, 1993) and selected

using the appropriate antibiotic. A. rhizogenes-mediated hairy root transformations

were done according to Boisson-Dernier et al. (2001) with modifications. We found

that transformation efficiency was increased if the plants were first placed on modified

Fahraeus medium containing 1 mM α-aminoisobutyric acid (AIB) without selection

for 7 days. All newly formed roots were removed, and plants were transferred to

selective media with no ethylene inhibitor and either 25 mg/L kanamycin (remained

on selective media for 17-21 days) or 10 mg/L hygromycin (for 10 days). Plants

remained on selective media until roots reached approximately 2.5 cm (we found that

less time was often needed for Jemalong A17 than for Jemalong). Plants were then

transferred to 1/2X Gamborg’s B5 Basal Salt medium (Sigma) with 1% agar to

36

recover from antibiotic selection. For confocal microscopy studies, 300 mg/mL

Augmentin (Research Products International) and 500 mg/L Cefotaxime (Sigma) were

added to the B5 medium to reduce the amount of A. rhizogenes carryover. Plants

remained on B5 for 1 week then were transferred to Buffered Nodulation Medium

(BNM; Ehrhardt et al., 1992) containing 0.1 μM aminoethoxyvinylglycine (AVG).

Plants were flood inoculated one week later with 10 mLs of the appropriate S. meliloti

strain diluted to OD600 = 0.05 in 1/2X BNM.

β-Glucuronidase assays

The upstream region of each open reading frame (3 kb at most, less if another ORF is

< 3 kb upstream) was amplified from BAC mth2-115c19 and cloned into pENTR

D/TOPO (Invitrogen) (Table 2-5). LR recombination was performed with the

Gateway-compatible vector pMDC163 (Curtis and Grossniklaus, 2003). Plasmids

were used to transform A. rhizogenes Arqua1. A. rhizogenes-mediated hairy root

transformation was performed as described above with hygromycin selection. GUS

assays were conducted as described in Oldroyd et al. (2001a).

RNAi and amiRNA construct design and screen

For RNAi constructs, 100-200 bp of either the conserved region of FLOTs or the

3’UTR were amplified from DNA prepared from BAC mth2-115c19 (Table 2-3). The

PCR products were first cloned into pENTR/D TOPO (Invitrogen). LR recombination

was performed with the binary vector pHELLSGATE8 (Helliwell and Waterhouse,

2003).

AmiRNA constructs were designed as described in Ossowski et al. (2008)

using the web designer described in Schwab et al. (2006)

(http://wmd2.weigelworld.org) which cross-references with available Medicago EST

databases (Table 2-4). The full length sequence for the desired FLOT target was

entered as the “target gene” and available ESTs for that target were entered as

“accepted off-targets”. The suggested amiRNAs were BLASTed against the available

M. truncatula genome to ensure there were no off target sequences that are absent

37

from the available EST library. The pRS300 plasmid (Ossowski et al., 2008) was

used as a template to create the amiRNA hairpin with an intron.

The final amiRNA PCR product was digested at the XhoI and XbaI sites

flanking the sequence encoding the amiRNA hairpin. The resulting product was

ligated into the pHELLSGATE8 vector XhoI and XbaI sites (thus removing the

Gateway cassette). The result was an amiRNA construct driven by the CaMV 35S

promoter with the same vector backbone as the RNAi constructs.

Using A. rhizogenes to generate transgenic hairy roots, we conducted a

preliminary screen of eight RNAi and twelve amiRNA constructs to identify those that

effectively silenced expression of one or more FLOT. ANOVA was used to identify

constructs that caused significant reduction in gene expression. Two-tailed t-tests

were used to determine if nodule number, percent Nod- and percent pink nodules were

different in silenced lines compared to the empty vector control. Linear regressions

were done using Microsoft Excel data analysis feature. To determine if second and

third order correlations existed, second and third order transformations were

performed on the data and linear regressions were conducted. Gene expression was

pooled by averaging the expression level of each gene in the same plant.

Plant Assays

Acetylene reduction (Turner, 1980) was performed as described (Oke and Long,

1999). Plants were initially grown on BNM plates as described above; at 21 dpi the

entire plant was moved to test tubes for the assays. At least 3 uninoculated plants

were assayed per construct to ensure that silencing FLOTs did not intrinsically cause

an increase in ethylene production.

To visualize infection events, plants were inoculated with Rm1021 expressing

lacZ from the plasmid pXLGD4 and stained for β-galactosidase activity at 7 dpi as

described (Boivin et al., 1990). Due to the altered lateral branching observed in some

FLOT-silenced lines, we used root weight rather than root length as a measure of root

size.

38

Localization of fusion proteins

The genomic regions of FLOT2 and FLOT4 were amplified from BAC Mth2-115c19

DNA and inserted into pCH010 (Table 2-5). pCH010 was constructed in two steps by

first inserting eGFP (with added 5’ EcoRI and XmaI sites) into the BamHI/XbaI sites

of pJG159; then the NPTII ORF was amplified from the pHELLSGATE8 vector and

inserted into the XhoI site in pJG159. pJG159 is a small (7.8 kb) binary vector that

was constructed by J. Griffitts (unpublished) by a three way ligation of inserts A and B

from pEGAD (Cutler et al., 2000); Table 2-5) and the SphI/XhoI fragment from

pCAMBIA1300 (www.cambia.org). To create insert A (Sph-RB-P35S-RI), pEGAD

was amplified with primers oJG346/347 and 348/349 followed by overlap extension-

PCR with oJG346/349. Insert B (RI-nosT-P35S-XhoI) was amplified from pEGAD

with oJG350/351.

For 24 hpi localization studies, plants were inoculated with Rm1021 over-

expressing NodD3 from the plasmid pRmE65 (Fisher et al., 1988). For infection

thread co-localization studies, plants were inoculated with Rm1021 constitutively

expressing mCherry from the plasmid pQDN03. pQDN03 was constructed by

replacing GFP in pDG71 (Gage, 2002) with mCherry (Table 2-5).

Root segments and nodule hand sections (for imaging the infection zone) were

excised and mounted in 0.1 M potassium phosphate buffer pH 7. Spinning disk

confocal microscopy was performed on a system described previously in Gutierrez et

al. (2009) using a 63X/1.3 NA glycerol immersion objective. GFP and RFP were

excited at 491 nm and 561 nm, respectively, by solid-state lasers. Z-projections of

root hairs are from 100-200 images taken at increments of 0.2 μms (MCL NanoDrive).

Stacks were processed using ImageJ software (http://rsbweb.nih.gov/ij

FM4-64 was dissolved in 0.1 M phosphate buffer pH 7.0 to a final

concentration of 20 μM and kept on ice until use (Bolte et al., 2004). The GFP/FM4-

64 experiment was imaged on a system described in Paredez et al. (2006) with the

same excitation settings listed above for GFP/RFP and 1000 ms exposures. Typical

exposure times were 1000 ms for GFP, 500 ms for mCherry and 1000 ms for FM4-64.

/). Typical

exposure times were 1000 ms for GFP, 500 ms for mCherry.

39

Hairy root time course

To determine if regulation of FLOTs was altered in hairy roots, we assayed FLOT

expression levels in uninoculated and inoculated M. truncatula cv Jemalong seedlings

transformed with the amiRNA empty vector construct EX117 (Table 2-4) at 1, 4, 7, 14

and 21 dpi. Plants were grown as described above and inoculated with 1/2X BNM or

Rm1021 in 1/2X BNM. Plants were harvested just below the callus at the appropriate

time point and flash frozen in liquid nitrogen. Three independent replicates of the

entire time course were performed; each time point sample was a pool of the ten plants

from a single plate. RNA was isolated with a yield of 50-100 μg per ten plants.

Experiment Intended Target Primer Name Primer sequence qPCR Actin chh256 CACGAGACCACCTACAACTCT chh257 GGACTTAGAAGCACTTCCTGT qPCR FLOT1 chh250 CTGAGCTTGAGGCTGCTAAAG chh251 TTAGCCTCTTGTACCTTAGTGTC qPCR FLOT2 chh234 CAAGAGCTTTTCTCAGATAAGGC chh237 ACTGATGGTGCCATGGGTATG qPCR FLOT3 chh244 AGTTGGCCAAAAAGAAGGCTG chh247 TTAGCCTCTTGTACCTTAGTTTC qPCR FLOT4 chh241 TGCGTCTGCTAATGCTTTCTGTG chh243 CCGAAGTTGAGGCTGCCAAAG PCR/expression FLOT1 chh073 TATGACATAGTAGTAGTTTG chh068 ATGTACCGGGTAGCAAAAGCA PCR/expression FLOT2 chh258 AGTCGAGGCGAAGAAGGCTGTT chh259 AGTCTCTTTCTGTTTCTTGTACAGC PCR/expression FLOT2 chh067 ATGAAAATTTACCGGGTCGCG chh074 TCAGGCATGTATGATCACGTA PCR/expression FLOT3 chh068 ATGTACCGGGTAGCAAAAGCA chh075 TGCATCTCCTAATTAAGACTT PCR/expression FLOT4 chh068 ATGTACCGGGTAGCAAAAGCA chh076 GCCAAAATAAAATTCCACAAT PCR/expression FLOT5 chh090 GTGGGACTTCATCGTGTAGC chh091 CCTAATACTTGCATTGCATCAT PCR/expression FLOT6 chh067 ATGAAAATTTACCGGGTCGCG chh077 CTACTATAAACCTCTAAACCC PCR/expression FLOT6 chh252 GGGTGAAGCAGGTGGTATG chh253 CTACTACTATAAACCTCTAAACCC PCR/expression FLOT6 chh254 AGGCGAAGAAGGCTGTGAAAC chh255 ACCCCTTGAGCTTGTCCAACT PCR/expression FLOT7/8 chh230 GTAGTTTAGTAATTTAGTAGTTTAAG chh231 TCAAAGAGAGGCTGAAGTGGCTGAGG PCR/expression FLOT7/8 chh231 TCAAAGAGAGGCTGAAGTGGCTGAGG chh107 AGTCTCTTTCTGTTTCTTGT

Table 2-2. PCR and qPCR primers to monitor FLOT expression

40

Construct (original: name used here)

Intended Target Primer Name Primer sequence

E: FLOT1-4 RNAi FLOT1-4 chh112 CCACAATTCTGTATGAGAAGAA chh113 GTTTCCAAGTGCATTGAGAAG

J FLOT1 UTR chh224 CACCACCTTTTATTGTGTGATATGTGTT chh225 TGTAAACTAAATCATCATATGACATAG

K FLOT2 UTR chh226 CACCGGTTTTGGTAATTTAGTAGCAGT chh227 ATTAAATTGGCATTTAATATAAGAG

L: FLOT4(3) RNAi FLOT3 UTR chh228 CACCAATTAGGATGATGCAACTATTATG chh229 ACCTGAAAATCTGAAAGACTAGTGA

M FLOT1 UTR chh277 CCACATCTTTACCTGACAAAAACTC chh278 GACTGGTGAATAAAACACATATCAC

N FLOT2 UTR chh279 CCACAGCCTTATCTGAGAAAAGCTC chh280 TCACGTAATAAAAAGTACTGCTAC

O FLOT2 chh281 CCACATGAAAATTTACCGGGTCGC chh282 GAGTTTGATGTCTTTGATGAAAATAC

Q FLOT1-4 chh285 CACCGTAAGGGATTACTTGATGATAAA chh286 TATTATCACCACCATTAGTCCAAAT

Table 2-3. RNAi Construct Primers Construct (original: targets)

Intended Target

Primer Name

Primer sequence

pRS300 amiRNA-A CACCCTGCAAGGCGATTAAGTTGGGTAAC amiRNA-B GCGGATAACAATTTCACACAGGAAACAG EX101 FLOT 1-4 chh287 gaTCAAGTGTCACAATCCCCTATtctctcttttgtattcc chh288 gaATAGGGGATTGTGACACTTGAtcaaagagaatcaatga chh289 gaATCGGGGATTGTGTCACTTGTtcacaggtcgtgatatg chh290 gaACAAGTGACACAATCCCCGATtctacatatatattcct EX102: FLOT1,3(4) amiRNA

FLOT 1-4 chh291 chh292 chh293 chh294

gaTTTCACTTCAGTTCTCACTTAtctctcttttgtattcc gaTAAGTGAGAACTGAAGTGAAAtcaaagagaatcaatga gaTACGTGAGAACTGTAGTGAATtcacaggtcgtgatatg gaATTCACTACAGTTCTCACGTAtctacatatatattcct

EX103 FLOT2 chh295 gaTTTAACGTGATTGGAGTCCCGtctctcttttgtattcc chh296 gaCGGGACTCCAATCACGTTAAAtcaaagagaatcaatga chh297 gaCGAGACTCCAATCTCGTTAATtcacaggtcgtgatatg chh298 gaATTAACGAGATTGGAGTCTCGtctacatatatattcct EX104 FLOT2 chh299 gaTGGTCCAAGACAGTGCACGGTtctctcttttgtattcc chh300 gaACCGTGCACTGTCTTGGACCAtcaaagagaatcaatga chh301 gaACAGTGCACTGTCATGGACCTtcacaggtcgtgatatg chh302 gaAGGTCCATGACAGTGCACTGTtctacatatatattcct EX105: FLOT2(3) amiRNA

FLOT2 chh303 chh304 chh305 chh306

gaTTTCTCGGCACTCATAGCTCGtctctcttttgtattcc gaCGAGCTATGAGTGCCGAGAAAtcaaagagaatcaatga gaCGCGCTATGAGTGGCGAGAATtcacaggtcgtgatatg gaATTCTCGCCACTCATAGCGCGtctacatatatattcct

EX106 FLOT3 chh307 gaTACTAGTGAATCTCAGACGTGtctctcttttgtattcc chh308 gaCACGTCTGAGATTCACTAGTAtcaaagagaatcaatga chh309 gaCAAGTCTGAGATTGACTAGTTtcacaggtcgtgatatg

41

chh310 gaAACTAGTCAATCTCAGACTTGtctacatatatattcct EX107: FLOT2(3,4) amiRNA

FLOT3 chh312 chh313 chh314 chh315

gaTACTAGTGAATCTCAGACACGtctctcttttgtattcc gaCGTGTCTGAGATTCACTAGTAtcaaagagaatcaatga gaCGCGTCTGAGATTGACTAGTTtcacaggtcgtgatatg gaAACTAGTCAATCTCAGACGCGtctacatatatattcct

EX108 FLOT1 chh315 gaTAAATATTCATGACCCGCGACtctctcttttgtattcc chh316 gaGTCGCGGGTCATGAATATTTAtcaaagagaatcaatga chh317 gaGTAGCGGGTCATGTATATTTTtcacaggtcgtgatatg chh318 gaAAAATATACATGACCCGCTACtctacatatatattcct EX109 FLOT1 chh319 gaTATTGAAGCAACGAGGACGCGtctctcttttgtattcc chh320 gaCGCGTCCTCGTTGCTTCAATAtcaaagagaatcaatga chh321 gaCGAGTCCTCGTTGGTTCAATTtcacaggtcgtgatatg chh322 gaAATTGAACCAACGAGGACTCGtctacatatatattcct EX110: FLOT4 amiRNA

FLOT4 chh323 chh324 chh325 chh326

gaTAAAGGTGTAATTTACAGGCGtctctcttttgtattcc gaCGCCTGTAAATTACACCTTTAtcaaagagaatcaatga gaCGACTGTAAATTAGACCTTTTtcacaggtcgtgatatg gaAAAAGGTCTAATTTACAGTCGtctacatatatattcct

EX111 FLOT4 chh327 gaTGCACTTAGATACACCCGTTCtctctcttttgtattcc chh328 gaGAACGGGTGTATCTAAGTGCAtcaaagagaatcaatga chh329 gaGACCGGGTGTATCAAAGTGCTtcacaggtcgtgatatg chh330 gaAGCACTTTGATACACCCGGTCtctacatatatattcct EX112: FLOT1(2) amiRNA

FLOT1+2 chh331 chh332 chh333 chh334

gaTATAATCCGAATTGGTTCAGCtctctcttttgtattcc gaGCTGAACCAATTCGGATTATAtcaaagagaatcaatga gaGCCGAACCAATTCCGATTATTtcacaggtcgtgatatg gaAATAATCGGAATTGGTTCGGCtctacatatatattcct

