The Plant Journal 78, 834–849 doi: …croplab.hzau.edu.cn › __local › 2 › 7F › 75 › B9A8EF030814E51993C...By screening drought-tolerant or sensitive rice mutants col-lected

A homolog of ETHYLENE OVERPRODUCER, OsETOL1,differentially modulates drought and submergence tolerancein rice

Hao Du, Nai Wu, Fei Cui, Lei You, Xianghua Li and Lizhong Xiong*

National Key Laboratory of Crop Genetic Improvement and National Center of Plant Gene Research (Wuhan), Huazhong

Agricultural University, Wuhan 430070, China

Received 18 August 2013; revised 24 January 2014; accepted 10 March 2014; published online 19 March 2014.

*For correspondence (e-mail [email protected]).

SUMMARY

Submergence and drought are major limiting factors for crop production. However, very limited studies

have been reported on the distinct or overlapping mechanisms of plants in response to the two water

extremes. Here we report an ETHYLENE OVERPRODUCER 1-like gene (OsETOL1) that modulates differen-

tially drought and submergence tolerance in rice (Oryza sativa L.). Two allelic mutants of OsETOL1 showed

increased resistance to drought stress at the panicle development stage. Interestingly, the mutants exhib-

ited a significantly slower growth rate under submergence stress at both the seedling and panicle develop-

ment stages. Over-expression (OE) of OsETOL1 in rice resulted in reverse phenotypes when compared with

the mutants. The OsETOL1 transcript was differentially responsive to abiotic stresses. OsETOL1 was found

to interact with OsACS2, a homolog of 1-amino-cyclopropane-1-carboxylate (ACC) synthase (ACS), which

acts as a rate-limiting enzyme for ethylene biosynthesis. In the osacs2 mutant and OsETOL1-OE plants, ACC

and ethylene content were decreased significantly, and exogenous ACC restored the phenotype of osetol1

and OsETOL1-OE to wild-type under submergence stress, implying a negative role for OsETOL1 in ethylene

biosynthesis. The expression of several genes related to carbohydrate catabolism and fermentation showed

significant changes in the osetol1 and OsETOL1-OE plants, implying that OsETOL1 may affect energy

metabolism. These results together suggest that OsETOL1 plays distinct roles in drought and submergence

tolerance by modulating ethylene production and energy metabolism. Findings from the expression and

functional comparison of three ethylene overproducer (ETOL) family members in rice further supported the

specific role of OsETOL1 in the responses to the two water stresses.

Keywords: Oryza sativa, drought, submergence, ethylene, energy metabolism.

INTRODUCTION

Sessile plants are often challenged by various abiotic stres-

ses such as extremes in water availability including

drought and submergence stress during their life cycle. To

respond to these stresses, plants have evolved a variety of

biochemical and physiological mechanisms that allows

them to adapt to adverse conditions (Hirayama and Shino-

zaki, 2010; Fukao and Xiong, 2013). Many of the adaptation

mechanisms are related to changes in the levels of endog-

enous hormones such as abscisic acid (ABA) and ethylene.

The ABA biosynthesis and signalling pathways are well

known for their roles in various stress responses. Ethylene

as an important gaseous hormone participates in a diverse

array of plant growth and development mechanisms such

as hypocotyl growth, cell elongation, fruit ripening, leaf

and flower abscission, nodulation, and plant senescence

(Wang et al., 2004; Frankowski et al., 2007). Meanwhile,

ethylene is also important for plants to respond rapidly

and coordinately to adverse environments, such as patho-

gen attack, hypoxia, and exposure to drought or submer-

gence stress (Metraux and Kende, 1983; Xu et al., 2006;

Wilkinson and Davies, 2010; Fukao et al., 2011). In the early

developmental stages of Arabidopsis thaliana, ethylene

appears to act as a negative regulator of ABA, and a posi-

tive regulator in the drought stress response, while in roots

it has a positive synergistic effect on ABA action (Ghas-

semian et al., 2000). Under drought stress conditions, the

increased endogenous ABA levels can limit ethylene pro-

duction to maintain the growth ratio between shoots and

roots (Sharp, 2002). Furthermore, ethylene signalling inhib-

its ABA-induced stomatal closure by impairing ABA

© 2014 The AuthorsThe Plant Journal © 2014 John Wiley & Sons Ltd

834

The Plant Journal (2014) 78, 834–849 doi: 10.1111/tpj.12508

mailto:[email protected]

regulation of stomatal closure (Tanaka et al., 2005). These

results suggest that ethylene may play a negative role in

the drought stress response, and that the developmental

and stress-responsive processes are controlled by a combi-

nation of biosynthesis, signal perception, and signal trans-

duction of ethylene and other factors.

Extensive genetic analyses in Arabidopsis have uncov-

ered an elaborate pathway for ethylene synthesis. These

studies have focused on cloning and characterization of

the genes for two key enzymes, 1-amino-cyclopropane-1-

carboxylate (ACC) synthase (ACS) and ACC oxidase (ACO).

ACS is a rate-limiting enzyme that converts S-adenosyl-L-

methionine to ACC (Wang et al., 2002), and ACC is then

converted to ethylene by members of the ACO family.

ACSs are encoded by a gene family with at least 12 mem-

bers in Arabidopsis (Yamagami et al., 2003; Tsuchisaka

and Theologis, 2004). The ACS genes are differentially reg-

ulated at the transcriptional level in response to environ-

mental stresses and developmental cues (Wang et al.,

2002). Arabidopsis eto1 is a recessive mutant of the ETH-

YLENE OVERPRODUCER 1 (ETO1), which was proposed to

encode a post-transcriptional regulator of ACS (Woeste

et al., 1999). ETO1 and ETO1-like (EOL) proteins in Arabid-

opsis have been shown to interact directly with the C-ter-

minus of the ACS5 protein, and thus inhibit ACS5 activity

by proteasome-dependent degradation in an in vitro activ-

ity assay (Wang et al., 2004). ETO1 has been characterized

as a protein with a Broad-Complex, Tramtrack, and Bric-a-

brac (BTB) domain at its amino-terminus, and six tetratric-

opeptide repeat motifs together with a coiled-coil motif at

its C-terminus. The BTB domain functions in protein–

protein interactions to mediate the interaction of ETO1

with other proteins (Wang et al., 2004). Arabidopsis con-

tains two potential paralogs of ETO1, designated as ETO1-

LIKE 1 (EOL1) and EOL2, which share significant similarity

to ETO1, including the presence of a six tetratricopeptide

repeat and the coiled-coil motif. The two paralogs can also

interact with ACS5 in yeast and indicate that they may also

direct ACS ubiquitination and turnover (Yoshida et al.,

2006; Christians et al., 2009). However, it has been found

that a single null mutation of EOL1 and EOL2 failed to

cause obvious growth defects and, in particular, no defects

in ethylene overproduction were observed; this result sug-

gested that EOL1 and EOL2 may act through non-ethylene

signalling pathways or have a more subtle effect on ethyl-

ene biosynthesis than ETO1 (Gingerich et al., 2005; Chris-

tians et al., 2009). Collectively, previous results in

Arabidopsis have indicated that the Arabidopsis BTB-type

E3 ligases work together with ETO1 to negatively regulate

ethylene synthesis and thus degrade type-2 ACSs

(Christians et al., 2009).

It is well known that submergence can induce ethylene

production, and that ethylene is involved in the control of

energy metabolism under submergence or hypoxic

conditions, as a lack of oxygen causes a reduction in respi-

ratory and photosynthetic efficiency and, as a conse-

quence, in energy production (Gupta et al., 2009). The role

of ethylene in energy metabolism under submergence con-

ditions has been well elucidated by the role of the SUB-

MERGENCE-1 A (SUB1A) gene in submergence-tolerant

rice. SUB1A, an ethylene responsive factor (ERF), promotes

a ‘quiescent strategy’ to avoid any unnecessary energy

consumption caused by gibberellin (GA)-mediated elonga-

tion in the submerged tissues (Bailey-Serres and Voesenek,

2010). In another distinct mechanism, the ERF transcription

factors SNORKEL1 and SNORKEL2 promote GA-mediated

internode elongation in deep-water rice varieties (Hattori

et al., 2009). Ethylene drives the expression of SUB1A and

SNORKEL1/2 that controls the quiescence of submergence

tolerance and the escape responses of deep-water rice,

respectively (Bailey-Serres and Voesenek, 2010). Such an

adaptation mechanism illustrates the exceptional effect of

ethylene and GA under submergence stress conditions.

