pasoaeesmscoRetstU

mmTspdisi1hia1rt

2

Genomics 61, 194–200 (1999)Article ID geno.1999.5945, available online at http://www.idealibrary.com on

0CA

The Promoter of the Poly(A) Binding Protein 2 (Pabp2) RetroposonIs Derived from the 5*-Untranslated Region

of the Pabp1 Progenitor Gene

Kenneth C. Kleene1 and Mary-Ann Mastrangelo

Department of Biology, University of Massachusetts Boston, 100 Morrissey Boulevard, Boston, Massachusetts 02125-3393

Received April 20, 1999; accepted July 26, 1999

bptbd

(iba1pw1wbEtagtt1t

irrsgpt(ipms

m

The mouse Pabp2 retroposon encodes an isoform ofoly(A) binding protein that is expressed in meioticnd early haploid spermatogenic cells. In the presenttudy, we have determined the transcription start sitef the Pabp2 gene to clarify the source of its promoter,prerequisite for expression of retroposons and pres-

rvation of their function by natural selection. The 5*nd of the mouse Pabp2 retroposon exhibits extensiveimilarity to the entire 5* UTR of the human PABP1RNA, but there is no similarity upstream of the tran-

cription start site of the human PABP1 mRNA, indi-ating that the Pabp2 gene lacks 5* flanking sequencesf the parental PABP1 gene. Oligonucleotide-directedNase H cleavage and 5* rapid amplification of cDNAnds both indicate that the transcription start site ofhe mouse Pabp2 gene is located ;330 bases down-tream of the capsite of the PABP1 mRNA, indicatinghat the Pabp2 promoter is derived from the PABP1 5*TR. © 1999 Academic Press

INTRODUCTION

Retroposons are a class of genes that were created byaking a reverse transcriptase copy of a processedRNA and inserting the DNA copy into genomic DNA.he canonical retroposon is characterized by the ab-ence of introns, and most exhibit the remnant of aoly(A) tail in a 39 A-rich terminus, short flankingirect repeats generated by insertion of the retroposonnto a staggered break in genomic DNA, and chromo-omal loci differing from those of their intron-contain-ng progenitors (reviewed in Vanin, 1985; Weiner et al.,986; Brosius and Tiedge, 1995). Many retroposonsave been created from mammalian mRNAs (Dein-

nger and Batzer, 1993), but nearly all have degener-ted into nonfunctional processed pseudogenes (Vanin,985; Weiner et al., 1986). It is popularly thought thatetroposons usually become nonfunctional becausehey are transcriptionally inert as a result of having

1 To whom correspondence should be addressed. Telephone: (617)87-6600. Fax: (617) 287-6650. E-mail: kenneth.kleene@umb.edu.

194888-7543/99 $30.00opyright © 1999 by Academic Pressll rights of reproduction in any form reserved.

een created from mature mRNAs that lack 59 flankingromoter elements (Li, 1997). Consequently, the func-ion of nonexpressed retroposons cannot be maintainedy natural selection, and they become inactivated byeleterious mutations.We have documented that a majority of retroposons

10/14) are expressed in testis and that in the six casesn which the expression in testicular cell types haseen examined, the transcripts are present in meioticnd/or haploid spermatogenic cells (Kleene et al.,998). This trend is supported by five additional retro-osons: the human MYCL2 and CDY retroposons,hich are expressed solely in testis (Morton et al.,989; Robertson et al., 1991; Lahn and Page, 1999); theallaby HPRT2 retroposon, which is expressed in liverut not in testis (Noyce et al., 1997); and the humanIF4E2 and Supt4h retroposons, whose expression in

estis have not been studied (Gao et al., 1998; Chiang etl., 1998). The expression of retroposons in spermato-enic cells has been attributed to X-chromosome inac-ivation in meiotic cells, which provides a strong selec-ive advantage for autosomal retroposons (McCarrey,994), and transcriptional derepression, which fostersranscriptional activity (Kleene et al., 1998).

The mouse Pabp2 gene encoding the testis-specificsoform of the poly(A) binding protein is an expressedetroposon (Kleene et al., 1994, 1998). The Pabp2 ret-oposon is derived from the Pabp1 gene, a highly con-erved, constitutively expressed intron-containingene encoding an ;70-kDa protein that binds to 39oly(A) tracts of cytoplasmic mRNAs and functions inhe initiation of translation and stability of mRNAsGallie, 1998). The objective of the present study was todentify the transcription start site of the Pabp2 retro-oson to clarify the source of its promoter and deter-ine why retroposons are preferentially expressed in

permatogenic cells.

