The recombinational enhancer for DNA inversion functions

volume 17 Number 15 1989 Nucleic Acids Research

The recombinational enhancer for DNA inversion functions independent of its orientation as aconsequence of dyad symmetry in the Fis-DNA complex

Roland Kanaar*, Jochem P.van Hal and Pieter van de Putte

Laboratory of Molecular Genetics, Department of Biochemistry, Leiden University, 2333 AL Leiden,The Netherlands

Received May 8, 1989; Revised and Accepted July 11, 1989

ABSTRACTThe Escherichia coli Fis protein binds to specific DNA sequences whose base composition variesenormously. One known function of Fis is to stimulate site-specific DNA recombination. We usedthe Gin-mediated DNA inversion system of bacteriophage Mu to analyze Fis-DNA interaction. Efficientinversion requires an enhancer which consists of two Fis binding sites at a fixed distance from eachother. Using mutant enhancers in which one of the Fis binding sites is replaced we show that Fisbinds symmetrically to the DNA and we locate the center of symmetry. Furthermore, we show thatone of the Fis binding sites can be replaced by a Fis binding site that normally functions in a processother than site-specific recombination.

INTRODUCTIONFis (factor for inversion stimulation) is a 11.2 kD DNA binding protein encoded byEscherichia coli [1,2]. This basic heat-stable protein is abundant in exponentially growingcells [3]. Fis was first identified as an E. coli factor required for in vitro activity of thebacteriophage Mu Gin- and Salmonella typhimurium Hin DNA invertases [4,5]. Theseinvertases change the orientation of a segment of DNA by acting on two recombinationsites that border the DNA segment. Efficient recombination also depends on Fis and ad^-acting DNA element; the recombinational enhancer [6,7,8]. Footprinting and gelretardation analyses have shown that Fis interacts non-cooperatively with two sites on theenhancer [9]. Furthermore, it has been shown for the Hin system that the enhancer onlystimulates recombination when the spacing between the two Fis binding sites is 48 bp orincreased by an integer number of helical turns [10]. In the Hin system, but not in theGin system, E. coli non-specific DNA binding protein HU also stimulates recombination[4,5].

There are several other site-specific DNA inversion systems similar to those mentionedabove. They include the Cin system of phage PI [11] and the Pin system found in E.coli [12]. In all the systems the enhancer lies within the gene coding for the DNA invertaseas diagrammed for the Gin system in Figure 1. A role for Fis in phage lambda excisionhas also been determined [3]. In addition several other Fis binding sites with unknownfunction have been identified, for example in the phage Mu left attachment site [13, P.v.d.P.,pers. comm.; M. Chandler pers. comm.].

The Fis protein recognizes specific DNA sequences which exhibit no apparent consensussequence. Thus recognition of binding sites by Fis may depend in part on features of theDNA other than primary sequence. Ta characterize the properties of Fis-DNA interactionwe used an in vitro Gin recombination system. The DNA substrate contains two

© IRL Press 6043

Downloaded from https://academic.oup.com/nar/article-abstract/17/15/6043/1044554by gueston 12 April 2018

Nucleic Acids Research

invertible segment gin gene

gixR GinN GinC

Figure 1. Structure of the invertible G segment of phage Mu.A part of the right end of the genome of bacteriophage Mu is shown (not to scale). The invertible G segmentis bordered by two gu recombination sites (open arrows), oriented as inverted repeats. The two Fis bindingsites (hatched boxes) of the enhancer lie in the gene encoding the Gin recombinase. The sites are namedGinN(terminus) and GinC(terminus) according to their position closest to the start- and stopcodon of the gingene, respectively

