90
The role of genetics in diagnosis and treatment of mood disorders Alessandro Serretti, MD, PhD Institute of Psychiatry University of Bologna Italy

The role of genetics in diagnosis and treatment of mood disorders Alessandro Serretti, MD, PhD Institute of Psychiatry University of Bologna Italy

Embed Size (px)

Citation preview

Page 1: The role of genetics in diagnosis and treatment of mood disorders Alessandro Serretti, MD, PhD Institute of Psychiatry University of Bologna Italy

The role of genetics in diagnosis and treatment of mood disorders

Alessandro Serretti, MD, PhD

Institute of PsychiatryUniversity of Bologna

Italy

Page 2: The role of genetics in diagnosis and treatment of mood disorders Alessandro Serretti, MD, PhD Institute of Psychiatry University of Bologna Italy

Genetics of mood disorders

Is genetics important for MD? Is genetics useful for MD diagnosys? Is genetics important for MD treatment? Is genetics useful for MD treatment?

Page 3: The role of genetics in diagnosis and treatment of mood disorders Alessandro Serretti, MD, PhD Institute of Psychiatry University of Bologna Italy

Genetics of mood disorders

Is genetics important for MD? Is genetics useful for MD diagnosys? Is genetics important for MD treatment? Is genetics useful for MD treatment?

Page 4: The role of genetics in diagnosis and treatment of mood disorders Alessandro Serretti, MD, PhD Institute of Psychiatry University of Bologna Italy

Morbid Risk in Bipolar Disorder

62

8 82 1

0

10

20

30

40

50

60

70

MZ DZ First degree Second degree General Population

%

Page 5: The role of genetics in diagnosis and treatment of mood disorders Alessandro Serretti, MD, PhD Institute of Psychiatry University of Bologna Italy

Morbid Risk in Major Depressive Disorder

40

119

5

0

5

10

15

20

25

30

35

40

45

MZ DZ First degree General Population

%

Page 6: The role of genetics in diagnosis and treatment of mood disorders Alessandro Serretti, MD, PhD Institute of Psychiatry University of Bologna Italy

Genetics of mood disorders

Is genetics important for MD? Yes Is genetics useful for MD diagnosys? Is genetics important for MD treatment? Is genetics useful for MD treatment?

Page 7: The role of genetics in diagnosis and treatment of mood disorders Alessandro Serretti, MD, PhD Institute of Psychiatry University of Bologna Italy

Genetics of mood disorders

Is genetics important for MD? Yes Is genetics useful for MD diagnosys? Is genetics important for MD treatment? Is genetics useful for MD treatment?

Page 8: The role of genetics in diagnosis and treatment of mood disorders Alessandro Serretti, MD, PhD Institute of Psychiatry University of Bologna Italy
Page 9: The role of genetics in diagnosis and treatment of mood disorders Alessandro Serretti, MD, PhD Institute of Psychiatry University of Bologna Italy
Page 10: The role of genetics in diagnosis and treatment of mood disorders Alessandro Serretti, MD, PhD Institute of Psychiatry University of Bologna Italy
Page 11: The role of genetics in diagnosis and treatment of mood disorders Alessandro Serretti, MD, PhD Institute of Psychiatry University of Bologna Italy
Page 12: The role of genetics in diagnosis and treatment of mood disorders Alessandro Serretti, MD, PhD Institute of Psychiatry University of Bologna Italy
Page 13: The role of genetics in diagnosis and treatment of mood disorders Alessandro Serretti, MD, PhD Institute of Psychiatry University of Bologna Italy
Page 14: The role of genetics in diagnosis and treatment of mood disorders Alessandro Serretti, MD, PhD Institute of Psychiatry University of Bologna Italy

62

8 82 1

0

10

20

30

40

50

60

70

MZ DZ First degree Second degree General Population

%

??

??

Page 15: The role of genetics in diagnosis and treatment of mood disorders Alessandro Serretti, MD, PhD Institute of Psychiatry University of Bologna Italy
Page 16: The role of genetics in diagnosis and treatment of mood disorders Alessandro Serretti, MD, PhD Institute of Psychiatry University of Bologna Italy
Page 17: The role of genetics in diagnosis and treatment of mood disorders Alessandro Serretti, MD, PhD Institute of Psychiatry University of Bologna Italy

Genetics of mood disorders

Is genetics important for MD? Yes Is genetics useful for MD diagnosys?

Not as we may think! Plasticity Is genetics important for MD treatment? Is genetics useful for MD treatment?