MATERIALS AND METHODS

Total testis RNA from sexually mature mice was purified by theethod of Chomczynski (1993) using the Trizol reagent (Bethesda

RRPwPmch(

Rt5fmuotwPGt1dWRtmrc

oseoPsPrPm1Uq1spifrdaUtcPiEt(

PFPw1mNtsmwtw5sita(aPnt

dtowiTptTlabb(sitp1

bihstgPstP

s

195PROMOTER OF THE Pabp2 RETROPOSON

esearch Laboratories, Bethesda, MD). Twenty micrograms of testisNA was annealed with an oligonucleotide complementary to theabp2 mRNA, 59 GCAGAGAATGTATCATACAGTGC, and cleavedith Escherichia coli RNase H (US Biochemicals) as described byorter and Curthoys (1997). The size of the cleaved fragment waseasured by electrophoresis for 18 h at 30 V in a 0.8% agarose gel

ontaining 2.2 M formaldehyde, transferred to nitrocellulose, andybridized to a 191-bp EcoRI–NcoI 59UTR fragment of Pabp2 cDNAKleene et al., 1994).

The location of the transcription start site was determined by 59ACE using a kit (Bethesda Research Laboratories). Briefly, 0.1 mg

otal testis RNA was annealed to 20 pmol of Pabp2 antisense primer,9GGACAAGCGCAGAGGATCAA, in 29 ml dH2O, incubated at 70°Cor 5 min, and copied in a 50-ml reaction containing 50 mM KCl, 2.5M MgCl2, 1.25 mM dNTPs, 10 mM Tris–HCl (pH 7.9), and 200nits Superscript reverse II transcriptase (Bethesda Research Lab-ratories). After incubation at 42°C for 60 min, the reaction waserminated by incubation at 95°C for 10 min, dC tails were addedith terminal transferase and dCTP, and 10 ml was amplified byCR using the above downstream primer and the anchor primer, 59GCCACGCGTCGACTAGTACGGGIIGGGIIGGGIIG. Fifty-microli-

er PCRs containing 50 mM KCl, 0.1% Triton X-100, 1.5 mM MgCl2,0 mM Tris–HCl (pH 9.0), 20 pmol of each primer, 0.25 mM eachNTP, and 2.5 U Taq DNA polymerase (Promega Biotec, Madison,I) were overlaid with mineral oil and amplified using an MJ-esearch thermocycler with the following program: 5 min of dena-

uration at 95°C, followed by 30 cycles of 61°C for 1 min, 72°C for 1in, and 95°C for 1 min. PCR products were characterized by aga-

ose gel electrophoresis, Southern blots, and DNA sequencing afterloning into the T-vector (Promega Biotec).

RESULTS

The sequences of the 59 flanking region and 59 UTRf the human PABP1 gene including the transcriptiontart site have been determined previously (Hornsteint al., 1999). The alignment of the sequences upstreamf the coding region of the mouse Pabp2 and humanABP1 genes depicted in Fig. 1 can be divided into fouregments: (1) nt 1–658 at the 59 end of the mouseabp2 gene sequence lack similarity to the 59 flankingegion of the human PABP1 gene; (2) nt 659–734 of theabp2 gene are 72.5% identical to the 59 UTR of PABP1RNA beginning at the capsite (Hornstein et al.,

999); (3) nt 735–874 lack similarity to the PABP1 59TR, but are ;69% identical to the consensus se-uence of mouse B1 repetitive element (Quentin,989); (4) nt 874–1312 ending with the first translationtart site are 69% identical to the PABP1 59 UTR. Therss3 program (Pearson, 1996) indicates that the sim-larity scores of the alignments of the second andourth segments, 37 and 97, are expected to occur,espectively, 0.06 and 0.17 times, in 200 shuffles. Evi-ently, the Pabp2 gene was created by retroposition ofcopy of the PABP1 mRNA that included the entire 59TR, but no 59 flanking sequences, followed by inser-

ion of a B1 repetitive element. This inference is alsoonsistent with observations that the 59 UTR of mouseabp1 ESTs and the human PABP1 mRNA are ;90%

dentical and that the longest 59 ends of two Pabp1STs (Accession Nos. AV110267 and AV110292) match

he human PABP1 transcription start site exactlyHornstein et al., 1999).

