Upload
prasit
View
212
Download
0
Embed Size (px)
Citation preview
239
Tissue Engineering and Regenerative Medicine, Vol. 11, No. 3, pp 239-246 (2014)
DOI 10.1007/s13770-014-0015-x
|Original Article|
The Responses of Human Adipose-derived Mesenchymal Stem Cells
on Polycaprolactone-based Scaffolds: an In Vitro Study
Thanaphum Osathanon1, 2,†,*, Boontharika Chuenjitkuntaworn3, Nunthawan Nowwarote2, Pitt Supaphol4,
Panunn Sastravaha5, Keskunya Subbalekha
5, and Prasit Pavasant
1,2
1Department of Anatomy, Faculty of Dentistry, Chulalongkorn University, Bangkok, 10330 THAILAND
2Mineralized Tissue Research Unit, Faculty of Dentistry, Chulalongkorn University, Bangkok, 10330 THAILAND
3Department of Oral Biology, Faculty of Dentistry, Naresuan University, Phitsanulok 65000 THAILAND4The Petroleum and Petrochemical College, Chulalongkorn University, Bangkok, 10330 THAILAND
5Department of Oral and Maxillofacial Surgery, Faculty of Dentistry, Chulalongkorn University, Bangkok, 10330 THAILAND
(Received: March 18th, 2014; Revision: April 23th, 2014; Accepted: May 12th, 2014)
Abstract : Polycaprolactone (PCL) has been investigated as an alternative synthetic polymeric scaffold for tissue
engineering application. In this study, the biological responses of human adipose-derived mesenchymal stem cells
(hADSCs) on PCL-based scaffolds were investigated in vitro. The hADSCs were isolated and characterized. Solvent
casting and particulate leaching method was employed as the fabrication method for PCL-based scaffolds. Here, we
illustrated that the isolated hADSCs exhibited fibroblast-like morphology, formed colonies in culture, and expressed
several stem cell markers. Moreover, the differentiation potency toward adipogenic, neurogenic and osteogenic lin-
eage was noted when cultured in the specific conditions. Polycaprolactone/hydroxyapatite composite scaffold (PCL/
HA) supported hADSCs attachment better than PCL scaffolds. Moreover, the alkaline phosphatase enzymatic activ-
ity and mineral deposition were greater on PCL/HA than PCL. Together, this present study illustrates the potential
utilization of PCL/HA and hADSC for bone tissue engineering.
Key words: Polycaprolactone, Hydroxyapatite, Mesenchymal stem cells, Adipose tissues
1. Introduction
Adult stem cells are able to be isolated from various kinds of
tissues, including bone marrow, dental-related tissues, and
adipose tissues.1,2 These isolated cells contain the mesenchymal
stem cells characteristics. Among these, bone marrow-derived
mesenchymal stem cells (BMSCs) have been profoundly
investigated and have significant potential application in
clinical treatment. Currently, BMSCs have been investigated
for many applications such as myocardial infarction, neuronal
disease, stroke and bone regeneration.3 The numerous clinical
trials using BMSCs in bone tissue engineering have been
reported 4,5 and showed the excellent potential of BMSCs for
bone defect repair. However, the disadvantages of BMSCs,
which are invasive harvesting technique and low number of
stem cell obtained from tissue samples, are limited their clinical
uses.6 Adipose-derived mesenchymal stem cells (ADSCs) have
been introduced as a possible stem cell source. The major
advantages of ADSCs are easy access of tissue sources, less
invasive to obtain samples, and give comparable amount of
mesenchymal stem cells to bone marrow.6 It has been shown
that these cells are able to differentiate into several specific cell
lineages such as osteogenic, chrondrogenic, adipogenic,
cardiomyogenic, neurogenic and endothelial lineages.7-11
Synthetic polymer has been employed as a candidate material
for tissue engineering application due to the controllable
fabricating and physical properties. Polycaprolactone (PCL) is
one of synthetic polymer used for bone tissue engineering.12 PCL
can be degraded by hydrolysis of ester bond in physiological
condition.13 Moreover, United State Food and Drug Administra-
tion (US-FDA) approved several medical applications of PCL,
such as suture materials14 and subdermal contraceptive implants.15
We previously reported the production and characterization of
PCL-based scaffolds for bone tissue engineering application.16
Upon cultured primary human bone cells on polycarprolactone/
hydroxyapatite composite scaffolds (PCL/HA), cells were
*Corresponding author
Tel: +66-2-218-8872
e-mail: [email protected] (Thanaphum Osathanon)
Thanaphum Osathanon et al.
