Breast Cancer Research and Treatment58: 87–97, 1999.© 1999Kluwer Academic Publishers. Printed in the Netherlands.

Report

The pure antiestrogen ICI 182780 is more effective in the induction ofapoptosis and down regulation of BCL-2 than tamoxifen in MCF-7 cells

Patrick Diel, Kai Smolnikar, and Horst MichnaDepartment of Morphology and Tumor Research, DSHS Cologne, Cologne, Germany

Key words:antiestrogens, apoptosis, BCL-2, breast cancer, MCF-7, tamoxifen, ZM 182780

Summary

There is increasing evidence that induction of apoptosis by antihormones is an important mechanism in regard totheir growth inhibitory action on hormone dependent tumors. In this report we have compared the efficiency oftamoxifen (Tam) and the pure antiestrogen ICI 182780 (ZM) to induce apoptosis in the estrogen dependent breastcancer cell line MCF-7. Clear evidence for induction of apoptosis could be demonstrated after treatment withboth antiestrogens. Application of the pure antiestrogen ZM led to a significantly higher induction of apoptosiscompared to the partial agonistic compound Tam. The ability of the two compounds to induce apoptosis correlatedwith their growth inhibitory action. On the molecular level administration of ZM led to a time dependent steadydecrease of BCL-2 mRNA and protein. Administration of Tam also initially decreased the expression of BCL-2.In contrast to ZM treatment, BCL-2 expression increased again after 8 h of incubation with Tam. After 96 h Tamtreated cells expressed BCL-2 levels nearly as high as untreated cells. In general, ZM decreased BCL-2 levels moreeffectively than Tam. Our results demonstrate that ZM and Tam possess quantitative and qualitative differences intheir ability to down regulate BCL-2 expression. The higher ability of the pure antiestrogen to down regulate BCL-2 expression may explain the superiority of the pure antiestrogen to induce apoptosis and to inhibit the growth ofMCF-7 cells.

Introduction

Tamoxifen (Tam), a nonsteroidal antiestrogen, hasbeen used as a treatment for breast cancer for a quarterof a century [1, 2]. A general issue using Tam as endo-crine therapy is the fact that during long term treatmentdrug resistance may occur [3, 4] and that the com-pound bears the risk to produce second malignancies[5]. Specifically, Tam is associated with an increaseddetection of endometrial cancer [6]. It is believed thatone of the main reasons for these disadvantages isbased on the fact that this compound has beside its ant-agonistic also agonistic properties [7]. For this reasona new class of pure antiestrogens was developed in themid of the 1980s [8]. The compound ICI 182780 (ZM)is under development for the treatment of advancedbreast cancer after failure of long-term adjuvant Tamtherapy. ZM is a 7α-alkylsulfinyl-analogue of estra-diol without any agonistic properties [8] and is a more

effective estradiol antagonist than Tam. It is able tosuppress tumor growth in animal models twice as longas the partial agonist Tam [9]. Although both antiestro-gens are able to reduce cell proliferation [10], the pureantagonist ZM is more effective than Tam [10, 11].There is an increasing evidence that the induction ofapoptosis by antihormones is an important mechanismin regard to their growth inhibitory action on hormonedependent tumors [12].

Apoptosis is a process that regulates cell number oreliminates damaged cells, and that differs morpholo-gically and biochemically from cellular necrosis [13].This active process is characterised by condensation ofnuclear chromatin, compaction of cytoplasmic organ-elles, reduction of cell volume, and internucleosomalDNA-fragmentation with eventual splitting of the cellinto a series of membrane fragments that subsequentlyundergo phagocytosis. These events are induced andmediated by a number of apoptosis associated genes.

88 P Diel et al.

An important class of molecules that plays a role inregulating the rate of apoptosis is the BCL-2 family ofcytoplasmic proteins. The ability of BCL-2 to suppressapoptosis is well documented [14]. Overproductionof BCL-2 protein resulted in a blockade of apoptosisand increased survival upon death stimuli [15]. Clin-ical studies showed a relationship between estrogenreceptor expression and BCL-2 protein level [16, 17].In MCF-7 cells a clear effect of estrogens on apoptoticpathways could be demonstrated. BCL-2 protein andmRNA is significantly increased in MCF-7 cells afterestradiol administration [18].

In this report we analyse if the higher efficacyof the new class of pure antiestrogens to inhibit thegrowth of MCF-7 cells is associated with a higher abil-ity to induce apoptosis. Therefore, a comparison of thedose dependent effects of Tam and ZM on the growthof MCF-7 cells will be correlated with the ability toinduce apoptosis in MCF-7 cells as well with changesin the cell cycle distribution. It will be demonstratedby use of the tunel method, electron microscopy, andcell cycle analysis that there is a clear correlationbetween the growth inhibitory action of ZM and Tamand the ability of the compounds to induce apoptosis.On the molecular level, we have analysed the expres-sion of members of the BCL-2 family on the mRNAand protein level in MCF-7 cells after administrationof Tam and ZM. ZM and Tam possess quantitative andqualitative differences in their ability to down regu-late BCL-2 expression. The higher efficacy of the pureantiestrogen to down regulate BCL-2 expression mayexplain the superiority of the pure antiestrogen to in-duce apoptosis and to inhibit the growth of MCF-7cells.