The location of the transcription start site of the

abp2 retroposon was determined by two methods.irst, the approximate transcription start site of theabp2 mRNA was determined by RNase H cleavageith an oligonucleotide complementary to nt 1652–675 of the Pabp2 gene (Accession No. AF001290) andeasurement of the size of the cleaved fragment inorthern blots by hybridization to a probe specific for

he Pabp2 59 UTR (Kleene et al., 1994). The resultshown in Fig. 2 are representative of three experi-ents in which the intact and cleaved Pabp2 mRNAsere about 2400 and 500 nt, respectively. Second, the

ranscription start site was determined more exactlyith 59 RACE (rapid amplification of cDNA ends). The9 ends of nine independent 59 RACE clones occurred atix positions over a 33-nt range. Southern blots alsondicated that the 59 RACE product was ;130 nucleo-ides including about 76 nt of Pabp2 cDNA, C-tails ofverage length 17 nt, and an anchor primer of 36 ntdata not shown). The RNase H cleavage and 59 RACEnalyses agree that the transcription start site of theabp2 gene is ;330 nt downstream from the 59 termi-us of the retroposed DNA, a sequence derived fromhe 59 UTR of the PABP1 mRNA.

Since the preceding findings indicate that a promotererived from the 59 UTR of the PABP1 mRNA drivesranscription of the Pabp2 gene, the 59 flanking regionf the Pabp2 gene and the 59 UTR of the PABP1 mRNAere examined for putative transcription factor bind-

ng sites with MatInspector V2.2 (Quandt et al., 1995).he 59 flanking region of the Pabp2 promoter containsotential binding sites for AP-2 and MSY-2, factorshat have been implicated in the transcription of thecp-10bt and cytochrome ct genes in meiotic and hap-

oid spermatogenic cells (Ewulonu et al., 1996; Yiu etl., 1997). The PABP1 59 UTR is also potentially capa-le of directing transcription in spermatogenic cellsecause it contains binding sites for AP2 and Sp1Bonny et al., 1998). The multiple transcription startites, a 59 CpG island, and the absence of a TATA-boxn the Pabp2 promoter resemble other genes that areranscribed specifically in spermatogenic cells (Kil-atrick et al., 1990; Teruya et al., 1990; Ariel et al.,991; Ewulonu et al., 1996; Yiu et al., 1997).

DISCUSSION

The efficacy of the Pabp2 promoter is demonstratedy the observation that the levels of the Pabp2 mRNAn meiotic and early haploid spermatogenic cells areigher than the levels of the PABP1 mRNA in severalomatic tissues (Kleene et al., 1994). We report herehat the 59 flanking sequence of the PABP1 progenitorene is absent from the Pabp2 retroposon and that theabp2 transcription start site is located ;330 nt down-tream from the start site of the PABP1 mRNA. Thus,he promoter of the Pabp2 gene is derived from theABP1 59 UTR.The finding that the promoter of the Pabp2 retropo-

on is derived from the 59 UTR of its progenitor gene

196 KLEENE AND MASTRANGELO

wttrtmMpsiTwiarcgocZ(ttpest

spptFD

cpsrtoemispims

o1latdtpfpmw11ntggtcr1Xi

sd1stt

tlb

samrmh1(MG

197PROMOTER OF THE Pabp2 RETROPOSON

as unexpected. It conflicts with the prevailing opinionhat the promoters of expressed retroposons, notablyhe preproinsulin retroposon, are derived from aber-ant transcripts that initiated upstream of the normalranscription start site and therefore retain the pro-oters of their progenitor genes (Soares et al., 1985;cCarrey, 1987, 1994; Li, 1997). This led us to com-

are the 59 flanking sequences and transcription startites of the 19 expressed retroposons and their progen-tors listed in the Introduction and Kleene et al. (1998).able 1 summarizes the conclusions of this analysis,hich document that each of three retroposons derives

ts promoters from the 59 UTR of the progenitor genend DNA located 59 to the site of insertion of theetroposon, while only the preproinsulin retroposonlearly acquired its promoter from the 59 flanking re-ion of its progenitor gene. The source of the promoterf the human Zfa retroposon is obscure because it wasreated from an alternative transcript of the progenitorfx gene that is not known to exist in natural mRNAs

Ashworth et al., 1990; Luoh and Page, 1994). Never-heless, the promoter of the Zfa retroposon conforms tohe rule that it is not derived from the major Zfxromoter. The origins of the promoters of many otherxpressed retroposons are unclear, because the tran-cription start sites of the retroposons and their paren-al genes have not been determined or because the

FIG. 1. Alignment of the 59 proximal regions of the mouse Pabp2ranscription start site of the human PABP1 gene is indicated by an aetters, and the o’s mark the nucleotide at the 59 ends of Pabp2 59 RACinding sites are underlined, and a CpG island is in boldface type.