EX116 None chh349 gaTAGCCATAGCTAACTACTTCCtctctcttttgtattcc chh350 gaGGAAGTAGTTAGCTATGGCTAtcaaagagaatcaatga chh351 gaGGCAGTAGTTAGCAATGGCTTtcacaggtcgtgatatg chh352 gaAAGCCATTGCTAACTACTGCCtctacatatatattcct EX117: empty vector

None chh353 chh354 chh355 chh356

gaTATCAATCTTCTGTCACTCTTtctctcttttgtattcc gaAAGAGTGACAGAAGATTGATAtcaaagagaatcaatga gaAAAAGTGACAGAACATTGATTtcacaggtcgtgatatg gaAATCAATGTTCTGTCACTTTTtctacatatatattcct

Table 2-4. amiRNA Construct Primers

42

Construct

Insert Template backbone vector

Primer Name

Primer sequence

pJG159 A (Sph-RB-P35S-RI)

pEGAD pCAMBIA 1300

oJG346 CGAGGCGCATGCCAAATGGACGAACGGATAAAC oJG347 GGTACCGGAAGCTTCGAGCTCTTAATTAAGGCCT oJG348 CGAAGCTTCCGGTACCCCGTCAACATGGTGGAGC oJG349 TCTAGAGAATTCGGATCCGTCCTCTCCAAATGAAATG pJG159 B (RI-osT-

P35S-XhoI) pCAMBIA

1300 oJG350 GGATCCGAATTCTCTAGACCCGATCGTTCAAACATTTG

oJG351 CTCGCGCTCGAGCTGCAGTCCTCTCCAAATGAAATGAA pCH010 eGFP pDG71 pJG159 chh050 AAAAGGATCCAAGAATTCAACCCGGGATGGTGAGCAAG

GGCGAGGAG chh051 AAAATCTAGATTACTTGTACAGCTCGTCCATG pCH010 NPTII pHELLS-

GATE8 pJG159 chh039 TTTTCTCGAGCACTCTCAATCCAAATAATCTGCA

chh040 TTTTCTCGAGTCAGAAGAACTCGTCAAGAAGGCG pCH035 FLOT2 ORF BAC

Mth2-115c19

pCH010 chh156 TTTTGAATTCATGAAAATTTACCGGGTCGCG chh172 TTTTCCCGGGAGAGCTTTTCTCAGATAAGGC

pCH118 FLOT4 genomic

BAC Mth2-115c19

pCH010 chh180 TTTCCCGGGATTCAAGTTTTTGTCAGGCAAGA chh181 TTTGGTACCTTCCCATGAACTTAACTCAATTG

pCH037 FLOT2 promoter

BAC Mth2-115c19

pMDC163 chh209 CACCTTGGCGGATATATGTGTGTGAT chh210 TCTTGATGATTTTGAGAAGAG

pCH038 FLOT3 promoter

BAC Mth2-115c19

pMDC163 chh211 CCACCCTCTAAAATCAGAATTGTCTG chh212 GTTGATTTTGGTTTGAATTTAG

pCH041 FLOT1 promoter

BAC Mth2-115c19

pMDC163 chh233 CACCGTCTTAATTAGGAGATGCAAGTA chh218 GTTGATAATGGTTTGAATTCGAGAAG

pCH042 FLOT4 promoter

BAC Mth2-115c19

pMDC163 chh232 CACCTTCCCATGAACTTAACTCAATTG chh220 CGTTGATTTTGATTTAATTTTTAAAAA

pQDN03 mCherry pRSET-B mCherry

pDG71 QDN01 TTTGGATCCACCATGGTGAGCAAGGGC

QDN02 TTTTCTAGATTACTTGTACAGCTCGTCCATGC

Table 2-5. Vector Construction

43

Chapter 3 CHAPTER 3: Localization of the symbiotic receptor kinases LYK3 and DMI2

ABSTRACT

Legume-rhizobia symbiosis initiates with plant recognition of the bacterial molecule

Nod Factor (NF). In Medicago truncatula, two receptor kinases, LYK3 and DMI2,

are known to be required for perception of the bacterial signal. LYK3 encodes a LysM-

family receptor required for bacterial entry into plant root hair cells. DMI2 encodes a

leucine-rich repeat receptor kinase that is required for early signaling events. We

report localization of GFP-tagged LYK3 and DMI2 prior to bacterial inoculation and

during symbiosis. In uninoculated root hairs, we found that both proteins have

punctate plasma membrane-associated distrubtions. Within minutes of bacterial

treatment, we observed an increase in DMI2:GFP-containing vesicles followed by a

rapid loss of DMI2:GFP signal. We did not observe DMI2:GFP on infection threads or

in nodule cells. We also observed an increase in LYK3:GFP-positive vesicles

following bacterial treatment but not until 6 hours post inoculation, and vesicles

persisted at 24 hours. We observed LYK3:GFP along infection threads in root hairs

but not associated with infection threads in mature nodules. Our data support genetic

evidence that DMI2 plays a role in signaling while LYK3 is involved in infection.

Our observation that LYK3:GFP infection thread association is restricted to root hair

cells suggest that infection thread growth in root hairs may involve different cellular

processes or receptors than infection of cortical cells.

44

INTRODUCTION Symbiosis between nitrogen-fixing bacteria and legume plants initiates with a signal

exchange between plant host and bacterium. Plants secrete compounds called

flavonoids into the surrounding soil. Flavonoids activate a Sinorhizobium meliloti

transcription factor NodD1 which upregulates expression of genes involved in

biosynthesis of a bacterial lipochitooligosaccharide called Nod Factor (NF) (Peck et

al., 2006). Medicago truncatula NF perception requires LysM-family receptors LYK3

and NFP. Other plant LysM receptors bind chitin (Iizasa et al., 2010) so LYK3 and

NFP are good candidates for receptors that directly bind the chitin backbone of

bacterial NF. NFP mutants have no measurable response to bacterial NF, while LYK3

mutants can perceive NF and initiate a number of preliminary events including

calcium spiking (Wais et al., 2000) and root hair tip growth, but form no infection

threads (Catoira et al., 2001; Smit et al., 2007). A leucine-rich repeat receptor kinase

DMI2 is genetically downstream of NFP (Catoira et al., 2000). These phenotypes

support a model where the NFP and LYK3 receptors bind NF and signal through

parallel pathways to initiate signaling events and bacterial entry into root hairs

respectively (Geurts et al., 2005; Smit et al., 2007).

Little is known about the cell biology of receptors during bacterial recognition

events or during infection. It is also unknown whether the receptors interact with one

another or if cross-talk is mediated downstream of the receptors. There is one report

that DMI2 is present on infection thread and cellular plasma membranes in nodules

(Limpens et al., 2005). When LYK3 was transiently expressed in Nicotiana

benthamiana, the protein appeared homogenous along the plasma membrane

(Lefebvre et al., 2010). We expressed GFP-tagged LYK3 and DMI2 by their native

promoters in the roots of M. truncatula. In uninoculated roots we observed that both

receptors had patchy distributions associated with the plasma membrane. After

bacterial treatment, DMI2:GFP and LYK3:GFP displayed distinct behaviors. Our

observations add to understanding of the function of these receptors during perception

of symbiotic bacteria and the role of bacterial perception during later stages of

symbiosis.

45

RESULTS Localization of symbiotic receptor kinases LYK3 and DMI2

To localize the LYK3 and DMI2 proteins, plants were stably transformed with a full

genomic copy of LYK3 (pLYK3:gLYK3) or DMI2 (pDMI2:gDMI2) translationally

fused to either GFP or an HASt dual-affinity tag (B. Riely and D. Cook, personal

communication). Root hair walls and other structures are known to display auto-

fluorescence; the HASt-tagged lines were used as controls for auto-fluorescence. The

hcl-1 mutant, which contains a point mutation in the predicted kinase domain of LYK3

(Smit et al., 2007), was transformed with the pLYK3:gLYK3:HASt and

pLYK3:gLYK3:GFP transgenes; two lines were recovered with each transgene. The

dmi2-1 mutant was transformed with the pDMI2:DMI2:GFP and

pDMI2:gDMI2:HASt transgenes; one line was recovered with each transgene. The

dmi2-1 mutant has a point mutation resulting in an early stop codon in the DMI2 open

reading frame and is a predicted null allele of DMI2 (Endre et al., 2002). In the

absence of the complementing transgenes, hcl-1 and dmi2-1 mutants form no nodules

or infection threads (Catoira et al., 2000; Catoira et al., 2001).

We confirmed that the LYK3 and DMI2 transgenes were able to complement

the hcl-1 and dmi2-1 mutant phenotypes by comparing nodulation and nitrogen

fixation to wildtype M. truncatula cv Jemalong A17 plants. All lines with the

exception of one pLYK3:gLYK3:HASt line (163.8) formed significantly fewer nodules

than wildtype plants (P < 0.01 by two-tailed t-test) (Figure 3-1A). We assessed

nitrogen fixation by indirect means by measuring the plants’ ability convert acetylene

to ethylene (Turner, 1980). We found that both pLYK3:gLYK3:HASt lines (163.5 and

46.10) and the pDMI2:gDMI2:GFP (63.8) had significantly reduced rates of acetylene

reduction per plant and per nodule (Figure 3-1B,C). The other lines had no significant

difference from wildtype plants in their ability to reduce acetylene. All lines tested

had some nitrogen fixation ability indicating that the DMI2 and LYK3 C-terminal

fusions are functional.

46

In concert with our attempt to localize GFP-tagged DMI2 and LYK3 in stable

transgenic lines, we used Agrobacterium rhizogenes-generated hairy roots transformed

with the gLYK3:GFP and gDMI2:GFP fusion proteins. We confirmed that when

introduced by hairy root transformation, the transgenes could complement the

nodulation defects in hcl and dmi2 mutants. We found that introduction of

Figure 3-1. LYK3 and DMI2 fusion proteins rescue mutant phenotypes Approximately 30 plants per genotype or transgenic line type were assayed for nodulation and acetylene reduction phenotypes at 21 dpi; error bars represent SEM. *P< 0.05 by two-tailed t-tests; n.d. not detected. In some cases, multiple transgenic lines were recovered with each construct; line numbers are in parentheses. (A) Average nodule number per plant. (B) Acetylene reduction assays showed that nodules on transgenic lines were able to fix nitrogen. (C) Adjusted acetylene reduction level per plant per nodule.

47

pLYK3:gLYK3:GFP into hairy roots restored nodulation in the hcl-1 allele as well as

hcl-2 and hcl-3 alleles (See Table 3-1 for a description of each mutant allele and

results of complementation assays). We found that introduction of

pDMI2:gDMI2:GFP into hairy roots restored nodulation to dmi2-1 as well as the

dmi2-3 and dmi2-4 mutants (Table 3-1).

Construct Genetic Background

Nature of mutation

Predicted effect on gene function

Hairy roots or Stable line

Nod+/ total plants

No Transgene A17 Wild type 36/36 No transgene hcl-1 (B56) Point mutation Non-functional

kinase domain 0/20

pLYK3:gLYK3:HASt hcl-1 (B56) Point mutation Non-functional kinase domain

Lines 46.10 and 163.8

22/29; 28/29

pLYK3:gLYK3:GFP hcl-1 (B56) Point mutation Non-functional kinase domain

Lines 22.3 and 26.1

28/30; 29/29

pLYK3:gLYK3:GFP A17 Wild type Hairy roots 3/5 pLYK3:gLYK3:GFP hcl-1 (B56) Point mutation Non-functional

kinase domain Hairy roots 3/5

pLYK3:gLYK3:GFP hcl-2 (W1) Point mutation in splice site

Loss of transcript; predicted null

Hairy roots 5/7

pLYK3:gLYK3:GFP hcl-3 (AF3) Point mutation Non-functional receptor domain

Hairy roots 1/2

No transgene dmi2-1 (TR25)

Frame shift Loss of transcript, predicted null

0/20

pDMI2:gDMI2:HASt dmi2-1 (TR25)

Frame shift Loss of transcript, predicted null

Line 73.9 27/28

pDMI2:gDMI2:GFP dmi2-1 (TR25)

Frame shift Loss of transcript, predicted null

Line 63.8 19/27

pDMI2:gDMI2:GFP A17 Wild type Hairy roots 5/7 pDMI2:gDMI2:GFP dmi2-1

(TR25) Frame shift Loss of transcript,

predicted null Hairy roots 8/15

pDMI2:gDMI2:GFP dmi2-3 (P1) Point mutation in splice site

Loss of exon 6 Hairy roots 1/3

pDMI2:gDMI2:GFP dmi2-4 (R38) Point mutation Non-functional kinase domain

Hairy roots 2/7

Table 3-1. Transgenes complement LYK3 and DMI2 mutants LYK3 and DMI2 transgenes were stably integrated or inserted via A. rhizogenes hairy roots into wildtype and mutant plants. Roots were scored for their ability to form nodules.

48

Both stable and hairy-root transgenics were used for LYK3:GFP localization

and yielded equivalent results. In uninoculated root hairs, we observed LYK3:GFP in

a punctate distribution at the extreme cell periphery in a gradient that was denser near

the growing tip (Figures 3-2 and 3-3). There was little co-localization of LYK3:GFP

with a cytoplasmic marker and few labeled cytoplasmic vesicles were visible (Figure

3-3). The LYK3:GFP signal followed the membrane after plasmolysis (Figure 3-4)

confirming that the labeled protein was not localized to the cell wall. These

observations suggest that majority of the LYK3:GFP signal is associated with the

plasma membrane. No signal was detectible in the LYK3:HASt transgenic lines. As

the signal was somewhat brighter in the LYK3:GFP (22.3) line (Table 3-1) and in

hairy roots in the hcl-2 background, these were used for subsequent localization

studies.

Figure 3-2. LYK3 has a punctate distribution in root hairs In uninoculated root hairs of the stable transgenic line 22.3 (hcl-1 mutant transformed with pLYK3:LYK3:GFP). The GFP signal was most evident in emerging (A) and elongating (B) root hairs. The signal was punctate and densest near the growing root hair tips. Images are maximum intensity projections of ~50 z-sections taken at 0.3µm increments. Scale: 10 µm.

49

Figure 3-3. LYK3:GFP has little overlap with a cytoplasmic marker in root hairs Hairy roots were generated in the hcl-2 mutant background with a plasmid containing the genomic LYK3 fused to GFP (pLYK3:gLYK3:GFP) and dsRed which marks the cytoplasm and nucleus (Curtis and Grossniklaus, 2003). The top half of each panel shows single z-slices through root hairs; the bottom halves show maximum intensity projections of ~50 z-sections taken at 0.3µm increments. Scale: 10 µm. LYK3:GFP has a punctate distribution (A) emerging, (B) elongating and (C) fully elongated root hairs.

50

Figure 3-4. LYK3:GFP signal stays with the membrane upon plasmolysis Roots in the transgenic line 22.3 were treated with 0.5 M sodium chloride for 10 minutes until the plasma membrane (arrow) had visibly retracted from the cell wall (arrowhead). (A) Single optical section of plasmolysed root hair. (B) Maximum intensity projection of 100 z-sections taken at 0.3µm increments showing reconstruction of the root hair cell. (C) DIC image of plasmolysed root hair. Scale: 10 µm.

DMI2:GFP signal was visible in hairy roots but not in the single available

stable transgenic line. In hairy roots in all dmi2 mutant backgrounds tested (Table 3-

1), DMI2:GFP had a punctate distribution at the extreme cell periphery similar to

LYK3:GFP (Figure 3-5). However, the signal gradient observed with LYK3:GFP,

with the densest signal at the root hair tip, was not observed with DMI2:GFP. There

was little co-localization of DMI2:GFP with a cytoplasmic marker and few

intracellular vesicles were evident (Figure 3-5).

51

Figure 3-5. DMI2 has a punctate distribution associated with root hair plasma membranes Hairy roots were generated in the dmi2-1 mutant background with a plasmid containing the genomic DMI2 fused to GFP (pDMI2:gDMI2:GFP). The top half of each panel shows single z-slices through root hairs; the bottom halves show maximum intensity projections of ~50 z-sections taken at 0.3µm increments. Scale: 10 µm. Plasmids for hairy root transformation contain a dsRed marker that marks the plant cytoplasm and nucleus enabling screening for transgenic roots (Curtis and Grossniklaus, 2003). DMI2:GFP has a patchy appearance in (A) emerging, (B) elongating and (C) fully elongated root hairs.