Materials and methods

Drugs

17β estradiol (E2) was purchased from Sigma Chem-ical Company (St. Louis, MO). The antiestrogens Tamand ICI 182780 (ZM) were kindly provided by Dr.K. Parczyk, Research Laboratories of Schering AG,Berlin, Germany.

Cell culture

MCF-7 cells were kindly provided by Dr. K. Par-czyk of Research Laboratories, Schering AG, Berlin,Germany. MCF-7 cells were routinely cultured in

Medium A (phenol red-free RPMI 1640 with 2 mM L-glutamine, 1.5 ng/ml insulin, 100 units/ml penicillin,and 100µg/ml streptomycin) with 10% fetal bovineserum in 75-cm2 flasks (Falcon, Lincoln Park, NJ)and grown in the presence of 5% CO2 in air at 37◦C.One week before initiation of experiments, cells wereswitched to medium A supplemented with 10% char-coal dextran-treated fetal bovine serum (FBS). Cellswere grown to confluence and passaged with the use oftrypsin EDTA. Steroids and antihormones were addedfrom a 10,000 fold concentrated stock solution in eth-anol. Final ethanol concentration in the medium wasless than 0.1%.

Cell proliferation studies

Cell number was determined by the MTT assay. MTT(thiasolyl blue) is converted from a yellow-colouredsalt to a purple-coloured formazan by cleavage ofthe tetrazolium ring by mitochondrial dehydrogenases,the activity of which is linear to the cell number. Cellswere seeded at 2000–5000 cells per well in 96-wellplates. After treatment as indicated, 50µl of 2 mg/mlMTT was added and plates were incubated at 37◦C for4 h. Wells were drained and formazan crystals weresolubilized in 150µl buffer (20% w/v sodium dodecylsulfate dissolved in 50% dimethylformamide / 50%dH2O containing 2.5% of 1 N HCl with a final pHof 4.7). Absorbance at 570 nm (reference 620 nm) wasdetermined on a Molecular Device vmax plate reader.

Electron microscopy

Breast cancer cells treated with TAM and ZM and un-treated cells were recovered from cultures and fixed in2% paraformaldehyde and 2.5% glutaraldehyde. Thefixed cells were embedded in polybed 812 and sec-tioned and observed in a Zeiss transmission electronmicroscope (Zeiss EM 10, Jena, Germany). Details ofthe procedure are described by Michna et al. [19].

Analysis of apoptosis using the tunel method andfluorescence microscopy

Cells were cultured for five days on microscope slidesin the presence of the respective antihormones and es-tradiol (10−10M). After fixation, tunel reaction wasperformed using theIn Situ Cell Death DetectionKit (Boehringer Mannheim). Apoptotic cells weredetected using fluorescence microscopy.

Apoptosis induction by antiestrogens 89

Cell cycle analysis

Cell cycle distribution was measured using flow cyto-metry. The cell pellet (1× 106 cells) was suspendedin 1 ml of fluorochrome solution (50 mg/ml propidiumiodide, 0.1% sodium citrate, 0.1% Triton X-100).Samples were plated overnight in the dark at 4◦Cand fluorescence of individual nuclei was measuredusing an EPICS flow cytometer (Coulter Electronics,Miami, USA). Data were analysed using the Coulterflow cytometric software.

RNA isolation and complementary DNA synthesis

Total cytoplasmic RNA was extracted from thecells according to the guanidiniumthiocyanate-CsClmethod described by Sambook et al. [20]. DNA-freeRNA was obtained by treatment with ribonuclease-free deoxyribonuclease I in the presence of pla-cental ribonuclease inhibitor for 30 min at 37◦C. Afterphenol–chloroform extraction and ethanol precipi-tation, RT’s were performed using the SuperScriptpreamplification System (Life Technologies, Gaithers-burg, MD).

Oligonucleotide primers for PCR reactions

Based on the cDNA sequences available at theEMBL databank, the following specific primer pairswere designed: BCL-2 sense primer, 5′-ACTT-GTGGCCCAGATAGGCACCCAG-3′, BCL-2 anti-sense primer 5′-CGACTTCGCCGAGATGTCCAG-CCAG-3′; Bax sense primer 5′-AAGAAGCTGAG-CGAGTGTCTC-3′, Bax antisense primer 5′-TGTCC-AGCCCATGATGGTTCT-3′; cytochrome c oxidasesubunit I sense primer, 5′-CGTCACAGCCCATGCA-TTCG-3′, antisense primer, 5′-CTGTTCATCCT-GTTCCAGCTC-3; progesterone receptor sense primer5′-CATGTCAGTGGACAGATGCT-3′, antisenseprimer 5′ ACTTCAGACATCATTTCCGG 3′; es-trogen receptor sense primer 5′-GCAGACAGGGA-GCTGGTTCA-3′, antisense primer 5′AGAGATG-CTCCATGCCTTTG-3′. Cytochrome c oxidase sub-unit I (1A) was used as reference gene. Primers weresynthesised by Roth (Karlsruhe, Germany). PCR-products were sequenced to verify their identity andhomology to corresponding cDNA sequences in theEMBL databank.