FIG. 2. Determination of the approximate transcription startite of the Pabp2 mRNA by RNase H cleavage. Testis RNA wasnnealed with an oligonucleotide complementary to the Pabp2RNA and cleaved with E. coli RNase H as described under Mate-

ials and Methods. The size of the cleaved fragment and intact Pabp2RNA were analyzed by electrophoresis and a Northern blot byybridization to a probe specific for the 59 end of Pabp2 mRNA. Lane, intact RNA; Lane 2, RNase H cleaved RNA. The RNA size markerstotal testis cytoplasmic RNA and Perfect RNA markers, Novagen,

ilwaukee, WI) for mouse were detected by staining with Sybro-reen II and phosphorimage analysis.

imilarity between the 59 flanking sequences of theyruvate dehydrogenase E1a2 subunit (Pdha-2) andhosphoglycerate kinase 2 (Pgk-2) retroposons andheir progenitor genes is too low to be detected byASTA (ktup 5 1) (Boer et al., 1987; McCarrey, 1987;ahl et al., 1990; Fitzgerald et al., 1992, 1994).This survey establishes that functional retroposons

reated by retroposition of mRNAs typically lack aromoter derived from the parental gene. This is con-istent with the popular idea that the vast majority ofetroposons will be transcriptionally inactive becausehey lack a promoter and its corollary that the creationf transcriptionally active retroposons whose promot-rs are derived from the 59 UTR of the progenitorRNA or DNA sequences upstream of the point of

nsertion of the retroposed DNA will be rare events. Ithould also be pointed out that the competency of theromoters of nascent retroposons is uncertain, becausenactive promoters may be activated by subsequent

utations or active promoters may be silenced by sub-equent mutation or methylation (Yoder et al., 1997).The tendency for retroposons to be expressed in mei-

tic and haploid spermatogenic cells (Kleene et al.,998) probably reflects the combined effects of pecu-iarities of gene expression that select for the functionnd foster transcription of retroposons. The function ofhe autosomal Pgk-2, Pdha-2, Zfa, glucose 6-phosphateehydrogenase 2, and glycerol kinase 2 retroposons ishought to be strongly selected for because they com-ensate for depletion of a somatic isoform resultingrom inactivation of transcription of intron-containingrogenitor genes on the X chromosome in meiotic sper-atogenic cells (McCarrey and Thomas, 1987; Ash-orth et al., 1990; Adler et al., 1991; McCarrey et al.,992; McCarrey, 1994; Dahl et al., 1990; Sargent et al.,994; Hendrickson et al., 1997). However, a similarumber of retroposons that are expressed solely inestis or spermatogenic cells lack X-linked progenitorenes whose transcription is inactivated in spermato-enic cells including the mouse Pabp2, human glu-amine dehydrogenase 2, the human Cg subunit ofAMP-dependent protein kinase, and human CDY ret-oposons (Kleene et al., 1994; Shashidharan et al.,994; Reinton et al., 1998; Lahn and Page, 1999). Thus,-chromosome inactivation is not the only factor select-

ng for functional retroposons in spermatogenic cells.We have also proposed that transcriptional derepres-

ion in meiotic and haploid spermatogenic cells is con-ucive to the expression of retroposons (Kleene et al.,998). Our opinion that transcription is derepressed inpermatogenic cells is based partly on the observationhat many genes that are expressed in somatic cells areranscribed at extraordinarily high levels, or from mul-

human PABP1 genes (Accession Nos. U68093 and AF001290). Thew. The oligonucleotide used in the 59RACE is indicated in lowercaselones. The first translation initiation codons and transcription factor

andrroE c

tg1hchR(sEr

dtidtepewp(dh

A

A

A

B

B

B

B

C

C

C

D

D

D

E

E

F

CNMPPSTZ

akRS1

198 KLEENE AND MASTRANGELO

iple start sites, or even inappropriately in spermato-enic cells (reviewed in Ivell, 1992; Eddy and O’Brien,998). Our opinion is also based on the knowledge thatistone acetylation (Grimes and Henderson, 1984),hromatin decondensing activity of the testis-specificistone H1t (Khadake and Rao, 1995), high levels ofNA polymerase II and basal transcription factors