240
increase type I collagen (COL I) and osteocalcin (OCN) mRNA
expressions. Moreover, the significant increase of mineral
deposition was noted. Furthermore, PCL/HA promoted bone
regeneration in rat calvarial defect model, suggesting that PCL/
HA could be a candidate material for bone defect repair.16
To enhance bone formation, the combination of mesenchymal
stem cells and three-dimensional scaffolds has been introduced
and shown to promote bone regeneration in critical size
defects.17-20 Therefore, the present study aimed to investigate
biological response of human ADSCs (hADSCs) on PCL-based
scaffolds in vitro.
2. Materials and methods
2.1 Fabrication of PCL-based Scaffolds
The scaffold fabrication was performed using protocol
previously reported.16 Briefly, PCL (Aldrich, USA; Mw =
80,000 g/mol) was dissolved in chloroform and mixed with
sucrose (Fluka Chemika, Switzerland), particle size 400-500 µm.
The porogens were dissolved in distilled water. Subsequently, the
scaffolds were saturated in 1 M sodium hydroxide (NaOH; Ajax
Finechem, Australia) solution and rinsed with distilled water. The
scaffolds were then immersed in ethanol (70% v/v) for 30 min
and subsequently rinsed with sterilized de-ionized water. For
PCL/HA, hydroxyapatite powder (HA), size 234 ± 68 nm was
mixed with PCL solution and processed through the procedures
described above.
2.2 Cell Isolation and Characterization
The human cell isolation protocol was approved by the Human
Ethical Committee, Faculty of Dentistry, Chulalongkorn
University. Inform consent was obtained. Briefly, the adipose
tissues, acquiring from resecting subcutaneous tissue during
craniofacial reconstructive surgery, were gently rinsed with
sterile phosphate buffer saline (PBS), minced into small pieces
and digested with collagenase (Sigma, USA). Harvested cells
were cultured in Dulbecco’s modified Eagle’s medium (DMEM;
Gibco, USA), containing 10% fetal bovine serum (FBS; Gibco,
USA), 2 mM L-glutamine, 100 units/mL penicillin, 100 µg/mL
streptomycin and 5 µg/mL amphotericin B (Gibco, USA) at
37oC in a humidified atmosphere of 5% CO2.
2.3 Doubling Time
Cells were seeded into six-well plates at density 12,500 cells/
well and further maintained for 96 h. Cells were then
trypsinized, and counted using a hemocytometer (Bright-
LineTM Hemacytometer; Sigma, USA). Doubling time was
calculated using the equation formerly reported.21
2.4 Colony Forming Unit Assay
Single cell suspension (500 cells) were plated into 35-mm-
diameter culture dishes and maintained in growth medium. At
day 14, the cells were fixed in 10% buffered formalin for 10 min,
washed twice with PBS and stained with coomassie blue. The
colonies were counted under phase contrast microscope.
2.5 Adipogenic Differentiation
Cells (25,000 cells) were seeded in 24-well-plate and cultured in
adipogenic medium [growth medium containing insulin (0.1 mg/
mL), dexamethasone (1 µM), 3-isobutyl-1-methylxanthine
(1 mM), and indomethacin (0.2 mM)] for 14 days.22 Subsequently,
cells were fixed in 10% buffered formalin, rinsed twice with PBS
and stained with 0.2 % Oil Red O in propanol for 5 min. The
intracellular lipid droplets were evaluated using invert phase
contrast microscope.
2.6 Neurogenic Differentiation
Single cell suspension (500,000 cells) were seeded in 60-mm-
petri dishes and maintained in neurobasal medium supplemented
with B27 (2%), b-FGF (20 ng/mL), EGF (20 ng/mL), L-
glutamine (2 mM), penicillin (100 units/mL), streptomycin
(100 µg/mL) and amphotericin B (5 µg/mL) (Gibco, USA) for 7
days.23 Neurosphere formation was observed under phase
contrast microscope at day 7.
2.7 Osteogenic Differentiation
Cells were seeded at a density of 25,000 cells/well on 24-well-
plate. To induce osteogenic differentiation, cells were cultured in
an osteogenic medium (growth medium supplemented with
ascorbic acid (50 µg/mL), dexamethasone (100 nM) and sodium
phosphate (2 mM) or beta-glyceraphosphate (10 mM)).22
2.8 Polymerase Chain Reaction (PCR)
RNA was extracted with Trizol reagent (Roche Diagnostics,
USA) according to the manufacturer’s instructions. RNA sample
(1 µg) was converted to cDNA by reverse transcriptase enzyme
(Promega, USA). The primer sequences were in Table 1. For
semi-quantitative PCR, the reactions were performed using Taq
polymerase in the thermocycling machine. The products were run
in 1.8% agarose gel and stained with ethidium bromide. For a
quantitative PCR, the reactions were performed using FastStart®
Essential DNA Green Master® (Roche Diagnostics, USA) in Real-
time PCR detection system (Biorad, USA).