recombination sites (gix) oriented as inverted repeats and an enhancer. By performingrecombination assays with versions of the substrate containing a mutated enhancer, twomodels for the functional geometry of the Fis-enhancer complex can be compared. Thesemodels have important implications for the geometry of the final synaptic complex in site-specific DNA inversion. In the first model, the Fis-enhancer complex has a direction, i.e.,it is asymmetric. The enhancer consists of two directly repeated Fis binding sites as depictedin Figure 2A (left side) based on a previously published consensus sequence (CAa/g-a—tGA-C) [9,10]. This enhancer can function in both orientations in site-specific DNAinversion if the Fis-enhancer complex interacts with only one of the recombination sites,for example, gixR. This presynaptic complex can subsequently interact with gixL to formthe final synaptic complex [ 14,15]. In the other orientation the enhancer can form the samepresynaptic complex by first interacting with gixh, because gixR and gixh are identicalbut inverted relative to each other. The capture of gixR will then complete synapsis. Inthe second model, the Fis-enhancer complex has two-fold rotational symmetry as depictedin Figure 2A (right side) or as depicted in Figure 2B. The symmetry of the Fis-enhancercomplex as depicted in Figure 2B is based on another recently published consensus sequence

4=-E55S3— —K«i((i H>tt»l—

B

BBSEB3

Figure 2. Models for geometry of the enhancer and mode of Fis binding.Fis protein is shown as triangles. The enhancer is depicted as a line with two hatched binding sites for Fis.

(A) Fis binds as monomer. The enhancer consist of either two directly Qeft side) or inversely (right side) repeatedFis binding sites. In both cases inverting one of the Fis sites will alter enhancer geometry and therefore abolishits function.

(B) Fis, shown as a dimer, binds symmetrically to its site. Inversion of a binding site has no effect on enhancergeometry.

6044



Plaamid pGP... Part of Enhancer Sequence Spacing (bp)

553 No Enhancer564 Gin Enhancer 48558 CTGCAGGTCGACTCTAGAGGA TCT -556 CTGCAGGTCGACTCTAGAGGATCCCCGCGCGTATCAACAAATGACCAGAACACAGA TCT 48559 CTGCAGGTCGACTCTAGAGGATCTGTGTTCtRRTCAtttRtTGAtacGCGCGGGGA TCT 48572 CTGCAGGTCGACTCTAGAGGATCTGTGTTCTGGTCATTTGTTGATACGCGCGACTCTAGAGGA TCT 55573 CTGCAGGTCGACTCTAGAGGATCTGTGTTCTGGTCATTTGTTGATACGCGCGACTCTAGCTAGAGGATCT 59590 CTGCAGGTCGACTCTAGAGGATCCCCACGCGTcaRCtgAAATGACCAGAACACAGA TCT 48591 CTGCAGGTCGACTCTAGAGGATCTGTGTTCTGGTCATTTcaRctgACGCGCGGGGA TCT 48577 CTGCAGCAGCTTGT AGTGCAAATTTTAaTCGACGGAGATC TCT 48581 CTGCAGCAGCTTGT AGTGCAAATTTTAaTCGACGGA TCT 44585 CTGCAGCAGCTTGT AGTGCAAATTTTAaTCGACGGATCCCCGGTC TCT 58584 CTGCAGCAGCTTGT AGTGCAAATTTTAaTCGACGGATCCCCGGGAATTTC TCT 53

Table 1. DNA substrates used in this study.Most substrates are derivatives of pGP556 which carries the Pin enhancer and two inverted repeated gix sites(see Figure 3). In the constructs carrying mutant enhancers the PinN site of pGP556 has been replaced by variousother (Fis binding) sites. The sequence of the Pstl-Bgin fragment containing the (replaced) PinN domain is shown.The remaining sequence of the these plasmids is identical, except for pGP553 and pGP564. pGP553 is a controlwithout an enhancer. pGP564 is a control carrying the Gin enhancer instead of the Pin enhancer. In most plasmidsthe BglU site has been lost. 'Spacing' indicates the distance in base pairs between the centers of symmetry ofthe N- and C- Fis binding sites of an enhancer. The Fis binding sites are underlined and mutations comparedto their respective controls are indicated in lower case. The one bp mutation in the MuAttL site is indicatedin lower case.

for Fis binding (G/T-YR-A/T-YR-C/A) [16]. In this case both orientations of theenhancer are functionally equivalent. Therefore, it will function independently of its modeof interaction with the gix sites. The enhancer could operate as described above.Alternatively, the symmetry element within the enhancer enables it to interact equivalentlyand simultaneously with both gix sites [17,18]. The results reported here rule out thepossibility that the enhancer has a direction. In contrast, we show that the enhancer issymmetric because the Fis-DNA complex itself has a two-fold axis of rotation. Furthermore,we locate the center of symmetry within the Fis-DNA complex.