Schmidt and Schibler, 1995), and testis-specific tran-cription factors (Hoog et al., 1991; Yiu et al., 1997;ddy and O’Brien, 1998) could all contribute to a de-

epressed environment.Finally, we wish to speculate that transcriptional

erepression may be a mechanism for producing ex-reme variability in the levels and structure of proteinsn spermatogenic cells and that this variability expe-ites speciation. Ferris et al. (1997) have documentedhat genes with functions in fertilization are evolvingxtremely rapidly. Furthermore, transcriptional dere-ression may underlie two unusual features of genexpression in spermatogenic cells: the utilization ofidespread translational repression as a mechanism torevent deleterious effects of excessive mRNA levelsKleene, 1996) and thermally unstable proteins thatenature at normal body temperature, producing aeat shock reponse (Sarge, 1995; Cataldo et al., 1997).

ACKNOWLEDGMENT

This work was supported by NSF Grant IBN-9418285.

REFERENCES

dler, D. A., Bressler S. L., Chapman, V. M., Page, D. C., andDisteche, C. M. (1991). Inactivation of the Zfx gene on the mouseX chromosome. Proc. Natl. Acad. Sci. USA 88: 4592–4595.riel, B., McCarrey, J., and Cedar, H. (1991). Methylation patternsof testis-specific genes. Proc. Natl. Acad. Sci. USA 88: 2317–2321.shworth, A., Skene, B., Swift, S., and Lovell-Badge, R. (1990). Zfais an expressed retroposon derived from an alternative transcriptof the Zfx gene. EMBO J. 9: 1529–1534.

TAB

Origins of Promoters o

Retroposon name (species of mammal) Sour

g subunit of cAMP-dependent protein kinase (H) 59 flank-myc2 (WC) ProgenYCL2 (H) Progenoly(A) binding protein 2 (M) Progenreproinsulin I (R) Progen-adenosylmethionine decarboxylase (M) 59 flankranslation initiation factor eIF4E2 (H) 59 flankfa (M) Other

Note. Species of mammal: M, mouse; H, human; R, rat; WC, woodnd patterns of expression of retroposons is contained in the followiinase (Reinton et al., 1998; Beebe et al., 1990); woodchuck N-myobertson et al., 1991; Morton et al., 1991); mouse Pabp2 (Kleene-adenosylmethionine decarboxylase 2 (Persson et al., 1995; Nishimu998); Zfa (Ashworth et al., 1990; Luoh and Page, 1994).

eebe, S. J., Oyen, O., Sandberg, M., Froysa, A., Hansson, V.,Jahnsen, T. (1990). Molecular cloning of a tissue-specific proteinkinase (C gamma) from human testis—Representing a third iso-form for the catalytic subunit of cAMP-dependent protein kinase.Mol. Endocrinol. 4, 465–475.oer, P. H., Adra, C. N., Lau, Y.-F., and McBurney, M. W. (1987). Thetestis-specific phosphoglycerate kinase gene Pgk-2 is a recruitedretroposon. Mol. Cell. Biol. 7: 3107–3112.onny, C., Cooker L. A., and Goldberg, E. (1998). Deoxyribnucleicacid–protein interactions and expression of the human testis-spe-cific lactate dehydrogenase promoter: Transcription factor Sp1plays a major role. Biol. Reprod. 58: 754–759.

rosius, J., and Tiedge, H. (1995). Reverse transcriptase: Mediator ofgenomic plasticity. Virus Genes 11: 163–179.ataldo, L., Mastrangelo, M.-A., and Kleene, K. C. (1997). Differen-tial effects of heat stress on translation of normal mRNAs inprimary spermatocytes, elongated spermatids and Sertoli cells inseminiferous tubule culture. Exp. Cell Res. 231: 206–213.