2.9 Cell Attachment Assay
MTT assay was employed to evaluate the viable cell attaching
on the scaffolds. In brief, cells were seeded onto the scaffolds at
Response of hADSC on PCL scaffolds in vitro
241
a density of 50,000 cells/scaffolds. At designated time point, the
cell-seeded scaffolds were incubated with MTT solution for 30
min at 37oC and the formation of formazan crystal was evaluated
by dissolving in dimethylsulfoxide (DMSO, Sigma, USA). The
optical density was evaluated at 570 nm.
For morphology observation, the samples were fixed with
2.5% glutaraldehyde (Sigma, USA) for 30 min. All specimens
were subsequently dehydrated in ethanol, processed for critical
point drying (CPD 7501, FISONS Instrument, UK) and sputter-
coated with Au. Scaffolds and cellular morphology was examined
using a scanning electron microscope (JSM 5401LV, JEOL,
Japan).
2.10 Alkaline Phosphatase Activity Assay
Cells seeded scaffolds were rinsed twice with PBS and lysed
in alkaline lysis buffer. The supernatant solution was incubated at
37oC in solution containing 2 mg/mL p-nitrophenol phosphate,
0.1 M aminopropanol and 2 mM MgCl2. To stop reaction,
NaOH solution (50 mM) was added to the mixture. The
absorbance at 410 nm was measured. The BCA assay (Pierce
Biotechnology, USA) was employed to determine the total cellular
protein. The ALP enzyme activity was further normalized to total
cellular protein.
2.11 Mineralization Assay
The cells were seeded at density 50,000 cells/scaffolds and
incubated in osteogenic medium described above. At 14 and 21
days, cold methanol was utilized for cell fixation for 10 min. The
cell-seeded scaffolds was subsequently washed with deionized
water and immersed in 1% Alizarin Red S solution (Sigma,
USA) for 3 min with gently agitation. The quantification was
performed by comparing the destaining solution absorbance at
570 nm (10% cetylpyridinium chloride monohydrate (Sigma,
USA) in 10 mM sodium phosphate). The absorbance was further
subtracted from those of scaffolds without cells.
2.12 Statistical Analyses
The results were illustrated as mean ± standard deviation.
Statistical significance was analyzed using independent t-test for
two groups comparison and a one-way analysis of variance
(ANOVA), followed by Tukey HSD test for multiple group
comparison. Differences at p < 0.05 were considered to be
statistically significant.
3. Results
3.1 Characterization of hADSCs
hADSCs exhibited spindle shape, fibroblast-like morphology
(Fig 1a). Doubling time (at passage 4) and numbers of colonies
(at passage 4 and 10) were shown in Table 2. Numbers of
colonies were counted at day 14. However, the colony formation
of hADSCs was noted as early as day 7 in culture. At passage 10,
Table 1. Primer sequences.
Gene Forward sequence Reverse sequence
OCT4 5’ AGACCCAGCAGCCTCAAAATC 3’ 5’ GCAACCTGGAGAATTTGTTCCT 3’
NANOG 5’ GGAAGAGTAGAGGCTGGGGT 3’ 5’ TCTCTCCTCTTCCTTCTCCA 3’
REX-1 5’ AGAATTCGCTTGAGTATTCTGA 3’ 5’ GGCTTTCAGGTTATTTGACTGA 3’
NESTIN 5’ CTGCGGGCTACTGAAAAGTT 3’ 5’ AGGCTGAGGGACATCTTGAG 3’
CD44 5’ GCAAGTTTTGGTGGCACGCA 3’ 5’ CAATCTTCTTCAGGTGGAGC 3’
CD73 5’ ACACTTGGCCAGTAAAATAGGG 3’ 5’ ATTGCAAAGTGGTTCAAAGTCA 3’
CD105 5’ CATCACCTTTGGTGCCTTCC 3’ 5’ CTATGCCATGCTGCTGGTGGA 3’
SOX9 5’ GAACGCACATCAAGACGGAG 3’ 5’ TCTCGTTGATTTCGGTGCTC 3’
NMD 5’ CACTGATAACTCGCCGTCCT 3’ 5’ CTCTTCAGCTTGGCTGCTCT 3’
GAPDH 5’ TGAAGGTCGGAGTCAACGGAT 3’ 5’ TCACACCCATGACGAACATGG 3’
For quantitative PCR
ALP 5’ CGAGATACAAGCACTCCCACTTC 3’ 5’ CTGTTCAGCTCGTACTGCATGTC 3’
OCN 5’ CTTTGTGTCCAAGCAGGAGG 3' 5' CTGAAAGCCGATGTGGTCAG 3'
OSX 5' GCCAGAAGCTGTGAAACCTC 3' 5' GCTGCAAGCTCTCCATAACC 3’
CBFA1 5’ ATGATGACACTGCCACCTCTGA 3’ 5' GGCTGGATAGTGCATTCGGTG 3'
COL1 5’ GTGCTAAAGGTGCCAATGGT 3’ 5’ ACCAGGTTCACCGCTGTTAC 3’
BMP2 5’ GCGTGAAAAGAGAGACTGC 3’ 5’ CCATTGAAAGAGCGTCCAC 3’
GAPDH 5’ TGAAGGTCGGAGTCAACGGAT 3’ 5’ TCACACCCATGACGAACATGG 3’
Thanaphum Osathanon et al.