MATERIALS AND METHODSEnzymesGin and Fis proteins were purified as described [17,19]. Enzymes used for recombinantDNA techniques were obtained from commercial sources.Bacterial strainsPlasmids were maintained in E. coli recA strains DH1 [20] or DH5a [GIBCO Ltd,Middlesex, UK]. Plasmids containing gix sites were isolated from strain PP2465 (recA56,pin, thi-209, Dpro-lacxlu, supE). Strain PP2465 was constructed as follows: A Thy"derivative of strain KMBL1154 (pin, thi-209, Dpro-lacxlu, supE)[our laboratory] wasselected as described [21]. A mating mixture of this strain with strain KA273 (Hfr, recA56,thr-\ 15, J7V-110) [our laboratory] was subsequently plated on glucose minimal platescontaining thiamine and proline. One of the UV-sensitive Thy+ exconjugants was namedPP2465.

6045



Din gene Rsai Bglll- H PinN I—l T PlnC

Haelll

+-

testinversionfrequency

B-BomHI P=PrtlE-EcoRI S-SmalH°H!ndIII

Figure 3. Construction of substrates.All mutant enhancer constructs are derived from pGP55O. It was constructed by cloning the Pin enhancer ofpGP301 into the Smal site of pUCl 19. Mutant enhancer constructs were obtained by replacing the PinN sitewith other Fis binding sites. A polylinker fragment was then exchanged for a fragment of pGP283 carrying twoinverted repeated gix sites. In the case of pGP550 this yielded pGP556. See Materials and Methods for details.

Recombination assayGin recombination reactions were performed at 37°C for 60 min and contained 6.7 /ig/mlDNA, 1.7 /ig/ml Gin, 0.3 ^g/ml Fis, 20 mM Tris-HCl (pH7.5), 10 mM MgCl2, 130 mMNaCl and 4% glycerol. Reactions were terminated by phenol/chloroform extraction ofthe DNA followed by ethanol precipitation. Recombination was assayed by digesting theDNA with £coRI and subsequent electrophoresis through 0.8% agarose gels. The extentof recombination was determined by scanning photographic negatives of the ethidiumbromide-stained gels using a laser densitometer. To analyze the kinetics of stimulationof recombination a large volume reaction was prepared excluding Gin protein. After 5min preincubation at 37 °C Gin was added and samples were removed at various time points.DNA substratesThe characteristic features of the DNA constructs used in this report are listed in Table1. The construction of the parental substrate is shown in Figure 3. Substrates for the Ginrecombination reaction were purified by banding in CsCl-ethidium bromide gradients andwere >99% in supercoiled form. The sequence of all mutant enhancers was verified bydirect plasmid sequencing [22]. The mutant enhancers were derived from pGP550 whichcarries the PinN Fis binding site on a 35-bp BamHl-BgKl fragment. In all substrates thedistance and the orientation of the C Fis binding site of the enhancer relative to recombinationsites is identical except for the substrate containing the Gin enhancer (pGP564). The plasmidswere constructed as follows:

pGP283: The BglU site of pGP281 [15,18] was cut, filled in, and a 8-bp Hindm linker,d(CAAGCTTG), was inserted.

pGP297: The 162-bp Dral fragment of pGP238(-) [19] containing the Gin enhancerwas inserted into the Hindi site of pUC9 [23] such that the GinN domain was closestto the pUC9 Pstl site.

pGP550: The 109-bp HaeUl-Rsal fragment of pGP301 [12] containing the Pin enhancerwas inserted into the Smal site of pUCl 19 [24] such that the PinN domain was closestto the pUCl 19 BamUl site.

