Embed Size (px)
Citation preview
The role of GSK3 as a virulence factor
in Plasmodium infection
Leonardo Filipe Lemos Rocha
Thesis to obtain the Master of Science Degree in
Microbiology
Supervisors
Doctor Iset Medina Vera
Professor Doctor Arsénio do Carmo Sales Mendes Fialho
Examination Committee
Chairperson: Prof. Dr. Jorge Humberto Gomes Leitão
Supervisor: Dr. Iset Medina Vera
Member of the Committee: Dr. João Alexandre Guarita da Silva Rodrigues
November 2017
ii
This Master’s dissertation was performed in the Maria Mota’s laboratory, from the Instituto de
Medicina Molecular (iMM), during the academic year of 2016/2017.
Faculdade de Medicina da Universidade de Lisboa
Avenida Professor Egas Moniz 1649-028 Lisboa Portugal Edificio Egas Moniz, P3B-41
iMM Lisboa general contact (+351) 217 999 511
iii
Acknowledgments
Firstly, I would like to acknowledge Dr. Maria Mota for the opportunity to work in her lab. It was
a great pleasure to have her support and guidance and I thank her for believing in the project and for
being a model as a scientist.
I would like to express my huge gratitude to my supervisor Dr. Iset Vera: Iset, I have to thank
you for your massive support. You taught me how to be a scientist. How to think, how to plan, how to
execute, how to troubleshoot (a lot), how to create, how to interpret, how to criticize results, how to not
be afraid of failure and how to pursue success. I have to thank you for your patience, for explaining me
the same thing 3 or 4 times if necessary. I acknowledge the opportunity of being your student and learn
with/from you. Thank you for believing in me. Thank you for listening to my opinions and suggestions.
Thank you for your constant positive attitude. Thank you for always trying to make me see the bright
side of life. As a matter of fact, before, being my boss, you are a great friend. I know that you are a friend
that I count for life. Gracias!
I would like to also acknowledge my co-supervisor Prof. Dr. Arsénio Fialho for the constant
support during the year and for the help in this last process of writing, delivering and presenting the
thesis. Furthermore, I express my gratitude to the Master’s course supervisor Prof. Dr. Isabel Sá Correia,
also, for the continuous support.
I also, would like to express my gratitude to Dr. João Rodrigues, who kindly accepted to be a
jury on my defense.
I acknowledge the big family from the MMota lab. Thank you all for having received me so kindly.
Thank you, Sofia, for being our “lab mommy”, always with an unconditional support. Thank you,
Parreirinha, for your total availability for everything, especially with your persistent affection. Thanks to
the BEST PhD students ever: Thank you Apu, for being such a nice friend, always ready to help, not
only in terms of work but also personally, always with a friendly word to say. Thank you, Viriato, for your
friendship and full support and concern. You are a greaaaaat friend! Thank you João, my gambling
friend, for your constant help in everything. Thank you, Sara, for always keeping (or trying to keep) me
motivated. A big thanks to Debanjan, despite not knowing how to choose football clubs, for your
persistent motivation. Additionally, I would like to thank our brazilian friends Priscila and Maria. Then, I
would like to express my gratitude to the amazing Post-docs: Ângelo, thank you for your support and
concern and for your honest advices. Thank you, Vanessa, also for your help and advices. Thank you,
Inês, for your support, especially for your personal point of view. Thank you, Ksenija for your total
availability and help. Thank you, Sonali, also, for your help and care. Moreover, I would like to thank to
my buddy Miguel, especially, for your friendship. Finally, I would also like to acknowledge Liliana,
Margarida Ruivo and Lénia who were present when I arrived and made a great job by helping me to
integrate into the lab, as everyone.
Thank you, Inesita, for being my lab sister, for your honest friendship, for your absolute
availability to help, to talk and to listen… You are, indeed, a huge friend.
iv
Additionally, I would like to acknowledge all the iMM community, especially the Bioimaging
Facility, from which I received a huge help from António Temudo and from Ana Nascimento. Thank you
both for your support. In addition, a word of gratitude also to the Rodent Facility and to the Flow
Cytometry Unit. Furthermore, I would like to thank to Miguel Prudêncio, Luísa Figueiredo and Thomas
Hanscheid Labs for all the discussions and for all the exchange of material.
I thank all my biggest friends Miguel, Tomás, Afonso, Mariana, Eduardo, Bárbara, Cláudia,
Perdiz, Gonçalo, Luís, Verde, Gisela, Soraia, Catarina, Cotovio and Inês. Thank you all for being who
you are.
Additionally, I would like to express my gratitude to my Taekwondo family, Zen Kwon. Thank
you for teaching me how to grow up as an athlete and as a person.
A special gratitude to my family, to my younger sisters (Bea and Adriana), to my father, to my
uncle Carlos Filipe, aunt Tia Luísa and, especially, to my mother. Thank you for your education,
motivation and constant care.
I would like to express my deep feelings to my lovely Loirinha (Raquel). Thank you for being
who you are. Thank you for being so important. Thank you for letting me be part of your life and for
making part of mine. Thank you for being so close despite the distance. Thank you for being my
inspiration and love.
The last, but not the least, I would like to acknowledge the best woman that I have ever met, my
grandmother. Elisita, thank you for all your education and values. I ensure you that I use them every
day, as they are part of who I am. Thank for being such a wonderful inspiration. Thank you for being my
refuge. Even so, I have already accepted your apologies for leaving us. I hope that your wishes have
come true and you are in a better place. Nonetheless, you will always be my shining star, always taking
care of me. Therefore, I fully dedicate not only, this thesis but also my entire academic journey. Para a
minha Avó sempre amiga!
v
Abstract
Malaria is an infectious disease caused by Plasmodium parasites in which kinases are crucial
regulators of cellular processes and virulence. Glycogen Synthase Kinase 3 (GSK3) is one such kinase
considered as a target for antimalarial therapy and it is hypothesized to be involved in the regulation of
virulence during the erythrocytic cycle. Preliminary data shows that GSK3 null parasites are attenuated
with decreased replication. To gain further insight into its function and regulation in Plasmodium,
transgenic parasites expressing an epitope tagged GSK3 were used to study the spatial-temporal
dynamic expression of GSK3. Initial characterization shows that kinase expression is lower in early
parasite development but increases during parasite growth, with peak of expression during the phase
of active nuclear replication and maturation of daughter parasites. Furthermore, GSK3 was readily
detectable within the confines of the parasite, within the parasite cytoplasm, nucleus, and endoplasmic
reticulum in a diffuse and speckled pattern. During schizont stage, GSK3 co-localises with PbAMA1 and
PbSUB1, apically localized proteins within secretory organelles that function in invasion and egress,
respectively. Furthermore, a protocol was established to co-immunoprecipitate epitope-tagged PbGSK3
for the identification of possible GSK3 interacting proteins and substrates. Finally, a knockout genetic
complementation approach with wild type and non-functional kinase mutant was attempted to
complement the GSK3 deletion mutant. All in all, according to the obtained data, GSK3 might have a
key role in the parasite replication and in the function of mature merozoites, such as egress and/or
invasion processes.
Keywords
Egress; GSK3; Invasion; Plasmodium; Replication; Virulence
vi
vii
Resumo
A malária é uma doença infecciosa causada por parasitas de Plasmodium, nas quais as cinases
são reguladores cruciais dos processos celulares e da virulência. Glycogen Synthase Kinase 3 (GSK3)
é uma das cinases considerada como alvo antimalárico e pensa-se estar envolvida na regulação da
virulência, durante o ciclo eritrocítico. Dados preliminares mostram que os parasitas mutantes para
GSK3 são atenuados e têm uma replicação diminuída. Para obter mais informações sobre sua função
e regulação em Plasmodium, parasitas transgénicos que expressam GSK3 marcada com epítopos
foram utilizados para estudar a dinâmica da expressão espacial-temporal da GSK3. Uma
caracterização inicial mostra que a expressão da cinase é menor no desenvolvimento precoce do
parasita, mas aumenta durante o crescimento do mesmo, com um pico durante a fase de replicação
nuclear e amadurecimento da progenia. Além disso, GSK3 foi detetada no interior do parasita, difusa,
mas pontuado, dentro do citoplasma, núcleo e reticulo endoplasmático. Em esquizontes, GSK3 co-
localiza com PbAMA1 e PbSUB1, proteínas provenientes de organelos secretores que atuam na
invasão e saída dos merozoítos, respetivamente. Além disso, foi estabelecido um protocolo para co-
imunoprecipitar PbGSK3 marcada com epítopos para a identificação de possíveis proteínas e
substratos que interagem com GSK3. Finalmente, foi realizada uma abordagem de complementação
genética, de tipo selvagem e mutante não funcional, para complementar o mutante de deleção de
GSK3. Em suma, de acordo com os dados obtidos, a GSK3 pode ter um papel fundamental na
replicação do parasita e em funções dos merozoítos maduros, como processos de saída e/ou invasão.
Palavras-chave
Invasão; GSK3; Plasmodium; Replicação; Saída; Virulência
viii
ix
Graphical Abstract
GSK3 might have a role in parasite replication (schizogony)
GSK3 might have a role in erythrocyte invasion
x
xi
Table of Contents
Acknowledgments ................................................................................................................................... iii
Abstract .................................................................................................................................................... v
Resumo ................................................................................................................................................... vii
Graphical Abstract ................................................................................................................................... ix
Table of Contents .................................................................................................................................... xi
List of Figures and Tables ...................................................................................................................... xiii
List of Abbreviations ............................................................................................................................... xv
Introduction ............................................................................................................................................. 1
1. Malaria......................................................................................................................................... 1
1.1 The burden of Malaria ......................................................................................................... 1
2. Mice models in Malaria ............................................................................................................... 4
3. Plasmodium Life cycle ................................................................................................................. 5
3.1 Invasion into host erythrocytes ........................................................................................... 8
3.2 Cell division in Plasmodium parasites ............................................................................... 11
4. Kinases in Plasmodium .............................................................................................................. 13
5. Glycogen Synthase Kinase 3 (GSK3) .......................................................................................... 15
5.1 GSK3 in high eukaryotes .................................................................................................... 15
5.2 GSK3 in unicellular Eukaryotes .......................................................................................... 16
5.3 GSK3 in Plasmodium spp. .................................................................................................. 17
Motivation and Research aims .............................................................................................................. 21
Materials and Methods ......................................................................................................................... 22
1. Ethics Statement ....................................................................................................................... 22
2. Statistics .................................................................................................................................... 22
3. Mice and Parasites .................................................................................................................... 22
3.1 In vivo infection with Plasmodium berghei parasites ........................................................ 23
3.2 In vitro synchronization of Plasmodium berghei parasites ............................................... 23
3.2.1 Immunofluorescence assays: ........................................................................................ 23
3.2.2 Immunoblotting (IB) Assays .......................................................................................... 24
3.2.3 Immunoprecipitation (IP) Assays................................................................................... 25
4. Molecular cloning in Plasmodium berghei: Generation of plasmids for the Pb∆gsk3
complementation .............................................................................................................................. 26
4.1 Transfection of the generated Pb∆gsk3 complement plasmids ....................................... 27
xii
5. Plasmodium falciparum in vitro culture .................................................................................... 28
5.1 Molecular cloning in Plasmodium falciparum: Generation of plasmids for the generation
of the Pfgsk3-gfp tagged line ........................................................................................................ 28
5.2 Transfection of the generated Pfgsk3-gfp plasmid ........................................................... 29
RESULTS AND DISCUSSION .................................................................................................................... 31
1. Spatial-temporal dynamics ............................................................................................................ 31
1.1. PbGSK3 tagged lines characterization ............................................................................... 31
1.1.1. Characterization at the genomic level........................................................................... 31
1.1.2. Functional characterization of the PbGSK3 tagged lines............................................... 32
1.1.2.1. Functional characterization: PbGSK3-HA epitope-tagged line .................................. 32
1.1.2.2. Functional characterization: PbGSK3-GFP fusion-tagged line ................................... 33
1.2. Generation of a PfGSK3-GFP fusion-tagged parasite line ................................................. 36
1.3. Towards the characterization of GSK3 expression fluctuation ......................................... 37
2. Towards the Identification of GSK3 interacting proteins and substrates ..................................... 49
2.1. Search for potential GSK3 substrates on PlasmoDB ......................................................... 49
2.2. Search for potential GSK3 substrates on STRING .............................................................. 52
2.3. Assessment of the GSK3 substrates: optimization of PbGSK3-HA Immuno-Precipitation 54
3. PbΔgsk3 complementation studies ............................................................................................... 59
3.1. Generation of the PbΔgsk3 complement plasmids ........................................................... 59
3.2. Transfection of the generated vectors .............................................................................. 61
3.3. Functional characterization of the PbΔgsk3 complement clones ..................................... 63
3.4. Troubleshooting the lack of phenotypic reversion in the PbΔgsk3 complement parasites
66
Conclusions and future perspectives .................................................................................................... 68
References ............................................................................................................................................. 72
Supplementary Material ....................................................................................................................... 76
xiii
List of Figures and Tables
Figure 1 – Global Malaria Mapper 2015 from WHO 2016. ...................................................................... 1
Figure 2 – Countries endemic for malaria in 2000 and 2016 from World Malaria Report 2016. ............. 2
Figure 3 – Estimated malaria cases (millions) in 2015 from World Malaria Report 2016. ...................... 3
Figure 4 – Injection of sporozoites into the human host's skin ................................................................ 5
Figure 5 – Plasmodium liver stage. ......................................................................................................... 6
Figure 6 – Plasmodium erythrocyte cycle. .............................................................................................. 6
Figure 7 – Gametocyte fertilization.. ........................................................................................................ 7
Figure 8 – Schematic representation of the cellular structures and the apical complex from the
merozoite. ................................................................................................................................................ 8
Figure 9 – Erythrocyte invasion by Plasmodium merozoites. ................................................................. 9
Figure 10 – Schizogony replication from Plasmodium parasites. . ...................................................... 12
Figure 11 – Comparison between P. berghei (A) and P. falciparum (B) kinomes. ............................. 13
Figure 12 – Amino acid sequence from the activation center of GSK3 in different orthologues ........... 18
Figure 13 – PbΔgsk3 parasites possess in vitro and in vivo phenotypes. ............................................ 20
Figure 14 – Genotyping of the parasite clones revealed positive integration of the GSK3 epitope-tags
............................................................................................................................................................... 32
Figure 15 – Pbgsk3-ha clone A4 showed positive phenotypic functionality .......................................... 34
Figure 16 – Both Pbgsk3-gfp clones showed positive phenotypic functionality .................................... 35
Figure 17 – Generation of an epitope-tagged PfGSK3-GFP by single homologous recombination ..... 36
Figure 18 – PfGSK3-GFP epitope-tagged line was successfully detected by immunofluorescence .. 37
Figure 19 – PbGSK3 is expressed throughout the erythrocytic cycle, having peaks of expression
during schizogony and at fully segmented schizonts ............................................................................ 38
Figure 20 – PbGSK3 has an increased expression throughout the erythrocytic cycle, having peaks of
expression during schizogony and in fully segmented schizonts .......................................................... 41
Figure 21 – PbGSK3 does not co-localize within the PVM and partially co-localises with the ER during
the trophozoite stage of the erythrocytic cycle ...................................................................................... 42
Figure 22 – PbGSK3 does not co-localize within the PVM and partially co-localises with the ER during
the late trophozoite stage of the erythrocytic cycle ............................................................................... 42
Figure 23 – PbGSK3 does not co-localize within the PVM and partially co-localises with the ER during
the late trophozoite in schizogony during the erythrocytic cycle ........................................................... 43
Figure 24 – PbGSK3 does not co-localize within the PVM and partially co-localises with the ER in
schizonts during the erythrocytic cycle .................................................................................................. 43
Figure 25 – PbGSK3 does not co-localize in the merozoite surface in the schizonts stage during the
erythrocytic cycle ................................................................................................................................... 44
Figure 26 – PbGSK3 t co-localize with the PbAMA1 and PbSUB1 apical proteins in the schizonts
stage during the erythrocytic cycle in samples fixed with acetone:methanol ........................................ 44
xiv
Figure 27 – GSK3 co-localises with AMA1 and SUB1 accordingly to a global statistical analysis ....... 46
Figure 28 – GSK3 is detected at the live imaging level ......................................................................... 47
Figure 29 – 185 Plasmodium genes are putative targets of GSK3 Search strategy system from
PlasmoDB .............................................................................................................................................. 49
Figure 30 – GO terms enrichment analysis for the putative targets of PbGSK3................................... 51
Figure 31 – An interaction network of 10 proteins was given by the STRING software for PfGSK3. ... 52
Figure 32 – PfCRK5 has a putative recognition site that can be phosphorylated by GSK3 NetPhosK
algorithm ................................................................................................................................................ 53
Figure 33 – PbGSK3-HA is detected both in the parasite soluble and insoluble fractions, depending on
the parasite stage of development during the erythrocytic cycle .......................................................... 55
Figure 34 – PbGSK3-HA is successfully immune-precipitated with anti-HA agarose beads using RIPA
as lysis buffer. ........................................................................................................................................ 56
Figure 35 – PbGSK3-HA is successfully immune-precipitated with anti-HA agarose beads using
CHAPS as lysis buffer. . ....................................................................................................................... 56
Figure 36 – PbGSK3-HA is successfully immune-precipitated with anti-HA agarose beads using 1%
SDS as lysis buffer ................................................................................................................................ 57
Figure 37 – Preliminary data showed no differences in the bands pattern in Silver staining despite a
positive detection of PbGSK3-HA after IP ............................................................................................. 58
Figure 38 – Generation of the Pb∆gsk3 complemented parasite lines ................................................ 60
Figure 39 – Pb∆gsk+ogsk3 clone A1 and Pb∆gsk+gsk3-YF clone D1 showed positive recombination
and integration of both ogsk3 versions parasite lines. .......................................................................... 62
Figure 40 – Positive RNA expression of the ogsk3 in the Pb∆gsk3+ogsk3 and Pb∆gsk3+gsk3 clones
............................................................................................................................................................... 62
Figure 41 – PbΔgsk3+ogsk3 did not reverted the phenotypic functionality of the PbΔgsk3 parasites . 65
Figure 42 – All the parasites in the infectivity assay for the functional complementation of PbΔgsk3
parasites showed positive amplification of the ogsk3 plus its flanking regions ..................................... 66
Figure 43 – No episomal contamination was detected in the PbΔgsk3 complement parasites ........... 67
Figure 44 – ogsk3 is expressed at the mRNA level ............................................................................. 67
Table 1 – PlasmoDB genome database about gsk3 orthologues in P. berghei and P. falciparum. ..... 17
Table 2 – List of antibodies that were used for the achievement of the IFA and IB metholodies ......... 29
Table 3 – List of primers that were used for the generation and genotyping of all the parasite lines used
in this project ......................................................................................................................................... 30
Supplementary Figure 1-Ponceau staining control ............................................................................... 76
Supplementary Figure 2- Plasmid used for the molecular cloning of the complemented lines. ........... 76
Supplementary Figure 4- Genotyping strategy for the amplification of the different regions. Scheme
representation of the expected recombination. ................................................................................... 77
Supplementary Figure 5- 1Kb plus ladder ............................................................................................. 77
xv
List of Abbreviations
Abbreviation Definition
µg Microgram
µL Microliter
µm Micrometers
5’FC 5-Fluorocytosine
AMA1 Apical membrane antigen 1
AMPK Adenosine monophosphate protein kinase
ANOVA Analysis of variances
AP2 Apetala 2
BSA Bovine serum albumin
CCM Complete culture medium
cDNA Complementary DNA
CDK Cyclin-dependent kinase
CDPKs Calcium dependent protein kinase CO2 Carbon dioxide
CRK CDK-related kinase
CST Cell signalling technologies
DNA Deoxyribonucleic acid
dpi Days post infection
ECM Experimental cerebral malaria
EM Electron-microscopy
ER Endoplasmic reticulum
F Phenylalanine
FBS Fetal bovine serum
FIKK Phenylalanine-isoleucine-lysine-lysine amino acid motive
FR Flanking region
gDNA Genomic DNA
GFP Green fluorescent protein
GO Gene ontology
GTS Global technical strategy
HA Hemagglutinin
hDHFR Human dihydrofolate reductase
HR Homologous region
HRP Horseradish peroxidase
Hs Homo sapiens
ICCB Intensity correlation coefficient-based
IB Immunoblotting
IFA Immunofluorescence analysis
iMM Instituto de Medicina Molecular
IP Immuno-precipitation
iRBC Infected RBC
kb kilobases
LB Luria-bertani
xvi
Ld Leishmania donovani
Li Leishemania infantum
Lm Leishemania major
MAPKK Mitogen-activated protein kinase kinases
Mass Spec Mass spectrometry
MCM Malaria complete medium
mRNA Messenger RNA
min Minutes
mL Millilitre
mM millimolar
MSP Merozoite surface protein
MTOC Microtubule organizing centre
NaCl Sodium chlorite
NCBI National Centre for Biotechnology Information
ng nanograms
ns Non-significant
O2 Oxygen
ogsk3 Optimized version of gsk3
Pb Plasmodium berghei
PBS Phosphate buffer saline
PCR Polymerase chain reactions
Pf Plasmodium falciparum
PFA Paraformaldehyde
PK Protein kinase
PlasmoDB Plasmodium data base
PV Parasitophorous vacuole
PVM Parasitophorous vacuole membrane
RBC Red blood cells
RIPA Radioimmunoprecipitation assay buffer
RNA Ribonucleic acid
RNAi RNA interference
RON Rhoptry neck protein
rpm Rotations per minute
RT Reverse transcriptase
SDM Site-directed mutagenesis
SDS Sodium dodecyl sulfate
sec Seconds
SERA Serine repeat antigens
SOB Super optimal broth
ß-ME ß-mercaptoethanol
STRING Search Tool for the Retrieval of Interacting genes/Proteins
T Threonine
Tb Trypanosoma brucei
TBS Tris buffer saline
WT Wild type
Y Tyrosine
1
Introduction
1. Malaria
Malaria is one of the most important vector-borne infection diseases in the world which,
according to the latest estimates from the World Health Organization (WHO), caused approximately 212
million new cases worldwide and an estimated number of 429 000 malaria deaths in 2016. This disease
is caused by the Plasmodium parasite, and is transmitted by female Anopheles mosquitoes. There are
six different species that infect humans: Plasmodium falciparum, Plasmodium vivax, Plasmodium ovale,
Plasmodium malariae and two zoonosis: Plasmodium Knowles and Plasmodium simium. Amongst
these, P. falciparum and P. vivax are the most prevalent, from which P. falciparum is the most virulent
being associated with the highest rates of illnesses and mortality (WHO, 2016).
1.1 The burden of Malaria
Malaria, as a vector-borne infection, has a huge impact on world society (Sachs and Malaney,
2002). The burden of this disease affects millions of people all around the planet, especially children
under five years old. Those children account for more than two thirds of the mortalities caused by this
disease which stands for, approximately, 303 000 deaths. Most of these cases (90%) occurs in Africa
which is the region that has the highest prevalence and incidence. The Figure 1, showed below,
represents the Global Malaria Mapper, from WHO, where it is possible to observe the incidence of the
disease worldwide, namely in the African continent. Moreover, it is also possible to infer malaria
distribution at a worldwide level namely in the South-East Asia, Eastern Mediterranean and American
regions (WHO, 2016).
Figure 1 – Global Malaria Mapper 2015 from WHO 2016.
Figure 2 – Countries endemic for malaria in 2000 and 2016 from
World Malaria Report 2016.Figure 3 – Global Malaria Mapper
2015 from WHO 2016.
2
Despite the strong incidence of this disease, in the past decade there has been a considerable
progress done in the fight against malaria. Since 2000 until 2015, there was a reduction in the global
incidence rate by 41%, and by 21% between 2010 and 2015. Regarding mortality, there was a decrease
of about 62% since 2000 and 29% since 2010. These data present a remarkable improvement in the
burden of this disease. In fact, in 2000 there were 108 countries considered endemic for malaria and at
the beginning of 2016 only 91 countries have that status (Figure 2).
Furthermore, due to investments in malaria programmes and research, it is expected even more
progress in malaria burden control, especially with the creation of the Global Technical Strategy for
Malaria 2016–2030 (GTS), which according to WHO “sets out a vision for accelerating progress towards
malaria elimination” in the next 14 years. The GTS programme aims to eliminate malaria from at least
35 countries by 2030 with a milestone of at least 10 countries without malaria by 2020. Besides that,
GTS also aims to prevent the re-establishment of this disease where it has been eliminated endemically
(WHO, 2016).
Interestingly, the decrease of malaria has been successfully achieved mostly due to prevention
and early diagnosis. On the one hand, cases of malaria can be easily prevented through vector control,
by avoiding mosquito bites and therefore inhibiting transmission. The use of insecticide-treated mosquito
nets and indoor residual spraying can offer personal protection against bites and, therefore, reduce the
risk of malaria, particularly in children. Moreover, intermittent precautionary treatment of malaria during
pregnancy has been also proven to be a good indicator of prevention in that risk group. On the other
hand, prompt diagnosis can stop disease development and prevent death, through microscopy analysis
that allows early detection of the parasite, reducing the risk of transmission and allowing for the
treatment (WHO, 2016).
Figure 2 – Countries endemic for malaria in 2000 and 2016 from World Malaria Report 2016.
Figure 4 – Estimated malaria cases (millions) in 2015 from World Malaria Report 2016.Figure
5 – Countries endemic for malaria in 2000 and 2016 from World Malaria Report 2016.