52

LYK3:GFP localizes to intracellular vesicles and infection threads post

inoculation

Few LYK3:GFP vesicles were visible in the cytoplasm in uninoculated root hairs

(Figure 3-4 and Figure 3-6A). Following treatment of roots with an S. meliloti strain

producing constitutive high levels of NF (Fisher et al., 1988), an increase in

LYK3:GFP intracellular vesicles was evident by 6 hours post inoculation (hpi) (Figure

3-6B) and persisted at 24 hpi (Figure 3-6C). An increase in vesicles was also

observed with 1 nM purified S. meliloti NF at 24 hpi, although the response was less

robust (Figure 3-6D). No consistent increase in vesicles was evident at 0.5 or 3 hpi

(not shown).

After bacterial treatment, LYK3:GFP signal was visible on the membrane

surrounding initiating and elongating infection threads in root hairs (Figure 3-6E to

N). By analogy to the membrane localization of LYK3:GFP in plasmolysed root

hairs (Figure 3-3), we inferred that LYK3 localized to infection thread membranes and

not the infection thread wall. No signal was associated with infection threads of

control plants expressing LYK3:HASt (Figure 3-6F). No signal was visible along

infection thread membranes in cortical cell layers at 4, 7, 10 and 14 dpi (Figure 3-7).

We observed pronounced auto-fluorescence associated with older infection threads in

the infection zone in control LYK3:HASt nodules (Figure 3-7).

53

54

Figure 3-6. LYK3 localizes to intracellular vesicles and infection threads post inoculation (A-F) M. truncatula stable lines transformed with pLYK3:LYK3:GFP (A-E) or pLYK3:LYK3:HASt (F). (A) In uninoculated roots, LYK3:GFP localized to the cell periphery and few intracellular vesicles were visible. (B) By 6 hours post inoculation with rhizobia, intracellular LYK3:GFP vesicles were visible. (C) LYK3:GFP vesicles persisted at 24 hours post inoculation. (D) Treatment with NF also increased appearance of vesicles, although less robustly than bacterial treatment. (A-D) are single optical sections. (E) After inoculation LYK3:GFP (green) was visible on growing infection thread membranes at 4 dpi (bacteria are expressing ptrp:mCherry and shown in red). (F) No GFP signal was visible on infection threads of plants expressing LYK3:HASt. (E-F) are maximum intensity projections of ~50 optical sections taken at 0.3 µm increments. Arrows mark infection thread membranes; arrowheads point to bacterial colonies in curled root hairs. (G-N) Introduction of pLYK3:gLYK3:GFP into hairy roots complemented the infection defect in the LYK3 mutant hcl-2. Arrows mark infection thread membranes; arrowheads point to bacterial colonies in curled root hairs. (G) LYK3:GFP was visible at the sites of initiating and (K) elongating infection threads. (H, L) The inserted plasmid contains pUbq:dsRed which marked the cytoplasm and nucleus (*). (I,M) Plants were inoculated with S. meliloti expressing ptrp:CFP. (J) is an overlay of (G-I) and (N) is an overlay of (K-M). (G-J) are single optical sections; (K-N) are maximum intensity z-projections of ~50 optical sections taken at 0.3 µm increments. Scale bars: 10 µm.

55

Figure 3-7. LYK3:GFP is not visible on infection threads in interior nodule cells Transgenic roots expressing either LYK3:GFP (line 22.3; bottom panels) or LYK3:HASt (line 46.10; top panels) were inoculated with S. meliloti expressing ptrp:mCherry. Images show infection threads (arrows) in the infection zone of a 10 day old nodule where bacterial release was evident (*) but little differentiation had occurred. No signal that was consistently different than auto-fluorescence was observed on infection threads in mature nodules in the LYK3:GFP-expressing plants. Images are maximum intensity z-projections of ~50 optical sections taken at 0.3 µm increments. Scale bars: 10 µm.

DMI2:GFP localizes to intracellular vesicles post-inoculation

Like uninoculated pLYK3:gLYK3:GFP-expressing root hairs, the majority of the

DMI2:GFP signal localized to the extreme cell periphery and not to intracellular

vesicles (Figures 3-5 and 3-8A). As early as 30 minutes post inoculation with either S.

meliloti or purified NF, a DMI2:GFP signal was evident on numerous intracellular

structures (Figure 3-8B). By 1 dpi, little signal was associated with either the plasma

membrane or cytosolic vesicles (Figure 3-8C). A faint cytoplasmic GFP signal was

visible at this time. No DMI2:GFP signal was detectible on infection threads in root

hairs (Figure 3-8D) or infection threads in nodules (Figure 3-9).

56

57

Figure 3-8. After bacterial treatment, DMI2:GFP localizes to intracellular vesicles Hairy roots were generated with pDMI2:gDMI2:GFP on the dmi2-1 mutant background; dsRed marks the cell cytoplasm and nucleus (*). (A) In uninoculated root hairs, the majority of the DMI2:GFP signal localizes to the extreme cell periphery and little DMI2:GFP signal co-localizes with a cytoplasmic marker (red). (B) By 30 minutes post treatment with NF, there is an increase in DMI2:GFP cytoplasmic vesicles. (C) By 1 day post treatment with NF, very little DMI2:GFP signal is visible along the plasma membrane or cytosolic vesicles. (D) 4 days post inoculation with S. meliloti expressing ptrp:CFP, no DMI2:GFP signal is visible along infection thread membranes (arrow). (A and B) are single optical sections; (C-D) are maximum intensity z-projections of ~50 optical sections taken at 0.3 µm increments. Scale bars: 10 µm.

Figure 3-9. DMI2:GFP is not visible on infection threads in interior nodule cells Transgenic hairy roots generated on dmi2-1 mutants expressing either DMI2:HASt (top panels) or DMI2:GFP (bottom panels) were inoculated with S. meliloti expressing ptrp:CFP. Images show infection threads (arrows) in the infection zone of a 10 day old nodule where bacterial release was evident (asterisk) but little differentiation had occurred. No signal that was consistently different than auto-fluorescence was observed in the DMI2:GFP-expressing plants. Images are maximum intensity z-projections of ~50 optical sections taken at 0.3 µm increments. Scale bars: 10 µm.

58

DISCUSSION We demonstrated that LYK3 and DMI2 N-terminal fusions can complement infection,

nodulation and nitrogen fixation defects in lyk3 and dmi2 mutants. We show that the

nodules on stable transgenic lines can fix nitrogen, but that some lines have reduced

fixation compared to wild type nodules (Figure 3-1). This indicates that the fusion

proteins were functional; the most likely explanation for partial complementation is

that the transgenes did not reflect endogenous expression levels due to positional

effects. The formation of nodules with reduced fixation suggests that LYK3 and DMI2

are required at multiple stages or continually during symbiosis, and not just during

initiation of symbiosis. This is consistent with previous characterizations of partial

loss of function mutants and RNAi lines showing that both LYK3 and DMI2 are

required for infection to progress (Limpens et al., 2005; Smit et al., 2007).

LYK3 is required for infection thread initiation and continued infection thread

growth (Catoira et al., 2001; Smit et al., 2007). The presence of LYK3:GFP at the

plasma membrane prior to interaction with bacteria, and the persistence of LYK3 on

infection threads, are consistent with these genetic data (Figures 3-2, 3-3 and 3-6).

We observed that LYK3:GFP is associated with intracellular vesicles post inoculation.

The origin of these vesicles is unknown; it is possible that they are the result of

endocytosis of LYK3:GFP from the membrane or that they are the result of new

protein synthesis and packaging into secretory compartments. LYK3 eventually

localizes to infection threads in root hairs; determining the origin of LYK3-containing

vesicles will help elucidate both how proteins are trafficked to infection threads during

symbiosis, and the mechanism of LYK3-mediated infection.

While LYK3:GFP was present on infection threads in root hairs, we could not

detect LYK3:GFP along infection thread membranes in interior nodule cells (Figure 3-

7). This lack of signal is consistent with previous reports that LYK3 expression is

weak to absent in the infection zone of mature nodules (Limpens et al., 2005;

Mbengue et al., 2010). The apparent absence of the LYK3 protein associated with

interior nodule cells is consistent with several interpretations: (a) low levels of LYK3

59

are sufficient for NF perception in nodules, (b) LYK3 may not be required for later

stages of infection, and/or (c) a different receptor is involved.

The observed behavior of DMI2:GFP was distinct from that of LYK3:GFP.

While LYK3 vesicles were evident no earlier than 6 hpi and persisted at 24 hpi, DMI2

vesicles were evident within 30 minutes of bacterial or NF treatment (Figure 3-8).

These vesicles did not persist and little to no DMI2:GFP signal was visible in root

hairs or in infected cells beyond 1 dpi. The rapid appearance of DMI2:GFP vesicles

upon NF application followed by signal loss is reminiscent of the ligand-dependent

endocytosis observed with the plant flagellin receptor FLS2 (Robatzek et al., 2006).

DMI2 is not predicted to bind NF; if the observed vesicles are in fact the result of

endocytosis, the most likely explanation is that NFP receptor (which itself lacks a

predicted kinase domain) binds NF and then interacts with DMI2, and NFP and DMI2

are internalized as a complex. This sort of receptor cooperation has been shown for

the BAK1 receptor like kinase and several receptor partners including the

brassinosteroid receptor BRI1 (Li et al., 2002; Nam and Li, 2002) and flagellin

receptor FLS2 (Chinchilla et al., 2007). Future studies are needed to determine if the

increase in DMI2:GFP vesicles are in fact the result of endocytosis of the membrane

signal, and whether this depends on NFP. Exploring the origin of DMI2 vesicles will

help elucidate the mechanism by which plants perceive and transduce the NF signal.

Our DMI2:GFP localization data conflict with a previous report that

DMI2:GFP is visible along infection threads and plasma membranes in infected

nodule cells (Limpens et al., 2005). Our experimental design closely mirrored the

Limpens et al. (2005) study; in both experiments, DMI2:GFP driven by its native

promoter was introduced into the dmi2-1 mutant background via A. rhizogenes-

mediated hairy roots. The prior study reported using a laser scanning confocal for

their localization while we used a more sensitive spinning-disk confocal; it is unlikely

that sensitivity of the instrument can account for the absence of signal in our

experiment. Additionally, the previous study did not report a DMI2:GFP signal in

root hairs prior to inoculation, again suggesting that our methods are equally or more

sensitive. A few subtle differences in the experimental designs exist. First, Limpens

60

et al. (2005) used a 2.2 kb promoter instead of our 2.0 kb promoter; it is possible that

there is an enhancer element in the missing 200 bps that is important for DMI2

expression. Second, Limpens et al. (2005) used a slightly different hairy root

transformation method; it is feasible that their method allowed for recovery of roots

with stronger expression of the DMI2:GFP transgene. A final possibility is that what

Limpens et al. (2005) reported as signal was actually auto-fluorescence. No controls

for auto-fluorescence were used in their study, and we observed substantial auto-

fluorescence on older infection threads (Figure 3-9). Resolving these issues will help

establish whether DMI2 functions locally to regulate infection thread growth and

bacterial release (as proposed by Limpens et al., 2005) or more globally to help

establish and monitor the progress of symbiosis (Endre et al., 2002; Bersoult et al.,

2005).

We demonstrated that symbiotic receptor-like kinases have patchy

distributions associated with plant plasma membranes that are reminiscent of

membrane raft signaling domains in animals (Lingwood and Simons, 2010). Our

findings suggest that compartmentalization of membrane proteins may be important

for signaling in plants. Prior to inoculation, the similarity in appearance and

distribution of LYK3:GFP and DMI2:GFP signals raises the possibility that the

proteins are co-distributed and possibly form a symbiotic receptor complex. The

differences in observed behaviors after inoculation support genetic data suggesting

that DMI2 functions as a component of the NF perception signaling pathway (Catoira

et al., 2000; Bersoult et al., 2005) while LYK3 is involved in infection (Smit et al.,

2007). Our studies are the first steps in elucidating the localization and regulation of

symbiotic receptor kinases before and during symbiosis. These studies complement a

decade of genetics that established the roles of receptor kinase genes in early

symbiotic events.

61

MATERIALS AND METHODS Plant growth and bacterial treatments.

Medicago truncatula Gaertner cv Jemalong, cv Jemalong A17 (an inbred line of

Jemalong), and mutant lines hcl-1, hcl-2, and hcl-3 (Catoira et al., 2001), dmi2-1

(Catoira et al., 2000), dmi2-3 and dmi2-4 (Endre et al., 2002) and transgenic lines

were grown, inoculated and harvested as described (Mitra and Long, 2004). Bacterial

growth and inoculations were done as described in Chapter 2.

Generation of LYK3 and DMI2 translational fusion constructs and transgenic

plants

pLYK3:gLYK3:GFP and :HASt and pDMI2:gDMI2:GFP and :HASt constructs and

transgenic lines were obtained from Brendan Riely in Doug Cook’s Lab (University of

California, Davis; personal communication).

Fluorescent bacterial plasmid construct design

pQDN01 was constructed by replacing GFP in pDG71 (Gage, 2002) with CFP.

pQDN03 was constructed by replacing GFP in pDG71 with mCherry (Haney and

Long, 2010). Both mCherry and CFP were amplified using forward primer

TTTGGATCCACCATGGTGAGCAAGGGC and reverse primer

TTTTCTAGATTACTTGTACAGCTCGTCCATGC. PCR products and were

digested with BamHI and XbaI and ligated into the corresponding sites in pDG71.

Acetylene reductions and hairy root transformation

were conducted as described in Chapter 2 materials and methods.

Confocal Microscopy

For 24 hpi localization studies, plants were inoculated with Rm1021 over-expressing

NodD3 from the plasmid pRmE65 (Fisher et al., 1988). For infection thread

localization studies, plants were inoculated with Rm1021 constitutively expressing

mCherry or CFP from the plasmids pQDN03 or pQDN01 pretreated for ~2 hours with

62

3 µM luteolin. The signal was brighter in the 22.3 LYK3:GFP than in the 46.10 line

possible likely due to positional effects of the transgene. The 22.3 line was used for

localization studies.

Root segments and nodule hand sections (for imaging the infection zone) were

excised and mounted in BNM buffer pH 6.5. Spinning disk confocal microscopy was

performed on a system described previously in Gutierrez et al. (2009) using a

100X/1.4 NA oil immersion objective for root hair membrane imaging or a 63X/1.3

NA glycerol immersion objective for infection thread and nodule imaging. CFP, GFP

and dsRed/mCherry were excited at 442, 491 nm and 561 nm, respectively, by solid-

state lasers; emission filtering was accomplished with band pass filters (470/40 for

CFP, 530/50 nm for GFP, and 640/50 nm for mCherry/dsRed; Chroma Technology).

Maximum intensity z-projections of root hairs are from ~100 images taken at

increments of 0.3 μms (MCL NanoDrive). Time-lapse images were taken at 2s

increments. Stacks were processed using ImageJ software (http://rsbweb.nih.gov/ij/).

Typical exposure times were 1000 ms for GFP, 300 ms for dsRed, 500 ms for

mCherry, and 500 ms for CFP.

63

Chapter 4 CHAPTER 4: Co-localization of flotillin protein FLOT4 with the symbiotic receptor LYK3

ABSTRACT In response to signals, proteins with patchy distributions in animal membranes

redistribute laterally, a previously unreported phenomenon in plants. A Medicago

truncatula flotillin protein, FLOT4, has a punctate plasma membrane distribution and

is required for infection by the nitrogen-fixing symbiotic bacterium Sinorhizobium

meliloti. We show that FLOT4 puncta density is altered in a predicted dead kinase

mutant of the symbiotic receptor LYK3. Like FLOT4, LYK3 has a patchy plasma

membrane distribution and localizes to infection thread membranes. In buffer-treated

control roots expressing tagged LYK3 and FLOT4, FLOT4 puncta are relatively stable

while LYK3 puncta are dynamic; the two labeled proteins show relatively little co-

localization. Bacterial treatment causes an increase in FLOT4 and LYK3 co-

localization, and both proteins occupy positionally stable plasma membrane domains.

Our work indicates that plant membrane protein arrangement and dynamics are altered

in response to symbiotic bacteria.

64

INTRODUCTION Proteins, sterols and lipids are often heterogeneously distributed in cellular plasma

membranes, defining domains of varying size. Studies of animals and fungal cells

show that extracellular stimuli and changes in membrane potential elicit changes in

microdomain structure and composition (Giri et al., 2007; Grossmann et al., 2007).