Both the transcriptional and translational regulation of

energy metabolism-related genes have been found to be

involved in the adaptation of plants to submergence or oxy-

gen-limited conditions (Bailey-Serres and Voesenek, 2008).

Under such conditions, hypoxia-induced genes that encode

alcohol dehydrogenase (ADH), pyruvate decarboxylase

(PDC), and sucrose synthase (SUSY) in several plant species

have contributed to the identification of several cis-

elements for hypoxia inducibility (de Bruxelles et al., 1996;

Magneschi and Perata, 2009). In Arabidopsis, the hypoxia-

responsive ERF genes HRE1 and HRE2 also belong to the

same ERF group as SUB1A. HRE1-OE plants showed an

increase in the activity of the fermentative enzymes pyru-

vate decarboxylase and alcohol dehydrogenase together

with increased ethanol production under hypoxia (Licausi

et al., 2010), which is a similar adaptive strategy to SUB1A.

Recently, the CBL-interacting protein kinase OsCIPK15 was

reported for its role in regulation of energy homeostasis

and Snf1 (sucrose non-fermenting-1)-related protein kinase

SnRK1A; it linked O2-deficiency signals to the SnRK1A-

dependent sugar-sensing cascade that regulates sugar and

energy production, and enabled rice to germinate and grow

under submergence conditions (Lee et al., 2009).

In contrast with the intensive molecular and genetic

studies of the regulation of ethylene synthesis in Arabidop-

sis and its role in the energy metabolism-related adaptive

strategies for submergence tolerance in rice, the role of

ethylene in linking both drought and submergence stres-

ses has seldom been addressed. In this study, we charac-

terized a rice gene OsETOL1, a homolog of Arabidopsis

ETO1 that encodes a putative E3 ubiquitin ligase involved

in the regulation of ethylene synthesis. We also found that

OsETOL1 plays different roles in the submergence and

drought tolerance of rice by regulation of the balance of

energy metabolism under the two water stresses.

© 2014 The AuthorsThe Plant Journal © 2014 John Wiley & Sons Ltd, The Plant Journal, (2014), 78, 834–849

An ETOL1 homolog modulates water stress tolerance in rice 835

RESULTS

Function of OsETOL1 in drought tolerance

By screening drought-tolerant or sensitive rice mutants col-

lected from the T-DNA mutant library in the Rice Mutant

Database (Wu et al., 2003; Zhang et al., 2006), one mutant

(in the background of japonica rice Zhonghua11 [ZH11])

was identified that showed increased drought resistance at

the reproductive stage. Flanking sequence analysis of this

mutant indicated that a gene (LOC_Os03g18360) that

encoded a putative E3 ubiquitin ligase that belonged to the

ETO family was interrupted (Figure 1a), and this mutant

was designated as osetol1-1. Co-segregation analysis sug-

gested that the drought resistance phenotype was due to

the T-DNA insertion in the OsETOL1 gene (Figure 1b). We

collected an allelic mutant of the OsETOL1 gene, named

osetol1-2, that also showed the drought-resistant pheno-

type. The T-DNA insertion sites of the osetol1-1 and

osetol1-2 mutants were located in the third intron and the

first exon, respectively (Figure 1a). Transcript analysis of

OsETOL1 suggested that the expression of OsETOL1 was

abolished in both the osetol1-1 and osetol1-2 mutants (Fig-

ure 1c). Under normal conditions, the homozygous mutant

showed no obvious phenotypic changes when compared

with the wild-type genotype (designated WT0 hereafter)

segregated from the heterozygous mutant (Figure 1d). Dur-

ing the course of drought stress, the osetol1 mutant

showed no obvious difference in leaf wilting compared

with the WT0. However, after recovery, the mutant showed

a significantly higher spikelet fertility and biomass above-

ground when compared with the WT0 (Figure 1e,f). Never-

theless, no significant difference in drought tolerance was

observed for the mutant and WT0 at the seedling stage

(data not shown).

To test whether OsETOL1 over-expression (OE) has any

effect on drought resistance, the full-length cDNA of OsE-

TOL1 under the control of the maize ubiquitin promoter

(Figure S1a) was transformed into rice ZH11. Among the

22 independent transgenic plants generated, 13 plants

showed OE of the OsETOL1 transcript (Figure S1b). Two

of them (O9 and O22) were tested for drought resistance

at the four-leaf seedling and reproductive stages. Under

normal conditions, no phenotypic difference was

observed between the transgenic plants and wild-type

(WT), and no difference in drought tolerance was

observed at the seedling stage. After being drought-

stressed at the early panicle development stage followed

by recovery at the flowering stage, the positive OE plants

retained more green leaves (Figure 1g), but exhibited a

significantly lower spikelet fertility than WT (Figure 1h).

Nevertheless, the difference in the above-ground biomass

was not significant. These results suggest that the OsE-

TOL1 gene may have a negative role in drought tolerance

at the reproductive stage.

OsETOL1 functions in submergence tolerance

OsETOL1 is a homolog of the Arabidopsis ETO1 protein

that participates in the degradation of type-2 ACS, a rate-

limiting enzyme of ethylene biosynthesis (Wang et al.,

2004), and ethylene is involved in submergence tolerance

in rice (Fukao et al., 2006). Therefore, we further examined

the osetol1 mutant under submergence stress. The mutant

seedlings exhibited slower growth than the WT0 after beingsubmerged for 7 days (Figure 2a,b). We extended the sub-

mergence stress for 60 days up to the grain-filling (milking)

stage by keeping only the top leaf tips exposed in the air,

and observed that the osetol1 mutant grew slower than

the WT0 throughout the duration of the stress period (Fig-

ure 2c). Under normal conditions, however, no significant

difference was detected at both the seedling stage and the

panicle development stage. These results suggested that

OsETOL1 may have an important role for the growth of

rice under submergence stress.

The influence of OsETOL1-OE on submergence tolerance

was also evaluated. The OsETOL1-OE plants showed

increased plant height when compared with the controls at

4 days after complete submergence treatment (Figure 3a,b).

After a prolonged submergence treatment (for 12 days),

all of the first and second leaves of the OE plants were

longer than the controls (Figure 3a,b). In rice, submer-

gence can induce the expression and enzymatic activity of

amylase, which promotes the degradation of starch (Lee

et al., 2009; Magneschi and Perata, 2009). We found that

the total soluble sugar content declined gradually in both

the OsETOL1-OE plants and the control plants, however

the OE plants maintained significantly higher levels of sol-

uble sugar content than the controls during the course of

submergence stress (Figure 3c). Meanwhile, the soluble

sugar content was significantly lower in the osetol1

mutant than in the corresponding WT’ under submer-

gence stress (Figure 3c). Nevertheless, no significant dif-

ference of starch level in osetol1 and OE plants was found

under normal and submergence conditions (Figure S2).

These results suggest that the positive effect ofOsETOL1-OE

on plant growth under submergence conditions may be

partially due to the relatively high level of soluble sugar for

energy metabolism. In addition, the positive role of

OsETOL1 in submergence tolerance may be independent of

SNORKEL1/2 and SUB1A as these genes are absent in the

rice ZH11 (Figure S3).

Expression profiles of OsETOL1

The different phenotypes of the osetol1 mutant and OsE-

TOL1-OE plants under drought and submergence stresses

prompted us to examine the expression level of OsETOL1

under different stress and phytohormone treatments. As

shown in Figure 4(a), the OsETOL1 transcript level was

strongly induced by drought (18-fold) and ABA (11-fold),


836 Hao Du et al.

and it was also slightly induced by salt, heat, and ethyl-

ene treatments (Figure 4a). During submergence treat-

ment, the OsETOL1 transcript was rapidly induced to

about seven-fold at 12 h after the initiation of stress, but

after this time point the expression declined slowly to the

level seen under normal conditions, and it was

(a)

(b)

(c)

(d) (e)

(f)

(g)(h)

Figure 1. Identification of the osetol1 mutants and drought performance of osetol1 mutant and OsETOL1-over-expression rice.

(a) Schematic diagram of the OsETOL1 gene structure and two allelic T-DNA insertion mutants, osetol1-1 and osetol1-2.