Semiquantitative PCR

Semiquantitative PCR was performed according to themethod described by Murphy et al. [21] and modi-fied by Knauthe et al. [22]. To normalise signalsfrom different RNA samples cytochrome c oxidasesubunit I (1A) was coamplified as internal stand-ard. The suitability of lA as reference gene, espe-cially in estrogen sensitive tissues, has been demon-strated in former publications [22]. Amplification re-actions were stopped before leaving the exponentialphase. Amplification was performed using a Perkin-Elmer/Cetus 9600 thermal cycler (Norwalk, CT).Thermus flavus polymerase (0.5 U; Biozym, Hess.Oldendorf, Germany); dNTPs (ATP, GTP, CTP andTTP, 200µmol/l each); and the respective oligonuc-leotide primers (500 ng each) were added to an amountof first strand cDNA equivalent to 200 ng total RNA.The reaction volume was adjusted to 50µl using1× PCR buffer (50 mM Tris–HCl (pH 9.0), 20 mM(NH4)2SO4 and 2.5 mM MgCl2). Amplification cyclescomprised a 1-min step at 94◦C for denaturation, a 1-min step at 58◦C for annealing, and a 1-min step at72◦C for elongation. Reaction products were separ-ated on 1× Tris borate EDTA-6% polyacrylamide gelsand detected by ethidium bromide staining.

Western blot analysis

The expression of BCL-2 was determined by western-blot analysis. A mouse monoclonal antibody to humanBCL-2 was used (type # 124, DAKO, Carpintera, CA).Briefly, proteins were extracted from cells with ex-tracting buffer containing: 150 mM NaCl, 10 mM Tris,pH 7.4, 5 mM EDTA, 1% Triton X-100, 1 mM PMSF,1µg/ml Leupeptin. Appropriate protein amounts weresubjected to sodium dodecyl sulfate-polyacrylamideelectrophoresis (12% gel). After electrophoresis pro-teins were transfered to nitro-cellulose sheets. Theblots were blocked in TBST buffer with 5% non-fat dry milk (TBST-buffer: 20 mM Trisbase, 150 mMNaCl, 0.05% Tween 20) for 1 h at room temperature.After 3 h of incubation with the designated primaryantibody and 1 h incubation with the second anti-body, immune complexes were detected with the en-hanced chemiluminescence detection method (Amer-sham, UK) and then exposed to Hyperfilm ECL(Amersham, UK).

90 P Diel et al.

Results

Effect of Tam and ZM on growth of MCF-7 and T47 Dbreast cancer cells

To investigate the growth inhibitory potency of thepure antiestrogen ZM182780 (ZM) and Tamoxifen(Tam), MCF-7 cells were seeded at a concentrationof 1500 cells per well (MCF-7 cells) in a 96 wellmicrotiter plate and cultured for two days in RPMI1640 medium with 10% charcol treated FCS in thepresence of 10−10M E2. After two days the cells wereswitched to RPMI 1640 medium with 10% charcoaltreated FCS, 10−10M E2, and the respective concen-trations of Tam and ZM (10−9–10−6 M). Cells werecultured for five days in the presence of antihormones.A control group of MCF-7 cells was cultivated in theabsence of estradiol and antihormones.

Figure 1A shows the dose response curves of thegrowth inhibitory action of ZM and Tam on MCF-7 cells. The growth inhibitory potency of the pureantiestrogen ZM was at all concentrations higher thanthe growth inhibitory potency of Tam. At concentra-tions in the range of 10−6–10−7 M Tam was able toreduce the growth of MCF-7 cells to a level which isreached by a withdrawal of E2. A strong growth inhib-

Figure 1. Effects of Tam and ZM on the proliferation of MCF-7and T47 D cells. Cells were cultured for 5 days in RPMI 1640medium containing charcoal-dextran stripped FBS10%, E2, and therespective concentrations of the antiestrogens Tam and ZM. (A)Dose dependent growth inhibition of MCF-7 cells by Tam and ZM.(B) Growth inhibitory effects of 10−7 M Tam and ZM on MCF-7and T47 D cells. A 100% growth is equivalent to an increase inthe cell number from 1,500 to 18,000 cells per well after 7 dayscultivation.

itory effect of Tam was observed at a concentrationof 10−5 M. Interestingly, the pure antiestrogen ZMreduces the growth of MCF-7 cells at concentrationsstarting at 10−9 M more intensively than the withdrawlof E2.

To investigate the growth inhibitory potency ofTam and ZM in different types of hormone dependentbreast cancer cells, MCF-7 cells and T47 D cells wereseeded at concentrations of 1500 cells per well (MCF-7 cells) or 2000 cells per well (T47 D) in a 96 wellmicrotiter plate and cultured as described above in thepresence of 10−7 M Tam per 10−10M E2 or 10−7 MZN per 10−10 M E2. Figure 1B shows that in both celllines the growth inhibitory potency of ZM was super-ior to the potency of Tam. The pure antiestrogen ZMreduces the growth of both T47 D and MCF-7 cellsmore intensively than the withdrawal of estradiol.