6046



PinNGinNCinNHinN

PinCGinCCinCHinC

C l n l l l A G [ T A C C T T T T T T A A C j C l CCinlV G|G TlcfYlA A C T T C c |TlTfA C | GCinV G C C | G C A | T T T G C [ T G C|C A T

Figure 4. Comparison of Fis binding shes.The two-fold axis of rotation is indicated by vertical bars. Bases corresponding to base pairs in the duplex DNAinvariant under rotation are boxed. Binding sites were identified using footprint analysis [3,9,13, CM. van Drunenand P.v.d.P., unpublished results] with the exception of the Fis binding sites in Pin and Gin which are alignedbased on sequence similarity. A Fis binding site from a recombinational enhancer has suffix N(terminus) whenclosest to the start codon of the genei it is situated in or C(terminus) when closest to the stopcodon of the gene.In all recombinational enhancers the two-fold axes of rotation in the N- and C- Fis binding sites are separatedfrom each other by 48 bp.

pGP564: To convert the pUC9 vector of pGP560 (see below) to a pUCl 19 vector the0.7-kb Scal-Nari fragment of pGP560 was exchanged for the corresponding 1.2-kb fragmentof pUC119.

pUC119(pGP553), pGP297(pGP560), pGP550(pGP556), pGP561(pGP558),pGP562(pGP559), pGP567(pGP572), PGP568(pGP573), pGP574(pGP577),pGP580(pGP581), pGP582(pGP584), pGP583(pGP585), pGP588(pGP59O) andpGP589(pGP591): These plasmids were constructed using standard cloning techniques.For the construction of pGP588 and pGP589 oligonucleotides were used. Plasmids pGP574,pGP580, pGP582, pGP583 are derived from plasmid pGP690 [CM. van Drunen andP.v.d.P., unpublished results] which carries a Fis binding site, designated MuAttL, thatis situated in the left attachment site of phage Mu. pGP690 has a one bp mutation in theMuAttL site (indicated in lower case in Table 1). After inserting gix sites, by exchangingthe polylinker Hindm-Pstl fragment for the 2.2-kb Hindm-Pstl fragment of pGP283(-),these plasmids were renamed as indicated in parentheses. The relevant sequence of theseplasmids is shown in Table 1.

RESULTSComparison of all Fis binding sites known to date showed that the primary sequence ofthe sites varies tremendously (Figure 4). However, all sites have some dyad symmetry(boxed bases in Figure 4). Based on this symmetry a palindromic consensus sequence(G/T-YR~A/T~YR-C/A) has been proposed [16]. The following experiments, using

6047



Aa b c d M

Ba b c d M

Ca b c d e M

Da b c d M

Figure 5. Stimulation of recombination by mutant enhancer constructs.Various mutant enhancer constructs were assayed for their ability to stimulate recombination as detailed in Materialsand Methods. The resulting ethidium bromide-stained gels are shown. Recombinant bands are indicated by arrows.M is 350 ng of Lambda DNA digested with EcoRl and Hindlll. See Table 1 for a detailed description of themutant enhancers.

(A) Control experiments- a) pGP553, no enhancer; b) pGP564, Gin enhancer; c) pGP556, Pin enhancer; d)pGP558, Pin enhancer with deleted PinN site.

(B) Inversion of an enhancer domain: a) pGP556; b) pGP559, Pin enhancer with inverted PinN site; c) pGP572,similar to pGP559 except for a 7-bp insertion between the two Fis sites; d) pGP573, similar to pGP559 exceptfor a 11-bp insertion between the two Fis sites.

(C) Replacement of a Fis site from an enhancer: a) pGP556; b) pGP577, Pin enhancer with the PinN site replacedby the Fis binding site from the phage Mu left attachment site; c) pGP581, similar to pGP577 except for a 4-bpdeletion between the two Fis sites; d) pGP585, similar to pGP577 except for a 5-bp insertion between the twoFis sites; e) pGP584, similar to pGP577 except for a 10-bp insertion between the two Fis sites.(D) Mutations in a half-site of a Fis binding site: a) pGP556; b) pGP590, similar to pGP556 except for a 6-bp

Pvull mutation in the left half-site of a Fis binding site; c) pGP559; d) pGP591, similar to pGP559 except fora 6-bp PvuU mutation in the right half-site of a Fis binding site.