3
Relative to the symptomatology of infection, malaria usually causes one cyclic pattern of fever,
where each cycle lasts 3 days and it is composed of 3 stages. The first one is the cold stage, where the
body temperature decreases and the patient has a lot of cold. Afterwards, there is the hot stage,
characterized by high fevers and the body temperature rises above 40oC. Finally, the body temperature
decreases and starts the sweating stage, associated with dehydration. Remarkably, this cycle called
paroxysm is considerably synchronous occurring in cycles of 24 hours or multiples, according to
Plasmodium species. For P. falciparum, the erythrocytic cycle lasts 48h, which results in the disruption
of the erythrocytes in 48 hours, causing cyclic pattern of fever. Fundamentally, the symptomology of
malaria is due to the rupture of the infected erythrocytes that release toxic contents such as antigens
and haemozoin, leading ultimately to fever. Furthermore, the cause of death is associated with severe
impairments such as cerebral malaria, severe anaemia and respiratory distress (Management of severe
Malaria, Third edition).
As it was mentioned, P. falciparum is the most mortal species affecting humans. According to
WHO, 96% of world cases of malaria are caused by this species (Figure 3). Nonetheless, P. vivax is
also relevant in other world regions besides Africa, from which the proportion of deaths caused by this
species rises to 41% and its widespread morbidity. P. vivax has the ability to produce quiescent forms
during the hepatic stage of infection, called hypnozoites. These dormant forms remain inside
hepatocytes for weeks or months without undergoing replication or entailing any symptoms for the host.
Afterwards, hypnozoites can re-activate and replicate leading to relapses of the disease (Imwong et al.,
2007).
Malaria’s treatment is a subject that requires urgent attention and effort due to the lack of enough
clinically approved medications. In particular, resistance to the current treatments is of major concern,
as the parasites evolve rapidly (Blasco et al. 2017). Artemisinin-based combination therapy (ACT) is a
combination of artemisinin derivate which acts against blood stage asexual and sexual forms providing
a rapidly clearance of parasites. In this combination there is a longer acting partner drug, which is slowly
eliminated, that allows for the protection against parasites that survived to the artemisinin derivate
(Guidelines for the treatment of Malaria, Third edition). ACT is currently the frontline treatment for P.
falciparum malaria in areas where other treatments such as Chloroquine are obsolete due to parasite
resistance. However, there is evidence of decreased sensitivity to ACTs, prompting an alarm for the
potential spread of resistance as currently there are no other clinically available treatments beyond
Arteminisin derivative treatments (Blasco, Leroy and Fidock, 2017).
Figure 3 – Estimated malaria cases (millions) in 2015 from World Malaria Report 2016.
4
2. Mice models in Malaria
For decades, mouse models have been used for studies relatively to malaria infection. As a
matter of fact, despite controversy on whether they truly recapitulate disease in humans, the use of
rodent’ models has notably improved the knowledge of this disease by opening an entire new point of
view (Zuzarte-luis, Mota and Vigário, 2014).
Interestingly, different species of rodent parasites are available, providing several possibilities
of in vivo infections, such as Plasmodium berghei, Plasmodium yoelii and Plasmodium chabaudi. Of
these, P. berghei is the most genetically tractable and is well characterized as a rodent malaria parasite
model. Moreover, the wide variety of Plasmodium strains in combination with the distinct host rodent
models available allows for the study of malaria disease in different courses and outcomes, which in
turn can be extrapolated to human infections (Zuzarte-luis, Mota and Vigário, 2014).
In fact, there are several distinct host models with specific features, such as C57BL/6, Balb/c
and DBA/2 mice. The availability of transgenic hosts and parasites provides the control of several
conditions before and during the infection, namely at the level of the immune system. As an example,
for the PbANKA strain it is possible to have different disease outcomes (severe anaemia, placental
malaria, experimental cerebral malaria) depending on the rodent host. For instance, if using C57BL/6
mice model, PbANKA is able to cause experimental cerebral malaria (ECM). However, the ability from
this parasite strain to cause ECM is lost if using Balb/c mice. Hence, different parasite strains enable
the study of malaria disease outcomes, such as lung injury or respiratory distress (PbNK65) and liver
injury. Therefore, the possible cause of death depends on the combination of rodent and parasite strains.
Thus, it is advantageous to adapt our mice approach according to the aim of interest (Zuzarte-luis, Mota
and Vigário, 2014).
Furthermore, while using rodent models it is possible to easily control and maintain parasite’s
life cycle, allowing for the optimization of conditions such as controlled infections, either by mosquito
bite of infected Anopheles mosquitoes or by intra-dermal or intra-venous injection of sporozoites.
Moreover, it is also possible to skip the liver-stage of infection by direct injection, intra-peritoneal or intra-
venous, of infected erythrocytes (Zuzarte-luis, Mota and Vigário, 2014). Having all these advantages in
mind, mice models were used in this project as an in vivo approach to dissect the role of GSK3 in
Plasmodium spp., providing a set of several experiments to improve the knowledge about this kinase.
5
3. Plasmodium Life cycle
Plasmodium spp. have a complex life cycle that include two hosts, the vector, which is the
Anopheles mosquito, and the mammalian host. During its life cycle, there are unique extracellular forms
specialized in the invasion of different cell types at specific stages, which means that each stage is
characterized by the presence of specific life forms of the parasite.
Infection of the mammalian hosts begins with the injection of Plasmodium sporozoites, present
in the mosquitoes’ salivary glands, when a female Anopheles mosquito is taking its blood meal, and
injects those parasites into the skin. There, they are able to reach and penetrate a blood vessel entering
the bloodstream, due to gliding motility (Figure 4). Therefore, sporozoites actively migrate through cells,
resulting in the disruption of the host cell membrane (Prudêncio, Rodriguez and Mota, 2006).
The sporozoites that enter the blood circulation rapidly access the liver, where they cross
several cells until they invade a final hepatocyte, without disruption of the cell plasma membrane,
forming a specialized compartment, the parasitophorous vacuole (PV) derived from the invagination of
the host cell plasma membrane and the association of parasite derived lipids (Prudêncio, Rodriguez and
Mota, 2006). Thus, by establishing infection inside the hepatocyte followed by differentiation, the
parasite replicates into thousands of merozoites, also known as exoerythrocytic forms (EEF). Then, the
merozoites, which are enclosed in derived vesicles from the hepatocyte’s membrane, named
merosomes, are released into the bloodstream to begin the erythrocytic cycle of infection (Figure 5)
(Cowman et al., 2016).
Figure 4 – Injection of sporozoites into the human host's skin.
Adapted from Prudêncio et al., 2006.
Figure 7 – Plasmodium liver stage. Adapted from Silvie et al., 2008.Figure
8 – Injection of sporozoites into the human host's skin.
Adapted from Prudêncio et al., 2006.
Sporozoites
6
By entering the blood circulation, the free merozoites rapidly invade erythrocytes, beginning the
blood stage of the infection, a process that is significantly fast and dynamic, which results from a strong
interaction between the merozoite and the red blood cell, causing deformation of the host cell. This
invasion process will be further described in the next section. Therefore, by establishing the erythrocyte
infection (Figure 6), the parasite passes through a sequence of stages, each one with specific
characteristics (Koning-ward et al., 2016).
The initial stage is the ring form, which is characterized by the ring shape of the parasite and by
Giemsa-stained smears it is possible to identify a unique circular digestive vacuole, which is a
lysosomal/endocytic compartment. Then, the parasite expands, i.e. grows and develops into the
trophozoite form, which is the most metabolically active parasitic form during the intraerythrocytic stage
of development. During this stage, the initial digestive vacuole expands and a dark pigment called
hemozoin, which is produced by the vacuole digestion of host-derived haemoglobin, can be detected.
Afterwards, the parasite increases its deoxyribonucleic acid (DNA) replication, preceding its own
replication, in a process called schizogony, which will be further described in below. This process gives
rise to individualized schizonts that rupture and lead to the release of daughter merozoites into the
bloodstream. These infectious merozoites can re-invade new erythrocytes in a process that is repeated
umpteen times, allowing for the rapid expansion and constant replication of the parasite population
within the mammalian host (Silvie et al., 2008).
Figure 5 – Plasmodium liver stage. Adapted from Silvie et al., 2008.
Figure 9 – Plasmodium erythrocyte cycle. Adapted from Koning-ward et al. 2016.Figure 10 –
Plasmodium liver stage. Adapted from Silvie et al., 2008.
Figure 6 – Plasmodium erythrocyte cycle. Adapted from Koning-ward et al. 2016.
Figure 11 – Gametocyte fertilization. Adapted from Koning-ward et al., 2016.Figure 12 – Plasmodium
erythrocyte cycle. Adapted from Koning-ward et al. 2016.
7
Moreover, the parasite needs to ensure its sexual reproduction to improve the natural selection
of its offspring. Thus, during the erythrocytic cycle, a small proportion of parasites commit to a sexual
stage of development, from which a few number of parasites differentiate into male or female
gametocytes. This differentiation is promoted by a set of environmental factors allowing for the specificity
of this process (Koning-ward et al., 2016) (Cowman et al., 2016).
The sexual stage, illustrated in the Figure 7, is essential to ensure Plasmodium transmission
between the two distinct hosts as gametocytes are the forms ingested by the female Anopheles
mosquito during a blood meal. In the mosquito midgut, the male gametocyte becomes motile due to
exflagellation allowing for its migration and further fertilization of the female gametocyte. Afterwards, the
resulting zygote undergoes meiosis and a process of differentiation resulting in the formation of the
tetraploid ookinete. This form, still present within the midgut, is motile and crosses the midgut epithelial
cell layer towards the basal lamina giving rise to the oocyst. The oocysts undergo asexual replication
via schizogony, producing thousands of sporozoites which then egress and migrate to the salivary
glands. Those sporozoites are injected into the human host during the next blood meal, completing the
life cycle of the parasite (Koning-ward et al., 2016).
Figure 7 – Gametocyte fertilization. Adapted from Koning-ward et al., 2016.
8
3.1 Invasion into host erythrocytes
Invasion of red blood cells by Plasmodium spp. is a complex multistep process that relies on a
highly synchronized process. In general, host-cell invasion by apicomplexan parasites is a unique way
of cell entry due to a sophisticated invasion apparatus characteristic of this phylum. The apical complex
is one of the main features required for the taxonomic relevance of this taxa, which consists in three
distinctive secretory organelles called micronemes, rhoptries and dense granules, from which the first
two are located in the anterior end, while the dense granules are in the posterior end. These
ultrastructural characteristics, as it is schematized in the Figure 8, are functionally conserved amongst
the members that compose this phylum, leading to a preserved strategy of success by these obligatory
intracellular pathogens (Dubremetz et al., 1998).
As previously described, the release of thousands of merozoites from the merosomes, at the
end of the liver stage of infection, results in the first erythrocytic cycle, in which each merozoite will
invade a new red blood cell (Figure 9). Although this invasion process is extremely complex, it is also
very quick due to the narrow time frame that the parasite has to successfully enter the cell. The invasion
process is initiated with merozoite attachment, which is followed by apical reorientation, leading to the
formation of a tight junction that involves sequential discharge of the contents of the apical organelles
in a highly regulated manner to allow receptor binding, in order to ensure an effective erythrocyte
invasion that culminates with the complete sealing of the PV within the host cell (Koch and Baum, 2016).
Figure 8 – Schematic representation of the cellular structures and the apical complex from the
merozoite. Adapted from Tardieux & Baum 2016.
Mn- Micronemes; Rh- Rhoptries; APR- Apical polar rings; IMC- Inner Membrane complex (i-inner
membrane; o-outer membrane); PPM – Parasite Plasma Membrane; Dg-Dense granules; Go- Golgi; Nu-
Nucleus; Mt-Microtubules
9
The entrance in the erythrocyte is provided by the mechanical force powered by an actin-myosin
motor. Contrarily to induced phagocytic dependent invasion, such as virus or bacteria, Apicomplexan
parasites actively penetrates host cells through a force that is driven by the actin-myosin motor. This will
drive actin filaments and linked adhesins rearward, allowing for a traction force that pushes the parasite
forward into the host cell (Tardieux and Baum, 2016).
Moreover, signal transduction pathways are essential regulators of this synergistic multistep
mechanism. For instance, calcium and cyclic adenosine monophosphate fluxes promote the secretion
of micronemes and rhoptries proteins, which have crucial roles in the orchestration of erythrocyte
invasion either by being part of signalling pathways or by direct function in the process (Singh and
Chitnis, 2017). Furthermore, protein kinases and phosphatases are also important regulators in this
process as it was observed in different large-scale phospho-proteome studies, namely in schizonts and
extracellular merozoites. By comparing the phospho-proteome profile between these two mentioned
stages, it was depicted a differential protein phosphorylation that indicates 785 phosphorylation sites
specific for merozoites. In addition, the cluster analysis of the merozoite phosphoprotein interaction
network revealed that the largest cluster has an enhanced role for merozoite-related processes, i.e.,
invasion biology (Lasonder et al., 2015). Therefore, the identification of key participants, like proteins
kinases or phosphatases, involved in this multistep process would enable the development of novel
targets for intervention strategies in the fight against malaria. Interestingly, there is a redundancy in
invasion pathways due to the discovery of different receptors and merozoites surface proteins that may
not be present for the invasion to occur, as well as alternative signalling cascades, which opens the way
for the development of novel therapeutic targets (Singh and Chitnis, 2017). Nevertheless, it is important
to refer that those receptors and respective ligands are not conserved among the Plasmodium genus,
causing an imprudent extrapolation between species.
Figure 9 – Erythrocyte invasion by Plasmodium merozoites. Adapted from Koch & Baum 2016.
10
One of the most studied and characterized interactions in the Apicomplexa phylum that is known
to have a role in the invasion process is the AMA1 – RON complex. Apical membrane antigen 1 (AMA1)
protein is stored in the micronemes and is translocated to the parasite surface prior to erythrocyte
invasion. It was reported to be a crucial effector for cell invasion by Apicomplexan parasites, as it was
coimmunoprecipitated with a complex of proteins from the rhoptry neck, the RON proteins. This
interaction was previously identified in Toxoplasma gondii and then confirmed in Plasmodium spp. as
well (Alexander et al., 2006). Furthermore, by immunofluorescence this complex was found to colocalize
at the moving tight junctions in the merozoite apical end, prior to parasite entrance into the erythrocyte.
In addition to this colocalization, by blocking one of the RON proteins, RON2, with antibodies against it,
merozoite's invasion is blocked (Srinivasan et al., 2011). Interestingly, as the binding partners in this
complex are derived from two different compartments, it suggests a timely discharge of proteins from
different organelles in a highly synchronized way in order to ensure an efficient invasion (Singh and
Chitnis, 2017).
Although some of the enzymes have been described as important regulators in the invasion
process, they may also have a role in merozoite egress. Once the next generation of mature fully
segmented schizonts has developed, merozoite egress from the erythrocytes requires disruption of
several barriers such as the parasitophorous vacuole membrane (PVM), the host cytoskeleton and the
host plasma membrane. In schizonts, the progeny merozoites follow a sequential quick rupture of both
PVM and host cell membrane (Singh and Chitnis, 2017). Contrarily, the egress from hepatocytes
involves a first step in which the disruption of the PVM occurs without any impact in the integrity of the
host cell membrane, followed by a second step in which parasites uses the hepatocyte plasma
membrane to enclose the merozoites, forming merosomes (Tawk et al., 2013). Nonetheless, these are
highly synchronous and very stepwise processes that involve the regulation of different signalling
pathways including proteins from the apical organelles. Remarkably, in each case, this differently
disruption of each limiting membrane implies the secretion of proteases from the micronemes, which
involves an increase of cytosolic Ca2+ (Singh and Chitnis, 2017). One example of an important regulator
for parasites egress is the subtilisin-like protease SUB1, a bacterial like serine protease. This protease
was reported to trigger merozoite egress by being actively discharged into the PV lumen, where it
mediates the proteolytic maturation of the family of papain-like proteases called serine repeat antigens
(SERA), which have a role in the membranes disruption. Furthermore, SUB1 was also reported to be
required for merozoite maturation as it carries out the primary proteolytic processing of the well
characterized merozoite surface protein 1 (MSP1), MSP6 and MSP7, which interact with each other,
forming a complex. SUB1 processes (differently) each component, which remain associated at the
surface of the merozoite, essential for egress (De Monerri et al., 2011). Although Sub1 is essential for
both P. falciparum and P. berghei during the blood stage of infection, PbSUB1 conditional knock-out
parasites were reported to be unable to egress from infected hepatocytes and begin the erythrocytic
cycle. Interestingly, the processing of cysteine-protease PbSERA3 in the hepatic stage was reported to
be PbSUB1 dependent, as well as the maturation of PbMSP1. On the one hand, the absence of
merosome formation was associated with the accumulation of the PbSERA3 precursor in PbBSUB1-
deficient parasites. On the other hand, the MSPs complex successor was never detected in in PbSUB1-
11
deficient parasites. Therefore, SUB1 is considered essential to establish a blood stage infection as its
dual function in merozoite release and in merozoite surface proteins maturation are crucial for egress
(Tawk et al., 2013).
Therefore, this complex system of signalling pathways controls the activation of specific
enzymes, suggesting an extensive regulation by different routes that cross each order upon the superior
coordination of the apical organelles, allowing for an efficient parasite egress and invasion by
Plasmodium merozoites (Singh and Chitnis, 2017).
3.2 Cell division in Plasmodium parasites
As Apicomplexa are obligatory intracellular parasites, their ability to appropriately multiply inside
diverse host cell niches relies on a flexible cell division process. Firstly, cell cycle progression of this
taxon is spatially associated with an initial local division, followed a late global control. Secondly, the
nucleus is highly structured with well-defined boundaries. Furthermore, the microtubule organizing
centre (MTOC) of daughter cells is tethered to the centrosome, which allows for positioning of multiple
organelles. Although centromeres are similarly associated with the centrosome, the mechanism of
tethering is not fully understood. Additionally, cell cycle progression of daughter cells is orchestrated in
a stepwise and highly ordered manner, which is spatially and temporarily guided by a gene expression
cascade (Francia and Striepen, 2014).
Interestingly, Apicomplexa have distinct division mechanisms from the host cells. For instance,
during mitosis in mammalian cells, the nuclear envelope is disintegrated when the mitotic spindle is
formed and the chromosomes follow opposite directions, producing, after cytokinesis, two progeny cells.
Contrarily, apicomplexan parasites have closed nucleus mitosis as its envelope remains intact.
Therefore, DNA replication and nuclear mitosis can occur several times during the intracellular growth
of the parasite, producing polyploid cells prior to cytokinesis. In Apicomplexa, there are three different
replication mechanisms prior to cytokinesis: Endodyogeny, endopolygeny and schizogony. This last
mechanism is the mode of replication of Plasmodium spp., which culminates with the formation of
schizonts and is characterized by multiple rounds of mitosis that results in multiple nuclei sharing the
same cytoplasm, resulting in a non-geometrical expansion. This initial division is asynchronous and
local division yield a syncytium, i.e., a multinucleated cell produced from multiple rounds of mitosis in
the absence of cytokinesis. At the end, there is a late global process of synchronous mitosis that
coincides with the assembly via budding (cytokinesis), resulting in a fully segmented schizont full of
daughter merozoites. (Figure 10) (Francia and Striepen, 2014).
12
Plasmodium parasites possess a global transcription control that follows sequences of gene
activation and silencing cascades within a narrow time frame throughout the different stages that
compose the erythrocytic development (Bozdech et al., 2003). Moreover, this gene expression cascade
is thought to be regulated by the Apetala 2 (AP2)-type transcription factors homologues (ApiAP2s),
which were reported to bind to promoters of multiple co-regulated genes, having both promotion or
repression effects, depending on the proper time for expression (Painter, Campbell and Llinás, 2012).
Interestingly, these genes have also waves of transcription which goes in agreement with the global
regulation of transcription that controls the progress of intracellular development (Francia and Striepen,
2014). Furthermore, some cyclin-dependent kinase (CDK) related kinases have been described in
Plasmodium. In mammals, CDKs are important regulators in the cell cycle progression, however, its
function seems to differ in apicomplexan parasites. Nonetheless, CRK4, is a member of an
Apicomplexa-specific kinase sub-family related to CDKs. In P. falciparum, it was reported to be a key
cell cycle regulator that controls multiple rounds of DNA replication. Its essentiality for the trophozoite-
to-schizont transition and DNA replication became evident after the creation of a conditional knock-out
of PfCRK4, from which parasites got arrested at the beginning of schizogony (trophozoite stage) without
nuclei division or DNA replication. Hence, PfCRK4 was reported to be a crucial regulator of the S phase,
through the initiation of multiple rounds of DNA replication (Ganter et al., 2017).
Figure 10 – Schizogony replication from Plasmodium parasites.
Adapted from Francia and Striepen 2014.
Figure 13 – Comparison between P. berghei (A) and P.
falciparum (B) kinomes.
Adapted from (Tewari et al. 2010).Figure 14 – Schizogony
replication from Plasmodium parasites.
Adapted from Francia and Striepen 2014.
13
4. Kinases in Plasmodium
Protein Kinases are important regulators in eukaryotic cells, known to be involved in multiple
pathways. These enzymes can act like positive or negative regulators to other proteins allowing for the
specificity and accuracy of each cell process, especially in responses to intrinsic and extrinsic stimuli.
Thus, protein phosphorylation by kinases can be considered a universal regulatory mechanism and,
consequently, a possible target against many types of diseases. For Plasmodium, as it was mentioned
above, it is now being appreciated that kinases are involved in the invasion process, as well as in cell
cycle control during schizogony (Koch and Baum, 2016) (Francia and Striepen, 2014).
Regarding the differences between Plasmodium and Human kinomes, phylogenetic diversity
provides a discriminatory character which shows diversity between the kinomes. Interestingly, there are
some Plasmodium kinases that do not cluster in the typical eukaryotic protein kinase family, that
constitute the human kinome. Those include the FIKK family (Phenylalanine-isoleucine-lysine-lysine
amino acid motive) and a group of CDPKs (Calcium dependent protein kinase) similar to calcium-
regulated kinases found in plants. Moreover, there are two clusters, which are established in the Human
kinome, that are not present in the Plasmodium kinome: the tyrosine kinases and the MAPKK family
(mitogen-activated protein kinase kinases). By contrast, Plasmodium spp. have “orphan” sequences
that encode for particular kinases which do not cluster within the eukaryote protein kinases groups, such
as Protein Kinase 7 (PK7) and a CDK-related kinase CRK5 (Talevich et al., 2012). Interestingly, these
kinases were reported to be involved in the regulation of schizogony (Dorin-Semblat et al. 2013).
Nonetheless, the “malaria kinome” is largely conserved among Plasmodium spp. Through a
systematic phylogenetic analysis based on eukaryotic kinases domains, it was possible to infer the high
level of conservation between P. falciparum and P. berghei, as it is depicted in the following Figure 11.
The main difference is the extended FIKK family in the P. falciparum kinome, which allows for functional
signals related to secretion and protein exportation to the host cell, critical for the establishment of the
infection in the human host (Tewari et al., 2010).
Figure 11 – Comparison between P. berghei (A) and P. falciparum (B) kinomes.
Adapted from (Tewari et al. 2010).
Figure 15 – Amino acid sequence from the activation center of GSK3 in different
orthologues.Figure 16 – Comparison between P. berghei (A) and P. falciparum (B)
kinomes.
Adapted from (Tewari et al. 2010).
14
Furthermore, studies based on a kinome-wide gene deletion showed the essentiality of several
kinases during each stage of Plasmodium erythrocytic cycle, through a phenotypic screening of those
mutants. Interestingly, of the 65 kinases in P. falciparum kinome, 36 were reported to be essential for
the erythrocytic cycle, 12 were reported to be definitely dispensable, whereas 14 are likely dispensable,
despite not being able to knock them out. These numbers emphasize the fact that, despite several
kinases are key regulators with conserved and permanent function, many signalling networks in
Plasmodium are flexible, from which there are alternative regulators that promote plasticity in those
phospho-signalling pathways. Thus, phospho-proteomics approaches demonstrate the important role of
protein phosphorylation by conserved Plasmodium kinases, through the identification of putative kinase
substrates (Solyakov et al., 2011). Several phospho-proteomics analysis show that protein
phosphorylation, which is widely employed throughout the blood stage of infection, is crucial for the
regulation of different cellular processes. Remarkably, for more than half of genes analysed, the peak
of Ribonucleic acid (RNA) expression does not coincide with maximal protein abundance. Besides,
proteins that are expressed throughout the parasite stages during the erythrocytic cycle have a variable
peak of phosphorylation, suggesting that post-transcriptional and post-translational regulation, namely
phosphorylation, has an important role in Plasmodium (Pease et al., 2013). Therefore, phospho-
proteomics studies are essential to get further insight into post-translational modifications
(phosphorylation) that promote functional differences in parasite biology, either in a global approach
across the stages or in stage-specific forms within the intracellular development of the parasite.
15
5. Glycogen Synthase Kinase 3 (GSK3)
5.1 GSK3 in high eukaryotes
Glycogen synthase kinase 3 (GSK3) is a highly conserved kinase in eukaryotes. In fact, there
are hundreds of well characterized orthologues in higher eukaryotes that are described in the
HomoloGene (www.ncbi.nlm.nih.gov/homologene) online tool, from the National Centre for
Biotechnology Information (NCBI), which is “an automated system for constructing putative homology
groups from the complete gene sets of a wide range of eukaryotic species”. Nonetheless, GSK3 is a
well characterized enzyme among mammals, especially in humans. Interestingly, GSK3 was initially
defined as a regulator of glycogen metabolism as it phosphorylates and inactivates the glycogen
synthase enzyme. Its role in several humans’ diseases, such as psychiatric, neurological, inflammatory,
cardiovascular diseases and also in cancer, makes it an interesting target to study. In mammals, GSK3
encodes two paralogs, GSK3α and GSK3β (Beurel, Grieco and Jope, 2015).