Effect of Tam and ZM on the morphology of MCF-7breast cancer cells

To study if the observed growth inhibitory action ofthe antiestrogens is due to apoptosis, the morphologicchanges in MCF-7 breast cancer cells were investig-ated after treatment with ZM and Tam using electronmicroscopy. 400,000 cells were seeded in 2.5 cm petridishes on tissue tek coated cover glasses and cul-tured for 5 days in the presence of 10−10M E2 and10−7 M of the respective antihormones. In the anti-estrogen treated MCF-7 cells, shrinking of total cellvolume, compaction of cytoplasmic organelles, dilata-tion and vacuolization of the endoplasmatic reticulumcould be observed (Figure 2C, D). These morphologicchanges are consistent with the appearance of apop-tosis. Compared to untreated cells (Figure 2A) ZMtreated MCF-7 cells exhibited chromatin condensationat the nuclear periphery and a reduction in nuclearsize (Figure 2D). Almost 90% of the analysed nucleidemonstrated this typical feature of apoptosis. In Tamtreated MCF-7 cells also some nuclei showed signsof apoptosis like condensation and fragmentation ofchromatin, similar to the pattern observed after ZMtreatment (Figure 2C). Nevertheless, the large majorityof Tam treated cells reacted only with a faint con-densation of chromatin. The size of the mitochondriaseemed to be enhanced and they were frequently loc-ated near the nuclear envelope (Figure 2B). Comparedto ZM treated cells the overall amount of apoptoticnuclei was lower, in the range of 10–15% of allanalysed nuclei.

Apoptosis induction by antiestrogens 91

Figure 2. Electron microscopic analysis of MCF-7 cells after treatment with Tam and ZM. Cells were cultured for 5 days in RPMI 1640medium containing charcoal-dextran stripped FBS 10%, estradiol (10−10 M), and the respective concentrations of the antiestrogens Tam andZM (10−7 M). Cells representing the typical morphologic features of the cell population are shown. (A) 10−10 M estradiol. (B) 10−7 M Tamand 10−10 M estradiol. Note: the enlarged mitochondria localised near the nuclear envelope. (C) 10−7 M Tam and 10−10 M estradiol. Note:heterochromatin condensation. (D) 10−7 M ZM and 10−10 M estradiol. Note: heterochromatin condensation and vacuolisation.

Effect of Tam and ZM on apoptosis induction inMCF-7 cells

To investigate and quantify growth inhibitory andapoptotic events in MCF-7 and T47 D cells after treat-ment with Tam and ZM, a cell cycle analysis was per-formed. Cells were cultured for 5 days in the presenceof 10−10M E2 and 10−7 M of the respective antihor-mones. After propidium iodide staining of the DNA aflow cytometric analysis was performed. In Table 1 thecell cycle distribution of Tam and ZM treated MCF-7 cells is shown in comparison to nontreated cells.The ability of both antiestrogens to reduce the growth

Table 1. Effects of Tam and ZM on the population distri-bution of MCF-7 cells

Percentage of cells

Treatment Sub G0 G0/G1 S+G2+M

E2 3.5± 0.7 60.7± 1.9 35.8± 1.2

Tam 8.6± 0.4 66.8± 4.5 24.7± 4.2

ZM 16.1± 0.8 64.0± 3.3 19.9± 2.9

The results of three independent experiments are shown asmean±SD.

92 P Diel et al.

Figure 3. Analysis of apoptosis induction in MCF-7 cells after treatment with Tam and ZM. Cells were cultured for 5 days in RPMI 1640medium containing charcoal-dextran stripped FBS10%, estradiol (10−10 M), and the respective concentration of the antiestrogens Tam and ZM(10−7 M). (A) Analysis of cell cycle distribution and apoptosis induction (sub-G1 Population) by propidium iodide staining and flow cytometry.(B) Analysis of tunel staining by fluorescence microscopy. The results are representative of three experiments.

of MCF-7 cells is demonstrated in the reduction ofthe fraction of cells in the S+ G+ M phase. It isobvious that ZM has a higher ability to suppress thecell proliferation of MCF-7 cells than Tam. Cells withlower DNA content than that of G1 cells have beenconsidered to be apoptotic. Figure 3A shows a clearincrease of the Sub-G1 population in Tam and ZMtreated cells. The increase of the Sub-G1 populationin ZM treated cells is higher compared to Tam treatedcells (Table 1).

Since the flow cytometric analysis of apoptosisdoes not differentiate apoptotic cells from dead cells,we have performed a further method to measure ap-optosis. Therefore, MCF-7 cells were cultured in thepresence of 10−10M E2 and 10−7 M of the respect-ive antihormones on cell tek coated microscope slidesfor 5 days. Tunel reaction was performed and thecells were analysed using fluorescence microscopy.As shown in Figure 3B, fluorescence staining was vis-ible in the nucleus of Tam and ZM treated MCF-7

cells in contrast to nontreated cells, indicating DNA-fragmentation as the result of apoptosis. In keepingwith the data of the cell cycle analysis, the stainingwas more intensive in ZM treated MCF-7 cells. Sim-ilar results were obtained in ZM and Tam treated T47D cells (data not shown).