Page 18: The role of genetics in diagnosis and treatment of mood disorders Alessandro Serretti, MD, PhD Institute of Psychiatry University of Bologna Italy

Genetics of mood disorders

Is genetics important for MD? Yes Is genetics useful for MD diagnosys?

Not as we may think! Plasticity Is genetics important for MD

treatment? Is genetics useful for MD treatment?

Page 19: The role of genetics in diagnosis and treatment of mood disorders Alessandro Serretti, MD, PhD Institute of Psychiatry University of Bologna Italy

diagnosidiagnosiss

trials and errorstrials and errorseffective treatmenteffective treatment

TODAY….TODAY….

Page 20: The role of genetics in diagnosis and treatment of mood disorders Alessandro Serretti, MD, PhD Institute of Psychiatry University of Bologna Italy
Page 21: The role of genetics in diagnosis and treatment of mood disorders Alessandro Serretti, MD, PhD Institute of Psychiatry University of Bologna Italy

diagnosidiagnosiss

trials and errorstrials and errorseffective treatmenteffective treatment

TODAY….TODAY….

TOMORROW….TOMORROW….

tailor madetailor made

Page 22: The role of genetics in diagnosis and treatment of mood disorders Alessandro Serretti, MD, PhD Institute of Psychiatry University of Bologna Italy

Genetic Variation

Unrelated individuals are (only) 99% genetically similar.

There is about a 7 million bp difference between any two non-related individuals. Plus CNVs, epigenetics, expression controls…

This explains interindividual variability Hair color, weight and …. disease liability,

drug response.

Page 23: The role of genetics in diagnosis and treatment of mood disorders Alessandro Serretti, MD, PhD Institute of Psychiatry University of Bologna Italy

Pharmacogenetic studies (Medline 1992-2008)

0

200

400

600

800

1000

1200

1992

1994

1996

1998

2000

2002

2004

2006

Number of studies

Page 24: The role of genetics in diagnosis and treatment of mood disorders Alessandro Serretti, MD, PhD Institute of Psychiatry University of Bologna Italy

VARIATIONS IN DRUG RESPONSE

GENE

ß2-ADREN.

CETP

D2, D3, 5HT2

APOE4

RYANODINE

PROTHROMBIN

NET

Her2/neu

DRUG

ALBUTEROL

PRAVASTATIN

ANTIPSYCHOTICS

TACRINE

HALOTHANE

CONTRACEPTIVES

ATOMOXETINE

TRASTUZUMAB

EFFECT

Asthma response

Atherosclerosis resp.

Response-Side eff.

Alzheimer resp.

Malignant hyperthermia

Thrombosis

Response (Ramoz 2009)

Efficacy/Tolerance

Page 25: The role of genetics in diagnosis and treatment of mood disorders Alessandro Serretti, MD, PhD Institute of Psychiatry University of Bologna Italy
Page 26: The role of genetics in diagnosis and treatment of mood disorders Alessandro Serretti, MD, PhD Institute of Psychiatry University of Bologna Italy

GENETIC GENETIC POLYMORPHISMSPOLYMORPHISMS

PharmacokineticPharmacokinetic PharmacodynamicPharmacodynamic

•TransportersTransporters•Plasma protein bindingPlasma protein binding•MetabolismMetabolism

•ReceptorsReceptors•Ion channelsIon channels•EnzymesEnzymes•Immune moleculesImmune molecules

Page 27: The role of genetics in diagnosis and treatment of mood disorders Alessandro Serretti, MD, PhD Institute of Psychiatry University of Bologna Italy

HTTLPR SERT-STin2 5HT1A C-1019G 5-HT1B 5HT2A T102C 5HT2A G1438A 5HT2C 5HT6 C267T TPH A218C TPH2

NET T-182C NET G1287A

COMT MAOA DRD2 S311C DRD4 VNTR ACE I/D polymorphism G-protein beta3 C825T ADRB1 G1165C CRHR1 NOS C276T IL-1beta C511T DTNBP1 FKBP5 CLOCK

Genes investigated in the short termGenes investigated in the short term MDNF DTNBP1 nNOS IL-1beta APOE MDR1P-gp A-161T

Page 28: The role of genetics in diagnosis and treatment of mood disorders Alessandro Serretti, MD, PhD Institute of Psychiatry University of Bologna Italy
Page 29: The role of genetics in diagnosis and treatment of mood disorders Alessandro Serretti, MD, PhD Institute of Psychiatry University of Bologna Italy

REGULATORY VARIANT OF 5-HT TRANSPORTERREGULATORY VARIANT OF 5-HT TRANSPORTER

A functional polymorphism in the transcriptional control region upstream of the 5-HTT coding sequence (5-HTTLPR) has been reported (Heils et al., 1996).