recombinational enhancers in which the geometry of the Fis-enhancer complex has beenspecifically altered, were designed to investigate whether the Fis-DNA complex itselfexhibits this two-fold rotational symmetry.The Pin enhancer can replace the Gin enhancerThe Gin-mediated DNA inversion reaction was used to assay the activity of various mutantenhancers. All these enhancers are derived from the Pin enhancer because of the presenceof a convenient restriction site between the two Fis binding sites. Therefore, the activityof the wild-type Pin enhancer was first compared to that of the wild-type Gin enhancer.The construction of the substrate carrying the Pin enhancer is depicted in Figure 3. ThePin enhancer is expected to be fully functional in the Gin system because the N sites ofboth enhancers are identical and the C sites differ only in three bp (Figure 4). PlasmidspGP556 and pGP564 containing the Pin and Gin enhancers, respectively, were incubatedwith Gin and Fis and assayed for recombination as detailed in Materials and Methods.Figure 5A (lanes b and c) shows that both substrates were recombined efficiently. Thekinetics of stimulation of recombination for both enhancers was analyzed. A small difference

6048



A = pGP577• = pGP564

= pGP556O = pGP559

40 80time (mm)

120

Figure 6. Kinetics of stimulation.The extent of recombination stimulated by various (mutant) enhancer constructs was compared at various timepoints as detailed in Materials and Methods. pGP564 carries the wild-type Gin enhancer. pGP556 carries thewild-type Pin enhancer. pGP559 is identical to pGP556 except for the orientation of the PinN site. pGP577 isidentical to pGP556 except the PinN site has been replaced by the MuAttL site.

in the rate of stimulation was found as is evident from Figure 6. After 60 min of incubationwith Gin and Fis the extent of recombination of the substrate carrying the Gin enhancerwas 42%, as compared to 39% for the substrate containing the Pin enhancer.

To construct mutant enhancers the PinN Fis binding site was manipulated. This siteis indeed essential for enhancer function as a construct (pGP558) carrying only the PinCFis binding site did not recombine (Figure 5A, lane d).The Fis-DNA complex has a two-fold axis of rotationTo determine if a Fis binding site exhibits two-fold rotational symmetry, we tested theactivity of an enhancer carrying one of its Fis binding sites in inverted orientation ascompared to the wild-type situation. A plasmid containing the wild-type Pin enhancer(pGP556) carries the PinN Fis binding site on a 35-bp BglH-BamHl fragment. PlasmidpGP559 is identical to pGP556 except for the orientation of this 35-bp fragment. As shownin Figure 5B (lanes a and b) both plasmids were recombined efficiently. Therefore, theFis-DNA complex is present in a functionally equivalent orientation on both plasmids,despite the fact that the PinN Fis binding site is oriented differently on the substrates. Thisresult clearly shows that the Fis-DNA complex exhibit dyad symmetry.

The center of this dyad can be determined from this result. Enhancers have to conformto a strict spatial relationship of the two Fis binding sites [10]. Because inverting the PinNFis binding site yielded a functional enhancer its center of symmetry must coincide withthe center of the inverted fragment. Therefore, the central base pair of the 35-bp fragmentcontaining the PinN site is a rotational center of symmetry for the Fis-DNA complex.This center of symmetry was predicted in Figure 4 and from results obtained by Hubner

6049



and Arber for the Cin enhancer [16]. Note that the PinN Fis binding sites of pGP559and pGP556 are identical at only 6 of 17 positions (Table 1). The kinetics of stimulationof recombination was analyzed for both enhancers. After 60 min 39% of pGP556 DNAand 30% of pGP559 DNA was converted to the recombinant form (Figure 6). Thestimulation of recombination by pGP559 is high, but lower than that of a wild-type enhancer.

We ruled out the possibility that a mutant enhancer containing an inverted PinN siteis active in recombination independent of the distance between its Fis binding sites. Twomutant enhancers with an altered spacing between their Fis binding sites were constructed.Plasmids pGP572 and pGP573 are identical to the plasmid with the inverted PinN site(pGP559), except the distance between the inverted PinN site and the PinC site has beenincreased by 7 bp or 11 bp, respectively. These constructs did not recombine, Figure 5B(lanes c and d), showing that the function of a mutant enhancer with an inverted PinNsite is indeed dependent on spacing of the Fis binding sites.The PinN site can be replaced by another Fis binding siteReplacement of the PinN site by another Fis binding site should result in an active enhancerprovided that the new mutant enhancer conforms to the stringent spatial requirements,i. e., the center of symmetry of the new Fis binding site should be located 48 bp fromthe center of symmetry in the PinC Fis binding site. Such a construct could be made becausewe had located the center of symmetry of Fis binding in the experiment described above.A Fis binding site not present on any of the known recombinational enhancers was used.In plasmid pGP577 the PinN site is replaced by a Fis binding site located in the leftattachment site of phage Mu. This site is named MuAttL and its role in the Mu life cyclehas not yet been determined [P.v.d.P., pers. comm.]. The center of the partial symmetryof the MuAttL Fis binding site is at wild-type spacing relative to the PinC site. This constructdid recombine, as is evident from Figure 5C (lane b). This mutant enhancer stimulatedrecombination even more efficient than its parent, the wild-type Pin enhancer (pGP556),as can be seen in Figure 6. The amount of recombinant product accummulated after 60min is 44%.