(b) Genotypes of the segregated osetol1-1 and osetol1-2 mutants (nine plants shown) by using the forward primer (FP), reverse primer (RP), and the T-DNA pri-

mer (NTLB5). M, homozygous mutant; h, heterozygous mutant; WT0, wild-type segregated from the progenies of heterozygous mutant.

(c) Relative expression levels of OsETOL1 gene in the leaves of osetol1 mutants and wild-type (WT0) at seedling stage detected by quantitative polymerase chain

reaction (qPCR) using primer pairs FP1/RP1 and FP2/RP2 as indicated in Figure 1(a).

(d) Drought resistance phenotype at the panicle developmental stage (details in Experimental Procedures).

(e, f) The spikelet fertility and above-ground dry biomass (including straw and seeds at harvesting stage) after exposure to drought stress. Asterisks indicate sig-

nificant difference (t-test), *P < 0.05, **P < 0.01 level, values are means � standard deviation (SD) (n = 3).

(g) Appearance of positive OsETOL1-over-expression plants (09) and wild-type (WT-1) at the panicle developmental stage before drought stress and after

drought stress treatment and recovery.

(h) Analysis of the spikelet fertility and above-ground biomass. Asterisks indicate significant difference (t-test), *P < 0.05, **P < 0.01 level, values are

means � SD (n = 3).



suppressed after submergence for 5 days (Figure 4a).

OsETOL1 was not responsive significantly to the other

treatments (Figure 4a). As the mutant showed no obvious

phenotypic changes under other stress or phytohormone

treatments (data not shown), we propose that OsETOL1

may function primarily in regulation of drought and sub-

mergence tolerance.

The tempo-spatial expression of OsETOL1 under normal

growth conditions was also analysed. According to micro-

array data available from the rice gene expression data-

base (Wang et al., 2010), OsETOL1 is expressed

constitutively in most tissues and organs. It has relatively

higher expression levels in mature tissues than in imma-

ture tissues (Figure S4); this expression pattern was con-

firmed by quantitative polymerase chain reaction (qPCR)

analysis (Figure 4b). To further confirm the expression pro-

file of OsETOL1, the OsETOL1 promoter (approximately

2.5 kb upstream of the translation start site) fused to the b-glucuronidase (GUS) gene (Figure 4c) was transformed

into rice ZH11. The GUS signal in the transgenic rice was

strong in the anther, spikelet hull, node, old root, sheaths,

and mature leaves by comparison, but the signal was weak

in callus, young bud, root, and immature endosperm (Fig-

ure 4d–m), a finding that agreed well with the results from

the microarray and qPCR.

OsETOL1 interacts with OsACS2 in the cytosol

To determine the subcellular localization of OsETOL1, the

OsETOL1 coding sequence was fused in frame to the

green fluorescent protein (GFP) gene under the control of

the cauliflower mosaic virus 35S promoter. Arabidopsis

leaf protoplasts were co-transformed with 35S::OsETOL1-

EGFP and 35S::AtAOS-ERFP by polyethylene glycol (PEG)

treatment. AtAOS was used as a reference marker as it

has been reported as a cytosolic protein (Wang et al.,

1999). As shown in Figure 5(b), green fluorescence pro-

duced by OsETOL1-EGFP overlapped with red fluores-

cence (RFP) produced by 35S: AtAOS–ERFP (Figure 5a–d),

suggesting that OsETOL1 is a cytosolic protein. In Arabid-

opsis, ETO1 specifically interacts with and negatively reg-

ulates type 2 ACS (Wang et al., 2004). In rice, only one

type 2 ACS (OsACS2) was identified (Souza Cde et al.,

2008). In a yeast two-hybrid assay, OsETOL1 interacted

with OsACS2 (Figure 5e). The interaction between OsE-

TOL1 and OsACS2 was further confirmed by a bimolecu-

lar fluorescence complementation (BiFC) assay in

Arabidopsis protoplasts (Figure 5f–i). This result indicated

that OsETOL1 may function in ACC biosynthesis by inter-

acting with OsACS2 in rice.

OsETOL1 plays a negative role in ethylene biosynthesis

To further address the function of the OsETOL1�OsACS2

interaction in controlling the biosynthesis of ACC and eth-

ylene, we obtained a mutant of OsACS2 (also in the back-

ground of ZH11) with the T-DNA inserted in the promoter.

The transcript level of OsACS2 in the osacs2 mutant was

very low compared with the WT0 (Figure 6a). The OsACS2

gene was also responsive to drought and submergence

stresses (Figure 6b). As expected, the ACC level in the

osacs2 mutant was reduced significantly under normal,

(a) (b)

(c)

Figure 2. Phenotype of the osetol1 mutants

under submergence.

(a, b) The osetol1 mutant showed significantly

increased sensitivity to partial submergence

(complete submergence for 3 days and then

the water level was maintained so that the top

leaf tips were exposed, as indicated by the

white arrow, for 14 days) at the seedling

stage as indicated by the reduced growth rate.

Asterisks indicate significant difference (t-test),

**P < 0.01 level, values are means � standard

deviation (SD) (n = 8).

(c) The osetol1 mutant showed significantly

increased sensitivity to partial submergence

(complete submergence for 3 days and then

the water level was maintained, as indicated by

the white arrow, for up to 60 days) during the

vegetative and reproductive stages, as indi-

cated by the reduced plant height.


838 Hao Du et al.

drought, and submergence conditions (Figure 6c). The os-

acs2 mutant had a significantly lower spikelet fertility after

drought stress at the reproductive stage (Figure 6d), simi-

lar to the phenotypes of OsETOL1-OE rice.

To test whether OsACS2 and OsETOL1 are critical for

ACC and ethylene production in rice, we measured the rela-

tive contents of ACC and ethylene in the mutant and OsE-

TOL1-OE plants. The osetol1-1 plants produced higher

levels of ACC and ethylene than the control, while lower

contents of ACC and ethylene were detected in the OsE-

TOL1-OE plants under normal and stress conditions

(Figure 7a,b). In addition, the ethylene level was sup-

pressed by drought stress but enhanced by submergence

(Figure 7b). These results suggest that OsETOL1 negatively

influences the biosynthesis of ACC and ethylene via

interaction with OsACS2 in rice, the same mechanism as

established in Arabidopsis. To ascertain whether the accu-

mulation of ACC was associated with rice growth under

submergence conditions, the osetol1 mutant and OsETOL1-

OE plants with altered ACC levels were treated with exoge-

nous ACC under submergence or normal conditions. With-

out ACC treatment, OsETOL1-OE plants grew significantly

faster than the control under submergence conditions,

while the osetol1 mutant grew slower (Figure 7c). When

supplied with 10 lM ACC during the submergence stress,

the growth of osetol1 and OsETOL1-OE plants was not sig-

nificantly different compared with the corresponding WT

controls (Figure 7c,d); this result suggested that the effect

of OsETOL1 on plant growth under submergence condi-

tions was mainly due to the altered ACC (and/or ethylene)

levels in the mutant or over-expression plants. These

results when taken together suggested that OsETOL1 has a

role in control of the submergence response through the

regulation of ACC or ethylene biosynthesis.

Expression of energy metabolism-related genes in the

OsETOL1-OE and osetol1 plants

Regulation of energy metabolism has been commonly

adopted by plants in response to adverse environmental

changes. To determine whether the OsETOL1 gene is

involved in the regulation energy metabolism, a set of well

characterized genes that are related to carbohydrate catab-

olism and fermentation in rice were examined for their

expression levels in the OsETOL1-OE and WT plants. The

transcript levels of OsCIPK15, OsSnRK1, SUSY OsSUS1,a-amylase genes aAmy1, aAmy3, aAmy7, aAmy8 and alcohol

(a) (b)

(c)

Figure 3. OsETOL1-over-expression rice showed increased submergence tolerance.

(a, b) OsETOL1-over-expressing rice grew faster than the wild-type (WT0) under complete submergence conditions.