hiang, P.-W., Zhang, R., Stubbs, L., Zhang, L., Zhu, L., and Kurnit,D. M. (1998). Comparison of murine Supt4H and a nearly identicalexpressed, processed gene: Evidence of sequence conservationthrough gene conversion extending in the untranslated regions.Nucleic Acids Res. 26: 4960–4964.homczynski, P. (1993). A reagent for the single-step simultaneousisolation of RNA, DNA and proteins from cell and tissue samples.Biotechniques 15: 532–534.ahl, H.-H., Brown, R. M., Hutchison, W. M., Maragos, C., andBrown, G. K. (1990). A testis-specific of the human pyruvate de-hydrogenase E1a subunit is coded for by an intronless gene onchromosome 4. Genomics 8: 225–232.eininger, P. L., and Batzer, M. A. (1993). Evolution of retroposons.In “Evolutionary Biology” (M. Hecht, R. J. Macintyre, and M. T.Clegg, Eds.), Vol. 27, pp. 157–196. Plenum, New York.ePinho, R. A., Hatton, K. S., Tesfayae, A., Yancopoulos, G. D., andAlt, F. W. (1987). The human myc gene family: Structure andactivity of L-myc and an L-myc pseudogene. Genes Dev. 1: 1311–1326.ddy, M., and O’Brien, D. A. (1998). Gene expression during mam-malian meiosis. Curr. Top. Dev. Biol. 37: 141–200.wulonu, U. K., Snyder, L., Silver, L. M., and Schimenti, J. C. (1996).Promoter mapping of the mouse Tcp-10bt gene in transgenic miceidentifies essential male germ cells regulatory sequences. Mol.Reprod. Dev. 43: 290–297.

erris, P. J., Pavlovic, C., Fabry, S., and Goodenough, U. W. (1997).Rapid evolution of sex-related genes in Chlamydomonas. Proc.Natl. Acad. Sci. USA 94: 8634–8639.

1

xpressed Retroposons

of promoter Pattern of expression

insertion site Testis59UTR Liver tumors, brain59UTR Testis59UTR Primary spermatocytes, round spermatids59 flanking Pancreatic isletinsertion site Liver, spleen, kidney, testisinsertion site Cultured cells

Primary spermatocytes

ck. Information concerning the sequences, transcription start sites,references: human Cg catalytic subunit of cAMP-dependent protein(Fourel et al., 1990, 1992); human MYCL2 (DePinho et al., 1987;al., 1994, 1998); rat preproinsulin 1 (Soares et al., 1985); mouseet al., 1998); human translation initiation factor EIF4E2 (Gao et al.,

LE

f E

ce

ingitoritoritoritoringing

chungc2

etra

F

F

F

F

G

G

G

H

H

H

I

I

K

K

K

K

K

L

L

L

M

M

M

M

M

N

N

P

P

P

Q

Q

R

R

S

S

S

S

S

199PROMOTER OF THE Pabp2 RETROPOSON

itzgerald, J., Hutchison, W. M., and Dahl, H.-H. M. (1992). Isolationand characterization of the mouse pyruvate dehydrogenase E1agenes. Biochim. Biophys. Acta 1131: 83–90.

itzgerald, J., Dahl, H.-H. M., and Ianello, R. C. (1994). Differentialexpression of two testis-specific transcripts of the mouse Pdha-2gene during spermatogenesis. DNA Cell Biol. 13: 531–537.

ourel, G., Trepo, C., Bougueleret, L., Henglein, B., Ponzetto, A.,Tiollais, P., and Buendia, M.-A. (1990). Frequent activation ofN-myc by hepadnavirus insertion in woodchuck liver tumors. Na-ture 347: 294–298.

ourel, G., Transy, C., Tennant, B. C., and Buendia, M.-A. (1992).Expression of the woodchuck N-myc2 retroposon in brain and livertumors is driven by a cryptic N-myc promoter. Mol. Cell. Biol. 12:5336–5344.allie, D. R. (1998). A tale of two termini: A functional interactionbetween the termini of an mRNA is a prerequisite for efficienttranslation initiation. Gene 216: 1–11.ao, M., Rykchlik, W., and Rhoads, R. E. (1998). Cloning and char-acterization of human eIF4E genes. J. Biol. Chem. 273: 4622–4628.rimes, S. R., Jr., and Henderson, N. (1984). Acetylation of rat testishistones H2B and TH2B. Dev. Biol. 101: 516–521.endrickson, P. J. M., Hoogerbrugge, J. W., Baarents, W. M., De-Boer, P., Vreeburg, J. T. M., Vos, E. A., van de Lende, T., andGrootegoed, J. A. (1997). Testis-specific expression of a functionalretroposon encoding glucose-6-phosphate dehydrogenase in themouse. Genomics 41: 350–359.oog, C., Schalling, M., Grunder-Brundell, E., and Daneholt, B.(1991). Analysis of a murine male germ cell-specific transcript thatencodes a putative zinc finger protein. Mol. Reprod. Dev. 30: 173–181.ornstein, E., Git, A., Braunstein, I., Avni, D., and Meyuhas, O.(1999). The expression of poly(A)-binding protein gene is transla-tionally regulated in a growth-dependent fashion through a 59-terminal oligopyrimdine tract motif. J. Biol. Chem. 274: 1708–1714.