The mutant enhancer containing the MuAttL site has die same spatial requirements forfunction as the other recombinational enhancers. The constructs pGP581, pGP584 andpGP585 are identical to the construct containing the enhancer with the MuAttL site(pGP577), except they have a 4-bp deletion, a 5-bp or a 10-bp insertion between the MuAttLand PinC Fis binding sites. None of these constructs recombined, as can be seen in Figure5D (lanes c, d and e).Deletion of a half-site abolishes enhancer functionThe Fis binding site can be viewed as consisting of two half-sites centered around a pointof dyad symmetry. We tested whether destroying the dyad symmetry, i.e., deleting eitherone of these half-sites would result in an inactive enhancer. Two plasmids were constructedin which one half-site of a PinN Fis binding site was mutated into a PvuII site (Table1). This 6-bp mutation was chosen to minimize the primary sequence bias found for theFis binding sites and to minimize the dyad symmetry of the resulting mutant binding site.One of the mutant PinN-PvwII plasmids (pGP590) is derived from the wild-type Pin enhancerconstruct (pGP556), while the other (pGP591) is derived from the inverted PinN construct(pGP559). The enhancers on these plasmids are missing either the left or the right half-site of the PinN Fis binding site as compared to their controls but the spacing betweenthe centers of symmetry in the Fis binding sites has been preserved. As can be seen inFigure 5D (lanes b and d) deletion of either half-site completely abolished activity of theenhancers.

6050



DISCUSSIONFis is involved in a variety of biological reactions such as site-specific DNA inversion,phage lambda excision, and it presumably has other functions in E. coli. Examination ofall known Fis binding sites reveals no reasonable consensus sequence. There is not a singlebase conserved among all of the Fis binding sites shown in Figure 4. However, for a fewpositions bias towards certain bases can be found. A consensus sequence for a Fis bindingsite has been published [9,10]. This consensus sequence, however, was based only onFis binding sites that function in DNA inversion. These sites are all within the codingregion of the DNA invertases and therefore the sequence of these sites is constrained bythe requirement to produce a functional invertase. Recently another consensus sequence(G/T--YR-A/T-YR-C/A) has been proposed [16]. This consensus correctly describesthe bias for most base positions found in various Fis binding sites and also indicates thepartially palindromic nature of the site. The inability to compile a more defined consensussequence for Fis binding sites may reflect the mode by which Fis recognizes DNA. Fiscould recognize a structural property of DNA directed by the base composition or DNAsecondary structure, rather then the bases themselves. It could be that Fis recognizes itsbinding site by a mechanism similar to that used by the trp repressor. The trp repressorbinds to DNA mainly through protein-phosphate backbone interactions and not throughdirect contact with the bases [25]. Most of these interactions are provided by a helix-turn-helix motif of the repressor. The predicted amino acid sequence of Fis can accommodatesuch a helix-turn-helix structure [1,2].