242
hADSCs still exhibited high colony number and no statistical
difference was observed, compared to those of cells at passage 4.
STRO-1 positive cells were observed in isolated hADSCs
population (Fig 1b). The mRNA expressions of stem cells
markers were shown compared to human dental pulp stem cells
(DPSC) and human periodontal ligament stem cells (PDLSC)
(Fig 1c).23,24 The hADSCs expressed pluripotent stem cell
markers; OCT4, NANOG, and REX-1. The expression of neural
crest cell marker, NESTIN, was significantly lower compared to
those of DPSC and PDLSC. Moreover, hADSCs also expressed
CD44, CD73 and CD 105.
Upon cultured hADSCs in adipogenic medium for 14 days,
the intracellular lipid accumulation was markedly increased
compared to those cultured in normal growth medium (Fig 2a-
b). For osteoblast differentiation, the significant upregulation of
ALP activity was noted in those hADSCs cultured in osteogenic
medium at day 7 (Fig 2c). Moreover, the mineral deposition
was significantly enhanced in those cells cultured in osteogenic
medium for 14 days as evaluated by Alizarin Red S staining
(Fig 2d). Further, the potential neurogenic differentiation was
evaluated using neurosphere formation assay. The neurosphere
formation was found in cultured when hADSCs were cultured
in neurogenic medium (Fig 2e and f). The neurospheres were
increase in size and cellular density at 7 days compared to 1 day.
Moreover, these neurospheres were expressed higher SOX9 and
neuromodulin (NMD), neurogenic markers, mRNA levels
when compared to the control (Fig 2g).
Figure 1. Characterization of human adipose derived mesenchymal
stem cells (hADSCs). Morphological observation of hADSCs using
phase contrast microscope (a) and immunocytochemistry illustrating
STRO-1 positive cells (b) were illustrated. Expression of embryonic,
neural crest and mesenchymal stem cell markers was determined
using reverse transcriptase polymerase chain reaction (c); DPSC:
human dental pulp stem cells, PDL: human periodontal ligament
stem cells, hADSC: human adipose-derived mesenchymal stem
cells.
Table 2. Doubling time and colony forming unit of human adi-
pose-derived mesenchymal stem cells.
DonorDoubling times
(hours)
Colony forming unit (Colony count)
Passage 4 Passage 10
1 48.00 ± 5.76 99.25 ± 12.14 105.00 ± 17.03
2 53.50 ± 8.81 64.00 ± 6.37 64.00 ± 3.00
3 38.00 ± 2.02 107.75 ± 10.21 79.00 ± 20.22
Figure 2. Multipotential differentiation of human adipose derived
mesenchymal stem cells (hADSCs). Adipogenic differentiation
of human adipose-derived mesenchymal stem cells (hADSCs) in
vitro. The intracellular lipid accumulation was evaluated in hAD-
SCs cultured in growth medium (a) and adipogenic medium
(AM) (b) for 14 days. For osteogenic differentiation of hADSCs
in vitro, the alkaline phosphatase enzymatic activity of hADSCs
cutured in osteogenic medium (OM) for 7 days was analyzed (c).
The alizarin red staining of hADSCs cultured in growth medium
and osteogenic medium for 14 days was shown and the absor-
bance measurement of alizarin red accumulation was measured
(d). For neurogenic differentiation, Neurosphere formation of
hADSCs cultured in neurogenic medium for 1 days (e) and 7
days (f) were evaluated using phase contrast microscope. The
mRNA expression of neurogenic differentiation markers (SOX9
and NMD) was measured using reverse transcriptase polmerase
chain reaction (g). The asterisk indicated the statistical significant
difference at p<0.05.