(c) Analysis of the soluble sugar content of OsETOL1 transgenic plants under submergence. Asterisks indicate significant difference (t-test), *P < 0.05,

**P < 0.01 level, values are means � SD (n = 3).



dehydrogenase genes Adh1 and Adh2 were increased in

the WT0 under submergence conditions at the seedling

stage. Under drought stress at the panicle development

stage, however, most of these genes showed no obvious

change in expression level, and two genes, aAmy7 and Os-

SUS1, were even suppressed (Figure 8a). Adh1 and Adh2,

which encode alcohol dehydrogenases necessary for fer-

mentative metabolism, showed significantly increased

expression in the osetol1 mutant under submergence con-

ditions (Figure 8a). The four genes (OsSUS1, aAmy1,

aAmy3, and aAmy8) that encode SUSY and a-amylase

were up-regulated significantly in the OsETOL1-OE plants,

but were slightly down-regulated in the osetol1 mutant

(Figure 8a). These results suggested that fermentation and

starch metabolism may be regulated reversely under

submergence conditions. OsCIPK15 regulates OsSnRK1A

and MYBS1, which influence the transcription of a-amylase

genes and alcohol dehydrogenase genes, which are

required for seedling germination and growth under com-

plete submergence conditions (Lee et al., 2009). We found

that the transcript levels of OsCIPK15, OsSnRK1A, and

MYBS1 were increased in the OsETOL1-OE plants under

submergence (Figure 8a). However, OsCIPK15 was up-

regulated in the osetol1 mutant under drought stress

conditions. Furthermore, the OsETOL1 transcript was sup-

pressed in the OsCIPK15-OE plants, which showed

enhanced salt stress tolerance in our previous study (Xiang

et al., 2007) (Figure 8b); this result suggested that the

expression of OsETOL1 may also be regulated by Os-

CIPK15-mediated signalling processes under submergence

stress. These results together indicated that OsETOL1 may

function in the increase in starch degradation to produce

soluble sugar, but may suppress the fermentation pathway

under submergence conditions.

(a)

(b)

(c)

(d) (e) (f)

(g)

(h)

(i) (j) (k) (l)

(m)

Figure 4. Expression pattern of OsETOL1.

(a) Relative expression of OsETOL1 under dif-

ferent treatments. The quantitative polymerase

chain reaction (qPCR) values were normalized

to Actin1 gene and then presented as fold-

change relative to time point 0. Seedlings (four-

leaf stage) were subjected to cold (4°C), heat

shock (42°C), salt (200 mM NaCl), ABA (200 lM),GA (200 lM), UV (ultraviolet), wounding, ethyl-

ene, drought and submergence stresses (details

in Experimental Procedures).

(b) Expression profiles of OsETOL1 in different

tissues or organs including: (1) clum; (2) node;

(3) sheath; (4) three-leaf shoot; (5) hull; (6) seed;

(7) secondary branching of inflorescence; (8)

anther; (9) calli induction stage; (10) calli

screening stage; (11) calli differentiation stage;

(12) young shoot; (13) young root; (14) flag leaf

(sampled in the morning); (15) flag leaf (sam-

pled in the afternoon); and (16) pulvinus.

(c) Diagram of the POsETOL1:GUS construct.

(d–m) GUS staining is shown in the first node

at the tiller stage (d), clum (e), leaf at tiller stage

(f), callus (g), plumule and radicle, 48 h after

emergence in the dark (h), root at tiller stage (i),

ligule, auricle, pulvini and sheath (j), the sec-

ondary branching and inflorescence (k), seed

(l), and hull (m).


840 Hao Du et al.

Specificity of OsETOL1 in stress tolerance

Two additional ETO homologs, OsETOL2 (LOC_

Os07g08120) and OsETOL3 (LOC_Os11g37520) showing 73

and 78% identity, respectively, to OsETOL1, were predicted

in the rice genome. According to the expression profiles of

these genes, retrieved from the publicly available Collec-

tions of Rice Expression Profiling (CREP) database (Wang

et al., 2010). OsETOL1 exhibits an expression pattern that

was distinctly different from OsETOL2 and OsETOL3. The

OsETOL1 expression level was high in stamens and young

panicles (Figures 4 and S3), while OsETOL2 and OsETOL3

showed extremely low levels (Figure S4). In endosperm

and sheath, the expression of OsETOL1 was significantly

lower than OsETOL2 and OsETOL3 (Figure S4). The expres-

sion levels of the OsETOL family genes were also signifi-

cantly different under various stress conditions. Although

OsETOL1 and OsETOL3 displayed similar expression pat-

terns in salt, submergence and ethylene treatments, only

OsETOL1 was induced strongly by drought stress and ABA

treatment (Figure S5).

The distinctive expression patterns imply that OsETOL1

may play a specific role in stress tolerance. To verify this

hypothesis, we produced RNA interference (RNAi) trans-

genic rice for OsETOL2 and OsETOL3, and amiR-OsETOL1/

2/3-transgenic rice in which the three genes were sup-

pressed by an artificial microRNA approach (Figure 9a). T1

plants (three OsETOL2-RNAi (2Li5, 2Li7, 2Li14), three OsE-

TOL3-RNAi (3Li1, 3Li5, 3Li13), and two amiRNA (ai-3 and

ai-8)) were tested for drought resistance at the panicle

development stage. Under normal conditions, these plants

were very similar to the WT (Figure 9b). After drought

stress treatment, the OsETOL2 and OsETOL3 RNAi plants

showed no difference in spikelet fertility compared with

the WT (Figures S6 and S7), but the amiRNA plants

showed a significantly higher spikelet fertility (Figure 9c,d).

With the exception that the amiR-OsETOL1/2/3-transgenic

plants showed slightly reduced growth under submer-

gence stress, the other RNAi plants showed no obvious dif-

ference when exposed to the submergence stress

conditions. In addition, ACC content in the OsETOL2-RNAi

and OsETOL3-RNAi plants showed no significant changes

(data not shown). These results together suggested that

OsETOL1, but not OsETOL2 and OsETOL3, may function

specifically in regulating drought and submergence toler-

ance.

DISCUSSION

Previous studies have implicated that ethylene is a prin-

cipal stress modulator, especially in pathogen-induced

defense responses, and ethylene production was ele-

vated in many plants upon pathogen attack (Bleecker

and Kende, 2000; Broekaert et al., 2006). Studies also

suggest that submergence or hypoxia induces the accu-

mulation of ethylene, and ethylene triggers GA-promoted

cell elongation needing carbohydrate consumption

(Kende et al., 1998; Fukao et al., 2006). Previous studies

demonstrated that the direct inhibition of ACS5 (a rate-

limiting enzyme in ethylene biosynthesis) activity by the

ETO1 protein family depends on the ubiquitin/26S

proteasome system (Wang et al., 2004; Broekaert et al.,

2006). In this study, yeast two-hybrid and BiFC assays

(a) (b) (c) (d)

(e)

(f) (g) (h) (i)

Figure 5. Cytosol-localized OsETOL1 interacts

with OsACS2.

(a–d) Localization of the OsETOL1–GFP fusion

protein is merged with the cytosol marker pro-

tein AtAOS–RFP in the cytosol.

(e) Interaction of OsETOL1 and OsACS2 in a

yeast two-hybrid assay. The constructs for

yeast transformation are as follows: 1, OsE-

TOL1-BD and OsACS2-AD; 2, Negative control;

3, positive control C; 4, positive control D.

(f–i) Interaction of OsETOL1 and OsACS2

detected by fluorescence in bimolecular fluores-

cence complementation (BiFC) in Arabidopsis

protoplasts.



indicated that OsETOL1 can interact with OsACS2. Addi-

tionally, we found that ACC and ethylene production

were impaired significantly in the osetol1 mutant (Fig-

ure 7a,b), and the ACC level was also reduced in the os-

acs2 rice mutant (Figure 6c), similar to that in the

OsETOL1-OE plants (Figure 7a). These results suggested

that OsETOL1 is also a negative regulator of ethylene

biosynthesis, and that the interaction between ETO1 and

ACS2 may be conserved in plants. In addition, the

expression of OsACS2 was also induced by drought and

submergence stresses (Figure S8), further supporting the

involvement of the ETO–ACS2 interaction in the regula-

tion of stress tolerance.

A role for ETO genes in drought tolerance has not yet

been reported. Although the osetol1 mutant showed no

significant differences when compared with the WT0 at

the seedling stage, the mutant exhibited a significantly

higher spikelet fertility and biomass than the WT0 after

exposure to drought stress at the reproductive stage (Fig-

ure 1e,f). The OsETOL1-OE plants showed decreased

drought tolerance as indicated by significantly lower

spikelet fertility after exposure to drought stress even

though the OE plants retained more green leaves com-

pared with the WT (Figure 1g,h). The ACC-deficient os-

acs2 mutant also showed reduced spikelet fertility after

exposure to drought stress (Figure 6d). These results

(a) (b)

(c) (d)

Figure 6. Identification of the 1-amino-cyclopropane-1-carboxylate (ACC)-deficient mutant osacs2.