annello, R. C., Young, J., Sumarsono, S., Tymms, M. J., Dahl, H.-H.,Gould, J., Hedger, M., and Kola, I. (1997). Regulation of Pdha-2expression is mediated by proximal promoter sequences and CpGmethylation. Mol. Cell. Biol. 17: 612–619.

vell, R. (1992). “All that glisters is not gold”—Common testis genetranscripts are not always what they seem. Invest. J. Androl. 15:85–92.hadake, J. R., and Rao, M. R. S. (1995). DNA- and chromatin-condensing properties of rat testes H1a and H1t compared to thoseof rat liver H1bdec: H1t is a poor condensor of chromatin. Biochem-istry 34: 15792–15801.ilpatrick, D. E. L., Zinn, S. A., Fitzgerald, M., Higuchi, H., Sabol,S. L., and Meyerhardt, J. (1990). Transcription of the rat andmouse proenkephalin genes is initiated at distinct sites in sper-matogenic and somatic cells. Mol. Cell. Biol. 10: 3717–3726.leene, K. C. (1996). Patterns of translational regulation in themammalian testis. Mol. Reprod. Dev. 43: 268–281.leene, K. C., Mulligan, E., Steiger, D., Donohue, K., and Mas-trangelo, M.-A. (1998). The mouse gene encoding the testis-specificisoform of poly(A) binding protein (Pabp2) is an expressed retro-poson: Intimations that gene expression in spermatogenic cellsfacilitates the creation of new genes. J. Mol. Evol. 47: 275–281.leene, K. C., Wang, M.-Y., Hall, C., Cutler, M., and Shih, D. (1994).Developmental expression of poly(A) binding protein mRNAs inspermatogensis in the mouse. Mol. Reprod. Dev. 39: 355–364.

ahn, B. T., and Page, D. C. (1999). A third molecular evolutionaryprocess contributed genes to the human Y chromosome: Retropos-ing an autosomal mRNA yielded a testis-specific gene family. Nat.Genet. 21: 429–433.

i, W.-H. (1997). “Molecular Evolution,” Sinauer Associates, Inc.,Sunderland, MA.

uoh, S.-W., and Page, D. C. (1994). The structure of the Zfx gene onthe mouse X chromosome. Genomics 19: 310–319.cCarrey, J. R. (1987). Nucleotide sequence of the promoter regionof a tissue-specific human retroposon: Comparison with a house-keeping progenitor. Gene 61: 291–298.cCarrey, J. R. (1994). Evolution of tissue-specific gene expressionin mammals. BioScience 44: 20–27.cCarrey, J. R., and Thomas, K. (1987). Human testis-specific PGKgene lacks introns and possesses characteristics of a processedgene. Nature 326: 501–505.cCarrey, J. R., Dilworth, D. D., and Sharp, R. M. (1992). Semi-quantitative analysis of X-linked gene expression during spermat-ogenesis in the mouse: Ethidium bromide staining of RT-PCRproducts. Genet. Anal. Tech. Appl. 9: 117–123.orton, C. C., Nussenzweig, M. C., Sousa, R., Sorenson, G. D.,Pettengill, O. S., and Shows, T. B. (1989). Mapping and character-ization of an X-linked processed gene related to MYCL1. Genomics4: 367–375.ishimura, K., Liisanantti, M., Muta, Y., Kashiwagi, K., Shirahata,A., Janne, M., Kankare, K., Janne, O. A., and Igarashi, K. (1998).Structure and activity of mouse S-adenosylmethionine decarbox-ylase gene promoters and properties of the encoded proteins. Bio-chem. J. 332: 651–659.oyce, L., Conaty, J., and Piper, A. A. (1997). Identification of anovel-tissue specific processed HPRPT gene and comparison withX-linked transcription in the Australian marsupial Macropus ro-bustus. Gene 186: 87–95.