Effect of Tam and ZM on BCL-2 and Bax expressionof MCF-7 cells

To investigate if the ability of the antiestrogens ZMand Tam to induce apoptosis in MCF-7 cells correl-ates with alterations in the expression of key genesregulating apoptosis, the expression of members ofthe BCL-2 protein family in MCF-7 cells was studied.MCF-7 cells were cultured for 5 days in the presenceof 10−10 M E2 and 10−7 M of the respective antihor-mones. RNA was isolated and the mRNA expressionof the cell death inhibitory protein BCL-2 and thecell death promoting protein Bax was analysed us-

Apoptosis induction by antiestrogens 93

Figure 4. Analysis of BCL-2 and Bax expression of MCF-7 cellsafter treatment with Tam and ZM. Cells were cultured for 5 daysin RPMI 1640 medium containing charcoal-dextran stripped FBS10%, estradiol (10−10 M), and the respective concentration of theantiestrogens Tam and ZM (10−7 M). (A) Semiquantitative PCRanalysis of Bax and BCL-2 mRNA expression. (B) Western ana-lysis of BCL-2 expression. The results are representative of threeexperiments.

ing semiquantitative RT-PCR. As an internal referencefor the action of the antiestrogens the expression ofthe progesterone receptor and the estrogen insensit-ive gene cytochrome C oxidase was also investigated.As shown in Figure 4A, a decrease in BCL-2 mRNAexpression occurred after 96 h incubation in the pres-ence of ZM. In contrast, no effect on BCL-2 mRNAexpression could be observed in Tam treated cells.The mRNA-expression of Bax was unaffected in Tamtreated cells, whereas a slight increase could be ob-served in ZM treated cells. The mRNA expression ofthe PR was dramatically decreased after 96 h incub-ation in the presence of ZM, whereas only a slightdecrease could be detected after administration ofTam.

To investigate if the observed regulatory effect onBCL-2 mRNA expression correlates with BCL-2 pro-tein level, MCF-7 cells were cultured for 5 days inthe presence of 10−10M E2 and 10−7 M of the respect-ive antihormones. Protein extracts were prepared anda western blot analysis was performed. As shown inFigure 4B, after administration of ZM a clear decreaseof BCL-2 protein was observed. After administrationof Tam no alteration in the BCL-2 protein expressionwas detected.

Time dependent effects of Tam and ZM on theregulation of BCL-2 mRNA

The ability of Tam and ZM to down regulate BCL-2expression was determined at different times after ad-ministration of Tam and ZM to analyse if the observedcompound specific differences are associated with dif-ferent kinetics of action. MCF-7 cells were culturedin the presence of 10−10 M E2 and 10−7 M of the re-spective antihormones. After 3, 8, 24, 48, and 96 hcells were lysed and RNA was extracted. The mRNAexpression of BCL-2, Bax, PR, ER, and cytochrome-C-oxidase [14] was determined using semiquantitativeRT-PCR. As shown in Figure 5A and 5B a dramatictime dependent decrease of BCL-2 and PR mRNAexpression could be observed after administration ofZM. A small increase of Bax mRNA expression couldbe observed. After administration of Tam, in thefirst 8 h a strong decrease of BCL-2 (in the range of25%) and PR mRNA (in the range of 40%) couldbe observed. Interestingly, in contrast to ZM treatedcells, the mRNA expression of BCL-2 and PR in-creased again. After 96 h incubation about 80% of thePR mRNA expression level and 50% of the BCL-2mRNA expression level of untreated cells was reachedagain. Bax mRNA expression remained unaffected.The mRNA expression of the estrogen receptor (ER)remains unaffected after administration of Tam andZM.

Discussion

In the present report we could demonstrate a correla-tion between the growth inhibitory potency of the pureantiestrogen ZM, the partial agonist Tam, and the abil-ity of these compounds to induce apoptosis in MCF-7and T47 D cells. As shown in Figure 1, ZM is moreeffective in inhibiting the growth of MCF-7 cells thanTam. Whereas Tam is able to reduce the growth ofMCF-7 cells and T47 D cells to a level which is alsoreached by the withdrawal of E2, the pure antiestrogenZM reduces the growth of MCF-7 cells more effect-ively than the withdrawal of E2 alone. The inductionof apoptosis in MCF-7 cells by E2 withdrawal [23,24] and administration of antiestrogens [12, 23] hasalready been described. Hence, our data provide evid-ence that the superior growth inhibitory action of ZMis caused by its ability to induce apoptosis in MCF-7and T47 D cells.