In this report we characterize the binding of Fis to DNA by determining the geometryof the recombinational enhancer for site-specific DNA inversion. This enhancer consistsof two binding sites for Fis at a fixed distance from one another [10]. We assayed forfunctional Fis-DNA complexes by measuring the extent to which various mutant enhancersstimulate Gin-mediated DNA inversion. In the Introduction we described models forsynapsis in site-specific DNA inversion that differ in the geometry of the enhancers theyrequire (depicted in Figure 2). The different geometries of the enhancers dictate the modeof Fis binding. The asymmetric enhancer requires directly repeated Fis binding sites (Figure2A, left side), while the symmetric enhancer requires either inverted Fis binding sites (Figure2A, right side) or Fis binding sites with dyad symmetry (Figure 2B). By using the GinDNA inversion system it is possible to determine what the organization of the Fis bindingsites on the enhancer is. If an enhancer consists of two direct or inverted Fis binding sitesthen inverting one of them will change the geometry of the enhancer and cause its lossof function. On the other hand, if Fis binding sites have dyad symmetry, then invertingone of the binding sites around the center of symmetry will preserve the geometry of theenhancer and therefore its function.

Comparing the known Fis binding sites shows that a center of symmetry is present inall sites (Figure 4). We have shown that an enhancer carrying one of the Fis binding sitesinverted around this center of symmetry is still functional (Figure 5). This indicates thatthe Fis-DNA complex itself has dyad symmetry. As explained above this is the onlyarrangement of Fis binding sites in the enhancer that will still produce a functional enhancerafter one of the sites is inverted. It is unlikely that the Fis protein itself is symmetric,but symmetry can be provided by binding of an even number of monomers per bindingsite. Fis monomers could bind cooperatively to DNA or Fis could already exists as amultimer in solution and in the cell. Gel retardation analysis did not show the discretesteps of bands expected if Fis monomers would sequentially fill up the half-sites [9].Furthermore, Fis can be isolated as a dimer [4]. Collectively these data suggest that Fis

6051



binds to DNA as a symmetric dimer, which has also been suggested by Hiibner and Arber[16]. As expected, deleting either the left of the right half-site of a Fis binding site inan enhancer completely abolishes its functions (Figure 5D).

The analysis of Fis-DNA interaction presented in this report shows that therecombinational enhancer for site-specific DNA inversion is symmetric. This finding makesit unlikely that the enhancer first interacts with one gix site enabling this gix site to capturethe other, yielding an asymmetric synaptic complex [14,15]. Instead, these resultssubstantiate a model for synapsis that involves a symmetric synaptic intermediate [17].From detailed topological analyses it has become clear that in the final synaptic complexboth gix sites and the enhancer are intertwined around each other in a right-handed fashion.Intertwining of three sequences is most easily achieved at a branch point in supercoiledDNA [17,18]. The function of the enhancer could be to stabilize this branch point byinteracting simultaneously and equivalently with both gix sites. Additonal evidence forthe existence of these branched intermediates in Gin-mediated recombination has recentlybeen obtained by electron microscopy [15].

A Fis binding site of an enhancer can be replaced by a Fis binding site that normallyfunctions in a process other than site-specific recombination. Figure 5C shows that replacingthe PinN binding site by a Fis binding site (MuAttL) found in the left attachment site ofphage Mu yields an enhancer capable of stimulating recombination. The role of the MuAttLsite is not known, but this result suggests that Fis functions in both site-specific recombinationand in the Mu life cycle by the same mechanism. For example, it is known that the Fisprotein induces a bend in the DNA upon binding [10,26]. If bending is the critical functionsupplied by Fis then the angle by which the DNA is bent must be similar for the PinNand MuAttL sites because they both function in recombination in combination with thePinC site.

A number of observations remain unexplained. Figures 5B and 5C show that enhancerscontaining an inverted (pGP559) or a MuAttL (pGP577) Fis binding site must have thesesites at a specific distance from the other Fis binding site in order to function, as wasfound for the Hin enhancer. However, the Hin enhancer can still function after insertionsof an integral number of helical turns between the Fis binding sites [10]. Surprisingly,a 10-bp insertion in pGP577 and a 11-bp insertion in pGP559 resulted in inactive enhancersin the Gin system when tested both in vitro (Figure 5B and 5C) and in vivo (data not shown).It is known that the specific base sequence between the two Fis binding sites of an enhancerinfluences its activity [10]. Furthermore, recent experiments showed that helix insertionswill only yield a functional Cin enhancer when they are able to adopt a certain bentconformation upon Fis binding [26]. These findings could also account for the observationthat the plasmid carrying an enhancer with an inverted PinN domain (pGP559) recombinedat about 75% of the level of the wild-type Pin enhancer (pGP556) (Figure 6). DNAsequences between and around the Fis binding sites could effect the structure of the Fisbinding sites themselves. As we expect that DNA secondary structure is important forFis binding it is perhaps not surprising that alteration in surrounding sequences affectfunction.