earson, W. R. (1996). Effective protein sequence comparison. In“Methods in Enzymology” (R. F. Doolittle, Ed.), Vol. 266, pp. 227–258, Academic Press, San Diego.

ersson, K., Holm, I., and Heby, O. (1995). Cloning and sequencingof an intronless mouse S-adenosylmethionine decarboxylase genecoding for a functional enzyme strongly expressed in the liver.J. Biol. Chem. 270: 5642–5648.

orter, D., and Curthoys, N. P. (1997). Use of thermostable andEscherichia coli RNase H in RNA mapping studies. Anal. Biochem.247: 279–286.uandt, K., Frech, K., Karas, H., Wingender, E., and Werner, T.(1995). Matlind and Matinspector-New fast and versatile tools fordetection of consensus matches in nucleotide sequence data. Nu-cleic Acids Res. 23: 4878–4884.uentin, Y. (1989). Successive waves of fixation of B1 variants inrodent lineage history. J. Mol. Evol. 28: 299–305.einton, N., Haugen, T. B., Orstavik, S., Skalhegg, B. S., and Hans-son, V. (1998). The gene encoding the C gamma catalytic subunitof cAMP-dependent protein kinase is a transcribed retroposon.Genomics 49: 290–297.obertson, N. G., Pomponio, R. J., Mutter, G. L., and Morton, C. C.(1991). Testis-specific expression of the human MYCL2 gene. Nu-cleic Acids Res. 19: 3129–3137.

arge, K. D. (1995). Male germ cell-specific alteration in temperatureset point of the cellular stress response. J. Biol. Chem. 270: 18745–18748.

argent, C. A., Young, C., Marsh, S., Ferguson-Smith, M. A., andAffara, N. A. (1994). The glycerol kinase gene family: Structure ofthe Xp gene, and related intronless retroposons. Hum. Mol. Genet.3: 1317–1324.

chmidt, E. E. (1996). Transcriptional promiscuity in testis. Curr.Biol. 6: 768–769.

chmidt, E. E., and Schibler, U. (1995). High accumulation of com-ponents of the RNA polymerase II transcription machinery inspermatids. Development 121: 2373–2383.

hashidharan, P., Michaelidis, T. M., Robakis, N. K., Kresovali, A.,Papmatheakis, J., and Plaitakis, A. (1994). Novel human gluta-mate dehydrogenase expressed in neural and testicular tissuesand encoded by an X-linked intronless gene. J. Biol. Chem. 269:16971–16976.

S

T

V

W

Y

Y

Z

200 KLEENE AND MASTRANGELO

oares, M. B., Schon, E., Henderson, A., Karathanasis, S. K., Cate,R., Zeitlin, S., Chirgwin, J., and Efstradiadis, A. (1985). RNA-mediated duplication: The rat preproinsulin gene is a functionalretroposon. Mol. Cell. Biol. 5: 2090–2103.

eruya, J. H., Kutsunai, S. Y., Spear, D. H., Edwards, P. A., andClarke, C. F. (1990). Testis-specific transcription initiation sites ofrat farnesyl pyrophosphate synthetase mRNA. Mol. Cell. Biol. 10:2315–2326.anin, E. F. (1985). Processed pseudogenes: Characteristics andevolution. Annu. Rev. Gen. 19: 253–272.einer, A. M., Deininger, P. L., and Efstratiadis, A. (1986). Nonviralretroposons: Genes, pseudogenes and transposable elements gen-

erated by reverse flow of genetic information. Annu. Rev. Biochem.55: 631–661.

iu, G. K., Murray, M. T., and Hecht, N. B. (1997). Deoxyribonucleicacid-protein interactions associated with transcriptional initiationof the mouse testis-specific cytochrome c gene. Biol. Reprod. 56:1439–1449.

oder, J. A., Walsh, C. P., Bestor, T. H. (1997). Cytosine methylationand the ecology of intragenomic parasites. Trends Genet. 13, 335–340.

hang, L. P., Stroud, J. C., Walter, C. A., Adrain, G. S., and McCar-rey, J. R. (1998). A gene-specific promoter in transgenic micedirects testis-specific demethylation prior to transcriptional acti-vation in vivo. Biol. Reprod. 59: 284–292.