An electron microscopic analysis of the morpho-logy of MCF-7 cells after the application of Tam and

94 P Diel et al.

Figure 5. Time dependent analysis of Bax, PR, ER, and BCL-2 mRNA expression. Cells were cultured in RPMI 1640 medium containingcharcoal-dextran stripped FBS 10%, estradiol (10−10 M), and the respective concentration of the antiestrogens Tam and ZM (10−7 M). TotalRNA was isolated at the indicated time of incubation. Bax, PR, and BCL-2 mRNA expression was analysed by semiquantitative PCR asdescribed in Materials and methods using cytochrome C oxidase as reference gene. (A) Representative mRNA expression patterns. (B) Amountsof PR and BCL-2 mRNA. The amount of PCR products was determined by densitometric analysis. For the analysis of each time point mRNAof three independent experiments was pooled. cDNA synthesis and semiquantitative PCR analysis was performed independently four times.The results are shown as mean±SD. The mRNA expression att = 0 was defined as 1.

Apoptosis induction by antiestrogens 95

ZM in concentrations of 10–7 M revealed typical mor-phologic changes which are associated with apoptosis.Nevertheless, there are compound specific differences:whereas ZM treated MCF-7 cells revealed typical mor-phologic reactions which are characteristic features ofapoptosis (Figure 2D), the nuclei of Tam treated cellsdisplayed a variety of alterations (Figure 2B, C). Thisis in good agreement with recent reports which havedemonstrated that in Tam treated MCF-7 cells, sev-eral pathways leading to active cell death may co-exist[25]. In general, the percentage of nuclei undergoingapoptosis was higher in ZM treated cells. This find-ing could be confirmed by our quantitative analysis ofapoptosis in MCF-7 cells using flow cytometry andfluorescence microscopy in combination with tunelstaining (Figure 3A, B). The higher ability of ZM toinduce apoptosis could also be demonstrated in T47 Dcells (data not shown).

In summary, these findings provide evidence thatthe ability of ZM to induce apoptosis in physiologicaldoses may explain its superior growth inhibitory ac-tion, both in animal models and in clinical studies.Nevertheless, there are controversial reports on theability of antiestrogens to induce apoptosis in MCF-7cells [12, 24, 26]. This issue may be based on the ex-istence of several phenotypic variants of MCF-7 cellswhich are all stimulated by E2 but may respond dif-ferently to hormone withdrawal [10]. Recently, in aclinical study a significantly higher apoptosis indexcould be observed in estrogen dependent breast can-cer after application of the pure antiestrogen ZM [27].This indicates that the MCF-7 stain and the cultureconditions used in our experiments may validly mimicthe clinical situation and may act as a useful tool toinvestigate the molecular mechanisms involved in theapoptosis induction of antiestrogens.

Finally, we have investigated the expression ofmembers of the BCL-2 gene family, BCL-2 whichis thought to protect against apoptosis [14, 15], andBax which may be involved in regulation of BCL-2 through heterodimer formation and is believed tobe death-promoting [28]. A low level of Bax expres-sion in malignant breast tissue and tumor cell linescould be correlated with resistance towards apoptosis[29]. In our studies we could demonstrate that theability of Tam and ZM to induce apoptosis in MCF-7 cells directly correlates with the ability to enhanceBax and to reduce BCL-2 expression. Although ithas not been demonstrated so far that the expres-sion of the BCL-2 gene is directly regulated by anestrogen responsive element, there is evidence that

BCL-2 expression in breast cancer cells is in correla-tion with ER status [16, 17, 30], raising the possibilitythat BCL-2 members may be important in regulatingof homeostasis in hormone responsive cell lines. Inour investigations we were able to demonstrate thatBCL-2 mRNA expression was decreased by estrogendeprivation, whereas Bax expression was unaffected(Figure 4A). These findings are in good agreementwith the observations of Wang and Phang [18]. Ad-ministration of the pure antiestrogen ZM was also ableto reduce the expression of BCL-2 protein and mRNAvery efficiently (Figure 4), but surprisingly only a faintreduction of BCL-2 could be observed after 96 h treat-ment of MCF-7 cells with Tam (Figure 4). The effectsof Tam on the regulation of BCL-2 are controver-sially discussed: In recent publications a stimulationof BCL-2 protein expression in MCF-7ras cells hasbeen described [31]. In contrast to these findings areduction of BCL-2 protein expression by Tam butalso by the antiestrogen RU58668 was described inMCF-7 cells [32]. Our time dependent analysis of themRNA expression of Bax and BCL-2 provide datawhich may explain these controversial findings. Wecould demonstrate that the pure antiestrogen ZM isable to reduce the BCL-2 mRNA level very efficientlyin a linear time dependent manner (Figure 5A, B). Thepartial agonist Tam was also able to reduce the mRNAlevel in the first 8 h very efficiently. In contrast after 8 ha rise of the BCL-2 mRNA levels could be observed(Figure 5A, B). These findings indicate that the twocompounds possess different kinetics in regard to theirability to suppress BCL-2 mRNA expression.