Page 30: The role of genetics in diagnosis and treatment of mood disorders Alessandro Serretti, MD, PhD Institute of Psychiatry University of Bologna Italy
Page 31: The role of genetics in diagnosis and treatment of mood disorders Alessandro Serretti, MD, PhD Institute of Psychiatry University of Bologna Italy

HTT s/s

HTT l/s

HTT l/l

HAMD DECREASE DURING FLUVOXAMINE TREATMENT

5-HTTLPR variants in psychotic and non psychotic subjects

TIME

HA

MD

SC

OR

E

0

5

10

15

20

25

30

35

0 1 2 3 4 5 6

P<0.001

5-HTTLPR variants explained 7% of the variance of antidepressant efficacy

Page 32: The role of genetics in diagnosis and treatment of mood disorders Alessandro Serretti, MD, PhD Institute of Psychiatry University of Bologna Italy
Page 33: The role of genetics in diagnosis and treatment of mood disorders Alessandro Serretti, MD, PhD Institute of Psychiatry University of Bologna Italy
Page 34: The role of genetics in diagnosis and treatment of mood disorders Alessandro Serretti, MD, PhD Institute of Psychiatry University of Bologna Italy

• HTTLPR l variant associated with better outcome and side effects in caucasians, conflicting in asians (“flip-flop” Lin, 2007)

• Possibly through a complex and indirect effect • Multiple effects both in normals and patients (Serretti, 2006)

• Further variants control its effects

HTTLPR - ConclusionsHTTLPR - Conclusions

Page 35: The role of genetics in diagnosis and treatment of mood disorders Alessandro Serretti, MD, PhD Institute of Psychiatry University of Bologna Italy

• HTTLPR l variant associated with better outcome in caucasians

• Possibly through a complex and indirect effect • Multiple effects both in normals and patients (Serretti,

2006)

• Further variants control its effects

HTTLPR - ConclusionsHTTLPR - Conclusions

Page 36: The role of genetics in diagnosis and treatment of mood disorders Alessandro Serretti, MD, PhD Institute of Psychiatry University of Bologna Italy

HTTLPR - ConclusionsHTTLPR - Conclusions

Page 37: The role of genetics in diagnosis and treatment of mood disorders Alessandro Serretti, MD, PhD Institute of Psychiatry University of Bologna Italy
Page 38: The role of genetics in diagnosis and treatment of mood disorders Alessandro Serretti, MD, PhD Institute of Psychiatry University of Bologna Italy
Page 39: The role of genetics in diagnosis and treatment of mood disorders Alessandro Serretti, MD, PhD Institute of Psychiatry University of Bologna Italy

5-HTTLPR variations……

Broad influence of a single gene

on a range of aspects

 

Temperament

Stress reactivityAnatomical change

Mood disorders

Response to antidepressants

Poor serotonin pathway plasticity

Page 40: The role of genetics in diagnosis and treatment of mood disorders Alessandro Serretti, MD, PhD Institute of Psychiatry University of Bologna Italy

Harro J (2009): The brain prepared to become anxious: predisposing neurobiologyin animals and humans. Eur. Neuropsychopharm. 19:S113.

Page 41: The role of genetics in diagnosis and treatment of mood disorders Alessandro Serretti, MD, PhD Institute of Psychiatry University of Bologna Italy

• HTTLPR l variant associated with better outcome in caucasians

• Possibly through a complex and indirect effect • Multiple effects both in normals and patients (Serretti et al.,

Curr Drug Targ, 2006)

• Further variants control its effects

HTTLPR - ConclusionsHTTLPR - Conclusions

Page 42: The role of genetics in diagnosis and treatment of mood disorders Alessandro Serretti, MD, PhD Institute of Psychiatry University of Bologna Italy
Page 43: The role of genetics in diagnosis and treatment of mood disorders Alessandro Serretti, MD, PhD Institute of Psychiatry University of Bologna Italy

16-A

16-D

16-F

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16

tgcacccccagcatcccccc

tgcacccccggcatcccccc

tgcactcccagcatcccccc

Types of 16th repeat (*l)

Nakamura, 2000; Goldman, 2004

Page 44: The role of genetics in diagnosis and treatment of mood disorders Alessandro Serretti, MD, PhD Institute of Psychiatry University of Bologna Italy