(a) Schematic diagram of the OsACS2 gene structure and T-DNA insertion position in osacs2 mutant (top) and transcript analysis of OsACS2 in the leaves of os-

acs2-1 and osacs2-2 (two progenies generated from a heterozygous osacs2 mutant) and WT’ at seedling stage detected by quantitative polymerase chain reac-

tion (qPCR) (bottom). F1, forward primer; R1 (reverse primer). The qPCR values were normalized to Actin1 gene and then presented as fold-change relative to

osacs2-1.

(b) Relative expression of OsACS2 under drought and submergence treatments detected by qPCR (with qPCR values normalized to Actin1 gene and then pre-

sented as fold-change relative to osacs2-1).

(c) Quantification of the relative ACC content in osacs2 leaves at seedling stage before and after drought stress for 2 days. The values are relative to WT0-1 under

normal conditions. Asterisks indicate significant difference (t-test), *P < 0.05, **P < 0.01 level, values are means � SD (n = 3).

(d) The spikelet fertility in normal condition and after drought stress. Asterisks indicate significant difference (t-test), *P < 0.05, **P < 0.01 level, values are

means � standard deviation (SD) (n = 3).


842 Hao Du et al.

provide a link between ethylene and adaptation strategies

under drought conditions. Water stress can limit ethylene

production and the process may interact with ABA or

other hormones (Sharp, 2002), and suggested that ethyl-

ene has an important role in the plant response to

drought stress. Microarray and qPCR analyses showed

that many genes involved in ethylene biosynthesis or sig-

nalling pathways were suppressed under drought stress

conditions (Manavella et al., 2006). Over-expression of

the HD-Zip type transcription factor gene Hahb-4 in Ara-

bidopsis caused enhanced drought tolerance, mainly due

to the inhibition of ethylene-induced senescence (Manav-

ella et al., 2006). The senescence delay may help to

maintain active photosynthesis for longer periods, thus

allowing plants to synthesize osmoprotectants and other

metabolites (Manavella et al., 2006). And drought stress

decreases photosynthetic potential and an array of com-

plex metabolic progresses, resulting in disturbances in

energy metabolism (Chaves et al., 2009). In this study, no

significant difference in the photosynthetic rate was

(a) (b)

(c)

(d)

Figure 7. Quantification and identification of the 1-amino-cyclopropane-1-carboxylate (ACC) and ethylene levels.

(a) Quantification of the relative ACC content in the leaves of osetol1 and OsETOL1-over-expression plants under normal and drought stress (for 2 days; 2d) and

submergence (for 3 days; 3d) at seedling stage. osetol1-1 and osetol1-2 are two independent osetol1 plants; WT0, wild-type segregated from the progenies of

heterozygous osetol1 mutant; 06 and 09 as OsETOL1-over-expression lines. Asterisks indicate significant difference (t-test), *P < 0.05, **P < 0.01 levels respec-

tively, Values, relative to the corresponding WT0, are means � standard deviation (SD) (n = 3).

(b) Quantification of ethylene content in the leaves by gas chromatograph at seedling stage. Asterisks indicate significant difference at P < 0.05 and P < 0.01

levels, respectively. Values are means � SD (n = 3).

(c) Growth performance of ACC-deficient rice seedlings under normal and submergence conditions with exogenous ACC (10 lM ACC was added along with

submergence treatment.

(d) Statistics result for (c). Asterisks indicate significant difference at P < 0.05 and P < 0.01 levels, respectively. Values are means � SD (n = 3).



observed between the osetol1 mutant and the WT0 (data

not shown). However, the OsETOL1-OE rice exhibited an

obvious delay in senescence under drought stress condi-

tions (Figure 1g), which may result in a delay in the

transportation of carbohydrates from leaves to the

developing seeds, and finally lead to a reduced spikelet

fertility.

ABA plays an important role in drought resistance, and

has been well studied in many plants. We examined the

expression of several ABA-dependent drought-responsive

genes including TRAB1, RAB16A, and LEA3, however none

of them exhibited a difference in transcript level between

osetol1 and the WT0 under normal, drought, or submer-

gence conditions. The endogenous ABA level, ABA

sensitivity, and water loss rate of leaves were not signifi-

cantly different between osetol1 and the WT’ either under

normal or drought conditions (data not shown), implying

that OsETOL1 may be involved in drought resistance inde-

pendently of ABA signalling pathways. Interestingly, the

OsCIPK15 gene, which was reported to have a role in regu-

lation of energy homeostasis (Lee et al., 2009), was up-

regulated, but the a-amylase genes (aAmy1 and aAmy3),

which participate in starch degradation under drought

stress, were suppressed in the osetol1 mutant (Figure 8).

These results when taken together imply that energy

metabolism may be obstructed in osetol1 mutant. When

considering the conserved biochemical function of OsE-

TOL1 in negatively modulating ethylene production, we

(a)

(b)

Figure 8. Expression levels of genes related to energy metabolism under normal condition (NC) and stress (DR, drought; Sub, submergence) conditions in rice

leaves at seedling stage. The quantitative polymerase chain reaction (qPCR) values were normalized to Actin1 and then presented as fold-change relative to the

wild-type (WT) under NC.

(a) Expression of selected energy-metabolic genes in the OsETOL1-OE and osetol1 mutant.

(b) Expression of OsETOL1 in OsCIPK15 over-expression plants.


844 Hao Du et al.

propose that ethylene plays an important role in the starch

metabolism under drought stress conditions, especially at

the grain-filling and maturation stages.

Ethylene and GA were accumulated to higher levels

under submergence (Bailey-Serres and Voesenek, 2010). In

this study, we observed that OsETOL1 was induced by eth-

ylene and submergence, but was suppressed by GA (Fig-

ure 4a), this result suggested that OsETOL1 is indeed

involved in the submergence response in rice. SNORKEL1

and SNORKEL2 were cloned from a deep-water rice variety,

(a)

(b) (c)

(d)

Figure 9. Functional specificity of OsETOL1.

(a) The relative expression levels of amiR-OsETOL1/2/3 transgenic plants by quantitative polymerase chain reaction (qPCR) analysis. For each gene, the qPCR

values were normalized to Actin1 and then presented as fold-change relative to wild-type (WT).

(b) Performance of the osetol1 mutant, OsETOL2-RNAi, OsETOL2-RNAi, amiR-OsETOL1/2/3, and WT plants at heading stage.

(c) The performance of ai-3 and WT in the field before exposure to drought stress (top) and after drought stress and recovery (bottom).

(d) The spikelet fertility of RNA interference plants under normal conditions and after drought treatment at reproductive stage. Asterisks indicate significant dif-

ference (t-test), **P < 0.01 level, values are means � SD (n = 3).



in which ethylene accumulates under submergence condi-

tions to induce remarkable internode elongation via the eth-

ylene and GA signalling pathways (Hattori et al., 2009).

However, SNORKEL1 and SNORKEL2 were not present in

the non-deep-water rice variety ZH11 used in this study and

the SUB1A allele was also absent in ZH11 either (Figure S3).

Furthermore, rice varieties that possessed the SUB1A gene

displayed a distinct flooding-tolerant phenotype. This evi-

dence suggested that the function of OsETOL1may be inde-

pendent of the SNORKEL or SUB1A pathway.