Homo sapiens GSK3 (HsGSK3) has more than 100 known substrates in humans and the
prediction of the possible unknown targets is over 500. This kinase is constitutively active and acts
mostly as a repressor. Although the reason behind this versatility is still a subject of study, there are two
key functional domains that may contribute to it. On the one hand, there is a primed-substrate binding
domain that recruits the GSK3 targets. This is a highly-conserved feature of this enzyme, which means
most of the GSK3 substrates must be pre-phosphorylated by another enzyme to be recognized by GSK3
leading to multilayer regulation. On the other hand, GSK3 target sequence is Serine/Threonine-X-X-X-
Serine/Threonine-Proline (S/T-X-X-X-S/T-P), a sequence that is present in many proteins, making them
possible targets to this kinase, with further phosphorylation of the substrate. Furthermore, this target
sequence occurs more than once in several proteins, especially in a string, which promotes variability
within each target, meaning that GSK3 may phosphorylate each residue in sequential and distinct sites
(Beurel, Grieco and Jope, 2015).
Moreover, mammalian GSK3 is also regulated by phosphorylation in its N-terminal domain
which contains a conserved serine motif. Interestingly, the phosphorylation of those serine residues has
an impact in the GSK3 N-terminal tail, leading to its self-association and inhibition by acting as a primed-
substrate. Other mechanisms of GSK3 regulation include differential localization, time of expression,
and association with protein complexes (Beurel, Grieco and Jope, 2015).
Regarding the GSK3 subcellular localization, it is considered as a cytosolic kinase, however it
also shuttles between the mitochondria and nucleus and associates to the cytoskeleton as well as to
membranous structures such as multivesicular bodies (Beurel, Grieco and Jope, 2015). Although there
is very few information regarding mitochondrial GSK3 substrates, GSK3’s functions on the nucleus are
much better characterized, due to its regulatory role in gene expression. In fact, transcription factors are
the major class of GSK3 targets and GSK3 has a modulatory effect on histone modifications, controlling,
therefore, chromatin availability to these transcription factors, being ultimately involved in epigenetics
(Beurel, Grieco and Jope, 2015).
16
5.2 GSK3 in unicellular eukaryotes
Besides being a well characterized enzyme among mammals, both GSK3 paralogs are present
in unicellular eukaryotes, such as yeast, from which it is also well studied. Its versatility makes it one of
the most interesting kinases, from which the levels of applicability transcend the entire kingdom. For
instance, RIM11, which is the HsGSK3β orthologue in Saccharomyces spp., was reported to be required
for signal transduction during entry into meiosis, depending on nutrient availability. Interestingly, at high
glucose levels, RIM11 is constitutively repressed by phosphorylation on the serine residues at the N
terminal. However, at low glucose levels, RIM11 becomes active, which allows for the phosphorylation
of IME1 by this kinase. IME1 is a transcription factor that master regulates yeast sporulation by being
recruited to promotors of early meiosis-specific genes (Rubin-bejerano et al., 2004).
Thus, as an important cell fate regulator, GSK3 became a putative target that might contribute
to the fight against many infectious diseases caused by unicellular eukaryotes. As an example, GSK3
is highly conserved in the Kinetoplastid order, a taxonomic group that includes parasites from the
Trypanosomatidae family, such as the Trypanosoma and Leishmania genus. For instance, In Saldivia
et al., 2016, GSK3 from Trypanosoma brucei (TbGSK3) was reported to be an inhibitor of the parasite’s
Adenosine Monophosphate Protein Kinase (AMPK). This kinase is a key regulator of the cellular energy
homeostasis, which is highly conserved in eukaryotic cells, as it regulates several metabolic pathways,
working as a main energy sensor. Therefore, AMPK operates by switching between energy production
or energy consumption, accordingly to nutrient availability. When activated, it promotes catabolism and
inhibition of ATP consumption, influencing cell cycle regulation. Interestingly, TbGSK3 knockdown with
RNA interference (RNAi) lead to an increased TbAMPK subunit α-1 (TbAMPKα1) phosphorylation,
suggesting that GSK3 is a negative regulator of AMPK in T. brucei. Moreover, co-immunoprecipitation
experiments confirmed the interaction between TbGSK3 and TbAMPKα1. As TbAMPKα1 was reported
to promote the development of quiescent stumpy bloodstream forms in Trypanosoma, GSK3 seems
also to have a function in the cell cycle fate of this parasite (Saldivia et al., 2016).
Furthermore, GSK3 was also studied as a novel target against Leishmania spp. For instance,
Leishmania donovani GSK3 (LdGSK3) was targeted with compounds that are similar to the ones used
to inhibit HsGSK3 in order to test their anti-leishmanial activity. That drug-screen revealed a potential
role for LdGSK3 in cell-cycle progression at the intracellular stage, as the parasites get arrested without
proliferation, promoting a decreased growth phenotype. Despite this effect on the parasites, it was not
possible to distinguish possible cross activity effect on host cells (Xingi et al., 2009). Nonetheless, these
results and continued interest in GSK3 lead to study biochemical, structural and inhibitor structure-
activity relationships of Leishmania major GSK3 (LmGSK3) and Leishmania infantum GSK3 (LiGSK3)
(Ojo et al., 2011). These kinds of studies enable further development of efficient and specific GSK3
inhibitors that target not only Leishmania spp., but also Trypanosoma spp. infectious diseases.
17
5.3 GSK3 in Plasmodium spp.
Plasmodium spp. have a GSK3 orthologue of HsGSK3β. Remarkably, this orthologue is
conserved in all the species that compose the Plasmodium genus. However, its role on the parasite still
needs to be unveiled, despite several studies performed either with the human infectious species P.
falciparum (PfGSK3) or with the mouse infectious model P. berghei (PbGSK3).
The first comparison between the GSK3 orthologues from both species may be provided by the
PlasmoDB database (www.plasmodb.com) (Aurrecoechea et al., 2009). PlasmoDB is a genome
database for the Plasmodium genus, which compiles genomic, transcriptomic, proteomic data together
with other “omic” level data for in silico predictions. Below, it is presented one table that summarizes the
data for the gsk3 (gene) for both species. Remarkably, these orthologues are quite similar at the
genomic, transcriptomic and proteomic level. Despite being located in different chromosomes, gsk3
orthologues in P. falciparum and P. berghei are in synteny, as they share the same location in the
genome, from which physical co-localization and gene order is conserved. In fact, all the gsk3
orthologues of Plasmodium spp. are in synteny. Furthermore, according to PlasmoDB gsk3 is
considered not essential, i.e., likely dispensable, for the parasite’s life cycle (Table 1).
Table 1 – PlasmoDB genome database about gsk3 orthologues in P. berghei and P. falciparum.
PfGSK3 was initially characterized (Droucheau et al., 2004) by comparing the HsGSK3β with
Plasmodium GSK3 through a three-dimensional (3D) structural model of both enzymes. Remarkably,
the proteins are similar by sequence homology, from which the 3D structure is highly conserved.
Furthermore, the two major domains of HsGSk3 have its functional mechanism conserved in PfGSK3:
S/T-X-X-X-S/T-P target domain and priming phosphorylation. However, there are some differences that
promote functional variability between these homologs. The N-terminal serine domain responsible for
the negative regulation of the HsGSK3 is not present in the PfGSK3, which means that the mechanism
Properties PbANKA gsk3 Pf3D7 gsk3
Accession numbers (PlasmoDB)
PBANKA_0410400 PF3D7_0312400
Chromosome 04 03
Synteny yes yes
Genomic length 2259 2286
Exons 7 7
Introns 6 6
Transcript length 1293 1323
Protein length 430 440
Protein mass 49,7KDa 51,6KDa
Phenotype Likely Dispensable Likely Dispensable
18
of enzyme inhibition is absent in P. falciparum and it is not known any other mechanism of repression
for PfGSK3 (Droucheau et al., 2004).
Regarding the expression of Pfgsk3, although the gene was reported to be equally expressed
at the messenger RNA (mRNA) level throughout the erythrocytic cycle, PfGSK3 was weakly detected
by immunofluorescence when employing a polyclonal antibody against a conserved peptide from the
rat GSK3 described to cross react with GSK3 orthologues. Nonetheless, the protein seems to be
differently expressed, from which the highest peak was reported at the early trophozoite stage.
Additionally, PfGSK3 appeared to be located in clusters within the erythrocytes’ cytoplasm. In fact, it
was reported to be localized in the Maurer’s clefts, vesical structures that seem to be associated to
plasmodial proteins exportation through the erythrocytes’ cytoplasm to the RBC plasma membrane
(Droucheau et al., 2004).
Similarly to the studies of GSK3 targeting in many eukaryotes, the inhibition of PfGSK3 was
also studied. On the one hand, Droucheau et al., 2004 identified inhibitors of PfGSK3 reported to
promote a decreased growth rate. Nevertheless, the selectivity of those compounds was not appropriate
as they may also affect the host erythrocyte. On the other hand, Masch & Kunick 2015 presented one
high selective compound that inhibits PfGSK3, which was proposed to be used as a possible new
antimalarial agent. The evaluation of the compound’s anti-parasitic activity was achieved by a
luminescence-based assay also through the use of in vitro cultures of P. falciparum. Relatively to the
HsGKS3 specificity, the compound was chemically synthetized with a chemical group that does not
inhibit the human kinase, which increases its selectivity and, therefore, its efficiency (Masch and Kunick,
2015).
Relative to the mechanism of function of Plasmodium GSK3, there is some controversy
because, as it was mentioned before, Plasmodium spp. do not possess canonical tyrosine kinase family
in their kinome. However, the proof of concept for the tyrosine phosphorylation activation loop in
Plasmodium spp. kinases, was achieved by Solyakov et al. 2011. Through the use of anti-
phosphotyrosine antibodies, it was observed that a significant repertoire of proteins is tyrosine
phosphorylated in infected erythrocytes over the non-infected red blood cells, which was detectable
within the parasite fraction, within the PV. In their global phosphorylation analysis, they identified the
tyrosine 229 (Y229) within the activation loop of PfGSK3, which is auto-phosphorylated and, therefore,
responsible for the kinase’s enzymatic activity. Interestingly, PfGSK3 Y229 was detected with an antibody
against human tyrosine-phosphorylated GSK3α/β-Y279/216 (Solyakov et al., 2011), a region that is highly
conserved in GSK3 orthologs (Droucheau et al., 2004). For instance, by aligning the amino acid
sequence of the region that surrounds the centre responsible for the activation of GSK3 from P.
falciparum, P. berghei and H. sapiens, it is depicted a high level of conservation, almost identical,
between both Plasmodium species, which is preserved in the HsGSK3, promoting the cross reactivity
among species (Figure 12).
Figure 12 – Amino acid sequence from the activation center of GSK3 in different orthologues.
Figure 17 – PbΔgsk3 parasites possess in vitro and in vivo phenotypes.
A- In vitro maturation assay – boxplot graph presents the results of the merozoites per schizont counting;
N=3
WT PbANKA: 14,58±2,50;
PbΔgsk3: 11,8±2,22
19
Relatively to PfGSK3, it was initially considered as a likely essential kinase for the erythrocyte
asexual cycle due to several attempts to generate null mutants through homologous recombination. For
example, Solyakov et al. 2011 were not successful to delete Pfgsk3 and to date, no report has been
published describing a null PfGSK3 mutant. Nonetheless, due to the absence of in vivo studies in P.
falciparum, different approaches have been implemented to study the Plasmodium GSK3 in P. berghei,
PbGSK3. The fact that both the malaria kinome and GSK3 are largely conserved among Plasmodium
spp., enables the extrapolation of results for P. falciparum, from the rodent infectious model (Zuzarte-
luis, Mota and Vigário, 2014). In (Tewari et al., 2010), a systematic functional analysis of the malaria
kinome through a phenotypic screening of kinase mutants show that the Pbgsk3 could not be deleted
by homologous recombination. Therefore, PbGSK3 was considered essential to the blood stage of
infection, as it was posteriorly proposed by Solyakov et al., 2011.
Nevertheless, more recently in Gomes et al., 2015 a new approach of genetic screening in P.
berghei was developed and Pbgsk3 was able to be deleted from the genome. A genome-scale vector
resource based on a barcode sequencing was used as an approach to study the phenotype of the
growth rates of all mutants obtained in the deletion’s pool. The plasmids were designed by the
PlasmoGem resource and each one included long homology arms (approximately 7.4kb +/- 2.9 Kbp),
which increase the recombination efficiency when compared to conventional approaches, with unique
barcodes (10-11 nucleotides sequences) representing each mutant obtained from each vector, so that
in a mixed pool, each mutant can be identified and quantified. Thus, the barcode sequencing phenotype
corroborated that Pbgsk3 is dispensable for the erythrocytic cycle of P. berghei, without a reported
associated anomalous growth phenotype (Gomes et al., 2015). Moreover, this result was extrapolated
to PfGSK3, which is also considered, likely dispensable to P. falciparum, as it was depicted in Table 1,
despite the fact that its knockout was never done.
Unpublished data (Vera et al, unpublished) from Maria Mota laboratory from the Instituto de
Medicina Molecular (iMM) report that PbΔgsk3 parasites have an abnormal proliferation rate and that
these mutant parasites possess in vitro and in vivo phenotypes. On the one hand, in vitro maturation
cultures of the mutant parasites showed an impairment in parasite replication due to a decreased
number of merozoites per schizont in comparison to the wild type (WT) parasites (Figure 13A). On the
other hand, the absence of Pbgsk3 seemed to cause a different pattern in the parasitemia curve in blood
of infected mice, which is given by the number of infected erythrocytes per the total number of
erythrocytes over time in peripheral circulation (Figure 13B). Furthermore, C57BL/6 mice infected with
PbΔgsk3 parasites survive from ECM and instead die, approximately, 20 days later of
hyperparasitemia/severe anaemia (Figure 13C).
All in all, GSK3 is considered a putative target in the fight against malaria, from which the
function that it has in Plasmodium spp. needs to be defined. In order to know whether GSK3 represents
a virulence factor in Plasmodium infection, as it is being studied in Maria Mota Laboratory, it is necessary
to characterize the gsk3 deletion mutant across the parasite’s life cycle. Nonetheless, contrarily to
PfGSK3, PbGSK3 was never functionally characterized and the results that were reported in Droucheau
et al., 2004 need to be verified for P. berghei.
20
A
A
B
B
C
F
i
g
u
r
e
2
0
–
G
e
n
o
t
y
p
i
n
g
o
f
t
Figure 13 – PbΔgsk3 parasites possess
in vitro and in vivo phenotypes.
A- In vitro maturation assay – boxplot
graph presents the results of the
merozoites per schizont counting; N=3
WT PbANKA: 14,58±2,50;
PbΔgsk3: 11,8±2,22
B - Parasitemia curve – number of infected
erythrocytes per the total number of
erythrocytes over time - obtained through
the daily measurement of the parasitemia
of mice infect with each one of the four
strains by flow cytometry; N=5
3dpi – PbΔgsk3 ns
4dpi – PbΔgsk3 ns
5dpi – PbΔgsk3 ****
C – Survival curve – percentage of living
mice throughout the infection; N=5
PbΔgsk3 *
Figure 19 – PbΔgsk3 parasites possess
in vitro and in vivo phenotypes.
A- In vitro maturation assay – boxplot
graph presents the results of the
merozoites per schizont counting; N=3
WT PbANKA: 14,58±2,50;
PbΔgsk3: 11,8±2,22
21
Motivation and Research aims
GSK3 is a versatile kinase, conserved amongst eukaryotes, having a major role in the regulation
of innumerous pathways. Although it is well characterized both in high and low eukaryotes organisms,
its role in Plasmodium spp. remains unknown. Therefore, the major aim of this Master’s thesis project
is to dissect the function of GSK3 in Plasmodium spp., namely to unveil how GSK3 regulates virulence
in these parasites. This project will focus only on the blood stage of infection of the Plasmodium life
cycle. For this purpose, we will use the rodent malaria parasite P. berghei which, despite its phylogenetic
distance, is analogous to human malaria parasites, sharing essential aspects of physiology and life
cycle. Thus, the characterization of PbGSK3 will include in vivo as well as in vitro approaches. For that,
this project will include three main approaches:
I. We intend to characterize the spatial-temporal dynamics of GSK3 through a cellular
biology approach, i.e., we pretend to assess GSK3 expression fluctuations in each
developmental stage of the parasite during the erythrocytic cycle and its localisation
within the parasite and/or in the host cell. This approach is possible through the use of
GSK3 epitope-tagged lines. Additionally, an epitope-tagged P.falciparum GSK3 will be
generated and characterized
II. Furthermore, as GSK3 is reported to work as part of a complex, we aim to identify
GSK3 interactors, i.e., possible binding partners or targets, through a biochemical
approach. For this the GSK3 epitope-tagged lines will be used to optimize co-
immunoprecipitation protocols.
III. The third aim is to study the complementation phenotype of the PbΔgsk3 parasites
through a genetic approach by generating a complemented strain to recover the wild-
type phenotype and also by generating a non-functional kinase with mutation to a
tyrosine residue important in centre of the activation domain.
It is expected that these three independent aims, employed varied approaches, will further our
understanding of Plasmodium GSK3 function and its role in parasite virulence.
22
Materials and Methods
1. Ethics Statement
All in vivo protocols were approved by the internal animal care committee of Instituto de
Medicina Molecular (iMM) and were performed according to the national and European regulations.
2. Statistics
Statistical significance was determined using GraphPad (Prism) software. For comparisons
between two conditions a t-test, and one-way ANOVA for comparisons involving three or more
conditions were performed. Two-way ANOVA to compare parasitemias between wild type control
infected mice and mutant transgenic infected mice. Only parasitemias from 3, 4 and 5 days post-
infection were statistically analysed, as they represent the log phase of growth in the WT PbANKA and
PbΔgsk3 control groups. The log-rank (Matel-Cox) test was used to compare the survival distributions
of two groups. Significance was considered for p values below 0,05. The outliers in the boxplots
represent 5% of data points. Data values mentioned in the text are mean ± standard deviation. Results
were scored as * when p<0,05, ** when p<0,01, *** when p<0,001, **** when p<0,0001 and as ns (non-
significant).
3. Mice and Parasites
Balb/c and C57BL/6J mice (female or male) were purchased from Charles River® Breeding
Laboratories and housed in the Rodent Facility of iMM. Experimental mice (age 5-8 weeks; weight 20-
28g) were housed three to five per cage and allowed free access to food and water.
Wild type P. berghei ANKA strain with the constitutively expressing Green Fluorescence Protein
(GFP) background was obtained from Rita Tewari (Tewari et al., 2010), from the Institute of Genetics,
University of Nottingham. Wild-type P. berghei ANKA strain was obtained from Wellcome Trust Sanger
Institute (UK). Asexual parasitic forms were maintained through (intraperitoneal) passage of infected
blood in Balb/c mice. Stock of 15% glycerol blood vials were maintained at -80oC for all the parasite
lines. Pb∆gsk3, Pbgsk3-ha and Pbgsk3-gfp parasite lines were generated in the Maria Mota laboratory:
Pb∆gsk3 was generated by double homologous recombination between the WT PbANKART and target
plasmid (PbGEM-012290) obtained from Plasmogem resource (http://plasmogem.sanger.ac.uk/),
(Gomes et al., 2015) that included a selection cassette composed by the human dihydrofolate reductase
(hdhfr) and cytosine deaminase and uridyl phosphoribosyl transferase (yfcu) genes, flanked by
upstream and downstream regions of Pbgsk3 gene for homologous recombination. Pbgsk3-ha was
obtained by double-cross over with C-terminal hemagglutinin (HA) tagging plasmid (PbGEM-012298)
obtained from Plasmogem resource. Pbgsk3-gfp was obtained through transfection of wildtype (non-
GFP background) P. berghei ANKA clone 234 with plasmid composed of the 1.5kb of Pbgsk3 with a C-
terminal GFP via single cross over recombination.
23
3.1 In vivo infection with Plasmodium berghei parasites
Blood stage infections were first performed in donor mice through intraperitoneal injection of
parasitized frozen blood vials until parasitemia reached approximately 1%, from which mice were
sacrificed by Isoflurane (IsoFlo, from Esteve®) inhalation and blood was collected by cardiac puncture.
Circulating parasitemia levels were assessed by microscopic evaluation through Giemsa (Sigma®)
staining: Thin blood smears, fixed with 100% methanol and stained with Giemsa (10%v/v), were
observed under a 100x oil immersion microscope and parasitemia determined as percentage of infected
RBC (iRBC) to total RBC. Afterwards, experimental in vivo infections were initiated by intravenous
injection of 105 or 106 iRBC through the tail vein. Parasitemia levels in the blood was monitored daily by
Giemsa staining or by flow cytometry (for the parasites GFP background). Flow cytometry was
performed with the BD Accuri Cytometer®, from one drop of tail blood (approximately 2µL) in 500mL of
1X Phosphate Buffer Saline (PBS), from which the total number of acquired events was 500 000 and
the data was further analysed on the FlowJo® software to determine GFP positive events (iRBC) to total
cell population.
3.2 In vitro synchronization of Plasmodium berghei parasites
Blood from mice infected with the different P. berghei parasite lines, with an approximately 1-
2% parasitemia, was collected by cardiac puncture into 4mL of complete culture medium (CCM) (RPMI
medium (Thermo Scientific®) supplemented with 20% Fetal Bovine Serum (FBS), 25mM HEPES,
50µg/mL Penicillin/Streptomycin, 50μg/L Gentamycin, 2mM L-Glutamine). Blood was then centrifuged
at low speed, 2000 rotations per minute (rpm), for 3 minutes (min), without brake and the erythrocyte
packed pellet was then diluted in CCM to a final 2% haematocrit culture. Samples were incubated for
12-16 hours, in the dark, at 37oC with O2 controlled conditions. Maturation was confirmed by microscopic
visualization of Giemsa-stained smears. Merozoites per schizont imaging and quantification were
performed using the Leica DM 2500 Microscope at 100% oil immersion magnification, from which fully
matured schizonts containing fully segmented merozoites, with a single hemozoin pigment, were
quantified using the Cell Counter plugin from the Fiji software.
3.2.1 Immunofluorescence assays:
I. Paraformaldehyde (PFA) fixation
Mouse infected erythrocytes with Pbgsk3-ha or Pbgsk3-gfp parasites were fixed with
4%PFA/0.0075%glutaraldehyde in PBS for 30min. Fixed cells were, washed with in 1X PBS and then
permeabilized in 0.1 Triton X-100 for 15min. Blocking was performed with 5% (w/v) Bovine Serum
Albumin (BSA) in PBS for one hour. All the previous incubations were performed with shaking at room
temperature. Afterwards, samples were incubated overnight at 4oC with the following primary antibodies
(diluted in 5% BSA/PBS): rabbit anti-HA (1:500 from -Cell Signalling Technologies-CST®), rat anti-HA
clone 3F10 (1:500, from Roche®), rabbit anti-PbExp1(1:1000), rabbit anti-PbBip (1:500), rabbit anti-
24
PbMSP1 (1:500), rabbit anti-PbAMA1(1:500, kind gift of Dr. Michael Blackman, Francis Crick Institute,
London, UK), rabbit anti-PbSUB1 (1:500, kind gift of Dr. Michael Blackman, Francis Crick Institute,
London, UK), rabbit anti-GFP conjugated to Alexa Fluor 488 (1:500, from Invitrogen®) (Table 2). Next,
samples were washed one time with 0.05% Triton X-100 in PBS and two times with 1X PBS during
10min. Secondary antibody incubation was performed during one hour at room temperature with:
Donkey anti-rabbit IgG conjugated to Alexa Fluor 488 (1:500, from Invitrogen®), Donkey anti-rabbit IgG
conjugated to Alexa Fluor 568 (1:500, from Invitrogen®) and Donkey anti-rat IgG conjugated to Alexa
Fluor 488 (1:500, from Invitrogen®) (Table 2). Then, samples were washed one time with 1X PBS and
stained with Hoechst (1:1000 from Invitrogen®®) in PBS for nuclear staining, during 10min. After a final
wash with 1X PBS, samples were diluted mounted in Poly-D-Lysine coated cover slips with
Fluoromount-GTM (Invitrogen) onto a glass slide and prepared slides were allowed to dry overnight
before imaging. All the images were taken in the Zeiss LSM 880 point-scanning confocal microscope at
63x magnification and were acquired with a 5X digital zoom, at a pixel resolution of 1024x1024.
II. Acetone:Methanol fixation
Thin blood smears from Pbgsk3-ha infected mice were fixed in solution of ice cold
Acetone:Methanol in a 1:1 ratio. Fixation occurred at -20oC during 30min. Slides were then air dried and
processed for staining or stored at -20oC for later staining. Slides were washed three times with 1X PBS
and an area for staining were draw in the slide with a hydrophobic pen. Slides were blocked with 5%BSA
in 0.1% Triton x-100 (in PBS) during one hour at room temperature, inside a humidified chamber.
Afterwards, slides were incubated with the following antibodies (diluted in 5%BSA/PBS): rat anti-HA
3F10 (1:500), rabbit anti-SUB1 (1:500) and rabbit anti-AMA1 (1:500), during one hour at room
temperature (Table 2). Next, samples were washed three times with 1X PBS and, then, incubated with
secondary antibodies: Donkey anti-rat 488 (1:500) and Donkey anti-rabbit 568 (1:500) (Table 2).
Afterwards, samples were washed one time with 1X PBS and stained with Hoechst (1:1000 in PBS) for
nuclear staining, during 10min. After a final wash with 1X PBS, samples were diluted, mounted with
cover slips and Fluoromount-GTM, and allowed to dry overnight before imaging. All the images were
taken in the Zeiss LSM 880 point-scanning confocal microscope at 63x magnification, under the
previously mentioned conditions.