Studies with at least two independent Studies with at least two independent replicationsreplications

Page 45: The role of genetics in diagnosis and treatment of mood disorders Alessandro Serretti, MD, PhD Institute of Psychiatry University of Bologna Italy
Page 46: The role of genetics in diagnosis and treatment of mood disorders Alessandro Serretti, MD, PhD Institute of Psychiatry University of Bologna Italy
Page 47: The role of genetics in diagnosis and treatment of mood disorders Alessandro Serretti, MD, PhD Institute of Psychiatry University of Bologna Italy
Page 48: The role of genetics in diagnosis and treatment of mood disorders Alessandro Serretti, MD, PhD Institute of Psychiatry University of Bologna Italy
Page 49: The role of genetics in diagnosis and treatment of mood disorders Alessandro Serretti, MD, PhD Institute of Psychiatry University of Bologna Italy
Page 50: The role of genetics in diagnosis and treatment of mood disorders Alessandro Serretti, MD, PhD Institute of Psychiatry University of Bologna Italy
Page 51: The role of genetics in diagnosis and treatment of mood disorders Alessandro Serretti, MD, PhD Institute of Psychiatry University of Bologna Italy
Page 52: The role of genetics in diagnosis and treatment of mood disorders Alessandro Serretti, MD, PhD Institute of Psychiatry University of Bologna Italy
Page 53: The role of genetics in diagnosis and treatment of mood disorders Alessandro Serretti, MD, PhD Institute of Psychiatry University of Bologna Italy

(Binder et al., 2004) FKBP5 Assoc. with resp. in 2 indep. samples(Tsai et al., 2007) FKBP5 No association(van Rossum et al., 2006) NR3Cl ER22/23EK Associated with response(Papiol et al., 2007) FKBP5 rs1360780 trend with response (p=0.09)(Lekman et al., 2008) FKBP5 rs4713916 Assoc with remission(Kirchheiner et al., 2008) FKBP5 rs3800373 and rs1360780 associated with response

(venlafaxine and drug combination)

FKBP5

Page 54: The role of genetics in diagnosis and treatment of mood disorders Alessandro Serretti, MD, PhD Institute of Psychiatry University of Bologna Italy

BDNF

Page 55: The role of genetics in diagnosis and treatment of mood disorders Alessandro Serretti, MD, PhD Institute of Psychiatry University of Bologna Italy

Dysbindin

Studies with at least two independent replicationsStudies with at least two independent replications

Page 56: The role of genetics in diagnosis and treatment of mood disorders Alessandro Serretti, MD, PhD Institute of Psychiatry University of Bologna Italy

Studies with at least two independent replicationsStudies with at least two independent replications

Page 57: The role of genetics in diagnosis and treatment of mood disorders Alessandro Serretti, MD, PhD Institute of Psychiatry University of Bologna Italy

Dysbindin associated with SSRI antidepressant efficacyDysbindin associated with SSRI antidepressant efficacy

Page 58: The role of genetics in diagnosis and treatment of mood disorders Alessandro Serretti, MD, PhD Institute of Psychiatry University of Bologna Italy

Dysbindin associated with SSRI antidepressant efficacyDysbindin associated with SSRI antidepressant efficacy

 

 

DTNBP1 haplotype analysis for rs2005976, rs760761 and rs2619522, on final MADRS covariated for baseline scores (haplotypes frequency>1%) P=0.0073.

Page 59: The role of genetics in diagnosis and treatment of mood disorders Alessandro Serretti, MD, PhD Institute of Psychiatry University of Bologna Italy

DYSBINDIN GENE (DTNBP1) IN mood disorders:

ASSOCIATION WITH CLINICAL RESPONSE TO

SSRIs

DYSBINDIN GENE (DTNBP1) IN mood disorders:

ASSOCIATION WITH CLINICAL RESPONSE TO

SSRIs

Arias, B; Serretti, A; Mandelli, L; Gastó, C; Catalán, R; Di Ronchi, D; Fañanás, L.

Arias, B; Serretti, A; Mandelli, L; Gastó, C; Catalán, R; Di Ronchi, D; Fañanás, L.