Emerging evidence suggests that some plant membrane components also have patchy

distributions (Homann et al., 2007; Gutierrez et al., 2009; Raffaele et al., 2009; Haney

and Long, 2010). How plant membrane proteins are organized and the significance of

lateral compartmentalization has yet to be established except by analogy to animals

and fungi. Legume-rhizobia symbioses provide a model for exploring changes in

membrane protein distribution during signal perception. In this system, membrane

protein distribution and dynamics can be monitored in an intact live host, abundant

molecular and genetic tools are available, and there is an extensive body of work

establishing a clear sequence of distinct cellular behaviors for early plant responses to

bacteria.

Recent studies implicated the flotillin proteins (FLOT) and a remorin protein

(SymREM) in symbiotic plant-microbe interactions (Haney and Long, 2010; Lefebvre

et al., 2010). FLOT2 and FLOT4 function non-redundantly during symbiosis between

Medicago truncatula and its bacterial symbiont Sinorhizobium meliloti (Haney and

Long, 2010). Fluorescent protein fusions to FLOT2 and FLOT4 have a punctate

plasma membrane distribution. Both FLOT4:GFP and SymREM localize to host-

derived infection structures called infection threads and are required for normal

infection thread growth. FLOT4:GFP redistributes after bacterial inoculation to form

a bright cap at the root hair cell tip (Haney and Long, 2010) suggesting that perception

of symbiotic bacteria alters membrane protein distribution.

Legumes are able to recognize rhizobial signaling molecules known as Nod

Factors (NFs). NFs consist of a chitin backbone with several species-specific

modifications (Roche et al., 1991a). NF perception and signaling in M. truncatula is

dependent on the receptors NFP, LYK3 and DMI2 (Catoira et al., 2000). NFP and

LYK3 encode LysM-type receptors that are hypothesized to bind bacterially secreted

65

NFs (Amor et al., 2003; Smit et al., 2007; Lefebvre et al., 2010); LysM-family

receptors bind chitin in Arabidopsis (Iizasa et al., 2010). DMI2 is a leucine-rich

repeat receptor kinase predicted to act downstream of NFP (Catoira et al., 2000). NFP

and DMI2 mutants are impaired in nearly all responses to symbiotic bacteria (Catoira

et al., 2000) whereas LYK3 mutants (also known as hcl) are impaired in infection

(Catoira et al., 2001; Smit et al., 2007).

Using the patchy distribution of FLOT4:GFP (Chapter 2), we explored the role

of signal perception (via NFP, LYK3 and DMI2) in regulating organization of

membrane proteins. While the function of FLOT4 distribution is not known, it can

serve as a scorable marker for membrane organization and can be used as a phenotype

to assess the effect of genetic changes on membrane structure. We found that the

density of FLOT4 puncta is decreased in a predicted dead kinase mutant of LYK3.

Like FLOT4, tagged LYK3 has a patchy distribution in plant membranes, forming

puncta at or below the limit of optical resolution. LYK3 puncta undergo a shift in

dynamics from mobile to immobile after treatment with symbiotic bacteria. Immobile

LYK3 puncta co-localize with FLOT4 after bacterial treatment. These results show

that plant membrane proteins undergo complex lateral reorganization in response to a

signal.

66

RESULTS A change in FLOT4 distribution is associated with rhizobia-triggered re-

initiation of root hair growth

Prior to inoculation, FLOT4:GFP localizes to puncta that are evenly distributed along

root hair plasma membranes; by 24 hours post inoculation FLOT4 is distributed in a

cap at the tip of some elongating root hairs (Haney and Long, 2010). To explore the

timing of these events in more detail, we repeated these experiments at 1, 6, 12, 18,

24, and 36 hours post inoculation (hpi). We found that the tip localization was

observed in root hairs that had re-initiated directional growth but had not formed a full

curl (Figure 4-1). Root hair responses to bacteria are asynchronous; nonetheless we

were able to assign these events primarily to the interval between 12 and 24 hpi. We

also found that in responding root hairs, FLOT4:GFP puncta appear dimmer and more

diffuse (Figure 4-1). By 36 hours, many root hairs had formed full curls and tip

localization was less apparent, possibly due to auto-fluorescence in the inner portion

of the curl (Figure 4-1, right panel).

Figure 4-1. Redistribution of FLOT4 during re-initiation of root hair tip growth Hairy roots expressing pFLOT4:gFLOT4:GFP were observed at 1, 4, 6, 12, 24, and 36 hours post inoculation. Tip localization of FLOT4:GFP was observed in root hairs that had re-initiated directional growth but not formed a full curl; root hairs in this stage were primarily observed between 12 and 24 hours post inoculation with S. meliloti Rm1021 over-expressing NodD3. At least 10 root hairs on 5 roots were observed at each time point. Images are maximum intensity projections of ~50 optical sections taken at 0.3 µm increments. Scale bar: 10 µm.

67

Over-expression of FLOT2 results in increased FLOT4 polarity

Since GFP-tagged FLOT2 and FLOT4 have similar localizations in root hairs but

differ in epidermal cells (Chapter 2), we explored the degree of co-distribution of

tagged FLOT2 and FLOT4 proteins. We used Agrobacterium rhizogenes to generate

A17 hairy roots co-transformed with pFLOT4:gFLOT4:GFP and

35S:gFLOT2:mCherry (FLOT2 was not visible under its native promoter). In roots

with visible green and red puncta, FLOT4:GFP had an increase in polarity compared

to roots transformed with just FLOT4 alone (Figure 4-2A and B). In root hair cells,

FLOT2:mCherry and FLOT4:GFP puncta had a high degree of overlap. We

quantified the overlap in three dimensional space and found a Pearson’s correlation

coefficient (r) of 0.73±0.06 (n=12 root hairs from 4 plants; Figure 4-2C). Post

inoculation, we observed a decrease in overlap of FLOT2 and FLOT4 puncta in root

hairs that had reinitiated directional growth and now r=0.45±0.12 (n=15 root hairs

from 3 plants; Figure 4-2D; P=0.0004). We occasionally observed tip localization of

the FLOT2:mCherry signal in root hairs that have reinitiated growth, which was not

observed in plants transformed with FLOT2:GFP (Chapter 2) or FLOT2:mCherry

alone.

68

69

Figure 4-2. Co-expression of FLOT2:GFP and FLOT4:mCherry (A) In uninoculated epidermal cells, FLOT4:GFP was evenly distributed along the plasma membrane and FLOT2:mCherry was polarly localized (arrows). Images are single optical sections; scale bar: 10 µm. (B-D) Hairy roots co-expressing pFLOT4:gFLOT4:GFP and p35S:gFLOT2:mCherry. Images in (B) are single optical sections of epidermal cells; (C-D) are maximum intensity projections of ~50 optical sections taken at 0.3 µm increments. Scale bars: 10 µm. (B) In uninoculated epidermal cells, an increase in polar distribution of FLOT4:mCherry was observed (arrows). (C) FLOT4:GFP and FLOT2:mCherry puncta co-localize in uninoculated root hairs. (D) Upon inoculation, there is a lower degree of co-localization in root hairs that have re-initiated directional growth and there is an increase in signal from both proteins at root hair tips (arrows).

FLOT4 mis-localizes in a LYK3 mutant

Early plant responses to bacteria and Nod Factor, including re-initiation of root hair

growth, depend on NFP and LYK3 pathways. To determine if these pathways are also

required for FLOT4 redistribution in response to S. meliloti, we expressed

FLOT4:GFP in mutant backgrounds of the symbiotic receptors DMI2, NFP, and

LYK3. We found that in the absence of bacteria, the density of FLOT4 puncta

decreased in epidermal cells of the LYK3 mutant hcl-1 (predicted dead kinase allele)

but was unaffected in nfp (predicted null allele) or dmi2-4 (predicted dead kinase)

genetic backgrounds (Figure 4-3A through D, I). In wildtype plants, FLOT4 puncta

are relatively evenly dispersed along cell membranes of epidermal cells and root hairs

(Haney and Long, 2010). There was a slight increase in polar localization of

FLOT4:GFP puncta in all three mutant backgrounds (Figure 4-3J; P<0.01). By

contrast, FLOT2:GFP, which normally shows marked polarity in epidermal cells but

not root hairs, had no decrease in spot density or increase in polar localization when

expressed in the hcl-1 background (Figure 4-3G and H). Thus, increased polar

localization is specific to FLOT4, and mis-localization of FLOT4 is not due to a

general perturbation of membrane proteins in the hcl-1 mutant. We conclude that prior

to bacterial inoculation, FLOT4 distribution is partially dependent on symbiotic

receptors while FLOT2 is not.

The hcl-1 mutant allele harbors a single-base substitution within the highly

conserved ATP binding pocket of the LYK3 kinase domain, a change that is predicted

70

to abolish kinase activity (Smit et al., 2007). By contrast, the hcl-2 and hcl-4 alleles

contain mutations in first intron splice sites and display reduced (hcl-4) or no (hcl-2)

LYK3 transcript (Smit et al., 2007). We tested if decreased FLOT4 puncta density was

specific to the hcl-1 allele or if it also occurred in the LYK3 splice mutants. The

density of FLOT4:GFP puncta in hcl-2 and hcl-4 was indistinguishable from wild type

roots (Figure 4-3E,F,I and J). We also assessed FLOT4 distribution and found

FLOT4:GFP was significantly more polar in hcl-2 while localization in hcl-4 was

indistinguishable from wild type roots (Figure 4-3J). The degree of increase in FLOT4

polar localization correlates with the strength of the symbiotic defect suggesting that

FLOT4 localization depends on the activity of LYK3 (Smit et al., 2007).

71

Figure 4-3. FLOT4 mis-localizes in roots carrying mutations in a symbiotic receptor (A-F) Hairy roots transformed with pFLOT4:gFLOT4:GFP; images are maximum intensity z-projections of ~45 optical sections taken at 0.3 µm increments. (A) FLOT4:GFP puncta in epidermal cells of wild type (A17), (B) hcl-1, (C) dmi2-4, (D) nfp-1 (E) hcl-2 or (F) hcl-4 roots. Arrows point to cells with polar protein localization. (G-H) Epidermal cells of hairy roots transformed with 35S:gFLOT2:GFP (images are single optical sections) in (G) wild type (A17) or (H) hcl-1 roots. (I) Decreased spot density was specific to FLOT4:GFP in the hcl-1 mutant background. (J) Polar localization was approximated by the ratio of apical cell membrane signal density to abaxial membrane signal density (see methods). Increased polar localization was found for FLOT4:GFP when expressed in hcl-1, hcl-2, dmi2-4 and nfp mutants. (I-J) Maximum intensity z-projections of ~45 optical sections taken at 0.3 µm increments were used for analyses. Error bars represent ± SEM; *P<0.01. Scale bars: 10 µm.

FLOT4 and LYK3 have increased co-localization after bacterial inoculation

FLOT4 and LYK3 have similar RNAi phenotypes, gene expression patterns, and

protein localization, suggesting they may function cooperatively to mediate symbiotic

infection and that FLOT4 and LYK3 membrane puncta may be co-distributed (Smit et

al., 2007; Haney and Long, 2010; Mbengue et al., 2010). We generated hairy roots

expressing pFLOT4:gFLOT4:mCherry in wild type plants, the hcl-1 mutant, or the

hcl-1 mutant stably transformed with pLYK3:gLYK3:GFP. The hcl-1 mutant displayed

both a decrease in density of FLOT4:mCherry puncta and a polarity defect; the

pLYK3:gLYK3:GFP transgene complemented only the density phenotype (Figure 4-

4).

72

Figure 4-4. LYK3:GFP complements the decrease in FLOT4 puncta density in the hcl-1 mutant (A-C) Hairy roots expressing pFLOT4:gFLOT4:mCherry were generated on wild type A17 plants, hcl-1 mutant plants or the hcl-1 mutant stably transformed with pLYK3:gLYK3:GFP. Maximum intensity z-projections of ~45 optical sections taken at 0.3 µm increments were used for analyses. Scale bar: 10 µm. (A) FLOT4:mCherry localizes to membrane puncta in A17 plants. (B) In the hcl-1 mutant, FLOT4:mCherry has a lower density of puncta and has increased polarity. (C) The LYK3:GFP transgene complements the decrease in density of FLOT4 puncta in an hcl-1 mutant background. (D) Quantification of localization shows that LYK3:GFP rescues the decrease in FLOT4 puncta but not polarity. (a vs. b P < 0.05 by two-tailed t-test).

In buffer-treated root hairs, FLOT4:mCherry and LYK3:GFP showed a limited

overlap in distribution but had distinct dynamic behaviors (Figures 4-5 and 4-6, left

panels). Using 3-D image volumes acquired at the root hair cell tip, we calculated

Pearson’s correlation coefficients (r) in voxels (Costes et al., 2004). In buffer-treated

root hairs, r=0.15±0.03, indicating that FLOT4 and LYK3 co-localize only slightly

more often than is predicted by an uncorrelated distribution of the proteins. Time-

lapse imaging revealed that bright FLOT4 puncta were relatively stable while the

majority of LYK3 puncta were dynamic (Figure 4-6A,B, and C). Intensities from

FLOT4 and LYK3 signals along linear transects of the time-averaged images show

that in the absence of bacteria there is little correlation of average LYK3 and FLOT4

position and intensity (Figure 4-6D,E).

Bacterial treatment of root hair cells had a pronounced effect on FLOT4 and

LYK3 co-localization at 24 hours (Figure 4-5, right panels). In cells that reinitiated tip

growth FLOT4 and LYK3 co-localization rose sharply (Figure 4-5C; r=0.66±0.03;

P=5x10-15). In inoculated root hairs that had not reinitiated tip growth (swollen or no

73

visible response), we observed an increase in co-localization compared to buffer

treated roots, although to a lesser degree (r=0.40±0.05; P=1x10-4). As observed with

FLOT4:GFP (Figure 4-1; Haney and Long, 2010), FLOT4:mCherry became

distributed in more spots by 24 hpi and redistributed to form a cap at the cell tip

(Figure 4-5A).

After bacterial treatment, the dynamics of LYK3:GFP also changed

significantly in root hairs that had re-initiated tip growth. The LYK3:GFP signal

shifted from motile to relatively stable puncta, and both the positions and relative

intensities of stable LYK3:GFP puncta were well correlated with FLOT4:mCherry

puncta (Figure 4-6, compare left and right panels). LYK3:GFP vesicles were evident

in the cytoplasm of these root hairs, but these vesicles were not marked by

FLOT4:mCherry (Figure 4-7).

74

Figure 4-5. LYK3 and FLOT4 co-localize in inoculated root hairs in 3-D space (A) Co-distributions of FLOT4:mCherry and LYK3:GFP signals in 3-D space; z-stacks were obtained at 0.3 µm increments from the top 15 µms of root hairs. (B) Higher magnification of images in (A). (C) Pearson’s correlation coefficients (r) for 3-D voxel intensities were calculated from 2-D correlation plots (Costes et al., 2004). Left panels: buffer-treated root hairs (r=0.15±0.03; n=23 root hairs on 4 plants). Right panels: 24 hours after bacterial treatment a significant increase in co-distribution was observed (r=0.66±0.03; n=22 root hairs on 3 plants; P=5x10-15). Maximum intensity projections, correlation plots, and r-values of representative root hairs are shown.

75

Figure 4-6. After inoculation, LYK3 puncta shift from dynamic to stable Time-series images of FLOT4 and LYK3 after buffer or bacterial treatment acquired at 2s intervals for 180s. (A) Single frame shows that the puncta distribution of LYK3 and FLOT4 is maintained in the absence or presence of bacteria (B) 90-frame averaged images are shown; diffuse signals are indicative of mobile puncta while discrete spots designate stable puncta.