Recent reports described that the pure antiestrogenZM is able to reduce the amount of ER in antiestro-gen treated cells [33, 34]. In our own analysis wecould not see a downregulation of ER mRNA expres-sion (Figure 5a) after treatment with the antiestrogens.Therefore, it is likely that the observed reduction ofER is not caused by a downregulation of the ER genebut by a destabilisation of the ZM bound receptor.The effect of a ER reduction may be a good explan-ation to explain the different kinetics of Tam and ZMin regard to BCL-2 suppression. This is indicated bythe PR mRNA expression. The PR is a classical es-trogen dependent gene [35] and directly regulated byan estrogen responsive element [36]. In the first 8 hthere is an intensive decrease in PR mRNA expressionafter administration of Tam and ZM. This decrease iscaused by blocking the receptor. The different intens-ity of down regulation reflects the different potencyof the two compounds. After 8 h of ZM treatment

96 P Diel et al.

the decrease of PR mRNA continues, whereas no fur-ther decrease could be observed in Tam treated cells.This, in our opinion, may reflect the degradation ofthe ER receptor after administration of ZM. The factthat ZM may reduce the amount of ER whereas Tammay only block the receptor may explain the higherefficiency of ZM to reduce BCL-2 expression and toinduce apoptosis.

In conclusion, the results presented in this reportindicate that the superior growth inhibition of thepure antiestrogen is correlated with a higher abilityto induce apoptosis in MCF-7 cells. The inductionof apoptosis by ZM is associated with a dramaticdecrease of BCL-2 expression in MCF-7 cells. There-fore, the results may have wider implications in regardto the importance of apoptosis in development ofantihormone resistance in estrogen-responsive breastcancer.

Acknowledgements

We thank Dr. Karsten Parczyk for providing MCF-7cells and antiestrogens and M. Euler and M. Maskusfor their technical assistance during these studies.

References

1. Furr BJ, Jordan VC: The pharmacology and clinical uses oftamoxifen. Pharmacol Ther 25: 127–205, 1984

2. Jaiyesimi IA, Buzdar AU, Decker DA, Hortobagyi GN: Useof tamoxifen for breast cancer: twenty-eight years later. J ClinOncol 13: 513–529, 1995

3. Morrow M, Jordan VC: Molecular mechanisms of resistanceto tamoxifen therapy in breast cancer. Arch Surg 128: 1187–1191, 1993

4. Tonetti DA, Jordan VC: Possible mechanisms in the emer-gence of tamoxifenresistant breast cancer. Anticancer Drugs6: 498–507, 1995

5. Jordan VC, Morrow M: Should clinicians be concerned aboutthe carcinogenic potential of tamoxifen? Eur J Cancer 30A:1714–1721, 1994

6. Assikis VJ, Neven P, Jordan VC, Vergote I: A realistic clinicalperspective of tamoxifen and endometrial carcinogenesis. EurJ Cancer 32A: 1464–1476, 1996

7. Bilimoria MM, Assikis VJ, Jordan VC: Should adjuvanttamoxifen therapy be stopped at 5 Years? Cancer J Sci Am2: 140–150, 1996

8. Wakeling AE: A new approach to breast cancer therapy – totalestrogen ablation with pure antiestrogen. In: Jordan VC (ed)Long-Term Tamoxifen Treatment for Breast Cancer. MadisonW, University of Wisconsin, 1994, pp 219–234

9. Osborne CK, Coronado-Heinsohn EB, Hilsenbeck SG, Mc-Cue BL, Wakeling AE, McClelland RA, Manning DL, Nich-olson RI: Comparison of the effects of a pure steroidal anti-estrogen with those of tamoxifen in a model of human breastcancer. J Natl Cancer Inst 87: 746–750, 1995

10. Gradishar WJ, Jordan VC: Clinical potential of new antiestro-gens. J Clin Oncol 15: 840–852, 1997

11. Wakeling AE, Dukes M, Bowler J: A potent specific pure anti-estrogen with clinical potential. Cancer Res 51: 3867–3873,1991

12. Wilson JW, Wakeling AE, Morris ID, Hickman JA, Dive C:MCF-7 human mammary adenocarcinoma cell deathin vitroin response to hormone-withdrawal and DNA damage. Int JCancer 61: 502–508, 1995

13. Kerr JF, Wyllie AH, Currie AR: Apoptosis: a basic biolo-gical phenomenon with wide-ranging implications in tissuekinetics. Br J Cancer 26: 239–257, 1972

14. Hockenbery D, Nunez G, Milliman C, Schreiber RD,Korsmeyer SJ: BCL-2 is an inner mitochondrial membraneprotein that blocks programmed cell death. Nature 348: 334–336, 1990

15. Garcia I, Martinou I, Tsujimoto Y, Martinou JC: Preventionof programmed cell death of sympathetic neurons by the bcl-2proto-oncogene. Science 258: 302–304, 1992

16. Gee JM, Robertson JF, Ellis IO, Willsher P, McClelland RA,Hoyle HB, Kyme SR, Finlay P, Blamey RW, Nicholson RI:Immunocytochemical localization of BCL-2 protein in humanbreast cancers and its relationship to a series of prognosticmarkers and response to endocrine therapy. Int J Cancer 59:619–628, 1994

17. Ceccarelli C, Santini D, Chieco P, Taffurelli M, Marrano D,Mancini AM: Multiple expression patterns of biopathologicalmarkers in primary invasive breast carcinoma: a useful toolfor elucidating its biological behavior. Ann Oncol 6: 275–282,1995