Pharmacogenet Genomics, In PressPharmacogenet Genomics, In Press

Page 60: The role of genetics in diagnosis and treatment of mood disorders Alessandro Serretti, MD, PhD Institute of Psychiatry University of Bologna Italy

Two-way repeated measures ANOVA for rs760761Two-way repeated measures ANOVA for rs760761

0

5

10

15

20

25

30

0 4 8 12

Weeks

HD

RS

sco

res

CCCTTT

Page 61: The role of genetics in diagnosis and treatment of mood disorders Alessandro Serretti, MD, PhD Institute of Psychiatry University of Bologna Italy
Page 62: The role of genetics in diagnosis and treatment of mood disorders Alessandro Serretti, MD, PhD Institute of Psychiatry University of Bologna Italy
Page 63: The role of genetics in diagnosis and treatment of mood disorders Alessandro Serretti, MD, PhD Institute of Psychiatry University of Bologna Italy

P-glycoprotein - MDR1

Studies with at least two independent replicationsStudies with at least two independent replications

Page 64: The role of genetics in diagnosis and treatment of mood disorders Alessandro Serretti, MD, PhD Institute of Psychiatry University of Bologna Italy

MDR1

Page 65: The role of genetics in diagnosis and treatment of mood disorders Alessandro Serretti, MD, PhD Institute of Psychiatry University of Bologna Italy
Page 66: The role of genetics in diagnosis and treatment of mood disorders Alessandro Serretti, MD, PhD Institute of Psychiatry University of Bologna Italy
Page 67: The role of genetics in diagnosis and treatment of mood disorders Alessandro Serretti, MD, PhD Institute of Psychiatry University of Bologna Italy
Page 68: The role of genetics in diagnosis and treatment of mood disorders Alessandro Serretti, MD, PhD Institute of Psychiatry University of Bologna Italy

(Paddock, 2007) GRIK4 rs1954787 assoc. with remiss. p=.001

(Gau, 2007) p75 NTR S250L assoc. with response p=.039

GRIK4

Page 69: The role of genetics in diagnosis and treatment of mood disorders Alessandro Serretti, MD, PhD Institute of Psychiatry University of Bologna Italy
Page 70: The role of genetics in diagnosis and treatment of mood disorders Alessandro Serretti, MD, PhD Institute of Psychiatry University of Bologna Italy

HTTLPRHTTLPR SERT-STin2 5HT1A C-1019G 5-HT1B 5HT2A T102C5HT2A T102C 5HT2A G1438A 5HT2C 5HT6 C267T TPH1 A218CTPH1 A218C TPH2

NET T-182C NET G1287A

COMT MAOA DRD2 S311C DRD4 VNTR

ACE I/D polymorphism G-protein beta3 C825T ADRB1 G1165C CRHR1 NOS C276T IL-1beta C511T FKBP5 CLOCK

Genes investigated in the short termGenes investigated in the short term MDNFMDNF DTNBP1DTNBP1 nNOS IL-1beta APOE MDR1P-gpMDR1P-gp GRIK4

Different target of SSRI

Different Plasticity

Different SSRI availability in the brain

Glutamate modulation

Page 71: The role of genetics in diagnosis and treatment of mood disorders Alessandro Serretti, MD, PhD Institute of Psychiatry University of Bologna Italy

Some gene variants influence Some gene variants influence antidepressant effectsantidepressant effects

But…But…

Page 72: The role of genetics in diagnosis and treatment of mood disorders Alessandro Serretti, MD, PhD Institute of Psychiatry University of Bologna Italy

Is antidepressant a unitary Is antidepressant a unitary effect?effect?And…And…

Do genes influence only one Do genes influence only one behavioral feature?behavioral feature?

Page 73: The role of genetics in diagnosis and treatment of mood disorders Alessandro Serretti, MD, PhD Institute of Psychiatry University of Bologna Italy

CLOCK 3111T/C

Broad influence of a single gene

on a range of aspects

 

Temperament

Insomnia Diurnal Preference

Mood fluctuations

Response to antidepressants

Page 74: The role of genetics in diagnosis and treatment of mood disorders Alessandro Serretti, MD, PhD Institute of Psychiatry University of Bologna Italy
Page 75: The role of genetics in diagnosis and treatment of mood disorders Alessandro Serretti, MD, PhD Institute of Psychiatry University of Bologna Italy

Genetics of mood disorders

Is genetics important for MD? Yes Is genetics useful for MD diagnosys?

Not as we may think! Plasticity Is genetics important for MD

treatment? Yes Is genetics useful for MD treatment?

Page 76: The role of genetics in diagnosis and treatment of mood disorders Alessandro Serretti, MD, PhD Institute of Psychiatry University of Bologna Italy

Genetics of mood disorders

Is genetics important for MD? Yes Is genetics useful for MD diagnosys?

Not as we may think! Plasticity Is genetics important for MD treatment?