Response of hADSC on PCL scaffolds in vitro
243
3.2 In Vitro Evaluation of hADSCs on PCL-Based
Scaffolds
PCL and PCL/HA scaffolds exhibited highly porous and
interconnected structure (Fig 3a). The hADSCs were able to
attach on scaffolds as evaluated by MTT assay. Higher number
of hADSCs was attached on PCL/HA compared to PCL at 1 and
3 h (Fig 3b). From SEM observation, hADSCs attached as early
as 1h after seeding. Filopodia and lamellopodia were noted at 1
and 3 h (Fig 3c). At 1 d, cells were flattened and able to spread on
both types of the scaffolds. Monolayer was observed at 7 d after
seeding. Multilayer formation of hADSCs was observed in both
PCL and PCL/HA at 14 and 21 d. Together, these data implied
that both PCL and PCL/HA supported cell attachment and
growth in vitro, however, PCL/HA showed superior property
regarding supporting cell attachment.
To determine supportive property of PCL-based scaffolds for
Figure 3. Human adipose-derived mesenchymal stem cell (hADSCs) attachment and spreading on PCL-based scaffolds. SEM micro-
graphs represented the architecture of PCL and PCL/HA (a). The hADSCs attachment of PCL and PCL/HA at 1 and 3 h using MTT
assay was illustrated (b). The representative pictures for hADSC morphology on PCL and PCL/HA scaffolds at 1 and 3 h as well as 1, 7,
14 and 21 days were shown (c). The bars indicated the statistical significant difference at p<0.05.
Figure 4. Osteogenic differentiation of human adipose-derived mesenchymal stem cells (hADSCs) on PCL-based scaffolds in vitro. The
graphs represented the osteogenic mRNA expression (a), alkaline phosphatase enzymatic activity (b), and mineral deposition (c). The
mRNA expression was determined using quantitative polymerase chain reaction at day 7 (a). The alkaline phosphatase enzymatic activ-
ity and mineral deposition of hADSCs cultured on PCL-based scaffolds in normal growth medium and osteogenic medium were shown
(b and c, respectively). The asterisk and bars indicated the statistical significant difference compared to the control (p<0.05).
Thanaphum Osathanon et al.
244
hADSCs’ osteogenic differentiation, the mRNA expression of
osteogenic marker genes was evaluated using quantitative PCR
after seeding cells on the scaffolds and maintained in osteogenic
medium for 7 days (Fig 4a). The mRNA expression was slightly
higher in those cells seeded on PCL/HA. However, the statistical
significance was noted only for the OSX mRNA expression. In
addition, ALP activity was evaluated at 7, 14 and 21 days after
cultured hADSCs in osteogenic medium (Fig 4b). A trend of
ALP activity was increased at 14 days and, subsequently,
decreased at 21 days on both types of scaffolds. The significant
increase of ALP activity was observed in hADSCs seeded on
PCL/HA groups at 14 days compared to 7 days. Furthermore, the
increase of calcium deposition on cells seeded scaffolds was noted
(Fig 4c). For both PCL and PCL/HA, the calcium deposition at 21
days was slightly higher compared to 14 days. In addition, the
significant higher mineral deposition was noted on PCL/HA
compared to those of PCL alone at 14 days.
4. Discussion
In this study, we described the isolation and characterization
of hADSCs as well as the application of these cells with PCL-
based scaffolds for bone tissue engineering. Isolated adipose
tissue-derived cells were able to form colonies and differentiate
into several cell lineages. The hADSCs were also able to attach
and differentiate into osteoblast on PCL-based scaffolds. These
observations might support the potential strategy for hADSCs
and biocompatible scaffolds to promote bone repair and
regeneration.
Cells isolated from adipose tissues expressed several
embryonic stem cell marker genes such as OCT4, NANOG and
SOX2.25 However, it was noted that these pluripotent marker
gene expressions were much lower compared to those of
embryonic stem cells.26 The adipose derived cells were also
able to differentiate into osteoblast, chondroblast and
adipocyte.25,27 It has also been reported that a combination of
adipose derived cells and scaffolds enhanced bone regeneration
in calvarial defect models.17,28 Moreover, injection of these
cells into myocardial infarction sites was able to improve
cardiac function in rats.29 Interestingly, it has been shown that
STRO-1 positive subpopulation of ADSC exhibited high
osteogenic potential.30 Further, the previous study demonstrated
that the isolated ADSC may or may not express STRO-1 in
culture.31 Although, we did not quantitate the amount of STRO-
1 positive cells in our isolated cell population, the STRO-1
expression was noted in culture. Together, these results suggest
that the adipose tissues contain stem cells population and could
be used as an alternative source of stem cells in regenerative
medicine. Correspondingly, we showed in the present study
that heterogeneous cells isolated from human adipose tissues
had stem cell-like properties regarding stem cell marker gene
expressions and their differentiation abilities. In addition, we
further characterized single cell clone isolated from
heterogeneous population of adipose derived cells and found
that fourteen single cells clones were expressed stem cell
marker gene and able to differentiate into osteogenic and
adipogenic lineage 22,confirming the present of stem cells in
isolated cell population from adipose tissues.