The basis for the orientation independence of recombinational enhancers has now beenestablished. The enhancer consists of two Fis binding sites that display dyad symmetry.The axes of symmetry are separated from each other by exactly 48 bp. The symmetryof the enhancer allows it to function in both orientations independent of its mode ofinteraction with the recombination sites.

6052



ACKNOWLEDGMENTSPlasmid pGP690 was kindly provided by C M . van Drunen. We thank Claire Wymanand Chris Boles for critical comments on the manuscript.

•Present address: Department of Molecular Biology. University of California. Berkeley. CA 94720. USA

REFERENCES1. Johnson, R.C., Ball, C.A., Pfeffer, D. and Simon, M.I. (1988) Proc. Natl. Acad. Sci. USA 85, 3484-3488.2. Koch, C , Vandekerckhove, J. and Kahmann, R. (1988) Proc. Natl. Acad. Sci. USA 85, 4237-4241.3. Thompson, J.F., Moitoso de Vargas, L., Koch, C , Kahmann, R. and Landy, A. (1987) Cell 50, 901 -9084. Koch, C. and Kahmann, R. (1986) J. Biol. Chem. 261, 15673-15678.5. Johnson, R.C., Bruist, M.F. and Simon, M.I. (1986) Cell 46, 531-539.6. Kahmann, R., Rudt, F., Koch, C. and Mertens, G. (1985) Cell 41, 771-780.7. Johnson, R.C. and Simon, M.I. (1985) Cell 41, 781-791.8. Huber, H.E., Iida, S., Arber. W. and Bickle, T. (1985) Proc. Natl. Acad. Sci. USA 82, 3776-3780.9. Bruist, M.F., Glasgow, A.C., Johnson, R.C. and Simon, M.I. (1987) Genes & Development 1, 762-772.

10. Johnson, R.C, Glasgow, A.C. and Simon, M.I. (1987) Nature 329, 462-463.11. Iida, S., Meyer, J., Kennedy, K.E. and Arber, W. (1982) EMBO J. 1, 1445-1453.12. Van de Putte, P., Plasterk, R.H.A. and Kuijpers, A. (1984) J. Bactenol. 158, 517-522.13. Haffler, P. and Bickle, T.A. (1987) J. Mol. Biol. 198, 579-587.14. Kanaar, R. and Van de Putte, P. (1987) BioEssays 7, 195-200.15. Kanaar, R. (1988) Ph.D. thesis, Leiden University, The Netherlands.16. Hubner, P. and Arber, W. (1989) EMBO J. 8, 577-585.17. Kanaar, R., Van de Putte, P. and Cozzarelli, N.R. (1988) Proc. Natl. Acad. Sci. USA 85, 752-756.18. Kanaar, R., Van de Putte, P. and Cozzarelli, N.R. (1989) Cell, in press.19. Kanaar, R., Van de Putte, P. and Cozzarelli, N.R. (1986) Biochim. Biophys. Ada 866, 170-177.20. Hanahan, D. (1983) J. Mol. Biol. 156, 557-580.21. Miller, J.H., (1972), Experiments in Genetics, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York.22. Zhang, H., Scholl, R., Browse, J. and Somerville, C. (1988) Nucleic Acids Res. 15, 1220-1220.23. Vieira, J. and Messing, J. (1982) Gene 19, 259-268.24. Vieira, J and Messing, J. (1987) Meth. Enzymol. 153, 3 - 1 1 .25. Otwinowski, Z., Schevitz, R.W., Zhang, R.G., Lawson, C.L., Joachimiak, A., Marmorstein, R.Q., Luisi,

B.F. and Sigler, P.B. (1988) Nature 335, 321-329.26. Hubner, P., Haffter, P., Iida, S. and Arber, W. (1989) J. Mol. Biol. 205, 493-500.

This article, submitted on disc, has been automaticallyconverted into this typeset format by the publisher.

6053


Documents

The recombinational enhancer for DNA inversion functions