Yes Is genetics useful for MD treatment?

Yes, but in a complex way

Page 77: The role of genetics in diagnosis and treatment of mood disorders Alessandro Serretti, MD, PhD Institute of Psychiatry University of Bologna Italy

Some gene variants influence Some gene variants influence antidepressant effectsantidepressant effects

and other featuresand other features

Can we use them in everyday Can we use them in everyday clinical practice?clinical practice?

Page 78: The role of genetics in diagnosis and treatment of mood disorders Alessandro Serretti, MD, PhD Institute of Psychiatry University of Bologna Italy
Page 79: The role of genetics in diagnosis and treatment of mood disorders Alessandro Serretti, MD, PhD Institute of Psychiatry University of Bologna Italy

NONO

Page 80: The role of genetics in diagnosis and treatment of mood disorders Alessandro Serretti, MD, PhD Institute of Psychiatry University of Bologna Italy

NOT YETNOT YET

Page 81: The role of genetics in diagnosis and treatment of mood disorders Alessandro Serretti, MD, PhD Institute of Psychiatry University of Bologna Italy

Pharmacogenetics: problematic issues…and possible solutions

• Low variance explained by polymorphisms (HTTLPR=2.8%, TPH=2.7%, Gß3=1.2%) Other variables influence drug response: Life events, social support, temperament, hormons…and should be included in the model! Neural Network?

• Epigenetic factors, CNV, Splicing, Regional expression, gene interactions…should be controlled with multivariate or neural network models.

• Drug response may differ across episodes…longer follow up

Page 82: The role of genetics in diagnosis and treatment of mood disorders Alessandro Serretti, MD, PhD Institute of Psychiatry University of Bologna Italy
Page 83: The role of genetics in diagnosis and treatment of mood disorders Alessandro Serretti, MD, PhD Institute of Psychiatry University of Bologna Italy
Page 84: The role of genetics in diagnosis and treatment of mood disorders Alessandro Serretti, MD, PhD Institute of Psychiatry University of Bologna Italy
Page 85: The role of genetics in diagnosis and treatment of mood disorders Alessandro Serretti, MD, PhD Institute of Psychiatry University of Bologna Italy
Page 86: The role of genetics in diagnosis and treatment of mood disorders Alessandro Serretti, MD, PhD Institute of Psychiatry University of Bologna Italy
Page 87: The role of genetics in diagnosis and treatment of mood disorders Alessandro Serretti, MD, PhD Institute of Psychiatry University of Bologna Italy
Page 88: The role of genetics in diagnosis and treatment of mood disorders Alessandro Serretti, MD, PhD Institute of Psychiatry University of Bologna Italy

                                                                          

Would be the puzzle the Would be the puzzle the actual image of reality?actual image of reality?Would be the puzzle the Would be the puzzle the actual image of reality?actual image of reality?

adherence - compliance

adherence - compliancesocial support

social supportstressful eventsstressful events personality

personality

Epigenetic factorsEpigenetic factors

gene interactionsgene interactions

HormonsHormonsHormonsHormons

GenomicsGenomics GenomicsGenomics

Proteomics Proteomics Proteomics Proteomics

Page 89: The role of genetics in diagnosis and treatment of mood disorders Alessandro Serretti, MD, PhD Institute of Psychiatry University of Bologna Italy

Kansai Medical University, Japan

Prof. Toshihiko KinoshitaMasaki Kato MD

The Catholic University of Korea College of Medicine, South Korea

Prof. Chi-Un Pae

Universitat de Barcelona, Spain

Prof. Lourdes FananasBarbara Arias PhD

Univerza V Ljubljani - University Of Ljubljana, Slovenia

Prof. Vita Dolzan

Principal Collaborating Centers

Athens University, Greece

Prof. Yoannis LiappasAntonis Politis MDPetros Malitas MD

University of Toronto, Canada

Prof. Jim KennedyDaniel Muller MD

Ludwig-Maximilians-Universität München, Germany

Prof. Dan RujescuIna Giegling PsyD

Page 90: The role of genetics in diagnosis and treatment of mood disorders Alessandro Serretti, MD, PhD Institute of Psychiatry University of Bologna Italy

Psychiatric Genetic Unit, Institute of Psychiatry, University of Bologna, Italy

Alessandro Serretti MD PhD

Laura Mandelli PsyD

Raffaella CalatiPsyD, PhD

Sara Gibiino

Diana De Ronchi MD PhD

Antonio Drago MD

Alberto Chiesa MD

Martina Forlani