of 36 /36
1 The Lac Operon 1961, Jacob and Monod E. coli and other bacteria Bacterial Genes Many genes constitutively expressed “housekeeping” genes Other genes are more regulated Can be turned on, or off depending on cell needs

The Lac Operon 1961 , Jacob and Monod E. coli and other bacteria

  • Upload
    chaela

  • View
    64

  • Download
    2

Embed Size (px)

DESCRIPTION

The Lac Operon 1961 , Jacob and Monod E. coli and other bacteria. Bacterial Genes Many genes constitutively expressed “housekeeping” genes Other genes are more regulated Can be turned on, or off depending on cell needs. HOUSEKEEPING GENES. actin, beta (ACTB) - PowerPoint PPT Presentation

Citation preview

Page 1: The Lac Operon 1961 ,  Jacob and Monod E. coli and other bacteria

1

The Lac Operon 1961, Jacob and MonodE. coli and other bacteria

Bacterial Genes Many genes constitutively expressed

“housekeeping” genes

Other genes are more regulated Can be turned on, or off depending on cell needs

Page 2: The Lac Operon 1961 ,  Jacob and Monod E. coli and other bacteria

HOUSEKEEPING GENES

actin, beta (ACTB) glyceraldehyde-3-phosphate dehydrogenase ribosomal protein S27a H2B histone family, member L ATP synthase eukaryotic translation initiation factor 3, subunit 8 nascent-polypeptide-associated complex alpha polypeptide adenosine deaminase E2F transcription factor 4

2

Page 3: The Lac Operon 1961 ,  Jacob and Monod E. coli and other bacteria

REGULATED GENES

Insulin receptor Methylation enzymes Digestive enzymes Neurotransmitters Transcription factors Hormone genes

3

Page 4: The Lac Operon 1961 ,  Jacob and Monod E. coli and other bacteria

Operon

group of coordinately regulated genes 1 promoter for a number of genes Polycistronic mRNA Inducer molecule – turns operon on

4

Page 5: The Lac Operon 1961 ,  Jacob and Monod E. coli and other bacteria

5

E. Coli Lac Operon

E. coli cells normally grown in glucose BUT, if lactose is used instead: convert lactose to glucose and galactose

Page 6: The Lac Operon 1961 ,  Jacob and Monod E. coli and other bacteria

6

The Lac Operon allows for coordinate gene expression

Note: 1 mRNA, promoter, 3 genes

Page 7: The Lac Operon 1961 ,  Jacob and Monod E. coli and other bacteria

7

THE OPERON HAS

A. 3 STUCTURAL GENES = Z, Y, A

Page 8: The Lac Operon 1961 ,  Jacob and Monod E. coli and other bacteria

Lac Z gene encodes betagalactosidase

b-gal lactose ------------- glucose + galactose

substrate products

No lactose present ~ 3 molecules of bgal

Add lactose 3,000 molecules of bgal

8

Page 9: The Lac Operon 1961 ,  Jacob and Monod E. coli and other bacteria

9

So………………….. b- gal is an inducible enzyme

What is the role of lactose?

inducer

Page 10: The Lac Operon 1961 ,  Jacob and Monod E. coli and other bacteria

10

Lac Operon

B. promoter = allows transcription of ZYA C. operator = must be unbound for P to be “open”

What molecule are ALL of the components above?

Page 11: The Lac Operon 1961 ,  Jacob and Monod E. coli and other bacteria

11

Lac Y gene encodes permease that transports lactose into cell

Lac A encodes a transacetylase

Page 12: The Lac Operon 1961 ,  Jacob and Monod E. coli and other bacteria

12

D. Lac I gene

Encodes a repressor protein Repressor binds to operator

Page 13: The Lac Operon 1961 ,  Jacob and Monod E. coli and other bacteria

13

Is this operon ON or OFF?Is lactose PRESENT or ABSENT?

Page 14: The Lac Operon 1961 ,  Jacob and Monod E. coli and other bacteria

14

Which components act in cis?In trans?

Page 15: The Lac Operon 1961 ,  Jacob and Monod E. coli and other bacteria

15

Regulation of the Lac Operon

Its normally repressed! = OFF Because lactose is absent

Therefore, it is an inducible operon When lactose is present

Page 16: The Lac Operon 1961 ,  Jacob and Monod E. coli and other bacteria

INDUCER (LACTOSE SUGAR)

1. Lactose enters cell

16

Page 17: The Lac Operon 1961 ,  Jacob and Monod E. coli and other bacteria

2. Binds repressor protein causing conformational change

17

Page 18: The Lac Operon 1961 ,  Jacob and Monod E. coli and other bacteria

3. repressor cannot bind operator

18

Page 19: The Lac Operon 1961 ,  Jacob and Monod E. coli and other bacteria

4. RNA polymerase transcribes genes

5. Cell metabolizes lactose

19

Page 20: The Lac Operon 1961 ,  Jacob and Monod E. coli and other bacteria

20

Lactose (the inducer) enters the cellBinds repressor protein causing a conformational change

Page 21: The Lac Operon 1961 ,  Jacob and Monod E. coli and other bacteria

21

repressor binds operatorpolymerase cannot bind promoterno transcription of ZYA genes

No lactose:

Page 22: The Lac Operon 1961 ,  Jacob and Monod E. coli and other bacteria

22

Why study the lac operon?