Many studies have been employed PCL as a scaffold’s
component in various tissue engineering applications such as
ophthalmic implants, ligament, bone, cartilage, vessel and
cardiac tissue engineering.32-39 PCL also has slower degradation
rate compared to other synthetic polymers, i.e. poly-lactide-co-
glycolide (PLGA) and polylactic acid (PLA), led to its
application in control drug delivery system.13 In addition, PCL
could be easily modified its surface to improve biological
properties. In this regard, immobilization of Arg-Gly-Asp-
containing proteins on PCL electrospun fibrous scaffolds showed
the improvement of cell attachment and proliferation.40,41
Previously, our group demonstrated that the incorporation of
hydroxyapatite particles in PCL scaffolds improved the
mechanical properties, enhanced osteoblast differentiation in
vitro as well as supported bone regeneration in vivo.16
Pore
dimension was range between 478 and 502 µm,16 which has
been reported as optimal pore size for bone regeneration. In the
present study, we further demonstrated that PCL/HA enhanced
the differentiation of hADSCs toward osteogenic lineage
compared to PCL alone as shown by the increasing trend of
ALP activity and mineral deposition. The mechanism of PCL/
HA promoting osteoblast differentiation is yet unclear.
However, there are several explanations. First, the dissolution
of calcium and phosphate ions released from hydroxyapatite
crystals could directly induce the differentiation of osteoblasts.42
Second, the incorporation of hydroxyapatite particle in PCL
scaffolds may alter the surface topography of scaffold’s wall,
which leads to the increase of the surface roughness. The change
in surface roughness might promote osteoblast differentia-
tion.43,44 Third, it has been shown that biphasic calcium
phosphate scaffolds coated with PCL/nHA enhanced early
osteogenic differentiation of ADSC via the integrin-α2 and
MAPK/ERK signaling pathway.45 Moreover, it has been shown
that mesenchymal stem cells on PCL/collagen I/HA scaffolds
exhibited higher focal adhesion kinase phosphorylation levels
compared to the control,46 confirming the role of integrin in the
PCL/HA induced osteogenic differentiation. Lastly, it has also
shown that the HA shape influences the osteogenic differentia-
Response of hADSC on PCL scaffolds in vitro
245
tion. The rod shape PCL/nHA film markedly promoted
osteogenic differentiation of human osteoblast cells compared
to the spherical shape PCL/nHA film.47 Cells on rod shape
PCL/nHA film upregulated BMP-2 expression and could
further stimulate osteogenic differentiation of other cells. 47
Together, there are several potential mechanism (s) that relates
to PCL/HA regulating osteogenic differentiation. Thus, further
studies should be performed to identify the mechanism of PCL/
HA promoting osteogenic differentiation, particularly in
hADSCs.
5. Conclusion
The hADSCs have been proposed as an alternative cell source
for bone defect repair. The PCL-based scaffolds, described in this
study, support ADSCs attachment, spreading and differentiation
toward osteogenic lineage in vitro. Further animal studies should
be performed to archive more beneficial evidences regarding
ADSCs and PCL-based scaffolds for bone tissue engineering.
Acknowledgements: This work was supported by the
Ratchadapiseksomphot Endowment Fund of Chulalongkorn
University (RES560530156-HR) and the Research Chair Grant
2012, the National Science and Technology Development
Agency (NSTDA), Thailand.
Conflict of interest: The authors declared no conflict of
interest.
References
1. GT Huang, S Gronthos, S Shi, Mesenchymal stem cells derived
from dental tissues vs. those from other sources: their biology
and role in regenerative medicine, J Dent Res, 88, 792 (2009).
2. H Mizuno, Adipose-derived stem cells for tissue repair and
regeneration: ten years of research and a literature review, J
Nippon Med Sch, 76, 56 (2009).
3. EM Horwitz, M Dominici, How do mesenchymal stromal cells
exert their therapeutic benefit?, Cytotherapy, 10, 771 (2008).
4. J Lee, HM Sung, JD Jang, et al., Successful reconstruction of
15-cm segmental defects by bone marrow stem cells and
resected autogenous bone graft in central hemangioma, J Oral
Maxillofac Surg, 68, 188 (2010).
5. M Tadokoro, R Kanai, T Taketani, et al., New bone formation
by allogeneic mesenchymal stem cell transplantation in a
patient with perinatal hypophosphatasia, J Pediatr, 154, 924
(2009).