Recently, an in silico flux analysis revealed that meta-

bolic utilization of glycolysis and ethanol fermentation

were based on the oxygen availability and the efficient

breakdown of sucrose through SUSY instead of invertase

under submergence conditions (Lakshmanan et al., 2013),

this finding suggested essential roles for energy produc-

tion and distribution in the adaptation of plants to submer-

gence conditions. Moreover, previous study showed that

alcohol dehydrogenase genes were induced by complete

submergence in SUB1A rice (Fukao et al., 2006), and tran-

scriptome profiling analysis suggested that SUB1A regu-

lates multiple pathways associated with growth,

metabolism, and stress endurance (Jung et al., 2010). In

this study, Adh1 and Adh2 were suppressed in the OsE-

TOL1-OE plants under submergence conditions (Fig-

ure 8a), implying that the fermentation process may be

suppressed by OsETOL1, which is different to that in the

SUB1A rice. A previous study has shown that alcohol

dehydrogenase can repress the expression of a-amylases

involved in starch degradation and cell elongation in

leaves (Ismond et al., 2003). Protein levels and the activity

of a-amylase were shown to be induced by anoxia at the

seedling stage in rice (Guglielminetti et al., 1995). Here, we

found that the a-amylase and SUSY genes were induced

under submergence stress and that the induction was

increased in the OsETOL1-OE plants under submergence

conditions (Figure 8a), a finding that agrees with the signif-

icantly higher levels of soluble sugar in OsETOL1-OE

plants under submergence conditions (Figure 3c). A previ-

ous study has shown that SnRK1A is an important interme-

diate in the sugar signalling cascade, functioning upstream

of MYBS1 and aAmy3, and playing a key role in regulating

seed germination and seedling growth in rice (Lu et al.,

2007). Another study has suggested that OsCIPK15 is a key

regulator in the SnRK1-dependent sugar-sensing cascade,

and that it regulates sugar and energy production to

enable rice growth under submergence conditions (Lee

et al., 2009). Interestingly, the OsETOL1 transcript was

up-regulated in the OsCIPK15-OE plants (Figure 8b),

and suggested that the expression of OsETOL1 may also

be regulated by OsCIPK15-mediated signalling processes

under submergence conditions. Meanwhile, several energy

metabolism-related upstream genes, including MYBS1,

SnRK1A, and OsCIPK15 and starch degradation genes

aAmy and Sus1, were up-regulated in the OsETOL1-OE

plants under submergence conditions (Figure 8a); this

result further supported the idea that OsETOL1 may be

involved in the regulation of energy metabolism under

submergence conditions.

In conclusion, our findings suggested that OsETOL1 nega-

tively controls ACC and ethylene production, and we pro-

pose a simplified model for the distinct roles of OsETOL1 in

drought and submergence tolerance (Figure 10). Under

drought stress at the reproductive stage, the function of OsE-

TOL1 may inhibit the transportation of carbohydrates from

leaves to the developing seeds and result in a reduction in

grain-filling and spikelet fertility and a delay in ethylene-

induced maturation. Under submergence conditions, how-

ever, carbohydrate consumption and energy production was

promoted by OsETOL1, this change enabled the upper

leaves to elongate to extend above the surface of the water.

Thus, the same function of OsETOL1 in modulation of ethyl-

ene production caused different morphological alterations

in rice under drought and submergence conditions. The

OsETOL1-mediated ethylene production and energy metab-

olism may provide an access to reveal the adaptation strat-

egy to drought and submergence stresses in plants.

EXPERIMENTAL PROCEDURES

Plant materials and stress treatments

The osetol1-1 (04Z11DH56), osetol1-2 (05Z11E078), and osacs2(03Z11BK09) mutants (in the background of japonica rice Zhong-hua11 [ZH11]) were obtained from the Rice Mutant Database(http://rmd.ncpgr.cn/) (Wu et al., 2003; Zhang et al., 2006). Fordrought testing of the mutant and OE plants, seeds of T1 or T2

Figure 10. Working model for the function of OsETOL1 in response to

drought and submergence stresses.


846 Hao Du et al.

http://rmd.ncpgr.cn/

over-expression families and osetol1 mutants were germinated onMurashige and Skoog (MS) medium with 50 mg/L hygromycin.Drought stress at the reproductive stage was performed in sandy-mixed-soil field facilitated with a removable rain-off shelter. Thedetails of drought treatment and trait measurement were thesame as in a previous report (Hu et al., 2006). For submergencetreatment, WT plants of ZH11 were grown in the greenhouseunder a 14-h light/10-h dark cycle. Seedlings at the 4-leaf stagewere transferred to a deep tank, and fully submerged in the tanksfor 3 days, and the leaves were sampled (leaves from non-stressed control plants were collected at the same time points).The plants were maintained in submerged conditions, with thetop leaf tips (3–5 cm) exposed above the water, until the plantheight and other traits were measured.

To examine the transcript levels of genes under various stres-ses, seedlings at the four-leaf stage were subjected to cold (4°C);heat shock (42°C); salt (200 mM NaCl); and ultraviolet (UV) lighttreatment as described in our previous study (Du et al., 2010).Other treatments for expression level analyses were also con-ducted at the four-leaf stage. Wounding treatment was conductedby pricking leaves with a syringe followed by sampling at 0, 1, 3,and 6 h. Submergence treatment was conducted by transferringthe seedlings to a deep tank, with plants fully submerged, andleaves were sampled at 6 h, 12 h, 1 day, 3 days, 5 days, 7 days,and at 2 days after recovery. Ethylene treatment was conductedby injecting ethylene into a small plant growth chamber followedby sampling at 0, 1, 6, and 12 h. ABA or GA treatment was con-ducted by spraying 200 lM ABA or 200 lM GA on leaves followedby sampling at 0, 2, 6, 12 h, or 0, 1, 3, 6, and 12 h for GA, afterspraying. For ACC treatment, the seeds were sterilized with HgCl2(0.15%) and germinated for 4 days, and then grown in transparentplastic boxes (6 9 6 9 12 cm) with ½MS medium (0.6% agar, withor without 10 lM ACC; Sigma, USA, http://www.sigma-aldrich.-com) in a growth chamber at 25°C with a 14 h light/10 h dark cyclefor 2 days. Then the seedlings were submerged with sterilizedwater and kept to grow for 5 days before photography and mea-surement.

Plasmid construction and rice transformation

To generate the OsETOL1 OE constructs, the full-length cDNA ofOsETOL1 was amplified from rice ZH11, and the full-length cDNAproduct was introduced into the destination vector pCB1301U(under the control of the maize ubiquitin promoter). To investigatethe expression profile of OsETOL1, a genomic DNA sequence fromthe OsETOL1 promoter region (�2500 bp to +100 bp relative to theinitiation of transcription) was cloned into the DX2181 vector infront of the GUS reporter gene. The OsETOL2-RNAi and OsETOL3-RNAi constructs were made by introducing a fragment of 500 and600 bp, respectively, in the open reading frame region, into thepDS1301 vector (Chu et al., 2006). For the artificial microRNA con-struct, we used TAAACTGCGCATTCCAGCCTT as a conservedsequence to target the OsETOL1, OsETOL2, and OsETOL3 genessimultaneously using a method reported previously (Warthmannet al., 2008). The gene-specific primers for constructs are listed inTable S1. These constructs were introduced into japonica rice ZH11by Agrobacterium-mediated transformation (Lin and Zhang, 2005).

Gene expression analyses

Total RNA was isolated from rice leaves using Trizol reagent (Invi-trogen), and the DNase-treated RNA was reverse transcribed usingSuperScript reverse transcriptase (Invitrogen, http://www.lifetech-nologies.com) according to the manufacturer’s instructions. Quan-titative polymerase chain reaction (qPCR) was performed on an

optical 96-well plate in an ABI PRISM 7500 real-time PCR system(Applied Biosystems, http://www.appliedbiosystems.com) byusing SYBR Premix Ex Taq reagent (TaKaRa, http://www.takara.com). Reactions were performed in 20-ll volumes with the follow-ing protocol: first step of 94°C for 5 min and 40 cycles of 94°C for10 sec, and 68°C for 35 sec. The gene-specific qPCR primers arelisted in Table S1. The relative expression level of genes wasdetermined with the rice Actin1 gene as an internal control. Therelative expression level was calculated by the function describedpreviously (Livak and Schmittgen, 2001).

Subcellular localization and bimolecular fluorescence

complementation assays

To investigate the subcellular localization of the OsETOL1 pro-tein, the full OsETOL1 ORF was cloned into the pM999-33 vec-tor, and fused with the GFP reporter gene. Plasmids werepurified using the QIAGEN kit (Valencia, CA, USA, http://www.qiagen.com) columns in accordance with the manufac-turer’s protocol. The plasmids together with 35S::AtAOS:RFP asa cytosolic marker were introduced into Arabidopsis protoplastsin accordance with the method reported by (Yoo et al., 2007)with the minor modification that 5 lg of each plasmid was used.For BiFC analysis, OsETOL1 was cloned into the pVYNE vectorand fused to the N-terminus (1–155 aa) of yellow fluorescentprotein, and OsACS2 was cloned into the pVYCE vector andfused to the C-terminus (156–239 aa). The detailed informationregarding the BiFC vectors was provided by Waadt et al. (2008).Combinations of the BiFC constructs were expressed transientlyin protoplasts from Arabidopsis leaves via polyethylene glycoltransformation. The expression of the fusion protein was moni-tored after 16 h of incubation in a dark room, and the fluores-cence was captured by a confocal microscope (TCS SP2 Leica,http://www.leica.com).