76

(C) Kymographs of intensities in 90-frame time-series images (dashed blue line in B). In the absence of bacteria, LYK3 was dynamic and individual puncta were unstable, which produced an unstructured pattern in the kymograph. FLOT4 puncta were relatively stable and yielded vertical streaks. In the presence of bacteria, both LYK3 and FLOT4 puncta were stable and created vertical streaks in the kymographs. (A-C) Scale bars: 5 µm. (D) Signal intensities from FLOT4 (red) and LYK3 (green) signals along linear transects of the time-averaged images (dashed blue lines) are shown graphically. In the absence of bacteria there is little correlation of average LYK3 and FLOT4 position and intensity (R2=0.27±0.06; n=12 transects on 3 plants). With bacterial treatment, both the position and the relative intensity of the puncta are correlated (R2=0.85±0.02; n=16 transects on 4 plants; P=1x10-10). (E) Slope vs. intensity plots for charts in (B) are shown. These show that the rate of change in signal intensity as a function of position is well correlated between FLOT4:mCherry and LYK3:GFP only in the presence of bacteria. In buffer-treated root hairs R2(slope)=0.10±0.03; in bacteria-treated root hairs R2(slope)=0.74±0.02; P=4x10-13 by two-tailed t-test.

Figure 4-7. FLOT4:mCherry does not label LYK3:GFP intracellular vesicles Hairy roots expressing pFLOT4:gFLOT4:mCherry were generated on plants transformed with pLYK3:gLYK3:GFP. One day post inoculation with S. meliloti, LYK3 and FLOT4 showed an increase in co-distribution at the plasma membrane (arrowheads) but not LYK3:GFP intracellular vesicles (arrow). Images are single optical sections. Scale bar: 5 µm.

77

DISCUSSION FLOT2 affects FLOT4:GFP distribution

We found that FLOT4:GFP localization in epidermal cells was affected by FLOT2.

When FLOT4:GFP was co-expressed with FLOT2:mCherry driven by the constitutive

35S promoter, FLOT4:GFP showed increased polar localization in epidermal cells.

By analogy to animal FLOTs, this result suggests that FLOT2 and FLOT4 might form

hetero-oligomers (Solis et al., 2007; Babuke et al., 2009).

The observation that FLOT4:GFP expressed under its native promoter affects

FLOT2:mCherry localization raises questions of copy number and expression level in

hairy roots. FLOT2:GFP accumulation at root hair tips was only observed in hairy

roots co-transformed with FLOT4:mCherry. When A. rhizogenes strains for the two

constructs were mixed in a 1:1 ratio we obtained a frequency of co-transformation of

about 1 in 4 recovered roots (data not shown). If transformation primarily occurred as

a single event per root, we would not expect nearly this high a rate of co-

transformation. This implies that transgenic hairy roots contain multiple copies of the

transgenes, and even when expressed under native promoters, expression levels may

not be reflective of endogenous levels.

Plant membrane protein compartmentalization

We have found strong evidence that FLOT4 and LYK3 are components of the same

pathway. We show that the phenotype of FLOT4-silenced roots (Chapter 2) closely

resembles the phenotype of LYK3-silenced roots (Smit et al., 2007). A point mutation

in LYK3 caused decreased FLOT4:GFP spot density and increased polarity (Figure 4-

3), and after bacterial treatment, tagged FLOT4 and LYK3 co-localize in space and

time (Figures 4-5 and 4-6). The most parsimonious explanation for these observations

is that FLOT4 and LYK3 are components of a shared complex. An alternative is that

FLOT4 and LYK3 co-localization arises because they occupy distinct (sub-

microscopic resolution) protein complexes within stable microdomains. Further

studies are required to determine the functional significance of co-localization and

regulation of co-distribution of membrane microdomain proteins during symbiosis.

78

We found evidence for root hair membrane puncta with three different

properties: (1) pre-inoculation stable puncta marked by tagged FLOT2/FLOT4, (2)

pre-inoculation mobile puncta marked by tagged LYK3, and (3) post-inoculation

stable puncta marked by tagged LYK3/FLOT4. Our results show that plant

membranes have complex heterogeneity and that proteins exhibit distinct behaviors

that can be altered in response to signals. These data also demonstrate that changes in

membrane-protein architecture accompany altered root hair morphology during early

symbiotic events.

From these observations, we suggest that regulation of protein distribution and

dynamics within plant membranes may be a means of regulating protein function.

While LYK3 is required for infection thread initiation, the underlying mechanism is

unknown. Our data show that after bacterial treatment, LYK3:GFP is not restricted to

infection sites but instead shifts from dynamic to stable puncta that persist on plasma

membranes. One interpretation of this observation is that LYK3 functions within

immobile puncta to send a global signal that reprograms the root hair cell for infection.

An alternative is that sequestering LYK3 in immobile puncta negatively regulates

LYK3 function and serves to limit infection to one site per cell or to only certain cells.

Differentiation between the functional states of mobile and immobile populations of

LYK3 will provide insight into the mechanism by which LYK3 regulates infection

thread initiation.

More generally, our observations suggest two possible models of how

regulation of protein localization within plant membranes may be achieved. One

possibility is that multiple types of microdomains always exist in plant membranes

and that after perception of a signal, proteins travel from one domain to another. A

second possibility is that some proteins (such as LYK3) move freely in and out of

stable microdomains (such as those marked by FLOT4); upon signal perception,

movement of mobile proteins is restricted to stable domains. Both models allow for

the possibility that regulation of plasma membrane protein localization may be a

means by which plants direct responses to external signals.

79

MATERIALS AND METHODS Plant growth, bacterial treatments and hairy root transformations were

performed as described in the materials and methods of Chapter 2. FLOT2:mCherry

and FLOT4:GFP co-transformations were done by mixing equal ratios of A.

rhizogenes carrying each plasmid.

Construct design

pLYK3:gLYK3:GFP and :HASt constructs and transgenic lines were obtained from

Brendan Riely in Doug Cook’s Lab (U.C. Davis, unpublished).

Plasmids pCH153 containing pFLOT4:gFLOT4:mCherry and pCH046

containing 35S:FLOT2:mCherry were generated by replacing GFP in plasmids

pCH118 and pCH035 (Haney and Long, 2010) with mCherry. MCherry was

amplified with primers AAACCCGGGATGGTGAGCAAGGGCGAGGAG and

AAATCTAGATTACTTGTACAGCTCGTCCATG and inserted into the XmaI and

XbaI sites in pCH118 and pCH035 (Haney and Long, 2010).

Confocal microscopy

Microscope setup, optics and filters are described in Chapter 3 materials and methods.

Brightest point z-projections of stacks of epidermal cells or root hairs were

used for quantification of signal or density of spots. Final images included about 45 z-

sections taken at 0.3 μms increments to cover just the top half (~15 μms) of epidermal

cells. As a proxy for polarity, the ratio of signal density on the apical cell pole to the

epidermal surface was determined as follows: (1) the average apical signal was

measured by drawing a 1-pixel wide line along the apical membrane and using

ImageJ’s Measure function to determine the average intensity per pixel (or signal

density), (2) the epidermal signal was measured by a similar method but with a

rectangular selection, (3) the apical signal density was divided by the epidermal signal

density to determine ratio of signal density. To measure density of flotillin puncta,

images were automatically thresholded based on statistical distribution of signal so

that just the puncta on the epidermal surface were defined. Using the “analyze

80

particles” feature in Image J, the total number of spots was determined and divided by

the total area measured to give a spot density. No constraints were placed on spot

size or dimensions. At least 5 cells were measured from at least 3 independent plants

for a total of at least 15 measurements per treatment.

Co-localization experiments were done in three dimensional space using

Imaris’s (Bitplane) co-localization tool as described in Costes et al. (2004). Images

were cropped in three dimensions to include approximately 20 μm of the growing root

hair tip. The background thresholds were set at 1300 and 1080 for the green and red

channels respectively and determined based on auto-fluorescence and background

signals measured in hairy roots on LYK3:HASt plants co-transformed with an empty

vector pCH040 (same as pCH010 described in Chapter 2 except the plasmid lacks

GFP). The Pearson’s correlation co-efficient (r) was determined for co-localization in

3-D space. Twenty-three buffer-treated root hairs were analyzed from 4 individual

plants. Forty-three root hairs were analyzed on 3 independent inoculated plants, 22 of

which had reinitiated direction growth and 21 of which had not. Two-tailed t-tests

with equal variance were used to determine significance of the differences in r.

Time series data was acquired at 2 second intervals over a three minute period.

Analysis was done in ImageJ. Linear manual selections (1 pixel width) were made on

average intensity projections and stacks to generate average pixel intensity and

kymographs. Average pixel intensities were exported to Microsoft Excel to generate

graphical representations and coefficients of determination (R2). Slope at pixel

position x was approximated by the 3-point estimation: (f(x-h) - f(x+h))/2h where the

step h was a single pixel. Two time series data sets were analyzed from each of two

independent inoculated or uninoculated roots (four images per treatment). Three

selections were analyzed per root hair. Two-tailed t-tests with equal variance were

used to determine significance of the differences in R2 values.

81

CHAPTER 5: Conclusions and Future Directions

Plant membrane protein compartmentalization

Some plasma membrane-associated plant proteins have patchy distributions (Sutter et

al., 2006; Homann et al., 2007; Krugel et al., 2008; Gutierrez et al., 2009; Raffaele et

al., 2009). We found several plant proteins required for legume-rhizobia symbiosis,

including two receptor kinases (LYK3 and DMI2) and two flotillin proteins (FLOT2

and FLOT4), that also have patchy distributions associated with plasma membranes.

We showed that the distribution of FLOT4:GFP and LYK3:GFP is altered during

response to a symbiotic bacterium. The finding that signal perception affects

membrane protein distribution is not novel for animal cells (e.g. Stuermer et al., 2004;

Giri et al., 2007); yet, these are the first demonstrations of the phenomenon in plant

cells. In animal cells, evidence suggests that cellular processes are compartmentalized

in punctate plasma membrane domains called “rafts”. Currently, the animal field

defines “membrane rafts” as “small (10-200 nm), heterogeneous, highly dynamic,

sterol- and sphingolipid-enriched domains that compartmentalize cellular processes”

(Pike, 2006). The function and even existence of these domains has been the subject

of much controversy and attention (discussed below and in Lingwood and Simons,

2010).

Are the membrane puncta marked by LYK3 and FLOT4 analogous to animal

membrane rafts? LYK3:GFP and FLOT4:GFP puncta are sub-resolution by light

microscopy, so they are likely on the order of 10-200 nm. Animal membrane rafts are

nearly always defined by their cholesterol-association (Pike, 2006) and plants have

little to no cholesterol (Zappel and Panstruga, 2008). Our observations are consistent

with the possibility that LYK3 and FLOT4 co-localization serves to compartmentalize

a response to symbiotic bacteria. Yet the field of plant membrane biology is too early

in its development to say how similar these domains are to their animal counterparts in

terms of size, lipid and sterol composition, and dynamics.

To date, plant cell biology has been affected by misconceptions about how to

define membrane rafts (discussed in Opekarovà et al., 2010). Detergent resistance has

been used synonymously with membrane raft with little regard for size, composition,

82

or function (Peskan et al., 2000; Mongrand et al., 2004; Borner et al., 2005; Morel et

al., 2006; Lefebvre et al., 2007; Zappel and Panstruga, 2008; Lefebvre et al., 2010;

Mongrand et al., 2010). Detergent-based methods can introduce artifacts, and the

DRM fraction may not correlate with protein distribution in a living cell (Munro,

2003; Lingwood and Simons, 2010). As a consequence, DRM localization does not

necessarily have functional implications, and two proteins that co-partition in the

DRM fraction may not co-localize in a living cell. Despite clear evidence that “rafts”

are not equivalent to DRMs, detergent resistance is still used in many fields to claim

“raft” localization (e.g. Lefebvre et al., 2010; Lopez and Kolter, 2010; Ludwig et al.,

2010). Despite these concerns, is difficult to imagine how proteins could have such

striking, punctate distributions without functional consequence.

The environment of the plant membrane likely results in domains with distinct

properties from animal membranes. Protein diffusion in animal membranes is

constrained by a labyrinth of sterols, proteins, and cytoskeletal elements (Kusumi et

al., 2010). Because plant membrane composition differs from animal membranes, it is

likely that protein diffusion in plant membranes is under distinct constraints and may

differ in diffusion rates. Additionally, plant cells are walled, resulting in forces on the

plasma membrane from both the cell contents and the cell wall itself. Both stable and

dynamic plasma membrane-cell wall contact sites (Kohorn, 2000) could be sites of

membrane protein stabilization. Consequently, plant membranes may have unique

domains that are constrained by the cell wall. Plant membrane puncta size and

dynamics have not been extensively characterized, but evidence suggests that in

walled yeast cells, some punctate domains may be larger than 200 nm (Malinska et al.,

2003) and may be stable for hours (Malinska et al., 2004). Further work will define

the size range of plant membrane puncta, the sterol and lipid environment, and the

behaviors of these domains.

Plasma membrane protein compartmentalization during symbiosis

Nearly concurrent with the discovery of a requirement for FLOTs in symbiosis was the

discovery of a symbiotic remorin (REM) (Lefebvre et al., 2010). REMs, like FLOTs,

83

have punctate plasma membrane distributions (Raffaele et al., 2009) and localize to

infection threads during symbiosis (Lefebvre et al., 2010). Both REMs and FLOTs

are peripheral membrane proteins, predicted to be anchored by palmitoylation, and

have coiled-coil domains. That FLOTs and REMs have such similar predicted

topologies and have nearly indistinguishable but non-redundant requirements in

symbiosis begs the question: why both FLOTs and

One possibility is that FLOTs and REMs function similarly to animal FLOT1

and FLOT2. The two animal flotillins function non-redundantly and cooperatively in

several processes (Solis et al., 2007; Babuke et al., 2009; Riento et al., 2009). As

plants appear to have only one family of flotillins (Rivera-Milla et al., 2006), REMs

may perform a similar function to the second family of animal flotillins. A second

possibility is that FLOTs and REMs occupy distinct membrane compartments and that

a receptor, such as LYK3, may undergo a sort of “handoff” from one protein to the

other. In this model, one might predict that LYK3 and SymREM would co-localize

before inoculation and then a “handoff” of LYK3 to FLOT4 would occur after

inoculation.

REMs?

We observed that GFP-tagged DMI2 and LYK3 have similar punctate

distributions. DMI2 is required for infection and appears to act before LYK3 (Catoira

et al., 2000; Limpens et al., 2005). Genetic data support a model where LYK3 could

be phosphorylated by DMI2, resulting in LYK3 redistribution. Determining: 1) if

LYK3 and DMI2 co-distribute prior to bacterial treatment, 2) if DMI2 is necessary

and sufficient for LYK3 re-distribution and immobilization, and 3) if LYK3 is a target

of the DMI2 kinase domain, will provide insight into the mechanisms by which

symbiotic receptors regulate infection.

What is the function of FLOTs during symbiosis?

In animals, flotillins associate with effectors that interact with the actin cytoskeleton

(Langhorst et al., 2007; Neumann-Giesen et al., 2007; Langhorst et al., 2008a).

Cytoskeletal rearrangements are associated with symbiotic infection (Yokota et al.,

2009); by analogy, perhaps M. truncatula FLOT4 forms a complex with LYK3 and

84

with effectors that bind actin. In this way, flotillins could link NF perception and the

cytoskeletal rearrangements associated with infection. However, if this were the case,

one would expect FLOT4 localization, or FLOT4 and LYK3 co-localization, to be

limited to the site of initiating and growing infection threads. Instead, we observed

that FLOT4 and LYK3 co-localization and LYK3 immobilization is not restricted to

the infection site. This observation suggests that the function of FLOTs in symbiosis

may not be directly in infection thread initiation and growth.

Membrane depolarization is associated with NF perception in legume root

hairs and with signaling in animal neurons and T cells. Animal flotillins function

during T cell activation (Stuermer et al., 2004; Langhorst et al., 2006), a process

which depends on membrane depolarization. Animal flotillins also associate with ion

channels (Morrow and Parton, 2005; Suzuki et al., 2008; Robinson et al., 2010). This

begs the question, is there a link between flotillins and membrane depolarization

during symbiosis? Within minutes of NF application, root hairs undergo a rapid

change in membrane potential followed by calcium spiking (Ehrhardt et al., 1992;

Ehrhardt et al., 1996); both membrane depolarization and calcium spiking are required

for root hair curling (Wais et al., 2000). However, flotillin-silenced roots do not

exhibit root hair curling defects, suggesting that flotillins are not required for

membrane depolarization or calcium spiking during symbiosis (Chapter 2). Drug-

induced membrane depolarization in yeast causes a change in membrane protein

distribution (Grossmann et al., 2007). However, within the first 30 minutes post NF

application, when membrane depolarization and calcium spiking occur, we did not

detect a redistribution of FLOT4:GFP or a change in LYK3:GFP dynamics (Chapter 4

and not shown, respectively). While these observations do not rule out all possible

connections between flotillins and calcium signaling during symbiosis, we did not find

evidence for a role of flotillins in calcium spiking or membrane depolarization.