3.2.2 Immunoblotting (IB) Assays
Complete parasite pellet extractions were performed on ice to minimize proteolytic activity and
protein degradation. The whole blood samples were firstly centrifuged at low speed (2000rpm) during
3min without brake, from which the blood packed pellet was resuspended in 1mL of 1X PBS and
erythrocytes were lysed, on ice with 0.1% saponin. Afterwards, the samples were centrifuged at high
speed (14000rpm) for 15 min at 4oC. The obtained parasite pellet was washed three times in 1X PBS,
resuspended in Radioimmunoprecipitation (RIPA) lysis buffer, incubated on ice for 15 min and
centrifuged at high speed (14000rpm) during 15min at 4oC. Both insoluble (pellet) and soluble
(supernatant) fractions were collected for further analysis. Total protein content was determined through
25
Bradford assay. Protein samples were diluted in 4X LDS NuPAGE Sample Buffer (Invitrogen) with 10%
β-mercaptoethanol (β-ME), from which the insoluble fraction was sonicated at 10microamperes for
15seconds (sec), and then denatured at 95oC for 5min and finally resolved in a 10% polyacrylamide gel
(SDS-PAGE). Resolved proteins were blotted onto a nitrocellulose membrane by wet transfer at
350milliamperes for one hour. Protein transfer to membrane was confirmed by staining in Ponceau S
solution (Sigma). Blocking of membrane surface was performed in 5%BSA in 0.2% Tween 20 –Tris
Buffer Saline (TBS-T) during one hour at room temperature. Then, the membrane was incubated
overnight at 4oC with primary antibody, rabbit anti-HA (1:1000, from CST) (Table 2). Next, the
membrane was washed three times with TBS-T for 10 min. Membrane was then incubated with anti-
rabbit secondary antibody conjugated with horseradish peroxidase (HRP) (1:2000, from CST) for one
hour at room temperature (Table 2). Finally, chemiluminescent signal was detected post addition of
Luminata Crescendo Western HRP substrate (Merck Milipore®) to the membrane visualized on the
ChemiDoc XRS+ Gel Imaging System (Bio-Rad®). Image analysis was performed with Image Lab
software (Biorad) and protein band quantification was performed with the Fiji software.
3.2.3 Immunoprecipitation (IP) Assays
Immunoprecipitation assays were performed with the soluble fraction after lysis of the parasite
pellet. Different lysis conditions and lysis buffers were tested during the technique‘s optimization: 20µL
of RIPA lysis buffer for 15min on ice; 200µL of RIPA lysis buffer (TRIS pH8 50mM, NaCl 150mM, EDTA
5mM, 1% Tx-100, 0,5% Sodium deoxycholate, 0,1% SDS, NaF 10mM, β-glycerophosphate 20mM,
Phosphatase inhibitor-Roche®,Protease inhibitor-Roche®) for 30min on ice; 200µL of CHAPS lysis buffer
(same components than RIPA including 1X CHAPS (Sigma®) for 30min on ice. 20µL of 1% SDS lysis
buffer (same components than RIPA except for the 1% SDS concentration) for 30min on ice (posteriorly
diluted 10X in RIPA lysis buffer without SDS: final concentration of 0.1%SDS). The immunoprecipitation
was performed with anti-HA conjugated agarose beads (Pierce® HA-Tag IP/Co-IP Kit, from
ThermoScientific). Sample incubation with the beads was performed overnight at 4oC under rotation.
Afterwards, samples were washed three times with 0.05% TBS-T and then eluted from the beads
through addition of 25µL of Non-Reducing Sample Buffer (Pierce® HA-Tag IP/Co-IP Kit, from
ThermoScientific) heating of the spin column at 99oC for 5min. Prior to loading, 2µL of β-ME were added
to the 25µL sample, which were resolved in a 10% polyacrylamide gel (SDS-PAGE). Then, resolved
protein complexes proceeded either to immunoblotting, as mentioned above, or to Silver Staining, from
which the gel was stained through the ProteoSilver™ Silver Stain Kit (Sigma®). The fixation was
performed during 40min and an extra ethanol wash was performed after fixing. All the other steps were
followed accordingly to the manufacture’s protocol. Gel development occurred until 7min post addition
of the developer solution.
26
4. Molecular cloning in Plasmodium berghei: Generation
of plasmids for the Pb∆gsk3 complementation
The mammalian/yeast codon optimized version of gsk3 (ogsk3) spliced coding sequence was
synthetized by GeneScript and was used to construct one of the complementation plasmids for
transfection of the Pb∆gsk3 parental line. All Polymerase Chain Reactions (PCR) were amplified with
Phusion® High fidelity proofreading polymerase (Thermo Scientific) with the following reaction
conditions: an initial denaturation at 95oC for 3min, followed by 30 cycles of 45sec at 95oC, 30sec at
55oC, 30sec at 50oC and 1.5min at 62oC, and a final extension step at 68oC for 10min. WT gsk3
upstream and downstream homologous flanking regions (5’HR and 3’HR, respectively) were equally
amplified, from PbANKA genomic DNA (gDNA) isolated with the NZY Blood gDNA Isolation kit
(nzytech®). Amplification (size and specificity) was verified by running a small aliquot (3µl) of the PCR
product was resolved in a 1% agarose gel. PCR product was purified (Qiagen QIAquick® PCR
Purification Kit). For the kinase dead mutant complement construct, the Quickchange II XL-10 SDM kit
(Agilent) was used to perform the site-directed mutagenesis from the ogsk3 within the GeneScript
plasmid. Each insert was digested, as well as the plasmids, with specific restriction digestion enzymes
(New England Biolabs): ogsk3 versions were digested with BamHI and NotI; 5’HR was digested with
HindIII and BamHI; 3’HR was digested with KpnI and HindIII. Each digested insert and plasmid was
resolved in a 1% agarose gel and correct sized bands were gel extracted (Qiagen QIAquick® Gel
Extraction kit). Both insert and vector DNA samples were ligated in the 5:1 molar ratio respectively,
overnight at 14oC using T4 ligase (New England Biolabs). The ligation mixture was used to transform
homemade XL-10 gold or homemade SURE2 Escherichia coli cells. Transformation occurred by heat
shock at 42oC for 45sec and then for 2min on ice. 900µL of pre-warmed (42oC) SOC medium (Super
Optimal Broth (SOB) supplemented with 20mM glucose) was added to the transformation mixture and
cells were allowed to grow at 37oC, 200rpm for 1hour. Cells were then plated on Luria-Bertani (LB) Agar
containing Ampicilin (1µg/mL), which is the bacterial selection marker of the vector, and incubated
overnight at 37oC. Transformed colonies were transferred to LB-Ampicilin broth and incubated overnight
at 37oC and 200rpm. Preliminary verification of insert was performed by Colony PCR, i.e., PCR with
primers specific for each insert, using the bacterial colony as source of DNA. Plasmid DNA was
extracted through the NYZTech Miniprep Kit (nzytech®) from cells in culture and then quantified by
spectrophotometry (Thermo Scientific Nanodrop 2000). Further verification of insert was performed by
sequential digestion of plasmid DNA with specific restriction enzymes for each inset and resolving the
digestion mixture in 1% agarose gel. Clones with appropriate insert size were sent for Sanger
Sequencing (Stabvida) to confirm the absence of non-desired mutations. Prior to parasite transfection,
25µg of donor vectors were linearized (HindIII) and DNA was extracted from the digestion mixture by
acidification with 3M Sodium Acetate (pH 5.2), followed by precipitated with ice cold 100% ethanol, at -
20oC, overnight. Precipitated DNA was obtained by high speed centrifugation (14000rpm) for 5min at
4oC. Next, supernatant was discarded and pellet was washed with 70% ethanol, centrifuged under the
same conditions and the supernatant was decanted so to the pellet was allowed to air-dry, which was
27
then eluted in 10µL of DNAse/RNAse free water and incubated overnight at 4oC to enhance solubility.
From those solutions, 10µg of DNA were used to transfection.
4.1 Transfection of the generated Pb∆gsk3 complement plasmids
Balb/c mice were infected with a cryopreserved blood vial of Pb∆gsk3 parasites, which were
bled when parasitemia levels were around 1%, as mentioned above. Parasites were synchronized via
in vitro overnight culture and fully matured schizonts were isolated through Nycodenz density-gradient
centrifugation, accordingly to the van Dijk et al. 1995. Thus, for preparation of schizonts blood
suspension was distributed equally (8mL per tube) into 15mL tubes and 5mL of 50% Nycodenz-PBS
solution was underlayed below the blood followed by a 20min centrifugation at room temperature and
at 450g without brake. A thin brown-grayish layer containing matured schizonts at the interface between
the two suspensions was collected gently with a Pasteur pipette, washed in CCM at 450g for 8min and
finally resuspended in 1mL of CCM until transfection. Afterwards, schizonts (1-5x107) were, pelleted,
resuspended in 100µL Nucleofactor solution 88A6 (Amaxa) with 10µg of the linearized transfection DNA,
transferred to the electroporation cuvette for electroporation with the Amaxa Nucleofector device, using
transfection protocol U33. Post electroporation, 100µL of CCM were immediately added to the contents
of the cuvette, and the total volume (approximately 200 µL) was injected intravenously via tail vein into
a naïve mouse to allow recovery of transfected merozoites. Positive detection of parasites was observed
24 hours post-transfection and mice were treated with the pro-drug 5-fluorocytosine (5’FC) compound
(negative selection) in the drinking water (1.5mg/mL) (Orr, Philip and Waters, 2012). Mice positive for
parasites were observed 5 days post-treatment. Mice were, then, bled and parasites were cryopreserved
in 60% glycerol/blood vials and a sample kept for genotyping from gDNA. Expression at the RNA level
was observed by PCR amplification of ogsk3 from complementary DNA (cDNA). Thus, total RNA from
the parasites was extracted, with the NZY Total RNA Isolation kit (nzytech®), from which, approximately
200ng of RNA was, then, reverse transcripted (25oC for 10min, 48oC for 50min and 85oC for 5min), using
nzytech® reagents (Random Hexamer NZY mix, dNTPs NZY mix, NZY Ribonuclease inhibitor and NZY
reverse transcriptase).
Afterwards, parasites were processed to parasite cloning, from which seed mice were infected
with the previously prepared blood vials and parasitemia and haematocrit were calculated. This allowed
for the serial dilution of the infected blood to obtain one single parasite that was then, injected into one
mouse. Mice that become positive after a period of 6-9 days are considered clones.
28
5. Plasmodium falciparum in vitro culture
P. falciparum 3D7 strain blood stage parasites were cultured at a 2% haematocrit using malaria
complete medium (MCM) composed of RPMI supplemented with 11mM glucose, 25mM HEPES, 100μM
Hypoxanthine, 2mM L-glutamine, 50μg/L Gentamicin and 0.5% Albumax II. Parasites were maintained
at 37oC with O2 and CO2 controlled conditions. Parasitemia was checked by Giemsa stained thin blood
smears.
Thawing of glycerol-frozen parasites was performed from a frozen vial of P. falciparum 3D7
thawed gently at 37°C following by successive incubations of thawed with salt solutions to reduce
potential for haemolysis. Blood was transferred to a 50ml falcon tube with a sterile pipette and blood
volume was measured. Then, 0.1 x blood volume of 12% NaCl in distilled water was added to the blood
slowly, dropwise, while shaking the tube gently and the tube was let to stand for 5 min. Then, 10 x blood
volume of 1.6% NaCl in distilled water was added to the blood slowly, dropwise, swirling the tube and
blood was centrifuged at 1500rpm at 20°C for 5 min. Supernatant was aspirated and 10 x blood volume
of MCM was added slowly, dropwise, while shaking the tube. Blood was centrifuged at 1500rpm at 20°C
for 5min and supernatant was aspirated. Pelleted blood cells were resuspended in MCM with 5%
haematocrit and transferred to a culture flask. Smears were made and medium was changed every day
until the parasites become visible by Giemsa staining, which happened around day 3.
5.1 Molecular cloning in Plasmodium falciparum: Generation of
plasmids for the generation of the Pfgsk3-gfp tagged line
The generation of the Pfgsk3-gfp tagged line was performed by C-terminal insertion of the gene that
codes for the enhanced version of the GFP protein by single homologous. All the cloning steps were
performed by classical restriction enzymes cloning (BamHI and PstI) as it was achieved for the P.
berghei constructs. In this case, the approximately 1.5kbp homologous region of Pfgsk3 was
successfully cloned into a plasmid which contained the gfp gene and the gene that encodes the
blasticidin S-deaminase, which is the selectable agent that promotes the resistance to blasticidin.
Positive cloning was confirmed by diagnostic digestion (BamHI and PstI) of the final plasmid and
sequencing of the insert.
29
5.2 Transfection of the generated Pfgsk3-gfp plasmid
The transfection was performed with a P. falciparum 3D7 culture with approximately 5%
parasitemia of ring stage parasites. Hence, 3mL of predominantly ring stage parasite culture was
harvested at low speed (1800rpm) for 3min at room temperature and washed with one time incomplete
Cytomix buffer. Next, the blood pellet was resuspended into a final volume of 400µl solution containing
100µg of non-digested plasmid resuspended in incomplete Cytomix. The electroporation was performed
in the Bio-Rad Gene Pulser using 0.31killovolts, 950microfaradays and infinite resistance, from which
the duration of the pulse was 11.2milliseconds. Afterwards, into the eletroporated material was added
3mL of pre-prepared RBC in MCM (4% haematocrit). Four hours post-transfection, the culture was fed
with 5mL fresh MCM, as well in the following day. Between the second and fifth days after transfection,
the culture was fed daily with 5mL of MCM containing (2.5µg/mL) blasticidin. On the sixth day 100µL of
fresh RBC (stock of 50% haematocrit) were added to the culture. From this day on, the culture was fed
every two days, with 5mL of MCM containing blasticidin with addition of fresh RBC every 5/6days.
Parasites were detected 17days after transfection. After parasites have been seen, the culture was fed
daily under the same conditions.
Antibody Type Conjugated Dilution factor
Solution Applicability Source
Rabbit anti-HA
Primary no 1:500 5%BSA/PBS IFA CST
Rat anti-HA Primary no 1:500 5%BSA/PBS IFA Roche
Rabbit anti-PbExp1
Primary no 1:1000 5%BSA/PBS IFA Custom-
made
Rabbit anti-PbBip
Primary no 1:500 5%BSA/PBS IFA Custom-
made
Rabbit anti-PbMSP1
Primary no 1:500 5%BSA/PBS IFA Custom-
made
Rabbit anti-PbAMA1
Primary no 1:500 5%BSA/PBS IFA Dr. Michael Blackman
Rabbit anti-PbSUB1
Primary no 1:500 5%BSA/PBS IFA Dr. Michael Blackman
Rabbit anti-GFP
Primary Alexa 488 1:500 5%BSA/PBS IFA Invitrogen
Donkey anti-rabbit
IgG Secondary Alexa 488 1:500 5%BSA/PBS IFA Invitrogen
Donkey anti-rabbit
IgG Secondary Alexa 568 1:500 5%BSA/PBS IFA Invitrogen
Donkey anti-rat IgG
Secondary Alexa 488 1:500 5%BSA/PBS IFA Invitrogen
Rabbit anti-HA
Primary no 1:500 5%BSA/TBS-T IB CST
Anti-rabbit IgG
Seconday HRP 1:2000 5%BSA/TBS-T IB CST
Table 2 – List of antibodies that were used for the achievement of the IFA and IB metholodies
30
Table 3 – List of primers that were used for the generation and genotyping of all the parasite lines used in this project
Primer name
Direction Species Amplicon Sequence (5’-> 3’)
1 Forward P. berghei Pbgsk3 5’HR-1 CTAAAGCTTAAAAGGGTTACAAAAACTGGT
2 Reverse P. berghei Pbgsk3 5’HR-1 CTAGGATCCATTTTGTTATCAATTCTTTATTAAT
3 Forward P. berghei Pbogsk3 CCGGGATCCATGAAAGATTGGCATACAGATGG
4 Reverse P. berghei Pbogsk3 GCGGCCGCTTACCTTTCTATGGTAAAACAGGAGTTG
5 Forward P. berghei Pbgsk3 3’HR-1 GGTACCTAACCAGAATAATTTTGTTAGAATATAGAAA
6 Reverse P. berghei Pbgsk3 3’HR-1 CTTAAGCTTTATATAACACTATAAAATATAAATTAGCTGAT
7 Forward P. berghei Pbgsk3 5’HR-2 CACATTATTAGTATGATCTAGAGATAAAAG
8 Reverse P. berghei Pbgsk3 5’HR-2 GCTTCGGTGTAGTAGTAGTCCT
9 Forward P. berghei Pbgsk3 3’HR-2 GCACACCAAACAACGCTA
10 Reverse P. berghei Pbgsk3 3’HR-2 CAAGTCCAACTATTTATGAATCAT
11 Forward P. berghei Pbgsk3-YF CCAAAGATCAGTGAGCTTCATCTGCAGCAGATTC
12 Reverse P. berghei Pbgsk3-YF GAATCTGCTGCAGATGAAGCTCACTGATCTTTGG
13 Forward P. berghei Pbgsk3 5’FR gDNA
CCATAAAATAGTTCATTACCTTTTACT
14 Forward P. berghei hdhfr cassette GGAAGATCTATGGTTGGTTCGCTAAACTGCATCG
15 Reverse P. berghei hdhfr cassette GGAAGATCTTTAATCATTCTTCTCATATACTTC
16 Forward P. berghei WT Pbgsk3 ATGAAAGATTGGCATACAG
17 Reverse P. berghei WT Pbgsk3 GGGCCCTCTTTCAATAGTAAAACAAGAGTT
18 Forward P. berghei HA integration 1 ACATTCACCCCCTTTGTGTT
19 Reverse P. berghei HA integration 1 TGCATAATCTGGAACATCATAT
20 Reverse P. berghei HA integration 2 CATACTAGCCATTTTATGTG
21 Forward P. berghei GFP integration ATGAAAGATTGGCATACAG
22 Reverse P. berghei GFP integration ACGCTGAACTTGTGGCCG
23 Forward P. falciparum Pfgsk3-HR CGCTGCAGCCAGACTGTACATAAATATATGAAAT
24 Reverse P. falciparum Pfgsk3-HR CGGGATCCCTTTCTATGATAACGTGCGTT
31
RESULTS AND DISCUSSION
1. Spatial-temporal dynamics
As the spatial-temporal dynamics of Plasmodium GSK3 are poorly understood, one of the aims
of this project is to study the expression fluctuations of GSK3 during the blood stage of infection. We
aim to characterize the expression of GSK3 in chronological terms, i.e., to study when and how much it
is expressed in each developmental stage of the parasite during the erythrocytic cycle. In addition, we
will assess the localization of the kinase within the parasite and/or its host cell. For both purposes, the
approach is to use two Pbgsk3 epitope-tagged lines to detect expression at the protein level. This
approach enables us to detect the protein using validated and commercially-available antibodies in the
absence of specific antibodies to endogenous protein.
1.1. PbGSK3 tagged lines characterization
To gain further insight into PbGSK3 function and importance for Plasmodium intra-erythrocytic
development we started by characterizing two PbGSK3 tagged lines. Both parasite lines were generated
by fusion of a specific tag to the PbGSK3 C-terminus, namely the hemagglutinin (HA) epitope from the
influenza virus and the Green Fluorescent Protein (GFP). Therefore, it is required to verify the
functionality of these transgenic parasite lines to confirm that the enzyme is acting properly in the
combination with the tag. Additionally, it was also generated a GFP fusion-tagged line of PfGSK3.
1.1.1. Characterization at the genomic level
The PbGSK3 epitope-tagged lines, previously generated in the Maria Mota laboratory, were
genotyped to identify parasite clones with proper tag integration at the genomic level. After transfection,
three parasite clones for each one of the tag lines were obtained: Clones A4, B3 and C2 for the Pbgsk3-
ha line and A1, A4 and B4 for the Pbgsk3-gfp line. The genotyping strategy was to amplify three regions:
the gsk3 gene; the human dihydrofolate reductase (hdhfr) gene, which is the positive selection marker
that confers resistance to pyrimethamine (Giulia Manzoni, 2014); the integration at the correct loci of the
genes that codify for the respective protein tag. For the HA integration, two different set of primers were
used in order to ensure the best coverage of the intended region with the amplification of two regions
from ha specific locus. Moreover, genomic DNA from WT PbANKA parasites was used as control. The
genotyping results revealed positive integration for both tagged lines (Figure 14). Regarding PbGSK3-
HA tagged line, only two clones (A4 and C2) showed positive integration for ha whereas all Pbgsk3-gfp
clones showed positive integration. Therefore, at the genomic level it is possible to conclude that both
tag markers were successfully fused to gsk3.
32
1.1.2. Functional characterization of the PbGSK3 tagged lines
To functionally validate the PbGSK3 tagged lines, we characterized them at a phenotype level
by performing two distinct approaches: First, an in vitro maturation assay was carried out to assess
parasite replication, i.e., cell division by schizogony. To perform such experiment, mice were infected
with the transgenic parasites and blood was collected and cultured overnight allowing for schizont
maturation. The number of merozoites, i.e. individual parasites, per fully segmented schizont was
assessed and compared between wild type and then Pb∆gsk3 parasite lines; Second, the in vivo
infection in C57BL7/6 mice was undertaken to study the progression of the murine malaria disease over
time, relatively to parasitemia, which is given by the number of infected erythrocytes per the total number
of erythrocytes over time, and the study of the survival, i.e., the cause and time of death. Hence, both
approaches enable the study of any possible phenotypic changes, as it is expected for the GSK3 tagged
lines to behave exactly as the non-tagged WT PbANKA parasites, which were used as a control for both
assays, as well as the Pb∆gsk3 parasite line.
1.1.2.1. Functional characterization: PbGSK3-HA epitope-tagged line
Relatively to the HA epitope, the two clones that showed positive integration of the tag, A4 and
C2, were analysed. For the in vitro maturation assay, Pbgsk3-ha clone A4 showed a slight difference in
comparison to the WT PbANKA parasites (despite not being statistically significant), which was not so
evident in the clone C2 (Figure 15A). This variability can be explained by the fact that merozoites number
per schizont are different between each parasite within the same parasite line. Moreover, conditions as
parasitemia of the seed donor mice or incubation time might affect the overnight in vitro cultures and,
hence, lead to variability. Even so, differences in replication may not be significant and need to be further
studied by in vivo infectivity assay that allowed the confirmation of the phenotypic behaviour of the
transgenic parasite strains. Nonetheless, the results obtained in both experimental assays are in
accordance, suggesting that parasites lacking gsk3 replicate at a lower rate giving rise to a decreased
number of daughter merozoites per schizont (Figure 15A).
Figure 14 – Genotyping of the parasite clones revealed positive integration of the GSK3 tags
Reaction 1: Pbgsk3 (2.2kbp) amplicon; Reaction 2: hdhfr amplicon (0.7kbp); Reaction 3: integration #1 of
the ha (2.2kbp) amplicon; Reaction 4: integration #2 of ha (2.2kbp) amplicon; Reaction 5: integration of
gfp (2.2kbp) amplicon; 1kb Plus Ladder.
Figure 21 – Pbgsk3-ha clone A4 showed positive phenotypic functionality
A- In vitro maturation assay – boxplot graph presents the results of the merozoites per schizont counting; N=3;
WT PbANKA: 15,87±0,68;
PbΔgsk3: 10,73±1,35;
Pbgsk3-ha-A4: 13,35±0,64;
Pbgsk3-ha-C2:Figure 22 – Genotyping of the parasite clones revealed positive integration of the
GSK3 tags
Reaction 1: Pbgsk3 (2.2kbp) amplicon; Reaction 2: hdhfr amplicon (0.7kbp); Reaction 3: integration #1 of
the ha (2.2kbp) amplicon; Reaction 4: integration #2 of ha (2.2kbp) amplicon; Reaction 5: integration of
gfp (2.2kbp) amplicon; 1kb Plus Ladder.
33
Analysis of the results obtained in the in vivo infectivity assay suggest that the two Pbgsk3-ha
clones behave and develop with a different pattern, as evidenced by a different progression of
parasitemia. Analysis of parasitemia curves shows that the clone A4 presented a parasitemia curve that
is comparable to the curve obtained for the WT PbANKA control, whereas the clone C2 describes a
curve that is similar to the one obtained for the Pb∆gsk3 parasite line (Figure 15B). Nonetheless, the
pattern of parasitemia curves in the wild type and in the Pb∆gsk3 parasites is maintained. Interestingly,
both Pbgsk3-ha clones did not follow the characteristic plateau followed by a drop in parasitemia
observed for the Pb∆gsk3 parasite line at day 4 post-infection (4dpi), showing instead an increase in
parasitemia, although not so prominent as in the WT PbANKA parasites (Figure 15B). Still, the PbGSK3-
HA epitope-tagged parasite clones described the same curve until 9dpi, that correspond to the death of
the clone A4 infected mice. As expected, mice infected with the clone A4 line died of Experimental
Cerebral Malaria (ECM), whereas only one mouse infected with the clone C2 died of this pathology
(Figure 15C). All remaining mice died of hyperparasitemia, i.e., severe anaemia, which is also the cause
of death in Pb∆gsk3 infected mice (Figure 15C). Therefore, the progression of infection and the outcome
of disease in mice infected with Pbgsk3-ha clone A4 parasites appear to behave as the WT PbANKA
control, whereas the Pbgsk3-ha clone C2 was apparently behaving as Pb∆gsk3 parasites.
Nevertheless, the Pbgsk3-ha clone C2 infected mice that survived to ECM, gave a parasitemia curve
that describes an intermediate pattern, as it does not fully resemble the lowered Pb∆gsk3 infection
(Figure 15B). Thus, despite the relatively small size of the epitope (3kDa), in Clone C2, GSK3 appears
to be slightly compromised, a conundrum that might affect downstream analysis and interpretations.