Yeast two-hybrid assays

The yeast two-hybrid assay was performed using the ProQuestTwo-Hybrid System (Invitrogen). The open reading frame of OsE-TOL1 that was generated by PCR was fused in frame with theyeast GAL4 DNA binding domain in the pDEST32 vector by theGateway Recombination Cloning method (Invitrogen). Similarly,the open reading frame of OsACS2 was fused in frame with theyeast GAL4 activation domain in the pDEST22 vector by the Gate-way Recombination Cloning method (Invitrogen) to generate baitand prey vectors, respectively. The two vectors were co-trans-formed into the yeast strain Mav203, and the valid transformantswere identified according to the manufacturer’s instructions. Thecolony-lift filter assay (X-gal assay) was performed as describedby the manufacturer (Invitrogen).

Quantification of ethylene and ABA

The ethylene levels of the plants grown in gas-chromatography(GC) vials (B7990-6A; National Scientific Company, Rockwood,USA, http://www.nsc-ksa.com) were determined by GC asdescribed previously (Shen et al., 2011). Quantification of ABAwas performed by the ABI 4000Q-TRAR LC-MS system with sta-ble-isotope-labeled ABA (D-ABA) as the standard (OlChemIm,Czech Specials) according to the methods described previously(Liu et al., 2012).

ACKNOWLEDGEMENTS

We thank Jian Xu and Rongjian Ye (Huazhong Agricultural Univer-sity) for providing plasmid pM999-33 and DX2181, respectively.



http://www.sigma-aldrich.com

http://www.sigma-aldrich.com

http://www.lifetechnologies.com

http://www.lifetechnologies.com

http://www.appliedbiosystems.com

http://www.takara.com

http://www.takara.com

http://www.qiagen.com

http://www.qiagen.com

http://www.leica.com

http://www.nsc-ksa.com

This work was supported by grants from the National Program forBasic Research of China (2012CB114305), the National Program onHigh Technology Development (2012AA10A303), the NationalNatural Science Foundation of China (31271316), the NationalProgram of China for Transgenic Research (2011ZX08009-003-002,2011ZX08001-003), and the Huazhong Agricultural University Sci-entific and Technological Self-innovation Foundation.

SUPPORTING INFORMATION

Additional Supporting Information may be found in the online ver-sion of this article.Figure S1. The OsETOL1 construct and analysis of the expressionlevel in transgenic plants.Figure S2. Starch content in leaves of OsETOL1 transgenic plantsand WT at seedling stage under normal and submergence condi-tions, DW, dry weight.Figure S3. Genotyping analysis of gene loci (SK1, SK2, andSUB1A) in the rice genotype ZH11 used in this work.Figure S4. Expression profiles of three OsETOL genes in the tis-sues and organs covering the entire life cycle of rice.Figure S5. Distinctive expression features of OsETOL family mem-bers under stress treatments (details in Experimental Procedures)as shown by heatmaps based on the log-transformed fold-change(relative time point 0) data derived from qPCR.Figure S6. Performance of OsETOL2-RNAi plants.Figure S7. Performance of OsETOL3-RNAi plants.Figure S8. Distinctive expression features of OsACS2 under stresstreatments.

Table S1. Primers used in this study.

REFERENCES

Bailey-Serres, J. and Voesenek, L.A. (2008) Flooding stress: acclimations

and genetic diversity. Annu. Rev. Plant Biol. 59, 313–339.Bailey-Serres, J. and Voesenek, L.A. (2010) Life in the balance: a signaling

network controlling survival of flooding. Curr. Opin. Plant Biol. 13, 489–494.

Bleecker, A.B. and Kende, H. (2000) Ethylene: a gaseous signal molecule in

plants. Annu. Rev. Cell Dev. Biol. 16, 1–18.Broekaert, W.F., Delaure, S.L., De Bolle, M.F. and Cammue, B.P. (2006) The

role of ethylene in host–pathogen interactions. Annu. Rev. Phytopathol.

44, 393–416.de Bruxelles, G.L., Peacock, W.J., Dennis, E.S. and Dolferus, R. (1996) Absci-

sic acid induces the alcohol dehydrogenase gene in Arabidopsis. Plant

Physiol. 111, 381–391.Chaves, M.M., Flexas, J. and Pinheiro, C. (2009) Photosynthesis under

drought and salt stress: regulation mechanisms from whole plant to cell.

Ann. Bot. 103, 551–560.Christians, M.J., Gingerich, D.J., Hansen, M., Binder, B.M., Kieber, J.J. and

Vierstra, R.D. (2009) The BTB ubiquitin ligases ET01, EOL1 and EOL2 act

collectively to regulate ethylene biosynthesis in Arabidopsis by control-

ling type-2 ACC synthase levels. Plant J, 57, 332–345.Chu, Z., Yuan, M., Yao, J. et al. (2006) Promoter mutations of an essential

gene for pollen development result in disease resistance in rice. Genes

Dev. 20, 1250–1255.Du, H., Wang, N., Cui, F., Li, X., Xiao, J. and Xiong, L. (2010) Characteriza-

tion of the beta-carotene hydroxylase gene DSM2 conferring drought

and oxidative stress resistance by increasing xanthophylls and abscisic

acid synthesis in rice. Plant Physiol. 154, 1304–1318.Frankowski, K., Kesy, J. and Kopcewicz, J. (2007) Regulation of ethylene

biosynthesis in plants. Postepy Biochem. 53, 66–73.Fukao, T. and Xiong, L. (2013) Genetic mechanisms conferring adaptation to

submergence and drought in rice: simple or complex? Curr. Opin. Plant

Biol. 16, 196–204.Fukao, T., Xu, K., Ronald, P.C. and Bailey-Serres, J. (2006) A variable cluster

of ethylene response factor-like genes regulates metabolic and

developmental acclimation responses to submergence in rice. Plant Cell,

18, 2021–2034.Fukao, T., Yeung, E. and Bailey-Serres, J. (2011) The submergence tolerance

regulator SUB1A mediates crosstalk between submergence and drought

tolerance in rice. Plant Cell, 23, 412–427.Ghassemian, M., Nambara, E., Cutler, S., Kawaide, H., Kamiya, Y. and

McCourt, P. (2000) Regulation of abscisic acid signaling by the ethylene

response pathway in Arabidopsis. Plant Cell, 12, 1117–1126.Gingerich, D.J., Gagne, J.M., Salter, D.W., Hellmann, H., Estelle, M., Ma, L.

and Vierstra, R.D. (2005) Cullins 3a and 3b assemble with members of

the broad complex/tramtrack/bric-a-brac (BTB) protein family to form

essential ubiquitin-protein ligases (E3s) in Arabidopsis. J. Biol. Chem.