Our data are most consistent with a role for flotillins downstream of calcium

signaling, prior to and during infection. In animal cells, flotillins have been implicated

in membrane traffic associated with signaling (Langhorst et al., 2008b; Riento et al.,

2009; Pust et al., 2010; Stuermer, 2010). We did not observe a significant pool of

85

intracellular flotillins in any plant cell type under any conditions tested, so it seems

unlikely that plant flotillins are involved in endocytosis or exocytosis during

symbiosis. Rather, a role for structuring clusters of LYK3 receptors, or bringing

LYK3 into contact with other proteins, is most consistent with our observations

(Stuermer, 2010).

Possible functions for plant membrane protein compartmentalization during

host-microbe interactions

We demonstrated that several proteins required for perception of and infection by

symbiotic bacteria have patchy distributions associated with the plasma membrane.

By analogy to animal membrane rafts, changes in membrane protein

compartmentalization may be a general response during plant-microbe interactions.

This is supported by the observation that an Arabidopsis flotillin is upregulated in

roots in response to the fungal elicitor chitin (Millet et al., 2010). As the backbone of

bacterial NF is composed of chitin, it is tempting to speculate that FLOTs may have a

generalized function in organizing membrane receptors in response to microbial

perception. As most plants species have multiple flotillin homologues (Rivera-Milla

et al., 2006), individual flotillins may have different receptor specificities, or

specificity may be regulated on the level of cell-type-specific expression.

A second possible role for membrane protein compartmentalization is in

exocytosis of secondary metabolites. In response to perception of potential pathogens,

plants roots deposit a waxy substance called callose in a patchy distribution on the

plasma membrane (Millet et al., 2010). Patchy callose deposition is reminiscent of

patchy membrane protein distribution and may require targeted exocytosis to specific

plant plasma membrane microdomains. Similarly, plant roots secrete secondary

metabolites including antimicrobial compounds during defense (Bais et al., 2005) and

flavonoids, which act as signaling molecules during legume-rhizobia symbiosis

(Peters et al., 1986). It is unknown how these compounds are secreted from plant

roots into the surrounding environment, but exocytosis is a likely mechanism.

Secondary metabolites are of increasing interest to studies of both plant- and animal-

86

microbe interactions. Understanding how secondary metabolites are secreted, and

determining what role membrane physiology plays in exocytosis in plants, is of

enormous importance in answering the question: how do eukaryotic hosts

communicate with and defend against microbial communities?

87

REFERENCES

Amor, B.B., Shaw, S.L., Oldroyd, G.E., Maillet, F., Penmetsa, R.V., Cook,

D., Long, S.R., Dénarié, J., and Gough, C. (2003). The NFP locus of

Medicago truncatula controls an early step of Nod Factor signal

transduction upstream of a rapid calcium flux and root hair deformation.

Plant J 34, 495-506.

Ané, J.M., Kiss, G.B., Riely, B.K., Penmetsa, R.V., Oldroyd, G.E., Ayax,

C., Levy, J., Debellé, F., Baek, J.M., Kaló, P., Rosenberg, C., Roe,

B.A., Long, S.R., Dénarié, J., and Cook, D.R. (2004). Medicago

truncatula DMI1 required for bacterial and fungal symbioses in legumes.

Science 303, 1364-1367.

Ardourel, M., Demont, N., Debellé, F., Maillet, F., de Billy, F., Promé, J.C.,

Dénarié, J., and Truchet, G. (1994). Rhizobium meliloti

lipooligosaccharide Nodulation Factors: different structural requirements

for bacterial entry into target root hair cells and induction of plant

symbiotic developmental responses. Plant Cell 6, 1357-1374.

Arellano-Reynoso, B., Lapaque, N., Salcedo, S., Briones, G., Ciocchini,

A.E., Ugalde, R., Moreno, E., Moriyon, I., and Gorvel, J.P. (2005).

Cyclic beta-1,2-glucan is a Brucella virulence factor required for

intracellular survival. Nat Immunol 6, 618-625.

Arrighi, J.F., Godfroy, O., de Billy, F., Saurat, O., Jauneau, A., and Gough,

C. (2008). The RPG gene of Medicago truncatula controls Rhizobium-

directed polar growth during infection. Proc Natl Acad Sci U S A 105,

9817-9822.

Babuke, T., Ruonala, M., Meister, M., Amaddii, M., Genzler, C., Esposito,

A., and Tikkanen, R. (2009). Hetero-oligomerization of reggie-

88

1/flotillin-2 and reggie-2/flotillin-1 is required for their endocytosis. Cell

Signal 21, 1287-1297.

Bais, H.P., Prithiviraj, B., Jha, A.K., Ausubel, F.M., and Vivanco, J.M.

(2005). Mediation of pathogen resistance by exudation of antimicrobials

from roots. Nature 434, 217-221.

Batut, J., Andersson, S.G., and O'Callaghan, D. (2004). The evolution of

chronic infection strategies in the alpha-proteobacteria. Nat Rev

Microbiol 2, 933-945.

Baumann, C.A., Ribon, V., Kanzaki, M., Thurmond, D.C., Mora, S.,

Shigematsu, S., Bickel, P.E., Pessin, J.E., and Saltiel, A.R. (2000).

CAP defines a second signalling pathway required for insulin-stimulated

glucose transport. Nature 407, 202-207.

Bersoult, A., Camut, S., Perhald, A., Kereszt, A., Kiss, G.B., and

Cullimore, J.V. (2005). Expression of the Medicago truncatula DM12

gene suggests roles of the symbiotic nodulation receptor kinase in

nodules and during early nodule development. Mol Plant Microbe

Interact 18, 869-876.

Bickel, P.E., Scherer, P.E., Schnitzer, J.E., Oh, P., Lisanti, M.P., and

Lodish, H.F. (1997). Flotillin and epidermal surface antigen define a

new family of caveolae-associated integral membrane proteins. J Biol

Chem 272, 13793-13802.

Boisson-Dernier, A., Chabaud, M., Garcia, F., Becard, G., Rosenberg, C.,

and Barker, D.G. (2001). Agrobacterium rhizogenes-transformed roots

of Medicago truncatula for the study of nitrogen-fixing and

endomycorrhizal symbiotic associations. Mol Plant Microbe Interact 14,

695-700.

89

Boivin, C., Camut, S., Malpica, C.A., Truchet, G., and Rosenberg, C.

(1990). Rhizobium meliloti Genes Encoding Catabolism of Trigonelline

Are Induced under Symbiotic Conditions. Plant Cell 2, 1157-1170.

Bolte, S., Talbot, C., Boutte, Y., Catrice, O., Read, N.D., and Satiat-

Jeunemaitre, B. (2004). FM-dyes as experimental probes for dissecting

vesicle trafficking in living plant cells. J Microsc 214, 159-173.

Borisov, A.Y., Madsen, L.H., Tsyganov, V.E., Umehara, Y., Voroshilova,

V.A., Batagov, A.O., Sandal, N., Mortensen, A., Schauser, L., Ellis,

N., Tikhonovich, I.A., and Stougaard, J. (2003). The Sym35 gene

required for root nodule development in pea is an ortholog of Nin from

Lotus japonicus. Plant Physiol 131, 1009-1017.

Borner, G.H., Sherrier, D.J., Weimar, T., Michaelson, L.V., Hawkins, N.D.,

Macaskill, A., Napier, J.A., Beale, M.H., Lilley, K.S., and Dupree, P.

(2005). Analysis of detergent-resistant membranes in Arabidopsis.

Evidence for plasma membrane lipid rafts. Plant Physiol 137, 104-116.

Browman, D.T., Hoegg, M.B., and Robbins, S.M. (2007). The SPFH domain-

containing proteins: more than lipid raft markers. Trends Cell Biol 17,

394-402.

Capoen, W., and Oldroyd, G. (2008). How CYCLOPS keeps an eye on plant

symbiosis. Proc Natl Acad Sci U S A 105, 20053-20054.

Catalano, C.M., Czymmek, K.J., Gann, J.G., and Sherrier, D.J. (2007).

Medicago truncatula syntaxin SYP132 defines the symbiosome

membrane and infection droplet membrane in root nodules. Planta 225,

541-550.

Catoira, R., Timmers, A.C., Maillet, F., Galera, C., Penmetsa, R.V., Cook,

D., Dénarié, J., and Gough, C. (2001). The HCL gene of Medicago

truncatula controls Rhizobium-induced root hair curling. Development

128, 1507-1518.

90

Catoira, R., Galera, C., de Billy, F., Penmetsa, R.V., Journet, E.P., Maillet,

F., Rosenberg, C., Cook, D., Gough, C., and Dénarié, J. (2000). Four

genes of Medicago truncatula controlling components of a Nod Factor

transduction pathway. Plant Cell 12, 1647-1666.

Charpentier, M., Bredemeier, R., Wanner, G., Takeda, N., Schleiff, E., and

Parniske, M. (2008). Lotus japonicus CASTOR and POLLUX are ion

channels essential for perinuclear calcium spiking in legume root

endosymbiosis. Plant Cell 20, 3467-3479.

Chinchilla, D., Zipfel, C., Robatzek, S., Kemmerling, B., Nurnberger, T.,

Jones, J.D., Felix, G., and Boller, T. (2007). A flagellin-induced

complex of the receptor FLS2 and BAK1 initiates plant defence. Nature

448, 497-500.

Costes, S.V., Daelemans, D., Cho, E.H., Dobbin, Z., Pavlakis, G., and

Lockett, S. (2004). Automatic and quantitative measurement of protein-

protein colocalization in live cells. Biophys J 86, 3993-4003.

Curtis, M.D., and Grossniklaus, U. (2003). A gateway cloning vector set for

high-throughput functional analysis of genes in planta. Plant Physiol

133, 462-469.

Cutler, S.R., Ehrhardt, D.W., Griffitts, J.S., and Somerville, C.R. (2000).

Random GFP::cDNA fusions enable visualization of subcellular

structures in cells of Arabidopsis at a high frequency. Proc Natl Acad Sci

U S A 97, 3718-3723.

Debellé, F., Moulin, L., Mangin, B., Dénarié, J., and Boivin, C. (2001). Nod

genes and Nod signals and the evolution of the Rhizobium-legume

symbiosis. Acta Biochim Pol 48, 359-365.

Deininger, S.O., Rajendran, L., Lottspeich, F., Przybylski, M., Illges, H.,

Stuermer, C.A., and Reuter, A. (2003). Identification of teleost Thy-1

91

and association with the microdomain/lipid raft reggie proteins in

regenerating CNS axons. Mol Cell Neurosci 22, 544-554.

Demont, N., Debellé, F., Aurelle, H., Dénarié, J., and Promé, J.C. (1993).

Role of the Rhizobium meliloti nodF and nodE genes in the biosynthesis

of lipo-oligosaccharidic Nodulation Factors. J Biol Chem 268, 20134-

20142.

Donovan, C., and Bramkamp, M. (2009). Characterization and subcellular

localization of a bacterial flotillin homologue. Microbiol-Sgm 155,

1786-1799.

Downie, J.A. (1989). The nodL gene from Rhizobium leguminosarum is

homologous to the acetyl transferases encoded by lacA and cysE. Mol

Microbiol 3, 1649-1651.

E.P.A. (2010). U.S. Greenhouse Gas Inventory Report--Inventory of U.S.

Greenhouse Gas Emissions and Sinks: 1990-2008. Available online

http://www.epa.gov/climatechange/emissions/usinventoryreport.html.

Ehrhardt, D.W., Atkinson, E.M., and Long, S.R. (1992). Depolarization of

alfalfa root hair membrane potential by Rhizobium meliloti Nod Factors.

Science 256, 998-1000.

Ehrhardt, D.W., Wais, R., and Long, S.R. (1996). Calcium spiking in plant

root hairs responding to Rhizobium nodulation signals. Cell 85, 673-681.

Ehrhardt, D.W., Atkinson, E.M., Faull, K.F., Freedberg, D.I., Sutherlin,

D.P., Armstrong, R., and Long, S.R. (1995). In vitro sulfotransferase

activity of NodH, a nodulation protein of Rhizobium meliloti required for

host-specific nodulation. J Bacteriol 177, 6237-6245.

Endre, G., Kereszt, A., Kevei, Z., Mihacea, S., Kaló, P., and Kiss, G.B.

(2002). A receptor kinase gene regulating symbiotic nodule

development. Nature 417, 962-966.

92

Fisher, R.F., Egelhoff, T.T., Mulligan, J.T., and Long, S.R. (1988). Specific

binding of proteins from Rhizobium meliloti cell-free extracts containing

NodD to DNA sequences upstream of inducible nodulation genes. Genes

Dev 2, 282-293.

Frick, M., Bright, N.A., Riento, K., Bray, A., Merrified, C., and Nichols,

B.J. (2007). Coassembly of flotillins induces formation of membrane

microdomains, membrane curvature, and vesicle budding. Curr Biol 17,

1151-1156.

Gage, D.J. (2002). Analysis of infection thread development using Gfp- and

DsRed-expressing Sinorhizobium meliloti. J Bacteriol 184, 7042-7046.

Gage, D.J. (2004). Infection and invasion of roots by symbiotic, nitrogen-

fixing rhizobia during nodulation of temperate legumes. Microbiol Mol

Biol Rev 68, 280-300.

Geurts, R., Fedorova, E., and Bisseling, T. (2005). Nod Factor signaling

genes and their function in the early stages of Rhizobium infection. Curr

Opin Plant Biol 8, 346-352.

Giri, B., Dixit, V.D., Ghosh, M.C., Collins, G.D., Khan, I.U., Madara, K.,

Weeraratna, A.T., and Taub, D.D. (2007). CXCL12-induced

partitioning of flotillin-1 with lipid rafts plays a role in CXCR4 function.

Eur J Immunol 37, 2104-2116.

Gleason, C., Chaudhuri, S., Yang, T., Munoz, A., Poovaiah, B.W., and

Oldroyd, G.E. (2006). Nodulation independent of rhizobia induced by a

calcium-activated kinase lacking autoinhibition. Nature 441, 1149-1152.

Glebov, O.O., Bright, N.A., and Nichols, B.J. (2006). Flotillin-1 defines a

clathrin-independent endocytic pathway in mammalian cells. Nat Cell

Biol 8, 46-54.

93

Griffitts, J.S., and Long, S.R. (2008). A symbiotic mutant of Sinorhizobium

meliloti reveals a novel genetic pathway involving succinoglycan

biosynthetic functions. Mol Microbiol 67, 1292-1306.

Griffitts, J.S., Carlyon, R.E., Erickson, J.H., Moulton, J.L., Barnett, M.J.,

Toman, C.J., and Long, S.R. (2008). A Sinorhizobium meliloti

osmosensory two-component system required for cyclic glucan export

and symbiosis. Mol Microbiol 69, 479-490.

Grossmann, G., Opekarovà, M., Malinsky, J., Weig-Meckl, I., and Tanner,

W. (2007). Membrane potential governs lateral segregation of plasma

membrane proteins and lipids in yeast. EMBO J 26, 1-8.

Gutierrez, R., Lindeboom, J.J., Paredez, A.R., Emons, A.M., and

Ehrhardt, D.W. (2009). Arabidopsis cortical microtubules position

cellulose synthase delivery to the plasma membrane and interact with

cellulose synthase trafficking compartments. Nat Cell Biol 11, 797-806.

Haney, C.H., and Long, S.R. (2010). Plant flotillins are required for infection

by nitrogen-fixing bacteria. Proc Natl Acad Sci U S A 107, 478-483.

Heckmann, A.B., Lombardo, F., Miwa, H., Perry, J.A., Bunnewell, S.,

Parniske, M., Wang, T.L., and Downie, J.A. (2006). Lotus japonicus

nodulation requires two GRAS domain regulators, one of which is

functionally conserved in a non-legume. Plant Physiol 142, 1739-1750.

Helliwell, C., and Waterhouse, P. (2003). Constructs and methods for high-

throughput gene silencing in plants. Methods 30, 289-295.

Hirsch, S., Kim, J., Munoz, A., Heckmann, A.B., Downie, J.A., and

Oldroyd, G.E. (2009). GRAS proteins form a DNA binding complex to

induce gene expression during nodulation signaling in Medicago

truncatula. Plant Cell 21, 545-557.