6. M Locke, J Windsor, PR Dunbar, Human adipose-derived
stem cells: isolation, characterization and applications in
surgery, ANZ J Surg, 79, 235 (2009).
7. LJ Fischer, S McIlhenny, T Tulenko, et al., Endothelial
differentiation of adipose-derived stem cells: effects of
endothelial cell growth supplement and shear force, J Surg
Res, 152, 157 (2009).
8. LE Flynn, The use of decellularized adipose tissue to provide an
inductive microenvironment for the adipogenic differentiation of
human adipose-derived stem cells, Biomaterials, 31, 4715 (2010).
9. T Rada, RL Reis, ME Gomes, Distinct Stem Cells
Subpopulations Isolated from Human Adipose Tissue Exhibit
Different Chondrogenic and Osteogenic Differentiation
Potential, Stem Cell Rev, 7, 64(2011).
10. YS Choi, GJ Dusting, S Stubbs, et al., Differentiation of human
adipose-derived stem cells into beating cardiomyocytes, J Cell
Mol Med, 14, 878 (2010).
11. S Jang, HH Cho, YB Cho, et al., Functional neural
differentiation of human adipose tissue-derived stem cells using
bFGF and forskolin, BMC Cell Biol, 11, 25(2010).
12. LS Nair, CT Laurencin, Biodegradable polymers as biomaterials,
Progress in Polymer Science, 32, 762 (2007).
13. A Kumari, SK Yadav, SC Yadav, Biodegradable polymeric
nanoparticles based drug delivery systems, Colloids Surf B
Biointerfaces, 75, 1 (2010).
14. RS Bezwada, DD Jamiolkowski, IY Lee, et al., Monocryl
suture, a new ultra-pliable absorbable monofilament suture,
Biomaterials, 16, 1141(1995).
15. PD Darney, SE Monroe, CM Klaisle et al., Clinical evaluation
of the Capronor contraceptive implant: preliminary report, Am J
Obstet Gynecol, 160, 1292 (1989).
16. B Chuenjitkuntaworn, W Inrung, D Damrongsri, et al.,
Polycaprolactone/hydroxyapatite composite scaffolds: Preparation,
characterization, and in vitro and in vivo biological responses of
human primary bone cells, J Biomed Mater Res A, 94, 241 (2010).
17. E Yoon, S Dhar, DE Chun, et al., In vivo osteogenic potential of
human adipose-derived stem cells/poly lactide-co-glycolic acid
constructs for bone regeneration in a rat critical-sized calvarial
defect model, Tissue Eng, 13, 619(2007).
18. PJ Taub, J Yau, M Spangler, et al., Bioengineering of calvaria
with adult stem cells, Plast Reconstr Surg, 123, 1178 (2009).
19. BM Seo, W Sonoyama, T Yamaza, et al., SHED repair critical-
size calvarial defects in mice, Oral Dis, 14, 428(2008).
20. Z Zhao, Z Wang, C Ge, et al., Healing cranial defects with
AdRunx2-transduced marrow stromal cells, J Dent Res, 86,
1207 (2007).
21. W Singhatanadgit, N Donos, I Olsen, Isolation and
characterization of stem cell clones from adult human ligament,
Tissue Eng Part A, 15, 2625(2009).
22. T Osathanon, K Subbalekha, P Sastravaha, et al., Notch
signalling inhibits the adipogenic differentiation of single-cell-
derived mesenchymal stem cell clones isolated from human
adipose tissue, Cell Biol Int, 36, 1161 (2012).
23. T Osathanon, N Nowwarote, P Pavasant, Basic fibroblast
growth factor inhibits mineralization but induces neuronal
differentiation by human dental pulp stem cells through a FGFR
and PLCgamma signaling pathway, J Cell Biochem, 112, 1807
(2011).
24. T Osathanon, P Ritprajak, N Nowwarote, et al., Surface-bound
orientated Jagged-1 enhances osteogenic differentiation of
human periodontal ligament-derived mesenchymal stem cells, J
Biomed Mater Res A, 101, 358(2013).
Thanaphum Osathanon et al.
246
25. M Neupane, CC Chang, M Kiupel, et al., Isolation and
characterization of canine adipose-derived mesenchymal stem
cells, Tissue Eng Part A, 14, 1007 (2008).
26. JJ Mao, DJ Prockop, Stem cells in the face: tooth regeneration
and beyond, Cell Stem Cell, 11, 291 (2012).
27. C Csaki, U Matis, A Mobasheri, et al., Chondrogenesis,
osteogenesis and adipogenesis of canine mesenchymal stem
cells: a biochemical, morphological and ultrastructural study,
Histochem Cell Biol, 128, 507 (2007).