280, 18810–18821.Guglielminetti, L., Yamaguchi, J., Perata, P. and Alpi, A. (1995) Amylolytic

activities in cereal seeds under aerobic and anaerobic conditions. Plant

Physiol. 109, 1069–1076.Gupta, K.J., Zabalza, A. and van Dongen, J.T. (2009) Regulation of respira-

tion when the oxygen availability changes. Physiol. Plant. 137, 383–391.Hattori, Y., Nagai, K., Furukawa, S. et al. (2009) The ethylene response fac-

tors SNORKEL1 and SNORKEL2 allow rice to adapt to deep water. Nat-

ure, 460, 1026–1030.Hirayama, T. and Shinozaki, K. (2010) Research on plant abiotic stress

responses in the post-genome era: past, present and future. Plant J, 61,

1041–1052.Hu, H., Dai, M., Yao, J., Xiao, B., Li, X., Zhang, Q. and Xiong, L. (2006) Over-

expressing a NAM, ATAF, and CUC (NAC) transcription factor enhances

drought resistance and salt tolerance in rice. Proc. Natl Acad. Sci. USA,

103, 12987–12992.Ismond, K.P., Dolferus, R., de Pauw, M., Dennis, E.S. and Good, A.G. (2003)

Enhanced low oxygen survival in Arabidopsis through increased meta-

bolic flux in the fermentative pathway. Plant Physiol. 132, 1292–1302.Jung, K.H., Seo, Y.S., Walia, H., Cao, P., Fukao, T., Canlas, P.E., Amonpant,

F., Bailey-Serres, J. and Ronald, P.C. (2010) The submergence tolerance

regulator Sub1A mediates stress-responsive expression of AP2/ERF tran-

scription factors. Plant Physiol. 152, 1674–1692.Kende, H., van der Knaap, E. and Cho, H.T. (1998) Deepwater rice: a model

plant to study stem elongation. Plant Physiol. 118, 1105–1110.Lakshmanan, M., Zhang, Z., Mohanty, B., Kwon, J.Y., Choi, H.Y., Nam, H.J.,

Kim, D.I. and Lee, D.Y. (2013) Elucidating the rice cells metabolism under

flooding and drought stresses using flux-based modelling and analysis.

Plant Physiol. 162, 2140–2150.Lee, K.W., Chen, P.W., Lu, C.A., Chen, S., Ho, T.H. and Yu, S.M. (2009) Coor-

dinated responses to oxygen and sugar deficiency allow rice seedlings

to tolerate flooding. Sci. Signal. 2, ra61.

Licausi, F., van Dongen, J.T., Giuntoli, B., Novi, G., Santaniello, A., Geigen-

berger, P. and Perata, P. (2010) HRE1 and HRE2, two hypoxia-inducible

ethylene response factors, affect anaerobic responses in Arabidopsis tha-

liana. Plant J, 62, 302–315.Lin, Y.J. and Zhang, Q. (2005) Optimising the tissue culture conditions for

high efficiency transformation of indica rice. Plant Cell Rep. 23, 540–547.Liu, H., Li, X., Xiao, J. and Wang, S. (2012) A convenient method for simul-

taneous quantification of multiple phytohormones and metabolites:

application in study of rice-bacterium interaction. Plant Methods, 8, 2.

Livak, K.J. and Schmittgen, T.D. (2001) Analysis of relative gene expression

data using real-time quantitative PCR and the 2�DDCT Method. Methods,

25, 402–408.Lu, C.A., Lin, C.C., Lee, K.W., Chen, J.L., Huang, L.F., Ho, S.L., Liu, H.J.,

Hsing, Y.I. and Yu, S.M. (2007) The SnRK1A protein kinase plays a key

role in sugar signaling during germination and seedling growth of rice.

Plant Cell, 19, 2484–2499.Magneschi, L. and Perata, P. (2009) Rice germination and seedling growth

in the absence of oxygen. Ann. Bot. 103, 181–196.Manavella, P.A., Arce, A.L., Dezar, C.A., Bitton, F., Renou, J.P., Crespi, M.

and Chan, R.L. (2006) Cross-talk between ethylene and drought signalling

pathways is mediated by the sunflower Hahb-4 transcription factor. Plant

J, 48, 125–137.Metraux, J.P. and Kende, H. (1983) The role of ethylene in the growth

response of submerged deep water rice. Plant Physiol. 72, 441–446.Sharp, R.E. (2002) Interaction with ethylene: changing views on the role of

abscisic acid in root and shoot growth responses to water stress. Plant

Cell Environ. 25, 211–222.


848 Hao Du et al.

Shen, X., Liu, H., Yuan, B., Li, X., Xu, C. and Wang, S. (2011) OsEDR1 nega-

tively regulates rice bacterial resistance via activation of ethylene biosyn-

thesis. Plant Cell Environ. 34, 179–191.Souza Cde, A., Barbazuk, B., Ralph, S.G., Bohlmann, J., Hamberger, B. and

Douglas, C.J. (2008) Genome-wide analysis of a land plant-specific acyl:

coenzyme A synthetase (ACS) gene family in Arabidopsis, poplar, rice

and Physcomitrella. New Phytol. 179, 987–1003.Tanaka, Y., Sano, T., Tamaoki, M., Nakajima, N., Kondo, N. and Hasezawa,

S. (2005) Ethylene inhibits abscisic acid-induced stomatal closure in Ara-

bidopsis. Plant Physiol. 138, 2337–2343.Tsuchisaka, A. and Theologis, A. (2004) Unique and overlapping expression

patterns among the Arabidopsis 1-amino-cyclopropane-1-carboxylate

synthase gene family members. Plant Physiol. 136, 2982–3000.Waadt, R., Schmidt, L.K., Lohse, M., Hashimoto, K., Bock, R. and Kudla, J.

(2008) Multicolor bimolecular fluorescence complementation reveals

simultaneous formation of alternative CBL/CIPK complexes in planta.

Plant J, 56, 505–516.Wang, C., Avdiushko, S. and Hildebrand, D.F. (1999) Overexpression of a

cytoplasm-localized allene oxide synthase promotes the wound-induced

accumulation of jasmonic acid in transgenic tobacco. Plant Mol. Biol. 40,

783–793.Wang, K.L., Li, H. and Ecker, J.R. (2002) Ethylene biosynthesis and signaling

networks. Plant Cell, 14(Suppl), S131–S151.Wang, K.L., Yoshida, H., Lurin, C. and Ecker, J.R. (2004) Regulation of ethylene

gas biosynthesis by the Arabidopsis ET01 protein. Nature, 428, 945–950.Wang, L., Xie, W., Chen, Y. et al. (2010) A dynamic gene expression atlas

covering the entire life cycle of rice. Plant J, 61, 752–766.Warthmann, N., Chen, H., Ossowski, S., Weigel, D. and Herve, P. (2008)

Highly specific gene silencing by artificial miRNAs in rice. PLoS ONE, 3,

e1829.

Wilkinson, S. and Davies, W.J. (2010) Drought, ozone, ABA and ethylene:

new insights from cell to plant to community. Plant Cell Environ. 33,

510–525.Woeste, K.E., Ye, C. and Kieber, J.J. (1999) Two Arabidopsis mutants that

overproduce ethylene are affected in the posttranscriptional regulation

of 1-aminocyclopropane-1-carboxylic acid synthase. Plant Physiol. 119,

521–530.Wu, C., Li, X., Yuan, W. et al. (2003) Development of enhancer trap lines for

functional analysis of the rice genome. Plant J, 35, 418–427.Xiang, Y., Huang, Y. and Xiong, L. (2007) Characterization of stress-respon-

sive CIPK genes in rice for stress tolerance improvement. Plant Physiol.

144, 1416–1428.Xu, K., Xu, X., Fukao, T., Canlas, P., Maghirang-Rodriguez, R., Heuer, S., Is-

mail, A.M., Bailey-Serres, J., Ronald, P.C. and Mackill, D.J. (2006) Sub1A

is an ethylene-response-factor-like gene that confers submergence toler-

ance to rice. Nature, 442, 705–708.Yamagami, T., Tsuchisaka, A., Yamada, K., Haddon, W.F., Harden, L.A. and

Theologis, A. (2003) Biochemical diversity among the 1-amino-cyclopro-

pane-1-carboxylate synthase isozymes encoded by the Arabidopsis gene

family. J. Biol. Chem. 278, 49102–49112.Yoo, S.D., Cho, Y.H. and Sheen, J. (2007) Arabidopsis mesophyll protop-

lasts: a versatile cell system for transient gene expression analysis. Nat.

Protoc. 2, 1565–1572.Yoshida, H., Wang, K.L., Chang, C.M., Mori, K., Uchida, E. and Ecker, J.R.

(2006) The ACC synthase TOE sequence is required for interaction with

ET01 family proteins and destabilization of target proteins. Plant Mol.

Biol. 62, 427–437.Zhang, J., Li, C., Wu, C., Xiong, L., Chen, G., Zhang, Q. and Wang, S. (2006)

RMD: a rice mutant database for functional analysis of the rice genome.

Nucleic Acids Res. 34, D745–D748.



Documents

The Plant Journal 78, 834–849 doi: …croplab.hzau.edu.cn › __local › 2 › 7F › 75 › B9A8EF030814E51993C...By screening drought-tolerant or sensitive rice mutants col-lected