Bearing this data in mind we decided to proceed only with the Pbgsk3 clone A4 parasite line
that was shown to have a growth as the WT PbANKA control, allowing for the study of PbGSK3 spatial-
temporal dynamics. Thus, this clonal line will be used to characterize PbGSK3 through detection of the
HA tag.
1.1.2.2. Functional characterization: PbGSK3-GFP fusion-tagged line
Regarding the GFP tag, we decided to functionally characterize clones A4 and B4 with the same
approaches used for the Pbgsk3-ha parasite lines. Remarkably, given the relatively big size of the tag
(25 kDa) both Pbgsk3-gfp clones described the same phenotypic behaviour of the WT PbANKA
parasites. For the in vitro maturation assay, the number of daughter merozoites per schizont was slightly
different than the wild type control, although not so pronounced as for the Pb∆gsk3 parasites (Figure
16A). Nonetheless, this decrease proved to be not significant (even statistically), as both transgenic
lines presented the expected wild type phenotype in the infectivity assay. Thus, mice infected with these
transgenic parasite lines described the same progression of the infection of the WT PbANKA parasites,
from which they showed the same parasitemia curve pattern (Figure 16B) and the same outcome of the
disease, as all the mice infected with either Pbgsk3-gfp or wild type parasites died of ECM (Figure 16C).
Furthermore, Pb∆gsk3 parasites continued to show the same phenotypic features described for this
deletion mutant line. Therefore, both clones were properly validated to characterize PbGSK3 through
detection of the GFP tag.
34
C
C
A
A
Figure 15 – Pbgsk3-ha clone A4 showed
positive phenotypic functionality
A- In vitro maturation assay – boxplot graph
presents the results of the merozoites per
schizont counting; N=3;
WT PbANKA: 15,87±0,68;
PbΔgsk3: 10,73±1,35;
Pbgsk3-ha-A4: 13,35±0,64;
Pbgsk3-ha-C2: 14,42±0,18.
B - Parasitemia curve – number of infected
erythrocytes per the total number of
erythrocytes over time - obtained through the
daily measurement of the parasitemia of mice
infect with each one of the four strains by flow
cytometry; N=5
•’ – 3dpi – PbΔgsk3 **; Pbgsk3-ha-A4 ****;
Pbgsk3-ha-C2 *
•’’ – 4dpi – PbΔgsk3 ****; Pbgsk3-ha-A4 **;
Pbgsk3-ha-C2 ****
•''' – 5dpi – PbΔgsk3 ****; Pbgsk3-ha-A4 ns;
Pbgsk3-ha-C2 *
C – Survival curve – percentage of living mice
throughout the infection; N=5
PbΔgsk3 **
Pbgsk3-ha-A4 ns
Pbgsk3-ha-C2 *
B
B
35
Figure 16 – Both Pbgsk3-gfp clones
showed positive phenotypic
functionality
A- In vitro maturation assay – boxplot graph
presents the results of the merozoites per
schizont counting; N=3
WT PbANKA: 15,21±1,18;
PbΔgsk3: 11,4±0,13;
Pbgsk3-gfp-A4: 13,78±0,80;
Pbgsk3-gfp-B4: 13,28±0,44.
B - Parasitemia curve – number of infected
erythrocytes per the total number of
erythrocytes over time - obtained through
the daily measurement of the parasitemia
by Giemsa-stained smears in mice infected
with each one of the four strains; N=5
3dpi – PbΔgsk3 ns; Pbgsk3-gfp-A4 ns;
Pbgsk3-gfp-B4 ns
4dpi – PbΔgsk3 ns; Pbgsk3-gfp-A4 ns;
Pbgsk3-gfp-B4 ns
5dpi – PbΔgsk3 ****; Pbgsk3-gfp-A4 ****;
Pbgsk3-gfp-B4 ***
C – Survival curve – percentage of living
mice throughout the infection; N=5
PbΔgsk3 **
Pbgsk3-ha-A4 ns
Pbgsk3-ha-C2 ns
A
Fig
ure
23
–
Bot
h
Pbg
sk3
-
gfp
clo
nes
sho
we
d
pos
itiv
e
phe
not
ypi
c
fun
ctio
nali
ty
A-
In
vitr
o
mat
ura
tio
n
ass
ay
–
box
plo
t
gra
ph
pre
sen
ts
the
res
ults
of
the
me
roz
oite
s
per
schi
zon
t
cou
ntin
g;
B
B
C
C
36
1.2. Generation of a PfGSK3-GFP fusion-tagged parasite line
In order to study the spatial-temporal dynamics of GSK3 in P. falciparum and to corroborate
the results from the rodent model of malaria (P. berghei) in a more clinically relevant parasite (P.
falciparum), a PfGSK3-GFP fusion-tagged line was generated during this project. Contrarily to P.
berghei, this study would only include the in vitro approach, as the P. falciparum 3D7 strain can be
continuously maintained in human erythrocytes. Nonetheless, a PfGSK3-GFP C-terminus tagged line
was successfully generated by single homologous recombination between a homologous region of
Pfgsk3 (Figure 17). This region was cloned in a vector that included the enhanced version of gfp and
the gene that encodes for the blasticidin S-deaminase, which promotes resistance to blasticidin, a
selectable marker for transfection. Successful cloning was confirmed by restriction enzymes digestion
and by sequence alignment with the WT locus. Therefore, 13 days post transfection we were able to
detect the desired transgenic parasites in the in vitro culture.
Preliminary results obtained by immunofluorescence showed positive signal for the GFP tag,
through an anti-GFP antibody, allowing for PfGSK3 detection (Figure 18). Nevertheless, to validate the
PfGSK3-GFP epitope-tagged parasites as a proper tool to study the expression levels of PfGSK3, it is
also necessary to detect PfGSK3-GFP by immunoblotting and confirm the proper size (approximately
75kDa, from which 50kDa correspond to the PfGSK3 and 25kDa belong to the GFP protein), as well as
assess the genomic integration of the tag and possible changes (mutations) in the gene, and also
possible functional phenotypic changes of this parasite line, such as growth rate deviations when
compared to the WT Pf3D7 parasites.
Figure 17 – Generation of an fusion-tagged PfGSK3-GFP by single homologous recombination A- Single homologous recombination with insertion of a C-terminal GFP tag into PfGSK3
gene locus B-Diagnostic digestion (BamHI and PstI) of the final construct: The upper band corresponds
to the 7kbp vector; The lower band matches the 1.5kbp Pfgsk3 homologous region(HR); 1Kb
Plus Ladder
Figure 25 – PfGSK3-GFP fusion-tagged line was successfully detected by immunofluorescence Confocal microscopy images of P. falciparum schizonts stained with a fluorophore conjugated anti-GFP antibody, to detect PfGSK3-GFP (green) and with Hoechst for nuclei staining (blue). Differential interference contrast (DIC) DIC was used for bright field (right). Scale bar–2µmFigure 26 – Generation of an fusion-tagged PfGSK3-GFP by single homologous recombination A- Single homologous recombination with insertion of a C-terminal GFP tag into PfGSK3
gene locus B-Diagnostic digestion (BamHI and PstI) of the final construct: The upper band corresponds to the 7kbp vector; The lower band matches the 1.5kbp Pfgsk3 homologous region(HR); 1Kb
Plus Ladder
B
B
A
Fi
gu
re
24
–
G
en
er
ati
on
of
an
fu
si
on
-
ta
gg
ed
Pf
G
S
K3
-
G
FP
by
si
ng
le
ho
m
ol
og
ou
s
re
37
1.3. Towards the characterization of GSK3 expression fluctuation
Plasmodium berghei parasites maintain tight synchronicity in the first erythrocytic cycles before
becoming slightly asynchronous with the progression of the infection. Synchronization assays with blood
stage parasites can be induced in P. berghei due to the ability to obtain highly enriched and purified
schizont stages. Upon injection of these fully mature schizonts into naïve mice, newly emerged
merozoites invade erythrocytes and begin a synchronous cycle allowing for collection of parasites from
early invasion (rings) to active growth (trophozoites) to full maturation (schizonts) (Janse & Waters,
1994).
In order to chronologically analyse the expression of PbGSK3, a time course assay was
performed with both Pbgsk3-ha and Pbgsk3-gfp parasites. Two types of analyses were performed: (i)
Immunoblotting to quantitatively and temporally analyse protein expression and (ii) Immunofluorescence
assay (IFA) to spatially localize protein expression across time.
The assessment of PbGSK3 expression quantification was obtained for the PbGSK3-HA
parasites. The predicted size of Plasmodium GSK3 based on amino acid sequence is 50 kDa. In
conjunction with the triple HA tag (3 kDa) the expected band size for the epitope-tagged PbGSK3-HA is
53kDa. Nonetheless, a band of approximately 60kDa (between the 50kDa and the 75kDa markers) was
specifically detected (Figure 19A). A band similar in size corresponding to PfGSK3 was previously
observed (Solyakov et al., 2011). Interestingly, the levels of expression of the kinase seem to be lower
during the early stages of the parasite development (being almost absent in the ring stage), but increase
substantially in the late stages. In fact, the signal seems to increase during trophozoite development,
having the highest peak during schizogony and at fully segmented schizonts (Figure 19A). Band
intensity quantification shows a slight increase of signal during trophozoite development followed by an
abrupt increase of expression during the late parasitic stages (Figure 19B).
Figure 18 – PfGSK3-GFP fusion-tagged line was successfully detected by immunofluorescence
Confocal microscopy images of P. falciparum schizonts stained with a fluorophore conjugated anti-GFP antibody, to detect PfGSK3-GFP (green) and with Hoechst for nuclei staining (blue).
Differential interference contrast (DIC) DIC was used for bright field (right). Scale bar–2µm
Figure 27 – PfGSK3-GFP fusion-tagged line was successfully detected by immunofluorescence
Confocal microscopy images of P. falciparum schizonts stained with a fluorophore conjugated anti-GFP antibody, to detect PfGSK3-GFP (green) and with Hoechst for nuclei staining (blue).
Differential interference contrast (DIC) DIC was used for bright field (right). Scale bar–2µm
PfGSK3-GFP Merged DIC
38
Contrary to the immunoblotting, both PbGSK3 tagged lines were used to characterize the
expression and spatial localization of PbGSK3 by immunofluorescence. As it was observed in the
quantitative immune-blotting expression analysis, we were able to corroborate an increase in PbGSK3
expression, with more robust signal in the late stages (Figure 20). Furthermore, both tagged parasite
lines appear to have the same pattern of expression and localization, which goes in agreement to what
was expected. PbGSK3 seems to be expressed within the parasite and was not readily detectable
beyond the confines of the parasite and within the host cell. Thus, we were unable to corroborate
localization within vesicular trafficking structures beyond the PVM, as it was previously reported for
PfGSK3 to co-localise in the Maurer’s clefts (Droucheau et al., 2004). Moreover, PbGSK3 is found within
the parasite cytoplasm in trophozoite and schizogony stages. PbGSK3 is also packaged into mature
merozoites. In addition, PbGSK3 appears also to be dispersed in the nucleus of the parasite. These two
subcellular localisations (cytosol and nucleus) of GSK3 are described for the mammalian GSK3
orthologue (Beurel, Grieco and Jope, 2015).
0
1
2
3
4
5
6
7
8
9
10
Rel
ativ
e P
bG
SK3
exp
ress
ion
Figure 19 – PbGSK3 is expressed throughout the erythrocytic cycle, having
peaks of expression during schizogony and at fully segmented schizonts
A-Top – Representative images of synchronized Giemsa-stained parasites
Middle – Immunoblotting analysis of PbGSK3-HA (53KDa) in whole parasite pellet
extract from different parasite stages using a rabbit monoclonal anti-HA antibody.
Bottom – PbBip used as a loading control; Each lane is representative of equivalent
numbers of parasites; See supplementary Figure 1 to check the Ponceau staining
B- Band intensity quantification using the ImageJ software. PbBip intensity levels were
used for normalization.
Figure 29 – PbGSK3 is expressed throughout the erythrocytic cycle, having
peaks of expression during schizogony and at fully segmented schizonts
A-Top – Representative images of synchronized Giemsa-stained parasites
Middle – Immunoblotting analysis of PbGSK3-HA (53KDa) in whole parasite pellet
extract from different parasite stages using a rabbit monoclonal anti-HA antibody.
Bottom – PbBip used as a loading control; Each lane is representative of equivalent
numbers of parasites; See supplementary Figure 1 to check the Ponceau staining
B- Band intensity quantification using the ImageJ software. PbBip intensity levels were
used for normalization.
B
Fi
gu
re
28
–
P
b
G
S
K
3
is
ex
pr
es
se
d
th
ro
ug
ho
ut
th
e
er
yt
hr
oc
yti
c
cy
cl
e,
ha
vi
ng
pe
ak
s
of
ex
pr
es
si
PbGSk3-HA 53KDa
PbBip 70KDa
A Giemsa
staining
Giemsa
staining
39
A
A Ea
rly
tro
ph
ozo
ite
Tro
ph
ozo
ite
La
te t
rop
ho
zoit
e
Sch
izo
gon
y Sc
hiz
on
ts
GSK3-HA Merged DIC
Rin
g
40
B
B
GSK3-GFP Merged DIC
Rin
g Ea
rly
tro
ph
ozo
ite
Tro
ph
ozo
ite
La
te t
rop
ho
zoit
e
Sch
izo
gon
y Sc
hiz
on
ts
41
As it was expected, the kinase is expressed across the entire erythrocytic cycle, as it seems to
be equally expressed at the RNA level during all the cycle (Droucheau et al., 2004). Even so, at the
protein level it is differentially expressed throughout the blood stage development. Remarkably, the
same type of expression was obtained by the two different techniques.
Furthermore, regarding the theoretical temporal dynamics of GSK3, it is expected in a
supposedly constitutively active enzyme to have an increasing gradient throughout the erythrocytic cycle
as the parasite develops, as it is observed for PbBip immunoblotting (Figure 19A). Nonetheless, the
detected peaks of expression in the late stages, namely in parasites that are in schizogony and in fully
matured schizonts, allow for the hypothesis that GSK3 might have a key role in the parasite replication
(i.e. schizogony) and in the function of mature merozoites.
In order to get further insight into PbGSK3 spatial dynamics within the parasite, we used
different markers, such as Exp1, a marker of the PVM (Spielmann et al., 2006) and PbBip, a marker of
the Endoplasmic reticulum (ER) (Slavic et al., 2016), Merozoite Surface Protein 1 (MSP1) a marker of
the merozoite surface (Kadekoppala and Holder, 2010), AMA1 which labels the micronemes (Healer et
al., 2002) and SUB1 which labels the exonemes organelle (Yeoh et al., 2007). The first one which, as
the name says, is expressed in the surface of the daughter merozoites and the last two, as it was
mentioned in the introduction, are invasion and egress protein markers, respectively. Furthermore, as
the levels of expression were low at the early time points, it was decided to use the last four, which
correspond to the trophozoites (Figure 21), late trophozoites (Figure 22), parasites in schizogony (Figure
23) and fully segmented schizonts (Figures 24-26), respectively.
Figure 20 – PbGSK3 has an increased expression throughout the erythrocytic cycle, having peaks of
expression during schizogony and in fully segmented schizonts
A) Immunofluorescence analysis of PbGSK3-HA by PFA fixation of iRBC from synchronized mice blood.
Confocal microscopy images of blood-stage parasites: ring, early trophozoite, trophozoite, late trophozoite, late
trophozoite in schizogony and fully matured schizonts stained with a monoclonal anti-HA antibody, to detect
PbGSK3-HA (green), and with Hoechst for nuclei staining (blue). DIC was used for bright light (right). Scale
bar–2µm
B) Immunofluorescence analysis of PbGSK3-GFP by PFA fixation of iRBC from synchronized mice blood.
Confocal microscopy images of blood-stage parasites: ring, early trophozoite, trophozoite, late trophozoite, late
trophozoite in schizogony and fully matured schizonts stained with a fluorophore conjugated anti-GFP antibody,
to detect PbGSK3-GFP (green), and with Hoechst for nuclei staining (blue). DIC was used for bright light (right).
Scale bar – 2µm
42
Figure 22 – PbGSK3 does not co-localize within the PVM and partially co-localises with the ER during the
late trophozoite stage of the erythrocytic cycle
Top - Confocal microscopy images of late trophozoites stained with a monoclonal anti-HA antibody, to detect
PbGSK3-HA (green), with an anti-Exp1 antibody (red) and with Hoechst for nuclei staining (blue). DIC was used
for bright light (right). Scale bar–2µm
Bottom - Confocal microscopy images of late trophozoites stained with a monoclonal anti-HA antibody, to detect
PbGSK3-HA (green), with an anti-Bip antibody (red) and with Hoechst for nuclei staining (blue). DIC was used for
bright light (right). Scale bar–2µm
Figure 21 – PbGSK3 does not co-localize within the PVM and partially co-localises with the ER during the
trophozoite stage of the erythrocytic cycle
Top - Confocal microscopy images of trophozoites stained with a monoclonal anti-HA antibody, to detect
PbGSK3-HA (green), with an anti-Exp1 antibody (red) and with Hoechst for nuclei staining (blue). DIC was used
for bright light (right). Scale bar–2µm
Bottom - Confocal microscopy images of trophozoites stained with a monoclonal anti-HA antibody, to detect
PbGSK3-HA (green), with an anti-Bip antibody (red) and with Hoechst for nuclei staining (blue). DIC was used for
bright light (right). Scale bar–2µm
Figure 32 – PbGSK3 does not co-localize within the PVM and partially co-localises with the ER during the
late trophozoite stage of the erythrocytic cycle
Top - Confocal microscopy images of late trophozoites stained with a monoclonal anti-HA antibody, to detect
PbGSK3-HA (green), with an anti-Exp1 antibody (red) and with Hoechst for nuclei staining (blue). DIC was used
for bright light (right). Scale bar–2µm
Bottom - Confocal microscopy images of late trophozoites stained with a monoclonal anti-HA antibody, to detect
PbGSK3-HA (green), with an anti-Bip antibody (red) and with Hoechst for nuclei staining (blue). DIC was used for
bright light (right). Scale bar–2µmFigure 33 – PbGSK3 does not co-localize within the PVM and partially co-
localises with the ER during the trophozoite stage of the erythrocytic cycle
Top - Confocal microscopy images of trophozoites stained with a monoclonal anti-HA antibody, to detect
PbGSK3-HA (green), with an anti-Exp1 antibody (red) and with Hoechst for nuclei staining (blue). DIC was used
for bright light (right). Scale bar–2µm
Bottom - Confocal microscopy images of trophozoites stained with a monoclonal anti-HA antibody, to detect
PbGSK3-HA (green), with an anti-Bip antibody (red) and with Hoechst for nuclei staining (blue). DIC was used for
bright light (right). Scale bar–2µm
Merged DIC PbEXP1 PbGSK3-HA Tr
op
ho
zoit
e
Tro
ph
ozo
ite
Merged DIC PbBip PbGSK3-HA
Late
Tro
ph
ozo
ite
Merged DIC PbBip PbGSK3-HA
Merged DIC PbEXP1 PbGSK3-HA
Late
Tro
ph
ozo
ite
43
Sch
izo
gon
y Sc
hiz
ogo
ny
Merged DIC PbEXP1 PbGSK3-HA
Merged DIC PbBip PbGSK3-HA
Figure 23 – PbGSK3 does not co-localize within the PVM and partially co-localises with the ER during the
late trophozoite in schizogony during the erythrocytic cycle
Top - Confocal microscopy images of late trophozoites in schizogony stained with a monoclonal anti-HA antibody,
to detect PbGSK3-HA (green), with an anti-Exp1 antibody (red) and with Hoechst for nuclei staining (blue). DIC
was used for bright light (right). Scale bar–2µm; Bottom - Confocal microscopy images of late trophozoites in
schizogony stained with a monoclonal anti-HA antibody, to detect PbGSK3-HA (green), with an anti-Bip antibody
(red) and with Hoechst for nuclei staining (blue). DIC was used for bright light (right). Scale bar–2µm
Figure 24 – PbGSK3 does not co-localize within the PVM and partially co-localises with the ER in
schizonts during the erythrocytic cycle
Top - Confocal microscopy images of schizonts stained with a monoclonal anti-HA antibody, to detect PbGSK3-
HA (green), with an anti-Exp1 antibody (red) and with Hoechst for nuclei staining (blue). DIC was used for bright
light (right). Scale bar–2µm; Bottom - Confocal microscopy images of schizonts stained with a monoclonal anti-
HA antibody, to detect PbGSK3-HA (green), with an anti-Bip antibody (red) and with Hoechst for nuclei staining
(blue). DIC was used for bright light (right). Scale bar–2µm
Sch
izo
nts
Sc
hiz
on
ts
Merged DIC PbExp1 PbGSK3-HA
Merged DIC PbBip PbGSK3-HA
44
Firstly, PbGSK3 did not co-localize with PbExp1, which means that it is not present in the PVM,
as it is observed for all the four studied parasitic stages (Figures 21-24). As a matter of fact, this marker
also enables for the conclusion that PbGSK3 is localized within the parasite fraction, as the PVM delimits
the boundary between parasite (PVM) and host cell cytoplasm. Thus, it does not seem to be exported
to the erythrocyte cytoplasm as previously suggested (Droucheau et al., 2004). This is more emphasized
in the trophozoite stage, as the parasite does not fully occupy the host cell (Figure 21). Additionally,
PbGSK3 appears to co-localize partially within the ER, labelled by PbBip, as it is appeared diffused with
no specific pattern of expression, as it happens in the nucleus (Figures 21-24).
Sch
izo
nts
Merged DIC PbMSP1 PbGSK3-HA
Figure 25 – PbGSK3 does not co-localize in the merozoite surface in the schizonts stage during the
erythrocytic cycle
Confocal microscopy images of schizonts stained with a monoclonal anti-HA antibody, to detect PbGSK3-HA
(green), with an anti-MSP1 antibody (red) and with Hoechst for nuclei staining (blue). DIC was used for bright light
(right). Scale bar–2µm;
Figure 37 – PbGSK3 does not co-localize in the merozoite surface in the schizonts stage during the
erythrocytic cycle
Confocal microscopy images of schizonts stained with a monoclonal anti-HA antibody, to detect PbGSK3-HA
(green), with an anti-MSP1 antibody (red) and with Hoechst for nuclei staining (blue). DIC was used for bright light
(right). Scale bar–2µm;
Sch
izo
nts
Sc
hiz
on
ts
Merged DIC PbAMA1 PbGSK3-HA
Merged DIC PbSUB1 PbGSK3-HA
Figure 26 – PbGSK3 co-localize with the PbAMA1 and PbSUB1 apical proteins in the schizonts stage
during the erythrocytic cycle in samples fixed with acetone:methanol
Top - Confocal microscopy images of schizonts stained with a monoclonal anti-HA antibody, to detect PbGSK3-
HA (green), with an anti-AMA1 antibody (red) and with Hoechst for nuclei staining (blue). DIC was used for bright
light (right). Scale bar–2µm; Bottom - Confocal microscopy images of schizonts stained with a monoclonal anti-
HA antibody, to detect PbGSK3-HA (green), with an anti-SUB1 antibody (red) and with Hoechst for nuclei staining
(blue). DIC was used for bright light (right). Scale bar–2µm
45
Regarding the co-localization of markers to fully matured schizonts, firstly, it is observed that
PbGSK3 is not present in the surface of the merozoite as it does not have the same pattern of expression
of PbMSP1. Additionally, it appears to localize within the merozoite cytoplasm, as it occupies the interior
of daughter parasites (Figure 25). Secondly, accordingly to the expression pattern of PbAMA1 and
PbSUB1, it seems to be compartmentalized in the apical organelles (Figure 26). However, the fixation
method used to stain proteins localized to the apical organelles is based on blood smears fixed with an
ice-cold acetone:methanol solution, instead of blood cells in suspension fixed with paraformaldehyde
(PFA) as performed for all the previous stainings. Interestingly, this type of fixation gives a completely
different pattern of expression for PbGSK3 in schizonts as the cellular structure is not so well preserved
and the signal seems to be agglomerated. Thus, PbGSK3 signal is, similarly to AMA1 and SUB1,
observed as a single spot within the apical end of the merozoite and remarkably, appears to co-localize
with both markers (Figure 26).
Nonetheless, in order to confirm co-localisation, it is necessary to measure co-localisation
instead of simply assuming it by visualizing the overlaid images. Hence, we applied a global statistical
analysis that performs intensity correlation coefficient-based (ICCB) analysis to assess the relationship
between fluorescence intensities through the JACoP software. There, we used the Person’s coefficient
to measure the strength of the linear relationship between the two signals, which can vary from -1 to 1.
This correlation coefficient measures the dependency of pixels in dual channels images, from which the
intensity of a given pixel in the “green” image is used as a x-coordinate of the scatter plot and the
intensity of the corresponding pixel in the “red” image as the y-coordinate. The result is a pixel
distribution diagram (scatter plot), named cytofluorogram, with a linear equation describing the
relationship between the intensities in the two images calculated by liner regression. The perfect co-
localisation is given by a x=y type equation (forming a 45o angle) (Figure 27C). Moreover, the slope is
directly influenced by the difference in signal intensity, which indicates partial co-localisation (when the
slope value moves away from 1) (Bolte and Cordelieres, 2006).
Furthermore, we also used the Mander’s coefficient to measure co-localisation between the
two signals. This coefficient is based on the Person’s but it excludes the intensity values from the
mathematical expression. Therefore, this coefficient does not consider the signal intensity in each
individual pixel. It just considers the presence or absence of signal in each pixel. Hence, the Mander’s
coefficient gives two ratios: M1, which is the ratio of the number of pixels from the green channel, for
which there are corresponding pixels from the red channel, to the total number of pixels in the green
channel. M2 is the opposite, for red. These ratios range from 0 to 1 (0%-100% co-localisation) (Bolte
and Cordelieres, 2006). Remarkably, a Person’s coefficient of 0,897 was obtained for the GSK3/AMA1
co-localisation, whereas it was obtained a 0.907 coefficient for the GSK3/SUB1 co-localisation.