28. L Cui, B Liu, G Liu, et al., Repair of cranial bone defects with
adipose derived stem cells and coral scaffold in a canine model,
Biomaterials, 28, 5477 (2007).
29. L Wang, J Deng, W Tian, et al., Adipose-derived stem cells are
an effective cell candidate for treatment of heart failure: an MR
imaging study of rat hearts, Am J Physiol Heart Circ Physiol,
297, H1020 (2009).
30. T Rada, RL Reis, ME Gomes, Distinct stem cells subpopulations
isolated from human adipose tissue exhibit different
chondrogenic and oteogenic differentiation potential, Stem Cell
Rev, 7, 64 (2011).
31. CS Lin, ZC Xin, CH Deng, et al., Defining adipose tissue-
derived stem cells in tissue and in culture, Histol Histopathol,
25, 807 (2010).
32. WY Yeong, N Sudarmadji, HY Yu, et al., Porous polycaprolactone
scaffold for cardiac tissue engineering fabricated by selective laser
sintering, Acta Biomater, 6, 2028 (2010).
33. S Kashanian, F Harding, Y Irani, et al., Evaluation of
mesoporous silicon/polycaprolactone composites as ophthalmic
implants, Acta Biomater, 6, 3566 (2010).
34. HJ Shao, YT Lee, CS Chen, et al., Modulation of gene
expression and collagen production of anterior cruciate ligament
cells through cell shape changes on polycaprolactone/chitosan
blends, Biomaterials, 31, 4695 (2010).
35. PM Lopez-Perez, RM da Silva, RA Sousa, et al., Plasma-
induced polymerization as a tool for surface functionalization of
polymer scaffolds for bone tissue engineering: An in vitro study,
Acta Biomater, 6, 3704 (2010).
36. D Lahiri, F Rouzaud, T Richard, et al., Boron nitride nanotube
reinforced polylactide-polycaprolactone copolymer composite:
Mechanical properties and cytocompatibility with osteoblasts
and macrophages in vitro, Acta Biomater, 6, 3524 (2010).
37. CG Jeong, SJ Hollister, A comparison of the influence of
material on in vitro cartilage tissue engineering with PCL, PGS,
and POC 3D scaffold architecture seeded with chondrocytes,
Biomaterials, 31, 4304 (2010).
38. S Fuchs, X Jiang, I Gotman, et al., Influence of polymer content
in Ca-deficient hydroxyapatite-polycaprolactone nanocomposites
on the formation of microvessel-like structures, Acta Biomater, 6,
3169 (2010).
39. X Zhang, V Thomas, Y Xu, et al., An in vitro regenerated
functional human endothelium on a nanofibrous electrospun
scaffold, Biomaterials, 31, 4376 (2010).
40. W Mattanavee, O Suwantong, S Puthong, et al., Immobilization
of biomolecules on the surface of electrospun polycaprolactone
fibrous scaffolds for tissue engineering, ACS Appl Mater
Interfaces, 1, 1076 (2009).
41. FJ Xu, ZH Wang, WT Yang, Surface functionalization of
polycaprolactone films via surface-initiated atom transfer
radical polymerization for covalently coupling cell- adhesive
biomolecules, Biomaterials, 31, 3139(2010).
42. Y Usui, T Uematsu, T Uchihashi, et al., Inorganic
polyphosphate induces osteoblastic differentiation. J Dent Res,
89, 504 (2010).
43. S Balloni, EM Calvi, F Damiani, et al., Effects of titanium
surface roughness on mesenchymal stem cell commitment and
differentiation signaling, Int J Oral Maxillofac. Implants, 24,
627 (2009).
44. TS Silva, DC Machado, C Viezzer, et al., Effect of titanium
surface roughness on human bone marrow cell proliferation and
differentiation: an experimental study, Acta Cir Bras, 24, 200
(2009).
45. Z Lu, SI Roohani-Esfahni, G Wang, et al., Bone biomimetic
microenvironment induces osteogenic differentiation of adipose
tissue-derived mesenchymal stem cells, Nanomedicine, 8, 507
(2012).
46. MC Phipps, WC Clem, SA Catledge, et al., Mesenchymal stem
cell response to bone-mimetic electrospun matrices composed of
polycaprolactone, collagen I and nanoparticulate hydroxyapatite,
PLoS One, 6, e16813 (2011).
47. Z Lu, SI Roohani-Esfahni, PC Kwok, et al., Osteoblasts on rod
shaped hydroxyapatite nanoparticles incorporated PCL film
provide an optimal osteogenic niche for stem cell differentiation,
Tissue Eng Part A, 17, 1651 (2011).