94

Homann, U., Meckel, T., Hewing, J., Hutt, M.T., and Hurst, A.C. (2007).

Distinct fluorescent pattern of KAT1::GFP in the plasma membrane of

Vicia faba guard cells. Eur J Cell Biol 86, 489-500.

Huber, T.B., Schermer, B., Muller, R.U., Hohne, M., Bartram, M., Calixto,

A., Hagmann, H., Reinhardt, C., Koos, F., Kunzelmann, K.,

Shirokova, E., Krautwurst, D., Harteneck, C., Simons, M.,

Pavenstadt, H., Kerjaschki, D., Thiele, C., Walz, G., Chalfie, M., and

Benzing, T. (2006). Podocin and MEC-2 bind cholesterol to regulate the

activity of associated ion channels. Proc Natl Acad Sci U S A 103,

17079-17086.

Iizasa, E., Mitsutomi, M., and Nagano, Y. (2010). Direct binding of a plant

LysM receptor-like kinase, LysM RLK1/CERK1, to chitin in vitro. J

Biol Chem 285, 2996-3004.

Kaló, P., Gleason, C., Edwards, A., Marsh, J., Mitra, R.M., Hirsch, S.,

Jakab, J., Sims, S., Long, S.R., Rogers, J., Kiss, G.B., Downie, J.A.,

and Oldroyd, G.E. (2005). Nodulation signaling in legumes requires

NSP2, a member of the GRAS family of transcriptional regulators.

Science 308, 1786-1789.

Kanamori, N., Madsen, L.H., Radutoiu, S., Frantescu, M., Quistgaard,

E.M., Miwa, H., Downie, J.A., James, E.K., Felle, H.H., Haaning,

L.L., Jensen, T.H., Sato, S., Nakamura, Y., Tabata, S., Sandal, N.,

and Stougaard, J. (2006). A nucleoporin is required for induction of

Ca2+ spiking in legume nodule development and essential for rhizobial

and fungal symbiosis. Proc Natl Acad Sci U S A 103, 359-364.

Katanaev, V.L., Solis, G.P., Hausmann, G., Buestorf, S., Katanayeva, N.,

Schrock, Y., Stuermer, C.A., and Basler, K. (2008). Reggie-1/flotillin-

2 promotes secretion of the long-range signalling forms of Wingless and

Hedgehog in Drosophila. EMBO J 27, 509-521.

95

Kiss, E., Olah, B., Kaló, P., Morales, M., Heckmann, A.B., Borbola, A.,

Lozsa, A., Kontar, K., Middleton, P., Downie, J.A., Oldroyd, G.E.,

and Endre, G. (2009). LIN, a novel type of U-box/WD40 protein,

controls early infection by rhizobia in legumes. Plant Physiol 151, 1239-

1249.

Kohorn, B.D. (2000). Plasma membrane-cell wall contacts. Plant Physiol 124,

31-38.

Kokubo, H., Helms, J.B., Ohno-Iwashita, Y., Shimada, Y., Horikoshi, Y.,

and Yamaguchi, H. (2003). Ultrastructural localization of flotillin-1 to

cholesterol-rich membrane microdomains, rafts, in rat brain tissue. Brain

Res 965, 83-90.

Krugel, U., Veenhoff, L.M., Langbein, J., Wiederhold, E., Liesche, J.,

Friedrich, T., Grimm, B., Martinoia, E., Poolman, B., and Kuhn, C.

(2008). Transport and sorting of the Solanum tuberosum sucrose

transporter SUT1 is affected by posttranslational modification. Plant Cell

20, 2497-2513.

Kusumi, A., Shirai, Y.M., Koyama-Honda, I., Suzuki, K.G., and Fujiwara,

T.K. (2010). Hierarchical organization of the plasma membrane:

investigations by single-molecule tracking vs. fluorescence correlation

spectroscopy. FEBS Lett 584, 1814-1823.

Langhorst, M.F., Solis, G.P., Hannbeck, S., Plattner, H., and Stuermer,

C.A. (2007). Linking membrane microdomains to the cytoskeleton:

regulation of the lateral mobility of reggie-1/flotillin-2 by interaction

with actin. FEBS Lett 581, 4697-4703.

Langhorst, M.F., Jaeger, F.A., Mueller, S., Sven Hartmann, L.,

Luxenhofer, G., and Stuermer, C.A. (2008a). Reggies/flotillins

regulate cytoskeletal remodeling during neuronal differentiation via

CAP/ponsin and Rho GTPases. Eur J Cell Biol 87, 921-931.

96

Langhorst, M.F., Reuter, A., Luxenhofer, G., Boneberg, E.M., Legler, D.F.,

Plattner, H., and Stuermer, C.A. (2006). Preformed reggie/flotillin

caps: stable priming platforms for macrodomain assembly in T cells.

FASEB J 20, 711-713.

Langhorst, M.F., Reuter, A., Jaeger, F.A., Wippich, F.M., Luxenhofer, G.,

Plattner, H., and Stuermer, C.A. (2008b). Trafficking of the

microdomain scaffolding protein reggie-1/flotillin-2. Eur J Cell Biol 87,

211-226.

Lefebvre, B., Furt, F., Hartmann, M.A., Michaelson, L.V., Carde, J.P.,

Sargueil-Boiron, F., Rossignol, M., Napier, J.A., Cullimore, J.,

Bessoule, J.J., and Mongrand, S. (2007). Characterization of lipid rafts

from Medicago truncatula root plasma membranes: a proteomic study

reveals the presence of a raft-associated redox system. Plant Physiol 144,

402-418.

Lefebvre, B., Timmers, T., Mbengue, M., Moreau, S., Hervé, C., Toth, K.,

Bittencourt-Silvestre, J., Klaus, D., Deslandes, L., Godiard, L.,

Murray, J.D., Udvardi, M.K., Raffaele, S., Mongrand, S., Cullimore,

J., Gamas, P., Niebel, A., and Ott, T. (2010). A remorin protein

interacts with symbiotic receptors and regulates bacterial infection. Proc

Natl Acad Sci U S A 107, 2343-2348.

Leigh, J.A., Signer, E.R., and Walker, G.C. (1985). Exopolysaccharide-

deficient mutants of Rhizobium meliloti that form ineffective nodules.

Proc Natl Acad Sci U S A 82, 6231-6235.

Levy, J., Bres, C., Geurts, R., Chalhoub, B., Kulikova, O., Duc, G.,

Journet, E.P., Ané, J.M., Lauber, E., Bisseling, T., Dénarié, J.,

Rosenberg, C., and Debellé, F. (2004). A putative Ca2+ and

calmodulin-dependent protein kinase required for bacterial and fungal

symbioses. Science 303, 1361-1364.

97

Li, J., Wen, J., Lease, K.A., Doke, J.T., Tax, F.E., and Walker, J.C. (2002).

BAK1, an Arabidopsis LRR receptor-like protein kinase, interacts with

BRI1 and modulates brassinosteroid signaling. Cell 110, 213-222.

Limpens, E., Franken, C., Smit, P., Willemse, J., Bisseling, T., and Geurts,

R. (2003). LysM domain receptor kinases regulating rhizobial Nod

Factor-induced infection. Science 302, 630-633.

Limpens, E., Ivanov, S., van Esse, W., Voets, G., Fedorova, E., and

Bisseling, T. (2009). Medicago N2-fixing symbiosomes acquire the

endocytic identity marker Rab7 but delay the acquisition of vacuolar

identity. Plant Cell 21, 2811-2828.

Limpens, E., Mirabella, R., Fedorova, E., Franken, C., Franssen, H.,

Bisseling, T., and Geurts, R. (2005). Formation of organelle-like N2-

fixing symbiosomes in legume root nodules is controlled by DMI2. Proc

Natl Acad Sci U S A 102, 10375-10380.

Lingwood, D., and Simons, K. (2010). Lipid rafts as a membrane-organizing

principle. Science 327, 46-50.

Liu, J., Deyoung, S.M., Zhang, M., Dold, L.H., and Saltiel, A.R. (2005). The

stomatin/prohibitin/flotillin/HflK/C domain of flotillin-1 contains

distinct sequences that direct plasma membrane localization and protein

interactions in 3T3-L1 adipocytes. J Biol Chem 280, 16125-16134.

Lopez, D., and Kolter, R. (2010). Functional microdomains in bacterial

membranes. Gene Dev 24, 1893-1902.

Ludwig, A., Otto, G.P., Riento, K., Hams, E., Fallon, P.G., and Nichols,

B.J. (2010). Flotillin microdomains interact with the cortical

cytoskeleton to control uropod formation and neutrophil recruitment. J

Cell Biol 191, 771-781.

Madsen, E.B., Madsen, L.H., Radutoiu, S., Olbryt, M., Rakwalska, M.,

Szczyglowski, K., Sato, S., Kaneko, T., Tabata, S., Sandal, N., and

98

Stougaard, J. (2003). A receptor kinase gene of the LysM type is

involved in legume perception of rhizobial signals. Nature 425, 637-640.

Malinska, K., Malinsky, J., Opekarovà, M., and Tanner, W. (2003).

Visualization of protein compartmentation within the plasma membrane

of living yeast cells. Mol Biol Cell 14, 4427-4436.

Malinska, K., Malinsky, J., Opekarovà, M., and Tanner, W. (2004).

Distribution of Can1p into stable domains reflects lateral protein

segregation within the plasma membrane of living S. cerevisiae cells. J

Cell Sci 117, 6031-6041.

Marsh, J.F., Rakocevic, A., Mitra, R.M., Brocard, L., Sun, J., Eschstruth,

A., Long, S.R., Schultze, M., Ratet, P., and Oldroyd, G.E. (2007).

Medicago truncatula NIN is essential for rhizobial-independent nodule

organogenesis induced by autoactive calcium/calmodulin-dependent

protein kinase. Plant Physiol 144, 324-335.

Mbengue, M., Camut, S., de Carvalho-Niebel, F., Deslandes, L., Froidure,

S., Klaus-Heisen, D., Moreau, S., Rivas, S., Timmers, T., Hervé, C.,

Cullimore, J., and Lefebvre, B. (2010). The Medicago truncatula E3

Ubiquitin Ligase PUB1 Interacts with the LYK3 Symbiotic Receptor

and Negatively Regulates Infection and Nodulation. Plant Cell.

Meade, H.M., Long, S.R., Ruvkun, G.B., Brown, S.E., and Ausubel, F.M.

(1982). Physical and genetic characterization of symbiotic and

auxotrophic mutants of Rhizobium meliloti induced by transposon Tn5

mutagenesis. J Bacteriol 149, 114-122.

Middleton, P.H., Jakab, J., Penmetsa, R.V., Starker, C.G., Doll, J., Kaló,

P., Prabhu, R., Marsh, J.F., Mitra, R.M., Kereszt, A., Dudas, B.,

VandenBosch, K., Long, S.R., Cook, D.R., Kiss, G.B., and Oldroyd,

G.E. (2007). An ERF transcription factor in Medicago truncatula that is

essential for Nod Factor signal transduction. Plant Cell 19, 1221-1234.

99

Millet, Y.A., Danna, C.H., Clay, N.K., Songnuan, W., Simon, M.D., Werck-

Reichhart, D., and Ausubel, F.M. (2010). Innate immune responses

activated in Arabidopsis roots by microbe-associated molecular patterns.

Plant Cell 22, 973-990.

Mitra, R.M., and Long, S.R. (2004). Plant and bacterial symbiotic mutants

define three transcriptionally distinct stages in the development of the

Medicago truncatula/Sinorhizobium meliloti symbiosis. Plant Physiol

134, 595-604.

Mitra, R.M., Shaw, S.L., and Long, S.R. (2004a). Six nonnodulating plant

mutants defective for Nod Factor-induced transcriptional changes

associated with the legume-rhizobia symbiosis. Proc Natl Acad Sci U S

A 101, 10217-10222.

Mitra, R.M., Gleason, C.A., Edwards, A., Hadfield, J., Downie, J.A.,

Oldroyd, G.E., and Long, S.R. (2004b). A Ca2+/calmodulin-dependent

protein kinase required for symbiotic nodule development: Gene

identification by transcript-based cloning. Proc Natl Acad Sci U S A

101, 4701-4705.

Mongrand, S., Stanislas, T., Bayer, E.M., Lherminier, J., and Simon-Plas,

F. (2010). Membrane rafts in plant cells. Trends Plant Sci 15, 656-663

Mongrand, S., Morel, J., Laroche, J., Claverol, S., Carde, J.P., Hartmann,

M.A., Bonneu, M., Simon-Plas, F., Lessire, R., and Bessoule, J.J.

(2004). Lipid rafts in higher plant cells: purification and characterization

of Triton X-100-insoluble microdomains from tobacco plasma

membrane. J Biol Chem 279, 36277-36286.

Morel, J., Claverol, S., Mongrand, S., Furt, F., Fromentin, J., Bessoule,

J.J., Blein, J.P., and Simon-Plas, F. (2006). Proteomics of plant

detergent-resistant membranes. Mol Cell Proteomics 5, 1396-1411.

100

Morrow, I.C., and Parton, R.G. (2005). Flotillins and the PHB domain

protein family: rafts, worms and anaesthetics. Traffic 6, 725-740.

Morrow, I.C., Rea, S., Martin, S., Prior, I.A., Prohaska, R., Hancock, J.F.,

James, D.E., and Parton, R.G. (2002). Flotillin-1/reggie-2 traffics to

surface raft domains via a novel golgi-independent pathway.

Identification of a novel membrane targeting domain and a role for

palmitoylation. J Biol Chem 277, 48834-48841.

Morzhina, E.V., Tsyganov, V.E., Borisov, A.Y., Lebsky, V.K., and

Tikhonovich, I.A. (2000). Four developmental stages identified by

genetic dissection of pea (Pisum sativum L.) root nodule morphogenesis.

Plant Sci 155, 75-83.

Munro, S. (2003). Lipid rafts: elusive or illusive? Cell 115, 377-388.

Murakami, Y., Miwa, H., Imaizumi-Anraku, H., Kouchi, H., Downie, J.A.,

Kawaguchi, M., and Kawasaki, S. (2006). Positional cloning identifies

Lotus japonicus NSP2, a putative transcription factor of the GRAS

family, required for NIN and ENOD40 gene expression in nodule

initiation. DNA Res 13, 255-265.

Nam, K.H., and Li, J. (2002). BRI1/BAK1, a receptor kinase pair mediating

brassinosteroid signaling. Cell 110, 203-212.

Neumann-Giesen, C., Fernow, I., Amaddii, M., and Tikkanen, R. (2007).

Role of EGF-induced tyrosine phosphorylation of reggie-1/flotillin-2 in

cell spreading and signaling to the actin cytoskeleton. J Cell Sci 120,

395-406.

Neumann-Giesen, C., Falkenbach, B., Beicht, P., Claasen, S., Luers, G.,

Stuermer, C.A., Herzog, V., and Tikkanen, R. (2004). Membrane and

raft association of reggie-1/flotillin-2: role of myristoylation,

palmitoylation and oligomerization and induction of filopodia by

overexpression. Biochem J 378, 509-518.

101

Newcomb, W. (1976). A correlated light and electron microscopic study of

symbiotic growth and differentiation in Pisum sativum root nodules.

Can. J. Exp. Bot. 54, 2163-2186.

Oke, V., and Long, S.R. (1999). Bacterial genes induced within the nodule

during the Rhizobium-legume symbiosis. Mol Microbiol 32, 837-849.

Oldroyd, G.E., and Long, S.R. (2003). Identification and characterization of

nodulation-signaling pathway 2, a gene of Medicago truncatula involved

in Nod Factor signaling. Plant Physiol 131, 1027-1032.

Oldroyd, G.E., and Downie, J.A. (2008). Coordinating nodule morphogenesis

with rhizobial infection in legumes. Annu Rev Plant Biol 59, 519-546.

Oldroyd, G.E., Engstrom, E.M., and Long, S.R. (2001a). Ethylene inhibits

the Nod Factor signal transduction pathway of Medicago truncatula.

Plant Cell 13, 1835-1849.

Oldroyd, G.E., Mitra, R.M., Wais, R.J., and Long, S.R. (2001b). Evidence

for structurally specific negative feedback in the Nod Factor signal

transduction pathway. Plant J 28, 191-199.