Furthermore, the ratios from the Mander’s coefficient also indicate complete co-localisation: Firstly, for
the GSK3/AMA1 co-localisation analysis, the M1 ratio (fraction of GSK3 overlapping AMA1) was 97%,
whereas the M2 ratio (fraction of AMA1 overlapping GSK3) 69%. Secondly, for the GSK3/AMA1 co-
localisation analysis, the M1 ratio (fraction of GSK3 overlapping AMA1) was 92%, whereas the M2 ratio
(fraction of AMA1 overlapping GSK3) 85%. Besides, both cytofluorograms showed complete co-
localisation (Figure 27A-B).
46
All in all, these ICCB analysis show complete co-localisation between GSK3 and the two apical
proteins. Nevertheless, despite the level of sensibility offered by this kind of staining is relatively high,
the meticulousness of this techniques is not enough to perceive small differences in subcellular co-
localisations. For example, as AMA1 and SUB1 are secreted proteins from different organelles
(micronemes and exonemes, respectively), it would be expected to detect dissimilarities in localization
for PbGSK3 with another method capable to detect that difference. Therefore, one powerful tool to study
PbGSK3 localisation would be the analysis at the Electron-Microscopy (EM) level, such as the Immuno-
EM through the use of the epitope-tagged PbGSK3 (Koster and Klumperman, 2003).
Regardless the obtained PbGSK3 signal from fixed samples, the expression levels of PbGSK3
were also assessed in live parasites (Figure 28). The approach was to synchronize parasites and image
fully matured schizonts, which was the parasite stage that had higher expression of GSK3. Therefore,
Pbgsk3-gfp parasites were used for live imaging of PbGSK3 as GFP emits fluorescence when excited
in a certain wave length (498nm). Interestingly, although the signal quenched quite fast. PbGSK3-GFP
expression was strong enough to emit fluorescence in detectable levels. As it was observed in (PFA)
fixed samples, GSK3 was also detected throughout the cell cytoplasm of individual merozoites, as well
within the nucleus (Figure 28). A previous report utilizing PfGSK3-GFP parasites combined with live
microscopy determined localization of GSK3 as nuclear, peri-nuclear, and cytosolic (Prinz et al., 2016),
thus corroborating the present observations.
A B
C
Figure 27 – GSK3 co-localises with
AMA1 and SUB1 accordingly to a global
statistical analysis
A – Cytofluorogram AMA1/GSK3: each dot
represents one individual pixel with
intensity values simultaneously for the
AMA1 signal and for the GSK3-HA signal
B – Cytofluorogram SUB1/GSK3: each dot
represents one individual pixel with
intensity values simultaneously for the
SUB1 signal and for the GSK3-HA signal
C – General scheme of a cytofluorogram
Figure 40 – GSK3 co-localises with
AMA1 and SUB1 accordingly to a global
statistical analysis
A – Cytofluorogram AMA1/GSK3: each dot
represents one individual pixel with
intensity values simultaneously for the
AMA1 signal and for the GSK3-HA signal
B – Cytofluorogram SUB1/GSK3: each dot
represents one individual pixel with
intensity values simultaneously for the
SUB1 signal and for the GSK3-HA signal
C – General scheme of a cytofluorogram
47
GSK3-GFP Merged Bright
0 s
ec
5 s
ec
10
se
c 1
5 s
ec
20
se
c
Figure 28 – GSK3 is detected at the live imaging level
Live imaging microscopy images of living schizonts excited with 488nm laser, to
detect PbGSK3-GFP (green). Hoechst for nuclei staining (blue). DIC was used
for bright light (right; 5 seconds intervals between exposure. Scale bar–2µm
Figure 42 – 185 Plasmodium genes are putative targets of GSK3
Search strategy system from PlasmoDB: Intersection between all the genes
whose protein product contains the target motif of GSK3 both in P. berghei
(correspondent orthologues) and P. falciparum, from which that are
phosphoproteomic evidence from Pease et al., 2013Figure 43 – GSK3 is
detected at the live imaging level
Live imaging microscopy images of living schizonts excited with 488nm laser, to
detect PbGSK3-GFP (green). Hoechst for nuclei staining (blue). DIC was used
48
The characterization of the spatial-temporal dynamics of GSK3 was possible through the use of
GSK3 fusion-tagged lines, which were previously validated. This chapter showed that PbGSK3, despite
being constitutively active, has a particular profile of expression, as it was differently abundant during
parasite development throughout the erythrocytic cycle. Interestingly, the levels of expression of GSK3
seem to be lower during the early stages of the parasite development but levels increase during
trophozoite development, having the highest peak during schizogony and fully segmented schizonts.
Furthermore, GSK3 was not readily detectable beyond the confines of the parasite, being expressed in
the parasite cytoplasm, nucleus, to a certain extent within ER. At the fully matured schizonts stage,
PbGSK3 co-localises with PbAMA1, which is associated to invasion and labels the micronemes
organelles, and with PbSUB1, that labels the egress, associated organelles, exonemes. In addition,
PbGSK3-GFP was successfully detected with live imaging level at the schizont stage. Therefore,
according to these results, GSK3 might have a key role in the parasite replication (i.e. schizogony) and
in the function of mature merozoites, such as egress and/or invasion processes. Furthermore, based on
its extensive and varied localization within the parasite, such as nuclear localization, Plasmodium GSK3
may have other pleiotropic functions, like regulation of gene expression. All in all, we conclude that, as
observed in other organisms, GSK3 is a multi-faceted kinase with diverse localization and expression
levels which vary with development and progression through the cell cycle.
49
2. Towards the Identification of GSK3
interacting proteins and substrates
In order to get further insight into GSK3 role in Plasmodium spp., it would be advantageous to
have possible clues about its regulation, pathways, and cellular processes where it functions. This
information would allow us to better understand the obtained phenotype. However, neither the GSK3
function, substrates, binding partners or the pathways that it is involved in are yet elucidated in
Plasmodium. Nevertheless, as GSK3 is a well studied kinase in other organisms such as yeast (Rubin-
bejerano et al., 2004) and mammals (Beurel, Grieco and Jope, 2015), we can extrapolate information
regarding its potential binding partners and substrates. Given this information it is possible to predict
possible interacting proteins through an in silico approach.
2.1. Search for potential GSK3 substrates on PlasmoDB
Besides providing a whole set of information about one particular gene, the PlasmoDB database
(www.plasmodb.org) (Aurrecoechea et al., 2009) also offers a search strategy system that employs
various parameters to obtain curated gene lists based on metabolic pathways, sequence motif search,
expression, post-translational modifications, and other “omics” data integration. This, then, allows the
combination of different searches to cross the obtained data. Thus, an in silico analysis of the possible
targets of PbGSK3 was performed. Firstly, 950 genes were obtained by a search for the genes in P.
berghei whose protein product contained the S/T-X-X-X-S/T-P motif pattern, which is the GSK3
substrate motif (Beurel, Grieco and Jope, 2015). Then, from that list, only the genes (920) that have
orthologues in P. falciparum were crossed with the 1041 genes from P. falciparum whose protein product
contained the GSK3 target motif. This interception intended the selection for the genes that are possibly
conserved between the two species in terms of GSK3 regulation. Hence, 454 genes were obtained from
this search, which were then crossed with the mass spectrometry (Mass Spec) evidence for
phosphorylation. For this purposed, we used the phosphoproteome data from Pease et al. 2013 that
includes the P. falciparum intraerythrocytic stages (ring, trophozoite and schizont) phosphoproteome.
At the end, this simple search combination strategy provided 185 genes that code for proteins that are
possible targets of GSK3 during the blood stage of infection (Figure 29).
Figure 29 – 185 Plasmodium genes are putative
targets of GSK3
Search strategy system from PlasmoDB: Intersection
between all the genes whose protein product contains the
target motif of GSK3 both in P. berghei (correspondent
orthologues) and P. falciparum, from which that are
phosphoproteomic evidence from Pease et al., 2013
Figure 44 – 185 Plasmodium genes are putative
targets of GSK3
Search strategy system from PlasmoDB: Intersection
between all the genes whose protein product contains the
target motif of GSK3 both in P. berghei (correspondent
orthologues) and P. falciparum, from which that are
phosphoproteomic evidence from Pease et al., 2013
S/T-X-X-X-S/T-P S/T-X-X-X-S/T-P
50
Afterwards, a Gene Ontology (GO) enrichment analysis based on Molecular Function, Cellular
component and Biological Process gave three different lists of GO terms for each one of the ontology
parameters. However, as a large variability of genes were analysed, the obtained GO terms were
redundant, especially for the GO terms related to Molecular Function (Figure 30B). Nonetheless, some
highlighted GO functions include activities related to transcription and cytoskeletal rearrangement, which
are reported to be regulated by GSK3 in mammals (Beurel, Grieco and Jope, 2015). GO terms for
Cellular Component were mainly related to membrane and vesicular structures, which implies that GSK3
may be regulating processes related to trafficking (Figure 30A). Additionally, for the Biological Process,
results also show GO terms associated with transport, “entry into host”, “DNA replication” and metabolic
processes (Figure 30C). Even so, as all the 185 genes are putative targets of GSK3, it is difficult to
specifically attribute one individual role as it is likely that it is involved in the regulation of different
pathways, as has been described with the orthologs of this enzyme in other organisms. Furthermore,
by analysing the 185 genes list, relevant genes whose function was represented in the GO terms were
identified, such as AMA1, an invasion marker (Alexander et al., 2006) or the ApiAP2 transcription factors
family (Painter, Campbell and Llinás, 2012). Moreover, that list also included genes that are involved in
parasite egress, such as SERA5 (De Monerri et al., 2011). All in all, this approach provided a wide
search of possible binding targets that can be used as a dataset to formulate a possible Plasmodium
GSK3 ”targetome” and as a starting point to begin to understand the function of GSK3 in Plasmodium.
Nonetheless, experimental evidence needs to be established. For these approaches such differential
quantitative phospho-proteomics with GSK3 mutants and co-Immunoprecipitation studies to identify
interacting protein complexes would need to be employed.
A
Fi
g
ur
e
4
5
–
G
O
te
r
m
s
e
nr
ic
h
m
e
nt
a
n
al
y
si
s
51
B
B
C
Fi
g
ur
e
4
6
–
A
n
in
te
ra
ct
io
n
n
et
w
or
k
of
1
0
pr
ot
ei
n
s
w
Figure 30 – GO terms enrichment analysis for the putative targets of PbGSK3 A – GO terms related to Molecular Function B – GO terms related to Biological Process C – GO terms related to Cellular Component P-value cut-off=0.05
52
2.2. Search for potential GSK3 substrates on STRING
With the purpose of further identifying processes in which GSK3 is involved, a search of possible
Plasmodium GSK3 interacting proteins was undertaken using an in silico approach with STRING
(Search Tool for the Retrieval of Interacting Genes/Proteins; www.string.com) (Szklarczyk et al., 2016)
STRING is a webtool that provides the study of protein to protein interactions by using a database of
known and predicted protein interactions that incorporates and integrates data from other organisms
such as yeast, plants, Drosophila spp., mammals, etc. The interactions may be direct (physical
interactions) or indirect (functional associations) obtained through different methods, such as genetic
studies or high-throughput experimental procedures. Thus, STRING formulates an algorithm to obtain
a functional protein-association network of a particular protein. In this case, PbGSK3 was not
represented in the software’s database, but PfGSK3 was available for such an analysis to be performed.
Remarkably, a network of 10 proteins (Figure 31) was given by the software, from which two proteins
seem to have an interesting function: I) CAMP-dependent protein kinase A (PKA) and II) cyclin-
dependent protein kinase 5 (CRK5). Therefore, this network allows for the prediction of putative GSK3
binding partners that may act in a complex or in the same pathway of PfGSK3.
Figure 31 – An interaction network of 10 proteins was given by the STRING software
for PfGSK3
Scheme of the predicted interacting proteins of PfGSK3 by STRING software. The lines
represent the confidence, i.e., the strength of data support for each one of the interactions,
which is independent of the type of evidence for a particular association. Each node (Filled
nodes: proteins of known 3D structure; Empty nodes: proteins of unknown 3D structure)
represents one Individual protein. Line thickness indicates the strength of data support.
Figure 47 – PfCRK5 has a putative recognition site that can be phosphorylated by
GSK3
NetPhos algorithm output: phosphorylation of the threonine (T) residue at the position 634
of PfCRK5 amino acid sequence; # = residue number; x = phosphorylated amino acid.
53
I) PfCRK-5 is a cyclin-dependent kinase like enzyme, which does not have orthologs in the
mammalian kinome (Talevich et al., 2012). It was functionally characterized in Dorin-Semblat et al. 2013,
where it was shown that the lack of Pfcrk-5 gene promotes a proliferation rate phenotype. By creating a
knockout of this gene, which proved to be non-essential in P. falciparum erythrocytic cycle, this mutant
parasite was reported to have a lower proliferation rate than the wild type. Furthermore, these parasites
had a decreased number of merozoites per schizont, which meant that replication is also affected.
According to the authors, this may be the cause for the decreased parasitemia overtime, when
compared to wild type parasites. Due to the similarities between this phenotype and that of Pb∆gsk3, it
would be interesting to know whether PfCRK-5 might be regulated by PfGSK3. For that, we used the
NetPhos algorithm which predicts putative recognition sites for specific kinases
(http://www.cbs.dtu.dk/services/NetPhos-3.1) (Blom, Gammeltoft and Brunak, 1999). Interestingly,
there is one single possible recognition site present in Pfcrk-5 sequence that might be phosphorylated
by PfGSK3 (Figure 32). Nonetheless, this is just an in silico prediction which needs to be further
corroborated experimentally.
II) PKA is a ubiquitous kinase with several functions throughout eukaryotes. In (Prinz et al.,
2016), it was reported to have a key role in the activation of the microneme adhesin AMA1, which has
an important role in the invasion machinery by merozoites (Alexander et al., 2006). In this study, it was
proved that PKA phosphorylates AMA1 in the Serine (S) 610 residue and PfGSK3 phosphorylates at
the Threonine (T) 613. The S610 upstream phosphorylation by PKA was reported to be a prerequisite for
T613 phosphorylation by GSK3, which goes in agreement with a key feature of GSK3 as it requires
priming phosphorylation. In addition, the substrate motif of AMA1 conforms to known GSK3 substrates
as described above. Furthermore, it was shown that individual chemical inhibition of PfGSK3 and PfPKA
strongly inhibits the invasion capability of the parasite, as both kinases seem to be required for
hierarchical AMA1 phosphorylation in an in vitro kinase assay. However, this interaction and regulation
of AMA1 has yet to be confirmed biologically.
Figure 32 – PfCRK5 has a putative recognition site that can be
phosphorylated by GSK3
NetPhos algorithm output: phosphorylation of the threonine (T) residue at
the position 634 of PfCRK5 amino acid sequence; # = residue number; x =
phosphorylated amino acid. The score corresponds to the probability
(0.000-1.000) to occur phosphorylation (threshold=0.500)
Figure 49 – PfCRK5 has a putative recognition site that can be
phosphorylated by GSK3
NetPhos algorithm output: phosphorylation of the threonine (T) residue at
the position 634 of PfCRK5 amino acid sequence; # = residue number; x =
phosphorylated amino acid. The score corresponds to the probability
(0.000-1.000) to occur phosphorylation (threshold=0.500)
54
All in all, it is possible to conclude that the use of in silico analysis has benefits in the
characterization of an enzyme with an unknown role in order to predict possible binding partners. In this
case, the STRING software allowed us to set up two hypotheses of possible functions for Plasmodium
GSK3. On the one hand, it may be involved in the cell cycle control, acting on the parasite’s asexual
development during the blood stage of infection by targeting PfCRK-5. On the other hand, GSK3 may
also be involved in invasion, as may regulate AMA1 function, responsible for merozoite entry into host
erythrocytes. Nevertheless, GSK3 is known to be a ubiquitous kinase in other eukaryotes, namely in
humans, where it displays several roles throughout the organisms. Hence, it is very likely that this kinase
is involved in different pathways, leading to several phenotypes.
2.3. Assessment of the GSK3 substrates: optimization of
PbGSK3-HA Immuno-Precipitation
GSK3 function and regulation is often mediated via interaction within protein complexes (Beurel,
Grieco and Jope, 2015). To gain insight into the function and regulation of Plasmodium GSK3 and
identification of potential substrates it is important to identify protein-protein interactions. Thus, in order
to identify possible interacting partners of this kinase, we decided to employ a Immuno-precipitation (IP)
technique. First, it was necessary to optimize the protocol and characterize the availability of the protein
to be immuno-precipitated for further analysis of the obtained complexes.
In order to assess solubility of PbGSK3 during the parasite erythrocytic cycle, a standard well
established lysis buffer, Radioimmunoprecipitation assay buffer (RIPA buffer), was used to lyse cells
and separate soluble (supernatant) from insoluble fraction (pellet). Two parasite populations were
compared: Synchronized schizonts vs. mixed blood stage parasites (mainly trophozoite) from infected
mice were analysed by Immuno-blotting.
As it would be expected, results showed positive detection of PbGSK3-HA in both mixed blood
stages and synchronized schizonts (Figure 33). Interestingly, depending on the parasite stage, PbGSK3
showed a different pattern relative to solubility fraction with mixed blood stage parasites present more
in the soluble fraction whereas schizont parasites observed more in the insoluble fraction. Nonetheless,
it is depicted a difference regarding band intensity, as PbGSK3-HA detection was much more intense
in schizonts than in the mixed blood stages, which goes in agreement to what was concluded in the
spatial-temporal dynamics chapter, as the highest expression of PbGSK3 occurs in the late stages of
the parasite development. Furthermore, this dual detection of PbGSK3-HA in both fractions of the
parasite obtained after lysis can ultimately suggest that PbGSK3 is involved biological processes related
with proteins in different solubility compartments. This may be due to differential function within the
different parasite stages so that PbGSK3 may be interacting with different complexes with different
localizations which compromise its solubility in the different parasite stages. However, proper cell
fractionation experiments need to be repeated to validate this observation.
55
Given the results above, we decided to test whether it was possible to perform immuno-
precipitation of PbGSK3-HA. For that purpose, we chose to focus on the schizont stages, which express
the highest levels of PbGSK3 within the blood stage. Thus, we employed three different lysis buffer
conditions with increasing degree of solubilisation based on detergent composition: (I) RIPA buffer, (II)
CHAPS buffer, (III) 1% SDS buffer. Furthermore, to avoid contamination with IgGs, commercial anti-HA
agarose beads that have the anti-HA antibody covalently conjugated to the beads were used to perform
the PbGSK3-HA IP. Therefore, mice were infected with Pbgsk3-ha parasites, which were, then,
synchronized. The total volume of sample was divided into three equal parts, from which each sample
was lysed in parallel with one of each different lysis buffer:
I. RIPA lysis buffer
Although RIPA was the buffer used to achieve the previous immuno-blotting, it was decided to
improve the protocol by increasing the amount of volume and the incubation time during lysis. Thus,
instead of 25µL for 15 minutes, 200µL were used during a 30-minute incubation on ice. Remarkably,
simply by increasing both volume and period of lysis, the solubility of GSK3 in schizonts was increased.
Hence, we obtained an IP of PbGSK3-HA and detected it by immuno-blotting (Figure 34). Additionally,
PbGSK3-HA was also detected in the insoluble fraction of the parasite pellet, as well in the small part
of the soluble fraction that did not proceed to IP, as a control. Contrarily, it was not detected in the post-
IP fraction, confirming a proper binding between the tagged protein and the anti-HA antibody in agarose
beads.
PbGSk3-HA 53kDa
PbBip 70kDa
Mixed
blood stages
Schizonts
Figure 33 – PbGSK3-HA is detected both in the parasite soluble and insoluble fractions,
depending on the parasite stage of development during the erythrocytic cycle
Top - PbGSK3-HA is detected in the soluble fraction of the mixed blood-stages parasites by
immuno-blotting; PbGSK3 is detected in the insoluble fraction of the schizonts by immune-blotting;
Whole parasite pellet lysis with 25µL of RIPA lysis buffer during 15min on ice. PbGSK3-HA
detection with a monoclonal anti-HA antibody. 210 seconds exposure
Bottom - PbBip used as a loading control. 210 seconds exposure
56
II. CHAPS lysis buffer
CHAPS lysis buffer is similar to the RIPA lysis buffer but it contains an extra detergent, CHAPS
which is more stringent as it is a zwitterionic surfactant. The parasite lysis was done with the same
volume of buffer and the same period of incubation performed for the RIPA lysis. In fact, these lysis
conditions also managed to immuno-precipitate PbGSK3-HA and similar results were obtained upon
these conditions (Figure 35).
PbGSk3-HA 53kDa
PbGSk3-HA 53kDa
Figure 34 – PbGSK3-HA is successfully immune-precipitated with anti-
HA agarose beads using RIPA as lysis buffer.
Immuno-blotting analysis of PbGSK3-HA throughout an IP steps. PbGSK3
detected with a monoclonal anti-HA antibody. Whole Parasite pellet lysis with
200µL of RIPA lysis buffer during 30 minutes on ice. 5 seconds exposure.
Figure 52 – PbGSK3-HA is successfully immune-precipitated with anti-
HA agarose beads using RIPA as lysis buffer.
Immuno-blotting analysis of PbGSK3-HA throughout an IP steps. PbGSK3
detected with a monoclonal anti-HA antibody. Whole Parasite pellet lysis with
200µL of RIPA lysis buffer during 30 minutes on ice. 5 seconds exposure.
Figure 35 – PbGSK3-HA is successfully immuno-precipitated
with anti-HA agarose beads using CHAPS as lysis buffer.
Immuno-blotting analysis of PbGSK3-HA throughout an IP steps.
PbGSK3 detected with a monoclonal anti-HA antibody. Whole
Parasite pellet lysis with 200µL of CHAPS lysis buffer during 30
minutes on ice. 5 seconds exposure.
Figure 54 – PbGSK3-HA is successfully immune-precipitated
with anti-HA agarose beads using CHAPS as lysis buffer.
Immuno-blotting analysis of PbGSK3-HA throughout an IP steps.
PbGSK3 detected with a monoclonal anti-HA antibody. Whole
Parasite pellet lysis with 200µL of CHAPS lysis buffer during 30
minutes on ice. 5 seconds exposure.
57
III. 1% SDS
The 1% SDS (sodium dodecyl sulfate) lysis buffer is equal to the RIPA lysis buffer except for
the concentration of the SDS, which is 1% instead of 0.1%. Thus, the parasite pellet was lysed in 20µL
of 1% SDS buffer, during the same incubation time done for the previous conditions, which was
posteriorly diluted (10X) to a final volume of 200µL with a lysis buffer which did not contain SDS to
decrease the SDS concentration to 0.1%, to allow for the IP. This buffer confers the harshest lysis
conditions that denatures proteins. This is a more vehement lysis due to the much higher amount of the
SDS detergent. Since the antigen is the small peptide HA, denaturing of the protein likely does not affect
antigen-antibody recognition. Nonetheless, this approach is not ideal for antigen-antibody interactions
and is not indicated if it is desired to maintain proteins native form for subsequent downstream
applications or identification of interactors. Even so, likewise the previous lysis conditions, we also
managed to immuno-precipitate PbGSK3-HA (Figure 36)
Remarkably, the same type of results was obtained for the three different lysing conditions. It is
important to emphasize the fact that all the conditions were done with the same batch of parasites and
were performed in parallel, which enable the use of the same amount of protein. Moreover, the signal
was detected using the same time of the exposure, which enabled an equal comparison of the signals
obtained under the different conditions. Nonetheless, it was expected to immuno-precipitate PbGSK3-
HA as it was previously detected in the soluble fraction of the parasites in early stages. Thus, by
increasing the strength of the lysis conditions it was expected to solubilize the protein more. These
harsher conditions may have allowed for the disruption of the more resilient interactions or structures
that were compromising the solubility of PbGSK3-HA. However, by doing this, possible interactions are
being lost. Hence, to avoid losing those interacting partners, a trade-off between the solubility and the
binding complexes must be taken into account. On other words, it is necessary to compromise some
possible PbGSK3 interactions in order to immuno-precipitate the kinase and its complexes. Therefore,
the less vehement conditions that are capable to immuno-precipitate PbGSK3-HA should be
considered. Future optimizations, specifically for co-immunoprecipitation, should include lysis buffers
containing a non-ionic milder detergent, such as NP40, that is less disruptive of protein-protein
interactions.
PbGSk3-HA 53kDa
Figure 36 – PbGSK3-HA is successfully immuno-precipitated with anti-HA
agarose beads using 1% SDS as lysis buffer.
Immuno-blotting analysis of PbGSK3-HA throughout an IP steps. PbGSK3
detected with a monoclonal anti-HA antibody. Whole Parasite pellet lysis with
20µL of 1% SDS lysis buffer during 30 minutes on ice. 5 seconds exposure.
Figure 56 – PbGSK3-HA is successfully immune-precipitated with anti-HA
agarose beads using 1% SDS as lysis buffer.
Immuno-blotting analysis of PbGSK3-HA throughout an IP steps. PbGSK3
detected with a monoclonal anti-HA antibody. Whole Parasite pellet lysis with
20µL of 1% SDS lysis buffer during 30 minutes on ice. 5 seconds exposure.