“The lac operon is one of the most basic examples of gene regulation.  Gene regulation is an important area of study in medicine as many diseases and conditions are as a result of deficiencies in gene regulation.  Cancer is one such disease that results in the inability of a cell to control the genes that regulate its growth.  Many systems of gene regulation in humans are quite complex and not understood by biologists and researchers.  In studying simple models of gene regulation, we hope to perhaps gain some insight into how more complex gene regulatory systems work.”

Page 23: The Lac Operon 1961 ,  Jacob and Monod E. coli and other bacteria

Lac operon animation

23

Page 24: The Lac Operon 1961 ,  Jacob and Monod E. coli and other bacteria

Promoter region of the operon

24

-35 -10 +1

GGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGA LACZ

CCGAAATGTGAAATACGAAGGCCGAGCATACAACACACCT

Page 25: The Lac Operon 1961 ,  Jacob and Monod E. coli and other bacteria

25

Operon mutants

Mutant Mutant Phenotype

lac I - constitutive expression because…

Page 26: The Lac Operon 1961 ,  Jacob and Monod E. coli and other bacteria

26

This operon is not inducible

Page 27: The Lac Operon 1961 ,  Jacob and Monod E. coli and other bacteria

Mutant Mutant Phenotype

Oc constitutive expression because …

27

Page 28: The Lac Operon 1961 ,  Jacob and Monod E. coli and other bacteria

Mutant Mutant Phenotype

P- operon always off because……

28

Page 29: The Lac Operon 1961 ,  Jacob and Monod E. coli and other bacteria

Mutant phenotype

Z- operon is?

29

Page 30: The Lac Operon 1961 ,  Jacob and Monod E. coli and other bacteria

30

Operon on, or off in the absence of lactose?

Lac Oc I+P+OcZ+Y+A+

In presence of lactose?

Is it Inducible?

Page 31: The Lac Operon 1961 ,  Jacob and Monod E. coli and other bacteria

Operon on, or off in the absence of lactose? Lac I- I-P+O+Z+Y+A+

In presence of lactose?

Is it Inducible?31

Page 32: The Lac Operon 1961 ,  Jacob and Monod E. coli and other bacteria

32

Partial diploid cells contain a plasmid

F’ I+

Inducible?I-P+O+Z+Y+A+

Page 33: The Lac Operon 1961 ,  Jacob and Monod E. coli and other bacteria

F’ I- P- Z+Y-A-

I+P+O+Z- Y+A+

33

Inducible?

Page 34: The Lac Operon 1961 ,  Jacob and Monod E. coli and other bacteria

34

Repressor and polymerase = proteins diffusible Proteins can bind DNA act in TRANS

promoter, operator, and ZYA and I = genes cannot move act in CIS

Tips for plasmid analysis

Page 35: The Lac Operon 1961 ,  Jacob and Monod E. coli and other bacteria

Lac operon notes

The lac operon is under negative control Allolactose binds to allosteric site on repressor causing shape change If both glucose and lactose are present, lac genes weakly transcribed Maximal transcription when lactose is only source cyclic AMP and a catabolite activator protein produce this effect. The concentration of cyclic AMP in E. coli is inversely proportional to

the concentration of glucose: as the concentration of glucose decreases, the concentration of cyclic A

When the concentration of glucose is low, cAMP accumulates in the cell. The binding of cAMP and the catabolite activator protein to the lac promoter increases transcription by enhancing the binding of RNA polymerase to the lac promoter. MP increases.

Lac I gene has its own promoter Repressor is a 360 aa protein tetramer. Lac I promoter is weak, few repressor molecules in cell Super repressor binds to operator even in presence of lactose

35

Page 36: The Lac Operon 1961 ,  Jacob and Monod E. coli and other bacteria

Positive control of lac operon

CAP binds to cAMP CAP-cAMP binds to CAP site upstream of

promoter CAP recruits RNA pol

With glucose: + lactose Glucose preferentially used Catabolite repression because glucose reduces

levels of cAMP Lac operon at low levels

36