Opekarovà, M., Malinsky, J., and Tanner, W. (2010). Plants and fungi in the

era of heterogeneous plasma membranes. Plant Biol (Stuttg) 12, 94-98.

Ossowski, S., Schwab, R., and Weigel, D. (2008). Gene silencing in plants

using artificial microRNAs and other small RNAs. Plant J 53, 674-690.

Panter, S., Thomson, R., de Bruxelles, G., Laver, D., Trevaskis, B., and

Udvardi, M. (2000). Identification with proteomics of novel proteins

associated with the peribacteroid membrane of soybean root nodules.

Mol Plant Microbe Interact 13, 325-333.

Paredez, A.R., Somerville, C.R., and Ehrhardt, D.W. (2006). Visualization

of cellulose synthase demonstrates functional association with

microtubules. Science 312, 1491-1495.

102

Peck, M.C., Fisher, R.F., and Long, S.R. (2006). Diverse flavonoids stimulate

NodD1 binding to nod gene promoters in Sinorhizobium meliloti. J

Bacteriol 188, 5417-5427.

Peskan, T., Westermann, M., and Oelmuller, R. (2000). Identification of

low-density Triton X-100-insoluble plasma membrane microdomains in

higher plants. Eur J Biochem 267, 6989-6995.

Peters, N.K., Frost, J.W., and Long, S.R. (1986). A plant flavone, luteolin,

induces expression of Rhizobium meliloti nodulation genes. Science 233,

977-980.

Pike, L.J. (2006). Rafts defined: a report on the Keystone Symposium on Lipid

Rafts and Cell Function. J Lipid Res 47, 1597-1598.

Pust, S., Dyve, A.B., Torgersen, M.L., van Deurs, B., and Sandvig, K.

(2010). Interplay between toxin transport and flotillin localization. PLoS

One 5, e8844.

Quandt, H.J., Pühler, A., and Broer, I. (1993). Transgenic root nodules of

Vicia hirsuta: A fast and efficient system for the study of gene

expression in indeterminate-type nodules. Mol Plant-Microbe Interact 6,

699-706.

Radutoiu, S., Madsen, L.H., Madsen, E.B., Felle, H.H., Umehara, Y.,

Gronlund, M., Sato, S., Nakamura, Y., Tabata, S., Sandal, N., and

Stougaard, J. (2003). Plant recognition of symbiotic bacteria requires

two LysM receptor-like kinases. Nature 425, 585-592.

Raffaele, S., Bayer, E., Lafarge, D., Cluzet, S., German Retana, S.,

Boubekeur, T., Leborgne-Castel, N., Carde, J.P., Lherminier, J.,

Noirot, E., Satiat-Jeunemaitre, B., Laroche-Traineau, J., Moreau,

P., Ott, T., Maule, A.J., Reymond, P., Simon-Plas, F., Farmer, E.E.,

Bessoule, J.J., and Mongrand, S. (2009). Remorin, a Solanaceae

103

protein resident in membrane rafts and plasmodesmata, impairs potato

virus X movement. Plant Cell 21, 1541-1555.

Reuter, A., Binkle, U., Stuermer, C.A., and Plattner, H. (2004). PrPc and

reggies/flotillins are contained in and released via lipid-rich vesicles in

Jurkat T cells. Cell Mol Life Sci 61, 2092-2099.

Riely, B.K., Lougnon, G., Ané, J.M., and Cook, D.R. (2007). The symbiotic

ion channel homolog DMI1 is localized in the nuclear membrane of

Medicago truncatula roots. Plant J 49, 208-216.

Riento, K., Frick, M., Schafer, I., and Nichols, B.J. (2009). Endocytosis of

flotillin-1 and flotillin-2 is regulated by Fyn kinase. J Cell Sci 122, 912-

918.

Rivera-Milla, E., Stuermer, C.A., and Malaga-Trillo, E. (2006). Ancient

origin of reggie (flotillin), reggie-like, and other lipid-raft proteins:

convergent evolution of the SPFH domain. Cell Mol Life Sci 63, 343-

357.

Robatzek, S., Chinchilla, D., and Boller, T. (2006). Ligand-induced

endocytosis of the pattern recognition receptor FLS2 in Arabidopsis.

Genes Dev 20, 537-542.

Robinson, P., Etheridge, S., Song, L., Armenise, P., Jones, O.T., and

Fitzgerald, E.M. (2010). Formation of N-type (Cav2.2) voltage-gated

calcium channel membrane microdomains: Lipid raft association and

clustering. Cell Calcium 48, 183-194.

Roche, P., Lerouge, P., Ponthus, C., and Promé, J.C. (1991a). Structural

determination of bacterial Nodulation Factors involved in the Rhizobium

meliloti-alfalfa symbiosis. J Biol Chem 266, 10933-10940.

Roche, P., Debellé, F., Maillet, F., Lerouge, P., Faucher, C., Truchet, G.,

Dénarié, J., and Promé, J.C. (1991b). Molecular basis of symbiotic

104

host specificity in Rhizobium meliloti: nodH and nodPQ genes encode

the sulfation of lipo-oligosaccharide signals. Cell 67, 1131-1143.

Saalbach, G., Erik, P., and Wienkoop, S. (2002). Characterisation by

proteomics of peribacteroid space and peribacteroid membrane

preparations from pea (Pisum sativum) symbiosomes. Proteomics 2,

325-337.

Saito, K., Yoshikawa, M., Yano, K., Miwa, H., Uchida, H., Asamizu, E.,

Sato, S., Tabata, S., Imaizumi-Anraku, H., Umehara, Y., Kouchi, H.,

Murooka, Y., Szczyglowski, K., Downie, J.A., Parniske, M., Hayashi,

M., and Kawaguchi, M. (2007). NUCLEOPORIN85 is required for

calcium spiking, fungal and bacterial symbioses, and seed production in

Lotus japonicus. Plant Cell 19, 610-624.

Sallstrom, B., and Andersson, S.G. (2005). Genome reduction in the alpha-

Proteobacteria. Curr Opin Microbiol 8, 579-585.

Schauser, L., Wieloch, W., and Stougaard, J. (2005). Evolution of NIN-like

proteins in Arabidopsis, rice, and Lotus japonicus. J Mol Evol 60, 229-

237.

Schauser, L., Roussis, A., Stiller, J., and Stougaard, J. (1999). A plant

regulator controlling development of symbiotic root nodules. Nature

402, 191-195.

Schauser, L., Handberg, K., Sandal, N., Stiller, J., Thykjaer, T., Pajuelo,

E., Nielsen, A., and Stougaard, J. (1998). Symbiotic mutants deficient

in nodule establishment identified after T-DNA transformation of Lotus

japonicus. Mol Gen Genet 259, 414-423.

Schneider, A., Rajendran, L., Honsho, M., Gralle, M., Donnert, G.,

Wouters, F., Hell, S.W., and Simons, M. (2008). Flotillin-dependent

clustering of the amyloid precursor protein regulates its endocytosis and

amyloidogenic processing in neurons. J Neurosci 28, 2874-2882.

105

Schulte, T., Paschke, K.A., Laessing, U., Lottspeich, F., and Stuermer, C.A.

(1997). Reggie-1 and reggie-2, two cell surface proteins expressed by

retinal ganglion cells during axon regeneration. Development 124, 577-

587.

Schultze, M., Staehelin, C., Röhrig, H., John, M., Schmidt, J., Kondorosi,

E., Schell, J., and Kondorosi, A. (1995). In vitro sulfotransferase

activity of Rhizobium meliloti NodH protein: lipochitooligosaccharide

nodulation signals are sulfated after synthesis of the core structure. Proc

Natl Acad Sci U S A 92, 2706-2709.

Schwab, R., Ossowski, S., Riester, M., Warthmann, N., and Weigel, D.

(2006). Highly specific gene silencing by artificial microRNAs in

Arabidopsis. Plant Cell 18, 1121-1133.

Shearman, C.A., Rossen, L., Johnston, A.W., and Downie, J.A. (1986). The

Rhizobium leguminosarum nodulation gene nodF encodes a polypeptide

similar to acyl-carrier protein and is regulated by nodD plus a factor in

pea root exudate. EMBO J 5, 647-652.

Smit, P., Raedts, J., Portyanko, V., Debellé, F., Gough, C., Bisseling, T.,

and Geurts, R. (2005). NSP1 of the GRAS protein family is essential

for rhizobial Nod Factor-induced transcription. Science 308, 1789-1791.

Smit, P., Limpens, E., Geurts, R., Fedorova, E., Dolgikh, E., Gough, C.,

and Bisseling, T. (2007). Medicago LYK3, an entry receptor in

rhizobial Nodulation Factor signaling. Plant Physiol 145, 183-191.

Solis, G.P., Hoegg, M., Munderloh, C., Schrock, Y., Malaga-Trillo, E.,

Rivera-Milla, E., and Stuermer, C.A. (2007). Reggie/flotillin proteins

are organized into stable tetramers in membrane microdomains. Biochem

J 403, 313-322.

Solomon, S., Masilamani, M., Rajendran, L., Bastmeyer, M., Stuermer,

C.A., and Illges, H. (2002). The lipid raft microdomain-associated

106

protein reggie-1/flotillin-2 is expressed in human B cells and localized at

the plasma membrane and centrosome in PBMCs. Immunobiology 205,

108-119.

Spaink, H.P., Kondorosi, A., and and Hooykaas, P.J.J., (eds). (1998). The

Rhizobiaceae: Molecular Biology of Model Plant-Associated Bacteria.

Kluwer Academic Publishers, Boston, MA, 387-402.

Starker, C.G., Parra-Colmenares, A.L., Smith, L., Mitra, R.M., and Long,

S.R. (2006). Nitrogen fixation mutants of Medicago truncatula fail to

support plant and bacterial symbiotic gene expression. Plant Physiol 140,

671-680.

Stracke, S., Kistner, C., Yoshida, S., Mulder, L., Sato, S., Kaneko, T.,

Tabata, S., Sandal, N., Stougaard, J., Szczyglowski, K., and

Parniske, M. (2002). A plant receptor-like kinase required for both

bacterial and fungal symbiosis. Nature 417, 959-962.

Stuermer, C.A. (2010). The reggie/flotillin connection to growth. Trends Cell

Biol 20, 6-13.

Stuermer, C.A., Lang, D.M., Kirsch, F., Wiechers, M., Deininger, S.O., and

Plattner, H. (2001). Glycosylphosphatidyl inositol-anchored proteins

and fyn kinase assemble in noncaveolar plasma membrane

microdomains defined by reggie-1 and -2. Mol Biol Cell 12, 3031-3045.

Stuermer, C.A., Langhorst, M.F., Wiechers, M.F., Legler, D.F., Von

Hanwehr, S.H., Guse, A.H., and Plattner, H. (2004). PrPc capping in

T cells promotes its association with the lipid raft proteins reggie-1 and

reggie-2 and leads to signal transduction. FASEB J 18, 1731-1733.

Sutter, J.U., Campanoni, P., Tyrrell, M., and Blatt, M.R. (2006). Selective

mobility and sensitivity to SNAREs is exhibited by the Arabidopsis

KAT1 K+ channel at the plasma membrane. Plant Cell 18, 935-954.

107

Suzuki, T., Du, F., Tian, Q.B., Zhang, J., and Endo, S. (2008).

Ca2+/calmodulin-dependent protein kinase IIα clusters are associated

with stable lipid rafts and their formation traps PSD-95. J Neurochem

104, 596-610.

Tirichine, L., Imaizumi-Anraku, H., Yoshida, S., Murakami, Y., Madsen,

L.H., Miwa, H., Nakagawa, T., Sandal, N., Albrektsen, A.S.,

Kawaguchi, M., Downie, A., Sato, S., Tabata, S., Kouchi, H.,

Parniske, M., Kawasaki, S., and Stougaard, J. (2006). Deregulation of

a Ca2+/calmodulin-dependent kinase leads to spontaneous nodule

development. Nature 441, 1153-1156.

Turner, G.L., Gibson, A.H. (1980). Measurement of nitrogen fixation by

indirect means. In Methods for evaluation biological nitrogen fixation,

F.J. Bergersen, ed (Chichester, UK: John Wiley & Sons), pp. 111-138.

Utrup, L.J., Cary, A.J., and Norris, J.H. (1993). Five Nodulation Mutants of

White Sweetclover (Melilotus alba Desr.) Exhibit Distinct Phenotypes

Blocked at Root Hair Curling, Infection Thread Development, and

Nodule Organogenesis. Plant Physiol 103, 925-932.

Van de Velde, W., Zehirov, G., Szatmari, A., Debreczeny, M., Ishihara, H.,

Kevei, Z., Farkas, A., Mikulass, K., Nagy, A., Tiricz, H., Satiat-

Jeunemaitre, B., Alunni, B., Bourge, M., Kucho, K., Abe, M.,

Kereszt, A., Maroti, G., Uchiumi, T., Kondorosi, E., and Mergaert,

P. (2010). Plant peptides govern terminal differentiation of bacteria in

symbiosis. Science 327, 1122-1126.

Wais, R.J., Keating, D.H., and Long, S.R. (2002). Structure-function analysis

of Nod Factor-induced root hair calcium spiking in Rhizobium-legume

symbiosis. Plant Physiol 129, 211-224.

Wais, R.J., Galera, C., Oldroyd, G., Catoira, R., Penmetsa, R.V., Cook, D.,

Gough, C., Dénarié, J., and Long, S.R. (2000). Genetic analysis of

108

calcium spiking responses in nodulation mutants of Medicago

truncatula. Proc Natl Acad Sci U S A 97, 13407-13412.

Wang, D., Griffitts, J., Starker, C., Fedorova, E., Limpens, E., Ivanov, S.,

Bisseling, T., and Long, S. (2010). A nodule-specific protein secretory

pathway required for nitrogen-fixing symbiosis. Science 327, 1126-

1129.

Watarai, M., Makino, S., Fujii, Y., Okamoto, K., and Shirahata, T. (2002).

Modulation of Brucella-induced macropinocytosis by lipid rafts

mediates intracellular replication. Cell Microbiol 4, 341-355.

Werner, D., and Newton, W.E., (eds). (2005). Nitrogen Fixation in

Agriculture, Forestry, Ecology, and the Environment. Springer,

Dordrecht, The Netherlands, 347 pp.

Winzer, T., Bairl, A., Linder, M., Linder, D., Werner, D., and Muller, P.

(1999). A novel 53-kDa nodulin of the symbiosome membrane of

soybean nodules, controlled by Bradyrhizobium japonicum. Mol Plant

Microbe Interact 12, 218-226.

Yang, Z. (2008). Cell polarity signaling in Arabidopsis. Annu Rev Cell Dev

Biol 24, 551-575.

Yano, K., Yoshida, S., Muller, J., Singh, S., Banba, M., Vickers, K.,

Markmann, K., White, C., Schuller, B., Sato, S., Asamizu, E.,

Tabata, S., Murooka, Y., Perry, J., Wang, T.L., Kawaguchi, M.,

Imaizumi-Anraku, H., Hayashi, M., and Parniske, M. (2008).

CYCLOPS, a mediator of symbiotic intracellular accommodation. Proc

Natl Acad Sci U S A 105, 20540-20545.

Yokota, K., Fukai, E., Madsen, L.H., Jurkiewicz, A., Rueda, P., Radutoiu,

S., Held, M., Hossain, M.S., Szczyglowski, K., Morieri, G., Oldroyd,

G.E., Downie, J.A., Nielsen, M.W., Rusek, A.M., Sato, S., Tabata, S.,

James, E.K., Oyaizu, H., Sandal, N., and Stougaard, J. (2009).

109

Rearrangement of actin cytoskeleton mediates invasion of Lotus

japonicus roots by Mesorhizobium loti. Plant Cell 21, 267-284.

Yokoyama, H., Fujii, S., and Matsui, I. (2008). Crystal structure of a core

domain of stomatin from Pyrococcus horikoshii illustrates a novel

trimeric and coiled-coil fold. Journal of Molecular Biology 376, 868-

878.

Zahran, H.H. (1999). Rhizobium-legume symbiosis and nitrogen fixation

under severe conditions and in an arid climate. Microbiol Mol Biol Rev

63, 968-989, table of contents.

Zappel, N.F., and Panstruga, R. (2008). Heterogeneity and lateral

compartmentalization of plant plasma membranes. Curr Opin Plant Biol

11, 632-640.