58
In order to assess the protein pool that is immuno-precipitated, a Silver staining protocol was
performed. Also, this technique allows us to assess specificity, i.e., to see how clean is the PbGSK3-HA
IP and serves as a way to identify differences between PbGSK3-HA IP and an IP of a non-tagged GSK3
to, ideally, send for mass spec analysis to identify possible binding partners of GSK3. Thus, it was
performed an IP of the PbGSK3-HA and a control IP of the WT PbANKA parasites with RIPA lysis buffer,
as it is the most appropriate buffer to have the less harsh lysis (when compared with the other two lysis
buffers). The same lysis conditions previously mentioned in the IP with that buffer were used in this
experiment. Preliminary results showed indistinguishable differences in the band pattern between the
two samples in the silver staining (Figure 37A). Nevertheless, PbGSK3-HA was detected in the immune-
blotting performed in parallel (Figure 37B). Thus, the following step in the optimization of the Silver
staining is to perform a larger scale experiment, i.e., run a bigger gel and use a higher amount of
parasites in order to observe a different band pattern from the control, which is given by the associate
background. Additionally, it may be necessary to consider other milder lysis conditions to prevent loss
of potential binding partners of GSK3. Furthermore, washing conditions need to be optimized such as
increasing ionic strength of wash buffers and improving the pre-clearing of lysates with beads prior to
immuno-precipitation.
Altogether, the use of in silico approaches to have a glimpse at potential substrates and
interactors of GSK3 to generate interacting networks and hypothesis regarding GSK3 function.
However, in silico approaches need to be complemented with experimental approaches such as
techniques to identify interacting complexes of GSK3. With the current IP results, although still needing
to be optimized, it is now possible to proceed to downstream approaches such as sending IP samples
for mass spec or with kinase assays using purified enzyme to test candidate substrates.
PbGSk3-HA 53kDa
B
B
A
A
Figure 37 – Preliminary data showed no differences in the
bands pattern in Silver staining despite a positive
detection of PbGSK3-HA after IP
A - Silver staining of an immune-precipitated PbGSK3-HA.
PbANKA WT parasites were used has a non-tagged GSK3
control. Whole parasite lysis with 200µL of RIPA during 30
minutes on ice.
B – Immuno-blotting analysis of the PbGSK3-HA IP, detected
with a monoclonal anti-HA antibody. 5 seconds exposure.
Figure 58 – Preliminary data showed no differences in the
bands pattern in Silver staining despite a positive
detection of PbGSK3-HA after IP
A - Silver staining of an immune-precipitated PbGSK3-HA.
PbANKA WT parasites were used has a non-tagged GSK3
control. Whole parasite lysis with 200µL of RIPA during 30
minutes on ice.
B – Immuno-blotting analysis of the PbGSK3-HA IP, detected
with a monoclonal anti-HA antibody. 5 seconds exposure.
WT PbANKA
WT PbANKA
PbGSK3-HA
PbGSK3-HA
59
3. PbΔgsk3 complementation studies
3.1. Generation of the PbΔgsk3 complement plasmids
In order to specifically attribute the absence of gsk3 as the cause of the PbΔgsk3 phenotype, it
is necessary to complement this deletion mutant strain by reinserting the wild type gene to revert the
phenotype back to wild type. For this purpose, a double homologous recombination strategy where a
codon optimized gsk3 (ogsk3) flanked by approximately 1.5kbp of sequence corresponding to the locus
immediately upstream (5´homologous region-5´HR) and downstream of the gsk3 coding sequence
(3´homolougs region-3´HR) was used (Figure 38A). Thus, three inserts were successfully cloned into a
plasmid: The 5’HR, the ogsk3, and the 3’HR (Supplementary Figure 2). This vector includes both a
generic 3’UTR (untranslated region) downstream of the ogsk3 stop codon, and also a human
dihydrofolate reductase (hDHFR) cassette that serves as a positive selection marker that promotes the
resistance to the compound pyrimethamine (Giulia Manzoni, 2014).
As the tyrosine residue (Y229) was reported to be important in the activation domain of PfGSK3
(Solyakov et al., 2011), we wanted to test if complementation of Pb∆gsk3 parasites with a kinase-dead
mutant GSK3 would be sufficient to phenocopy and, therefore, explain the phenotype. Hence, a mutant
PbGSK3 where Y216 was replaced with phenylalanine (F) was generated by site-directed mutagenesis
(SDM) with primers that contained the intended mutation. Only one nucleotide was changed to alter the
codon TAC that codes for the Y, into a TTC, that codes for the F (Figure 38B). The presence of the
mutation was confirmed by sequencing of the obtained clones. Moreover, the strategy for the generation
of the final construct is exactly the same that was used for the Pbogsk3. Thus, the flanking regions were
identical, as well as the vector, enabling the generation of both constructs in parallel.
As all the cloning steps were executed with classical restriction enzymes, it was possible to
conclude that each insert was successfully cloned with the right orientation, due to the specificity of the
different restriction sites and due to the expected bands sizes obtained by restriction digestion or by
PCR amplification (Figure 38C) (Supplementary Figure 3). Besides, all the cloning steps were done in
parallel, leading to a continuous comparison between the inserts and vectors from each construct. At
the end of the cloning process, the final plasmids were sent for Sanger sequencing with two different
sets of primers that amplified not only from the ends of each insert but also from the middle, in order to
ensure the best coverage of the intended regions (Supplementary Figure 4). The sequencing results
revealed a high level of homology relatively to the predictable sequences, covering both strands and
confirmed the absence of undesired mutations (data not shown).
60
Figure 38 – Generation of the Pb∆gsk3 complemented parasite lines:
A - Schematic of complementation strategy by double homologous recombination between the
generated plasmids and the Pb∆gsk3 locus
B - Site-directed mutagenesis primers containing intended mutation (TAC to TTC) in the gsk3 gene
C - Diagnostic digestion of the final vector with restriction enzymes: The first well corresponds to the
linearized plasmid used for transfection (8,8kbp); The second well contains the 3’HR in the lower
band (1.3kbp) The third well has the 5´HR plus the ogsk3 gene in the lower band (2,7kbp). Left
figure: Pbogsk3 complement plasmid; Right figure: Pbogsk3-YF complement plasmid; See
Supplementary Figure 2; 1kb Plus Ladder
A
B
C
61
3.2. Transfection of the generated vectors
PbΔgsk3 parasites were generated in such a way so that gsk3 was replaced with a selection
marker that confers positive selection via expression of hDHFR leading to resistance to pyrimethamine
and negative selection via the uridyl phosphoribosyl transferase (yfcu) gene, which codes for an enzyme
that, in the presence of the pro-drug 5-fluorocytosine (5’FC), converts it into a toxic form killing parasites
that express yFCU (Giulia Manzoni, 2014). Thus, PbΔgsk3 parasites were transfected with the
generated complementation constructs and selection of recombined parasites was carried out via
negative selection by treating parasites with 5’FC in the drinking water 24h post-transfection. Successful
selection was verified by disappearance of parasites after treatment (data not shown). Mice, then,
become positive for parasites 5 days post-treatment and parasites were processed for genotyping.
The genotyping strategy included the amplification of six amplicons from extracted genomic
DNA (gDNA): the 5´and 3´homologous regions used in the construct, ogsk3 (including the point mutated
version of the gene), the hDHFR gene, and an amplicon to detect integration at the 5’ junction between
the homologous region (Supplementary Figure 5. gDNA from wild type, deletion mutant (PbΔgsk3) and
the transfection plasmid were used as controls. Amplification was observed for both versions of the gene
of interest (ogsk3, gsk3-YF), for the flanking regions, and for a positive recombination integration event
at the 5’ region (Figure 39). Interestingly, the genotyping results showed also the absence of the hDHFR
cassette in the in the vector. The lack of the hDHFR cassette was not observed in the previous cloning
steps as it was never amplified. Nonetheless, the absence of the hDHFR cassette is not relevant for the
transfection process since the selection of recombinant complemented parasites is via negative
selection from the yFCU cassette present in the PbΔgsk3 parasites. Nonetheless, a small amplification
of the hDHFR gene was observed in the transfected population (PbΔgsk3+ogsk3 P0 population), due to
the inefficient selection of the parental population that survived the negative selection with 5’FC drug.
However, the amplification of this gene when compared to the amplification of the integration regions,
is minimal. Therefore, the parasites were processed to parasite cloning.
The goal of this cloning is to clone one individual parasite that comes from the P0 population,
which consists of a mixed population of transfectants, in order to have a genetically identical population.
In this process, the transfected P0 population is serially diluted to obtain one single parasite that injected
into one mouse. Mice that become positive after a period of 6-9 days are considered clones and
genotyped for the desired integration. In this case, the integration of the ogsk3 complementation
cassette. This technique resulted in two clones, the A1 and A4 for the PbΔgsk3+ogsk3 parasites and
five clones, the A2, B1, B2, B3 and D1, for the PbΔgsk3+gsk3-YF parasites. All the clones were
processed for genotyping using the same strategy above. Remarkably, PbΔgsk3+ogsk3 clone A1 and
PbΔgsk3+gsk3-YF clone D1 presented a good integration pattern equivalent to the P0 population (Figure
39) (Note: The reaction 1 for the PbΔgsk3+ogsk3 parasites failed in this genotyping but it was obtained
in further analysis). Afterwards, the expression of the ogsk3 transgene was analysed at the mRNA level.
Results showed a satisfactory gene expression for both clones (Figure 40). Thus, these clones
proceeded for subsequent functional phenotype characterization of complemented Pb∆gsk3 deletion
mutant parasites.
62
Figure 40 – Positive RNA expression of the ogsk3 in the Pb∆gsk3+ogsk3 and Pb∆gsk3+gsk3 clones.
Amplification strategy: On the right are the background reactions that corresponds to the absence of the reverse
transcriptase (RT). On the left are the reactions with RT, which converted the mRNA into cDNA that was used as a
template for the ogsk3 amplification, with the expected size of 1.4kbp. As a positive control (+) it was used the final
plasmid prior to transfection and WT PbANKA parasites as a negative control (-); 1kb Plus Ladder
Figure 62 – Positive RNA expression of the ogsk3 in the Pb∆gsk3+ogsk3 and Pb∆gsk3+gsk3 clones.
Amplification strategy: On the right are the background reactions that corresponds to the absence of the reverse
Figure 39 – Pb∆gsk3+ogsk3 clone A1 and Pb∆gsk+gsk3-YF clone D1 showed positive recombination and
integration of both ogsk3 versions parasite lines.
Genotyping of the P0 population and the cloning parasites (See Supplementary Figure 5 for genotyping strategy):
Well 1- gDNA 5´FR (1,5kbp); Well 2- vector 5´HR(1,4kbp); Well 3 – gDNA 5´FR + vector 3´HR(2,8kbp);
Well 4 – vector 5´HR + ogsk3(2,7kbp); Well 5- ogsk3(1,4kbp); Well 6- hdhfr (0,7Kbp); 1Kb Plus Ladder
Figure 60 – Positive RNA expression of the ogsk3 in the Pb∆gsk3+ogsk3 and Pb∆gsk3+gsk3 clones.
Amplification strategy: On the right are the background reactions that corresponds to the absence of the reverse
transcriptase (RT). On the left are the reactions with RT, which converted the mRNA into cDNA that was used as
a template for the ogsk3 amplification, with the expected size of 1.4kbp. As a positive control (+) it was used the
final plasmid prior to transfection and WT PbANKA parasites as a negative control (-)Figure 61 –
Pb∆gsk3+ogsk3 clone A1 and Pb∆gsk+gsk3-YF clone D1 showed positive recombination and integration
of both ogsk3 versions parasite lines.
Genotyping of the P0 population and the cloning parasites (See Supplementary Figure 5 for genotyping strategy):
Well 1- gDNA 5´FR (1,5kbp); Well 2- vector 5´HR(1,4kbp); Well 3 – gDNA 5´FR + vector 3´HR(2,8kbp);
Well 4 – vector 5´HR + ogsk3(2,7kbp); Well 5- ogsk3(1,4kbp); Well 6- hdhfr (0,7Kbp); 1Kb Plus Ladder
RT + RT -
63
3.3. Functional characterization of the PbΔgsk3 complement
clones
As previously mentioned, the aim is to revert the PbΔgsk3 mutant phenotype by genetically
adding back a copy of gsk3 (PbΔgsk3+ogsk3) and to assess the phenotype of the PbΔgsk3 mutants
complemented with a non-functional kinase (PbΔgsk3+gsk3-YF). An in vivo infectivity assay and an in
vitro maturation assay were carried out to study possible changes in the expected phenotype. With the
in vivo infectivity assay the progression of murine malaria disease is analysed, including daily
parasitemia measurements and survival from disease pathology, namely experimental cerebral malaria
(ECM), which manifests in the C57BL7/6 inbred mouse strain (Zuzarte-luis, Mota and Vigário, 2014).
The in vitro maturation assay allows for the study of the phenotype in terms of replication within the
infected erythrocyte, during schizogony, as it was previously performed for the phenotypic
characterization of PbGSK3 epitope-tagged lines.
C57BL7/6 mice were infected with either four P. berghei parasite strains: WT PbANKA,
PbΔgsk3, PbΔgsk3+ogsk3 and PbΔgsk3+gsk3-YF parasites. Parasitemia and mouse survival were
analysed. In addition, blood from experimental mice at day three post infection (3dpi) was taken for in
vitro overnight maturation cultures to assess number of merozoite per schizont. Results from both in
vivo infectivity and survival are inconclusive since the wild type control strain did not behave as
expected. In essence, it was expected that mice infected with the WT PbANKA parasites would all
develop ECM and succumb to severe pathology by day 7-9 post of infection. However, the number of
daughter merozoites per schizont was lower than normal, with numbers similar to the PbΔgsk3 parasite
strain (Figure 41A) and in ECM was not 100%, which promoted an altered parasitemia curve in surviving
mice (Figure 41B and 41C). The high variability in the number of merozoites per schizont observed in
the boxplot graph (Figure 41A) for the wildtype control parasites is due to the sampling of mice that
followed different progressions of disease, as some died of ECM and others survived to ECM.
Despite not having a proper wildtype control, it is possible to deduce from the infectivity and the
maturation assays, that the observed experimental results from the complemented parasite line,
PbΔgsk3+ogsk3, do not correspond to what was expected. By reinserting the wild type gene into the
PbΔgsk3 parasite background, it was expected that the complemented parasites would behave like wild
type control parasites. However, similarly to the PbΔgsk3 infected mice, all mice infected with
PbΔgsk3+ogsk3 had 100% survival from ECM and parasitemias were comparable to the PbΔgsk3
(Figure 41B). As it was already mentioned, the PbΔgsk3 parasite line has a specific parasitemia curve,
where the infection progresses like wild type in the first 3-4 days and then goes down and remains low
until around 12dpi, followed by an exponential growth until the end mice eventually succumb to severe
anaemia due to hyperparasitemia between 25-30dpi. Additionally, the survival curve (Figure 41C) for
the PbΔgsk3+ogsk3 complemented strain describes the same pattern as the PbΔgsk3 parental line,
from which the cause of death was severe anaemia, associated with high parasitemia levels
(hyperparasitemia). Moreover, the number of merozoites per schizonts in PbΔgsk3+ogsk3 parasites
were similar to PbΔgsk3 (Figure 41A). Thus, despite not having the proper wild type control, when we
compare the complemented strain PbΔgsk3+ogsk3 with the mutant strain PbΔgsk3, we can conclude
64
that, in terms of replication and mouse infectivity, that the obtained complemented clone behaves as the
knock-out strain. All in all, it is possible to conclude that the PbΔgsk3+ogsk3 strain did not complement
the PbΔgsk3 parasite strain, as the main features of having a decreased number of merozoites per
schizont, a different parasitemia curve pattern and severe anaemia as cause of death were not reverted
to the wild type phenotype. Therefore, it is necessary to understand why the reversion was not achieved.
For instance, improper recombination or lack of functional protein expression in the complemented
transgene can explain the obtained phenotype.
Regarding the PbΔgsk3+gsk3-YF parasites, there was an increase in the number of daughter
parasites, compared to PbΔgsk3, which is statistically significant between them, as it is observed in the
boxplot respective to this strain (Figure 41A), there is a variability that tends to a higher number of
merozoites. In addition, infectivity in mice with this kinase-mutant complemented strain exhibited a
slightly different pattern that does not correspond to the PbΔgsk3. Interestingly, as observed in the graph
from Figure 41B, the parasitemia is higher than the PbΔgsk3 between 4dpi and 8dpi. Still, it does not
describe the expected and observed pattern for the wild type strain for that period, as the parasitemia is
lower. Furthermore, it is important to point out that two of five mice exhibited symptoms of ECM at 6dpi,
such as hind limb paralysis (data not shown). Nonetheless, both mice overcame this pathology and
survived from ECM. As with the PbΔgsk3 strain, the cause of death of mice infected mice with
PbΔgsk3+gsk3-YF parasites was hyperparasitemia. As it was hypothesized that the PbΔgsk3+gsk3-YF
parasites should behave as the deletion mutant strain, the results go in agreement to what was predicted
for the lack of a functional catalytic domain. However, it is necessary to confirm that the observed
phenotype is due to the presence of the point mutation of the expressed mutant protein and not to
improper recombination.
65
C
Fi
g
ur
e
65 –
Al
l
th
e
p
ar
as
it
es
in
th
e
B
Fig
ure
63
–
Pb
Δg
sk3
+o
gsk
3
did
no
t
rev
ert
ed
the
ph
en
oty
pic
fun
cti
on
alit
y
of
the
Pb
Δg
sk3
par
asi
tes
;
Pb
Δg
A
A
Figure 41 – PbΔgsk3+ogsk3 did not
reverted the phenotypic functionality of the
PbΔgsk3 parasites; PbΔgsk3+ogsk3-YF
seems to phenocopy the PbΔgsk3 parasites
in vivo
A- In vitro maturation assay – boxplot graph
presents the results of the merozoites per
schizont counting; N=3
WT PbANKA: 12,85±0,42;
PbΔgsk3: 12,0±0,08;
PbΔgsk3+ogsk3: 10,54±0,42;
Pbgsk3+gsk3-YF: 14,04±1,70.
B - Parasitemia curve – number of infected
erythrocytes per the total number of
erythrocytes over time - obtained through the
daily measurement of the parasitemia of mice
infect with each one of the four strains
by flow cytometry; N=5
•’ – 3dpi – PbΔgsk3 ns; Pbgsk3+ogsk3 ns;
Pbgsk3+gsk3-YF ns
•’’ – 4dpi – PbΔgsk3 ns; Pbgsk3+ogsk3 **;
Pbgsk3+gsk3-YF ns
•''' – 5dpi – PbΔgsk3 **; Pbgsk3+ogsk3 ****;
Pbgsk3+gsk3-YF **
C – Survival curve – percentage of living mice
through the infection; N=5
PbΔgsk3 *
Pbgsk3+ogsk3 *
Pbgsk3+gsk3-YF *
Figure 64 – PbΔgsk3+ogsk3 did not
reverted the phenotypic functionality of the
PbΔgsk3 parasites; PbΔgsk3+ogsk3-YF
seems to phenocopy the PbΔgsk3 parasites
in vivo
A- In vitro maturation assay – boxplot graph
presents the results of the merozoites per
schizont counting; N=3
WT PbANKA: 12,85±0,42;
PbΔgsk3: 12,0±0,08;
PbΔgsk3+ogsk3: 10,54±0,42;
Pbgsk3+gsk3-YF: 14,04±1,70.
66
3.4. Troubleshooting the lack of phenotypic reversion in the
PbΔgsk3 complement parasites
To study why the complementation phenotype was not recovered with the re-insertion of the
wild type gsk3, i.e. ogsk3, it is necessary to get further insight into three possible explanations: (i)
improper recombination at the locus, (ii) improper expression of the transgene at the mRNA level or
protein level (iii) unforeseen alteration/mutation to the transfection construct.
Regarding recombination at the genomic locus, as was shown before, genotyping of both
complemented parasite strains revealed positive integration within the region of interest, namely within
the region upstream of the coding gsk3 (5’HR). However, to understand a potential problem with the
parasites during the infectivity assay we decided to genotype parasites from each infected mouse, as
well as the seed mice. The ogsk3 transgene and the ogsk3 gene plus its flanking regions were amplified
to test for the presence of the transgene at the gDNA level. As it was expected, all parasites from mice
infected with the complemented strains showed positive integration (Figure 42). In order to detect any
problem that might be present within the transgenic expression cassette locus, such as underlying
potential mutations or deletions, the amplified cassette from gDNA was sequenced. The approach was
to sequence from flanking regions and from the core of the gene, to have the best coverage as possible.
Once again, the sequencing revealed no problems in the locus that might explain the lack of reversion
of the phenotype (data not shown). Then, it was hypothesized if it could be present any episomal
contamination, as it was already described to happen in Plasmodium (van Dijk, Waters and Janse,
1995). Thus, in order to detect the presence of possible remaining vector, it was planned a strategy to
amplify a region that could only be present if the plasmid is maintained in the parasite. Within the same
approach, it was intended to amplify a region that is not present in the vector but is present in the gDNA
that has recombined. Interestingly, no episomal DNA contamination was observed, as it is depicted in
the Figure 43. Furthermore, both plasmids were sent for re-sequencing but, once again, even with 100%
coverage of all inserts due to different primer sets (Supplementary Figure 4), the results showed good
sequence alignments. Therefore, at the genomic level, there is no evidence that may explain the
absence of phenotype reversion in the PbΔgsk3+ogsk3 parasite strain or may refute the observed
phenotype in the PbΔgsk3+gsk3-YF.
Figure 42 – All the parasites in the
infectivity assay for the functional
complementation of PbΔgsk3 parasites
showed positive amplification of the ogsk3
plus its flanking regions.
Genotyping strategy: Amplification of ogsk3
(1,4kbp) and gsk3 plus its flanking regions
(2,0kbp).
Note: It is expected one lower band (0,85kbp)
in the Pb∆gsk3 parasites referred to the
amplicon of the ogsk3 plus its flanking regions
due to a second binding site of one of the
primers within the hDHFR gene; 1kb Plus
Ladder
Figure 66 – No episomal contamination
was detected in the PbΔgsk3 complement
parasites.
Episomal detection strategy: amplification of
an episomal region (0,7kbp) and a gDNA
region (1,5kbp); WT PbANKA negative control
67
To test a problem in expression of the transgene, RNA was extracted from blood from one of
the mice, which were used in the functional infectivity assay, infected with PbΔgsk3+ogsk3 clone A1
parasite line and reverse transcribed into cDNA in order to test for ogsk3 expression at the mRNA level.
Although less expressed as in the positive control, as it is possible to see in the Figure 44, the intragenic
region of ogsk3 is being expressed above background given by the no reverse transcriptase (RT)
control. These results allow for the conclusion that the ogsk3 gene is being expressed at the mRNA
level. Consequently, at the transcriptomic level, there are no indications that might justify the lack of
phenotype reversion in the PbΔgsk3+ogsk3 parasite strain.
Unfortunately, it is not possible to know if the genes are being expressed at the protein level, as
both versions of the protein do not possess a tag marker associated.
All in all, it was not possible to revert the PbΔgsk3 phenotype back to wild type by reinserting
the Pbgsk3 gene. Despite present at the genomic and mRNA level, we conclude that functional PbGSK3
is not being expressed.
Figure 43 – No episomal contamination was detected in the PbΔgsk3
complement parasites.
Episomal detection strategy: amplification of an episomal region (0,7kbp) and a
gDNA region (1,5kbp); WT PbANKA negative control (for both amplicons); Final
plasmid prior to transfection as a positive control (for episomal amplification);
1Kb Plus Ladder
Figure 68 – ogsk3 is expressed at the mRNA level
Amplification strategy: On the right are the background reactions that
corresponds to the absence of the reverse transcriptase (RT). On the left are
the reactions with RT, which converted the mRNA into cDNA that was used as a
template for the ogsk3 amplification, with the expected size of 0,35kbp. As a
positive control, it was used the final plasmid prior to transfection (+) and WT
PbANKA parasites as a negative control (-).Figure 69 – No episomal
contamination was detected in the PbΔgsk3 complement parasites.
Episomal detection strategy: amplification of an episomal region (0,7kbp) and a
gDNA region (1,5kbp); WT PbANKA negative control (for both amplicons); Final
plasmid prior to transfection as a positive control (for episomal amplification);
1Kb Plus Ladder
Figure 44 – ogsk3 is expressed at the mRNA level Amplification strategy: On the right are the background reactions that corresponds to the absence of the reverse transcriptase (RT). On the left are the reactions with RT, which converted the mRNA into cDNA that was used as a template for the ogsk3 amplification, with the expected size of 0,35kbp. As a positive control, it was used the final plasmid prior to transfection (+) and WT PbANKA parasites as a negative control (-). 1kb Plus Ladder
68
Conclusions and future perspectives
All intracellular parasites rely on robust mechanisms that promote the establishment of a
successful infection within the host cell. Plasmodium spp. heavily depend on their conserved and
peculiar kinome, from which many kinases regulate the major processes that guarantee the evolutionary
success of these parasites (Tewari et al., 2010). The assessment of the key regulators of those vital
processes would allow for the generation of novel drug targets, as malaria still remains a major health
concern (WHO, 2016). Thus, the study of the role of GSK3 in Plasmodium infection, how it regulates
virulence and actively contributes directly or indirectly to successful infection, makes it a possible target
in malaria treatment. On the one hand, GSK3 can be a target itself, as it was proposed by previous
studies (Masch and Kunick, 2015) and as it is directly targetable in other organisms (Xingi et al., 2009).
Nonetheless, those studies did not take into account that GSK3 is directly involved in Plasmodium
virulence, which emphasizes the importance of targeting this specific enzyme. On the other hand,
unveiling the pathways and interactors that are regulated by GSK3 may contribute to the discovery of
novel targets in the fight against malaria.