18. Wang TT, Phang JM: Effects of estrogen on apoptotic path-ways in human breast cancer cell line MCF-7. Cancer Res 55:2487–2489, 1995

19. Michna H, Schneider MR, Nishino Y, El Etreby MF: Antitu-mor activity of the antiprogestins ZK 98.299 and RU 38.486 inhormone dependent rat and mouse mammary tumors: mechan-istic studies. Breast Cancer Res Treat 14: 275–288, 1989

20. Sambrook J, Fritsch EF, Maniatis T: Molecular Cloning – ALaboratory Manual, 2nd edition. Cold Spring Harbor Laborat-ory, Cold Spring Habor, 1989

21. Murphy LD, Herzog CE, Rudick JB, Fojo AT, Bates SE: Useof the polymerase chain reaction in the quantitation of mdr-1gene expression. Biochemistry 29: 10351–10356, 1990

22. Knauthe R, Diel P, Hegele-Hartung C, Engelhaupt A, Fritze-meier KH: Sexual dimorphism of steroid hormone receptormessenger ribonucleic acid expression and hormonal regula-tion in rat vascular tissue. Endocrinology 137: 3220–3227,1996

23. Warri AM, Huovinen RL, Laine AM, Martikainen PM,Harkonen PL: Apoptosis in toremifene-induced growth inhib-ition of human breast cancer cellsin vivo and in vitro. J NatlCancer Inst 85: 1412–1418, 1993

24. Kyprianou N, English HF, Davidson NE, lsaacs JT: Pro-grammed cell death during regression of the MCF-7 humanbreast cancer following estrogen ablation. Cancer Res 51:162–166, 1991

25. Bursch W, Ellinger A, Kienzl H, Torok L, Pandey S, SikorskaM, Walker R, Hermann RS: Active cell death induced by theanti-estrogens tamoxifen and ICI 164 384 in human mammarycarcinoma cells (MCF-7) in culture: the role of autophagy.Carcinogenesis 17: 1595–1607, 1996

26. Perry RR, Kang Y, Greaves B: Effects of tamoxifen on growthand apoptosis of estrogen-dependent and -independent humanbreast cancer cells. Ann Surg Oncol 2: 238–245, 1995

Apoptosis induction by antiestrogens 97

27. Ellis PA, Saccani-Jotti G, Clarke R, Johnston SR, Ander-son E, Howell A, A’Hern R, Salter J, Detre S, Nicholson R,Robertson J, Smith IE, Dowsett M: Induction of apoptosisby tamoxifen and ICI 182780 in primary breast cancer. Int JCancer 72: 608–613, 1997

28. Oltvai ZN, Milliman CL, Korsmeyer SJ: BCL-2 heterodimer-izes in vivo with a conserved homolog, Bax, that acceleratesprogrammed cell death. Cell 74: 609–619, 1993

29. Bargou RC, Daniel PT, Mapara MY, Bommert K, WagenerC, Kallinich B, Royer HD, Dörken B: Expression of the bcl-2 gene family in normal and malignant breast tissue: lowbax-alpha expression in tumor cells correlates with resistancetowards apoptosis. Int J Cancer 60: 854–859, 1995

30. Leek RD, Kaklamanis L, Pezzella F, Gatter KC, Harris AL:bcl-2 in normal human breast and carcinoma, association withoestrogen receptor-positive, epidermal growth factor receptor-negative tumors andin situ cancer. Br J Cancer 69: 135–139,1994

31. Adam L, Crepin M, Israel L: Tumor growth inhibition, ap-optosis, and BCL-2 down-regulation of MCF-7ras tumors bysodium phenylacetate and tamoxifen combination. Cancer Res57: 1023–1029, 1997

32. Kandouz M, Siromachkova M, Jacob D, Chretien MarquetB, Therwath A, Gompel A: Antagonism between estradiol and

progestin on BCL-2 expression in breast-cancer cells. Int JCancer 68: 120–125, 1996

33. Gibson MK, Nemmers LA, Beckman WC Jr, Davis VL, CurtisSW, Korach KS: The mechanism of ICI 164,384 antiestrogen-icity involves rapid loss of estrogen receptor in uterine tissue.Endocrinology 129: 2000–2010, 1991

34. Dauvois S, White R, Parker MG: The antiestrogen ICI 182780disrupts estrogen receptor nucleocytoplasmic shuttling. J CellSci 106: 1377–1388, 1993

35. Horwitz KB, Koseki Y, McGuire WL: Estrogen control of pro-gesterone receptor in human breast cancer: role of estradioland antiestrogen. Endocrinology 103: 1742–1751, 1978

36. Savouret JF, Bailly A, Misrahi M, Rauch C, RedeuilhG, Chauchereau A, Milgrom E: Characterization of thehormone responsive element involved in the regulation ofthe progesterone receptor gene. EMBO J 10: 1875–1883,1991

Address for offprints and correspondence:Patrick Diel, Departmentof Morphology and Tumor Research, DSHS Cologne, Carl-Diem-Weg 6, 50927 Cologne, Germany;Fax: 049 221 4995 765;E-mail:diel@hrz.dshs-koeln.de