During this project we aimed, first, to study the spatial-temporal dynamics of Plasmodium GSK3.
Analysis of epitope-tagged P. berghei GSK3 parasite lines, which were properly validated in terms of
phenotypic functionality, enabled the assessment of the PbGSK3 expression fluctuation across the
erythrocytic cycle of the parasite. Despite being constitutively expressed both at the RNA and protein
levels, as it was described in previous studies (Droucheau et al., 2004), data herein described show that
PbGSK3 is differentially expressed during progression of the erythrocytic cycle. Interestingly, PbGSK3
presents lower levels of expression in the early stages of parasite development, increasing during
trophozoite development and with the highest peak during the stage of active replication, i.e. schizogony,
and in fully segmented schizonts. This different chronological expression, which, by immuno-blotting,
seems to be stage-specific, may indicate a key role of GSK3 in cellular processes specific of those
developmental stages of the parasite. Furthermore, at the localisation level, PbGSK3 was not detectable
beyond the confines of the parasite, which was more obvious in the early stages when the parasite still
does not fully occupy the entire host cell. Hence, PbGSK3 is expressed in the parasite´s cytoplasm, a
pattern that was also observed by live imaging microscopy. Additionally, it was also possible to detect
PbGSK3 in the parasite’s nucleus and ER. Moreover, at the fully matured schizonts stage, we report co-
localisation of PbGSK3 with PbAMA1 (Alexander et al., 2006), an apical protein from the microneme
organelles associated with invasion, and with PbSUB1 (De Monerri et al., 2011), another apical protein
that labels the egress associated organelle, exonemes. This co-localisation was confirmed by a global
statistical analysis (Bolte and Cordelieres, 2006) performed with the obtained images, however this
observation needs further characterization with a more sensitive technique, such as immuno-EM (Koster
and Klumperman, 2003). Even so, the co-localization with these apical proteins does not prove a direct
interaction between them. Nonetheless, it might suggest a possible role of GSK3 in the invasion or
egress processes or in processes associated to the trafficking and generation of such organelles. All in
all, it is important to underline the fact that this characterization was performed in the rodent infectious
model (P. berghei). Further characterization of the GSK3 expression fluctuation must be achieved in the
69
human infectious species P. falciparum. For that purpose, we generated a GFP fusion-tagged GSK3 in
P. falciparum. Preliminary data show robust expression in the late stages of parasite development. Even
so, further localization studies and experimental evidences, such as characterization and detection of
the expected band size of PfGSK3-GFP by immuno-blotting, should be performed in conjunction with
analysis of expression dynamics of PfGSK3. Thereafter, it will be possible to use this tagged line to
assess whether this kinase has the same type of expression fluctuation, observed for PbGSK3 during
the erythrocytic cycle, as well as set up assays to identify possible interactors. In addition, possible
changes in the expression pattern might be expected between GSK3 from the two Plasmodium species
due to distinctive features, not only, between the proteins, as they have, for instance, variations in the
amino acid sequence and potentially inters-species differences. Moreover, as PfGSK3 was reported to
co-localize with Maurer’s clefts (Droucheau et al., 2004), it would be interestingly to confirm such an
observation in our tagged transgenic line.
The assessment of the temporal expression levels of PbGSK3 allowed us to focus on the later
stages of the erythrocytic cycle, as it is when PbGSK3 has the highest expression. Thus, this may
suggest that GSK3 may participate in signalling pathways or may regulate effectors in cellular processes
that occur at those developmental stages. Nonetheless, the biological processes and interactions in
which Plasmodium GSK3 is involved remain unknown. Therefore, in order to get further insight into
Plasmodium GSK3 interactome, we performed an in silico approach, which revealed to be
advantageous, giving clues about the possible functions of this kinase. Remarkably, this analysis led us
to a hypothesis of a plausible role of GSK3 mainly in the invasion machinery and in schizogony, during
the blood stage of infection. Even so, such interactions must be experimentally verified. Hence, through
a biochemical approach, we were able to immuno-precipitate PbGSK3-HA, which was detected both in
the soluble and insoluble fractions of the parasite pellet after lysis. This might indicate that PbGSK3 is
involved in biological processes that have differential solubilities as it may be interacting with different
complexes, with different localizations that compromise its solubility. However, it is necessary to improve
the lysis conditions through the use of lysis buffers that include, for instance, a non-ionic milder detergent
that is less disruptive of protein-protein interactions to avoid losing possible interacting partners. In
addition, the GFP fusion-tagged PfGSK3 should prove to be a proper tool to study PfGSK3 to assess,
similarly to PbGSK3-HA, PfGSK3 binding partners. Altogether, we predict that the identification of GSK3
interactors from both species, should have a high level of conservation, i.e. the majority should be same.
Ideally, those results would be comparable to the obtained list from the in silico approach. All in all, the
identification of GSK3 interactors under various conditions and during different developmental stages
(i.e. trophozoite vs. schizont) of the erythrocytic cyle may reveal the function of this enzyme in
Plasmodium spp.
In order to specifically attribute the Pb∆gsk3 phenotype to the lack of the gsk3 gene we aimed
to complement the deletion mutant transgenic line by reinserting the gene back into the proper locus.
These Pb∆gsk3 complementation studies were possible due to a genetic approach, from which we also
intended to study the centre of the activation domain of GSK3 to assess to mechanism of action of this
kinase. Therefore, we successfully generated two transgenic lines: one that complements the ∆gsk3
with a codon optimized version of gsk3 to revert it back to wild type and other that complements ∆gsk3
70
with a kinase-inactive mutant that includes a point mutation in the central tyrosine reside (Y216) which
when phosphorylated leads to GSK3 activation. Contrarily to what was expected, we did not recover the
wild type phenotype with the Pb∆gsk3+ogsk3 complemented strain as the infected mice with these
parasites behaved like the mice infected with the deletion mutant strain. Additionally, the wild type
phenotype in terms of replication, was not recovered as well. Regarding the Pb∆gsk3+ogsk3-YF
complemented strain, the obtained phenotype was inconclusive, as the progression of the disease in
the infected mice was different in terms of parasitemia curve pattern, as it did not behave as wild type
or as the deletion mutant, with an intermediate phenotype instead. Nonetheless, mice survived to ECM
and died of severe anaemia. Interestingly, in terms of replication the Pb∆gsk3+ogsk3-YF complemented
parasites seemed to act as the WT PbANKA control parasites. Moreover, it can be hypothesized that
the mechanism of GSK3 activation may not fully require phosphorylation at the conserved Y residue
and that the presence of the protein may still provide a certain compensatory mechanism. However, we
cannot exactly attribute the obtained phenotype to the presence of the point mutation. Nevertheless, we
proved that proper recombination occurred, from which it is possible to depict positive integration of both
versions of Pbgsk3 at the genomic and RNA levels. We, similarly, showed that there is no episomal
maintenance in those transfected parasites. In the end, we cannot prove that both versions of the kinase
are being expressed at the protein level due to the lack of a proper antibody against endogenous
PbGSK3. Even so, we suggest that it may be possible to overcome this limitation through the detection
of GSK3 via a the use of commercial antibodies against the mammalian GSK3 phospho-tyrosine as
was used in Solyakov et al., 2011. The signal detection by immuno-blotting should be observed only in
the Pb∆gsk3+ogsk3 parasites, as the Pb∆gsk3+ogsk3-YF parasites lack this residue. All in all, the
inability to revert the mutant phenotype leaves us with a conundrum that requires some further
investigations such as the demonstration that the complemented parasites have restored GSK3
functional activity. If the gene expression is affected in these transgenic parasites, the problem may lie
at the RNA regulation due to use of different 3’UTR and to the use of a codon optimized spliced version
of the gene. In terms of the genetic approach, we observed that negative selection may not be an optimal
approach. Thus, perhaps in future approaches we can consider using a non-spliced endogenous version
of the gene that is tagged so that protein expression can be detected. We also should consider the use
of positive selection. Therefore, it is necessary to generate marker free Pb∆gsk3 parasites, confirm
maintenance of the deletion mutant phenotype and then complement those parasites using positive
selection.
The strong phenotype from the Pb∆gsk3 suggest a reduced virulence of P. berghei parasites
and emphasize the relevance of generating a GSK3 deletion mutant in P. falciparum, despite being
described as refractory to deletion (Solyakov et al., 2011). Hence, alternative approaches to the
classical, and inefficient gene targeting methods may need to be employed. One such alternative is the
use of CRISPR-Cas9 system due to its increased efficiency in genome targeting (Doudna et al., 2014).
In P. falciparum, the CRISPR-Cas9 technique has already proven to be efficient, allowing for the
generation of deletion mutants and single-nucleotide substitutions in a short time frame. In order to adapt
the CRISPR-Cas9 system to P. falciparum, the Cas9 protein and the single guide RNA were expressed
under the control of Plasmodium regulatory elements (Ghorbal et al., 2014). Therefore, we propose the
71
use of the CRISPR-Cas9 technique to generate a PfGSK3 deletion mutant. In addition, it would be
advantageous to utilize this approach in conjunction with the generation of a conditional mutant with
control of expression at the genomic level through Cre-recombinase strategies, at the transcript level
through the use of riboswithces, or at the protein expression level through the use of targeting domains
such as destabilization domain (Koning-ward, Gilson and Crabb, 2015). The generation of a PfGSK3
deletion mutant would allow us to better characterize potential phenotype associated to invasion, egress,
or replication as these processes are well characterized and studied in P. falciparum (Koch and Baum,
2016) (Francia and Striepen, 2014). Additionally, the routinely in vitro cultivation in human red blood
cells would allow us to disengage any effect of the host contribution that we may be, otherwise,
observing in the rodent in vivo infections with P. berghei mutants.
All in all, this study has elucidated the spatial-temporal dynamics of PbGSK3 and how this
expression pattern may provide a clue into the function of GSK3 in Plasmodium. In addition, it was also
established the initial protocol for further characterization of the kinase and its interacting partners via
biochemical approaches such as immuno-precipitation followed by mass-spectrometry. Although the
genetic complementation studies proved to be unsuccessful, further attempts and strategies are
necessary to resolve it.
Through the understanding of GSK3 function, hypothesized to regulate virulence, we aimed to
further our understanding of Plasmodium virulence and biology with the ultimate goal of generating anti-
malarials or vaccines.
72
References
Alexander, D. L. et al. (2006) ‘Plasmodium falciparum AMA1 Binds a Rhoptry Neck Protein
Homologous to TgRON4 , a Component of the Moving Junction in Toxoplasma gondii’, Eukaryotic
Cell, 5(7), pp. 1169–1173. doi: 10.1128/EC.00040-06.
Aurrecoechea, C. et al. (2009) ‘PlasmoDB: A functional genomic database for malaria parasites’,
Nucleic Acids Research, 37, pp. 539–543. doi: 10.1093/nar/gkn814.
Beurel, E., Grieco, S. F. and Jope, R. S. (2015) ‘Pharmacology & Therapeutics Glycogen synthase
kinase-3 ( GSK3 ): Regulation , actions , and diseases’, Pharmacology and Therapeutics. Elsevier
Inc., 148, pp. 114–131. doi: 10.1016/j.pharmthera.2014.11.016.
Blasco, B., Leroy, D. and Fidock, D. A. (2017) ‘Antimalarial drug resistance: linking Plasmodium
falciparum parasite biology to the clinic’, Nature Medicine, 23(8), pp. 917–928. doi: 10.1038/nm.4381.
Blom, N., Gammeltoft, S. and Brunak, S. (1999) ‘Sequence and structure-based prediction of
eukaryotic protein phosphorylation sites’, Journal of Molecular Biology, 294(5), pp. 1351–1362. doi:
10.1006/jmbi.1999.3310.
Bolte, S. and Cordelieres, F. P. (2006) ‘A guided tour into subcellular colocalisation analysis in light
microscopy’, Journal of Microscopy, 224(3), pp. 13–232. doi: 10.1111/j.1365-2818.2006.01706.x.
Bozdech, Z. et al. (2003) ‘The Transcriptome of the Intraerythrocytic Developmental Cycle of
Plasmodium falciparum’, PLoS Biology. Edited by Gary Ward, 1(1), p. e5. doi:
10.1371/journal.pbio.0000005.
C-J_ Janse and A.P. Water-s (1995) ‘Plusmodium berghei : The Application of Cultivation and
Purification Techniques to Molecular Studies of Malaria Parasites’, Parasitology Today, (1990).
Available at: https://doi.org/10.1016/0169-4758(95)80133-2.
Cowman, A. F. et al. (2016) ‘Review Malaria : Biology and Disease’, Cell. Elsevier Inc., 167(3), pp.
610–624. doi: 10.1016/j.cell.2016.07.055.
van Dijk, M. R., Waters, a P. and Janse, C. J. (1995) ‘Stable transfection of malaria parasite blood
stages.’, Science (New York, N.Y.), 268(JUNE), pp. 1358–1362. doi: 10.1126/science.7761856.
Dorin-Semblat, D. et al. (2013) ‘An atypical cyclin-dependent kinase controls Plasmodium falciparum
proliferation rate’, Kinome, 1, pp. 4–16. doi: 10.2478/kinome-2013-0001.
Doudna, J. A. et al. (2014) ‘The new frontier of genome engineering with CRISPR-Cas9’. doi:
10.1126/science.1258096.
Droucheau, E. et al. (2004) ‘Plasmodium falciparum glycogen synthase kinase-3 : molecular model ,
expression , intracellular localisation and selective inhibitors’, Biochimica et Biophysica Acta (BBA) -
Proteins and Proteomics, 1697, pp. 181–196. doi: 10.1016/j.bbapap.2003.11.023.
Dubremetz, J. F. et al. (1998) ‘Apical organelles and host-cell invasion by Apicomplexa’, International
Journal for Parasitology, 28(7), pp. 1007–1013. doi: 10.1016/S0020-7519(98)00076-9.
Francia, M. E. and Striepen, B. (2014) ‘Cell division in apicomplexan parasites’, Nature Publishing
Group. Nature Publishing Group, 12(2), pp. 125–136. doi: 10.1038/nrmicro3184.
Ganter, M. et al. (2017) ‘Plasmodium falciparum CRK4 directs continuous rounds of DNA replication
during schizogony’, Nature Microbiology. Nature Publishing Group, 17017(February). doi:
73
10.1038/nmicrobiol.2017.17.
Ghorbal, M. et al. (2014) ‘Genome editing in the human malaria parasite Plasmodium falciparum using
the CRISPR-Cas9 system’, Nature Biotechnology. Nature Publishing Group, 2(June). doi:
10.1038/nbt.2925.
Giulia Manzoni (2014) ‘A rapid and robust selection procedure for generating drug-selectable marker-
free recombinant malaria parasites’, SCIENTIFIC REPORTS, 99210, pp. 1–10. doi:
10.1038/srep04760.
Gomes, A. R. et al. (2015) ‘Resource A Genome-Scale Vector Resource Enables High- Throughput
Reverse Genetic Screening in a Malaria Resource A Genome-Scale Vector Resource Enables High-
Throughput Reverse Genetic Screening in a Malaria Parasite’, Cell Host and Microbe. The Authors,
17(3), pp. 404–413. doi: 10.1016/j.chom.2015.01.014.
Healer, J. et al. (2002) ‘Independent translocation of two micronemal proteins in developing
Plasmodium falciparum merozoites.’, Infection and immunity, 70(10), pp. 5751–8. doi:
10.1128/IAI.70.10.5751.
Imwong, M. et al. (2007) ‘Relapses of Plasmodium vivax Infection Usually Result from Activation of
Heterologous Hypnozoites’, The Journal of Infectious Diseases, pp. 927–933. doi: 10.1086/512241.
Kadekoppala, M. and Holder, A. A. (2010) ‘Merozoite surface proteins of the malaria parasite: The
MSP1 complex and the MSP7 family’, International Journal for Parasitology. Australian Society for
Parasitology Inc., 40(10), pp. 1155–1161. doi: 10.1016/j.ijpara.2010.04.008.
Koch, M. and Baum, J. (2016) ‘Microreview The mechanics of malaria parasite invasion of the human
erythrocyte – towards a reassessment of the host cell contribution’, Cellular Microbiology, 18(3), pp.
319–329. doi: 10.1111/cmi.12557.
Koning-ward, T. F. De et al. (2016) ‘Plasmodium species : master renovators of their host cells’,
Nature Publishing Group. Nature Publishing Group, 14(8), pp. 494–507. doi: 10.1038/nrmicro.2016.79.
Koning-ward, T. F. De, Gilson, P. R. and Crabb, B. S. (2015) ‘Advances in molecular genetic systems
in malaria’, Nature Publishing Group. Nature Publishing Group, 13(6), pp. 373–387. doi:
10.1038/nrmicro3450.
Koster, A. J. and Klumperman, J. (2003) ‘Electron microscopy in cell biology: integrating structure and
function.’, Nature reviews. Molecular cell biology, Suppl(September), p. SS6-10. doi:
10.1038/nrm1194.
Lasonder, E. et al. (2015) ‘Extensive differential protein phosphorylation as intraerythrocytic
Plasmodium falciparum schizonts develop into extracellular invasive merozoites’, Proteomics, 15, pp.
2716–2729. doi: 10.1002/pmic.201400508.
Management of severe Malaria. (no date) Management of severe malaria.
Masch, A. and Kunick, C. (2015) ‘Biochimica et Biophysica Acta Selective inhibitors of Plasmodium
falciparum glycogen synthase-3 ( Pf GSK-3 ): New antimalarial agents ? ☆’, BBA - Proteins and
Proteomics. Elsevier B.V., 1854(10), pp. 1644–1649. doi: 10.1016/j.bbapap.2015.03.013.
De Monerri, N. C. S. et al. (2011) ‘Global identification of multiple substrates for Plasmodium
falciparum SUB1, an essential malarial processing protease’, Infection and Immunity, 79(3), pp. 1086–
1097. doi: 10.1128/IAI.00902-10.
74
Ojo, K. K. et al. (2011) ‘Structure determination of glycogen synthase kinase-3 from Leishmania major
and comparative inhibitor structure-activity relationships with Trypanosoma brucei GSK-3’, Molecular
and Biochemical Parasitology. Elsevier B.V., 176(2), pp. 98–108. doi:
10.1016/j.molbiopara.2010.12.009.
Orr, R. Y., Philip, N. and Waters, A. P. (2012) ‘Improved negative selection protocol for Plasmodium
berghei in the rodent malarial model’, Malaria Journal. BioMed Central Ltd, 11(1), p. 103. doi:
10.1186/1475-2875-11-103.
Painter, H. J., Campbell, T. L. and Llinás, M. (2012) ‘The Apicomplexan AP2 family: Integral factors
regulating’, Molecular and Biochemical Parasitology, 176(1), pp. 1–7. doi:
10.1016/j.molbiopara.2010.11.014.The.
Pease, B. N. et al. (2013) ‘Global Analysis of Protein Expression and Phosphorylation of Three Stages
of Plasmodium falciparum Intraerythrocytic Development’, Journal Proteome Research, 12(9), pp.
4028–4045. doi: 10.1021/pr400394g.Global.
Prinz, B. et al. (2016) ‘Hierarchical phosphorylation of apical membrane antigen 1 is required for
efficient red blood cell invasion by malaria parasites’, Scientific Reports. Nature Publishing Group,
6(1), p. 34479. doi: 10.1038/srep34479.
Prudêncio, M., Rodriguez, A. and Mota, M. M. (2006) ‘The silent path to thousands of merozoites : the
Plasmodium liver stage’, Nature Reviews Microbiology, 4(November), pp. 849–856. doi:
10.1038/nrmicro1529.
Rubin-bejerano, I. et al. (2004) ‘The In Vivo Activity of Ime1 , the Key Transcriptional Activator of
Meiosis-Specific Genes in Saccharomyces cerevisiae , Is Inhibited by the Cyclic AMP / Protein Kinase
A Signal Pathway through the Glycogen Synthase Kinase 3-  Homolog Rim11’, MOLECULAR AND
CELLULAR BIOLOGY, 24(16), pp. 6967–6979. doi: 10.1128/MCB.24.16.6967.
Sachs, J. and Malaney, P. (2002) ‘The economic and social burden of malaria’, Nature, 415(6872), pp.
680–685. doi: 10.1038/415680a.
Saldivia, M. et al. (2016) ‘The AMPK a 1 Pathway Positively Regulates the Developmental Transition
from Proliferation to Quiescence in Trypanosoma brucei Article The AMPK a 1 Pathway Positively
Regulates the Developmental Transition from Proliferation to Quiescence in Trypanosoma br’, Cell
Reports, pp. 660–670. doi: 10.1016/j.celrep.2016.09.041.
Silvie, O. et al. (2008) ‘Interactions of the malaria parasite and its mammalian host’, Current Opinion in
Microbiology, pp. 352–359. doi: 10.1016/j.mib.2008.06.005.
Singh, S. and Chitnis, C. E. (2017) ‘Molecular Signaling Involved in Entry and Exit of Malaria Parasites
from Host’, CSH perspectives in medicine, pp. 1–14. Available at:
http://perspectivesinmedicine.cshlp.org/content/7/10/a026815.long.
Slavic, K. et al. (2016) ‘A vacuolar iron-transporter homologue acts as a detoxifier in Plasmodium’,
Nature Communications. Nature Publishing Group, 7(May 2015), p. 10403. doi:
10.1038/ncomms10403.
Solyakov, L. et al. (2011) ‘Global kinomic and phospho-proteomic analyses of the human malaria
parasite Plasmodium falciparum’, Nature Communications. Nature Publishing Group, 2, p. 565. doi:
10.1038/ncomms1558.
75
Spielmann, T. et al. (2006) ‘Organization of ETRAMPs and EXP-1 at the parasite-host cell interface of
malaria parasites’, Molecular Microbiology, 59(3), pp. 779–794. doi: 10.1111/j.1365-
2958.2005.04983.x.
Srinivasan, P. et al. (2011) ‘Binding of Plasmodium merozoite proteins RON2 and AMA1 triggers
commitment to invasion’, PNAS, 108(32), pp. 2–7. doi: 10.1073/pnas.1110303108.
Szklarczyk, D. et al. (2016) ‘The STRING database in 2017: quality-controlled protein-protein
association networks, made broadly accessible’, Nucleic acids research, 45(D1), pp. D362–D368. doi:
10.1093/nar/gkw937.
Talevich, E. et al. (2012) ‘An evolutionary perspective on the kinome of malaria parasites’, The Royal
Society, pp. 2607–2618. doi: 10.1098/rstb.2012.0014.
Tardieux, I. and Baum, J. (2016) ‘Reassessing the mechanics of parasite motility and host-cell
invasion’, 214(5), pp. 507–515. doi: 10.1083/jcb.201605100.
Tawk, L. et al. (2013) ‘A key role for Plasmodium subtilisin-like SUB1 protease in egress of malaria
parasites from host hepatocytes’, Journal of Biological Chemistry, 288(46), pp. 33336–33346. doi:
10.1074/jbc.M113.513234.
Tewari, R. et al. (2010) ‘The Systematic Functional Analysis of Plasmodium Protein Kinases Identifies
Essential Regulators of Mosquito Transmission’, Cell Host and Microbe, 6, pp. 377–387. doi:
10.1016/j.chom.2010.09.006.
Treatment, F. O. R. T. H. E. and Malaria, O. F. (no date) ‘For the treatment of malaria’.
WHO (2016) World malaria report 2016.
Xingi, E. et al. (2009) ‘6-Br-5methylindirubin-3′oxime (5-Me-6-BIO) targeting the leishmanial glycogen
synthase kinase-3 (GSK-3) short form affects cell-cycle progression and induces apoptosis-like death:
Exploitation of GSK-3 for treating leishmaniasis’, International Journal for Parasitology. Australian
Society for Parasitology Inc., 39(12), pp. 1289–1303. doi: 10.1016/j.ijpara.2009.04.005.
Yeoh, S. et al. (2007) ‘Subcellular Discharge of a Serine Protease Mediates Release of Invasive
Malaria Parasites from Host Erythrocytes’, Cell, 131(6), pp. 1072–1083. doi:
10.1016/j.cell.2007.10.049.
Zuzarte-luis, V., Mota, M. M. and Vigário, A. M. (2014) ‘Malaria infections : What and how can mice
teach us’, Journal of Immunological Methods. Elsevier B.V., 410, pp. 113–122. doi:
10.1016/j.jim.2014.05.001.
76
Supplementary Material
Supplementary Figure 2- Plasmid used for the molecular cloning of the complemented lines. It includes the
5´HR, the 3´HR and both versions of the gsk3 gene. Additionally, it has the hDHFR cassette, its 3´UTR (a generic 3´UTR) and also a gene that confers resistance to the ampicillin antibiotic.
Supplementary Figure 1-Ponceau staining control
77
Supplementary Figure 3 – Restriction sites between each insert and respective size fragments
Supplementary Figure 5- Genotyping strategy for the amplification of the different regions.
Scheme representation of the expected recombination. Amplicon 1- gDNA 5´FR; Amplicon 2- vector 5´HR; Amplicon 3 – gDNA 5´FR + vector 3´HR; Amplicon 4 – vector 5´HR + ogsk3; Amplicon 5- ogsk3; Amplicon 6- hDHRF gene
Supplementary Figure 4 – Sequencing strategy: Different primers sets cover 100% of the ogsk3 gene plus
its flanking regions
Supplementary Figure 6 - 1Kb plus ladder
![Life Sciences...76 3 Contribution of Natural Products to Drug Discovery in Tropical Diseases mosquito [2]. Plasmodium falciparum, Plasmodium vivax, Plasmodium ovale, Plasmodium malariae,andPlasmodium](https://img.pdfslide.us/doc/110x75/6049cbda4f3447749747f712/life-sciences-76-3-contribution-of-natural-products-to-drug-discovery-in-tropical.jpg)
