THE JOURNAL OF BIOLOGICAL CHEMISTRY 0 1992 by The American Society for Biochemistry and Molecular Biology, Inc.

Vol. 267, No. 32, Issue of November 15, pp. 23113-23121,1992 Printed in U. S A .

cDNA Cloning of MEV, a Mutant Protein That Facilitates Cellular Uptake of Mevalonate, and Identification of the Point Mutation Responsible for Its Gain of Function*

(Received for publication, July 28, 1992)

Christine M. Kim$, Joseph L. Goldstein, and Michael S . Brown From the Department of Molecular Genetics, University of Texas Southwestern Medical Center at Dallas, Dallas, Texas 75235

We report the expression cloning of pMev, a cDNA that facilitates cellular uptake of mevalonate. pMev was isolated from the met-18b-2 clone of Chinese ham- ster ovary (CHO) cells, which were selected for growth in low concentrations of mevalonate when synthesis is blocked by compactin (Faust, J. R., and Krieger, M. (1987) J. Biol. Chem. 262,1996-2004). pMev encodes a 494-residue protein, MeV, that is predicted to have 12 membrane-spanning regions, consistent with a membrane transporter. Surprisingly, levels of Mev mRNA and protein are similar in CHO and met-18b-2 cells. The Mev gene differs from the wild-type gene by a single base change that substitutes a cysteine for phenylalanine in the 10th membrane-spanning region. met-18b-2 cells are heterozygous for this dominant gain-of-function mutation. Transfection of a cDNA en- coding pMev, but not the wild-type cDNA, elicited a marked increase in [3H]mevalonate uptake and incor- poration into cellular lipids in stably and transiently transfected cells. The availability of pMev will facili- tate studies of [3H]mevalonate incorporation into trace products, including p21” and other prenylated pro- teins.

Mevalonate is a key intermediate in the synthesis of sterols and isoprenoids. In animals the bulk product of mevalonate metabolism is cholesterol, some of which is converted to steroid hormones and bile acids. Mevalonate is also converted into dolichols, which act as carriers in the assembly of car- bohydrate chains of glycoproteins; ubiquinones, which partic- ipate in electron transport; and isopentenylated transfer RNAs, which play specific roles in protein synthesis (Gold- stein and Brown, 1990). The most recently discovered prod- ucts of mevalonate metabolism are a family of proteins whose adherence to membranes is facilitated by covalent attachment of mevalonate-derived prenyl groups, namely, farnesyl and geranylgeranyl. Such prenylated proteins include p21“ pro- teins, which regulate cell growth; lamins, which help to form the nuclear envelope; membrane-bound subunits of signal-

* This work was supported in part by Research Grant HL 20948 from the National Institutes of Health and by research grants from the Lucille P. Markey Charitable Trust and the Perot Family Foun- dation. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) M97382.

$ Supported by Medical Scientists Training Grant GM 08014 and National Research Service Award GM 07062 from the National Institutes of Health.

transducing G proteins; and a large family of Ras-related 21- 25-kDa proteins that bind GTP and regulate the budding and fusion of membranous vesicles (Glomset et al., 1991).

Mevalonate is produced by a membrane-bound enzyme of the endoplasmic reticulum, 3-hydroxy-3-methylglutaryl-coen- zyme A (HMG-CoA)’ reductase. Complex regulatory mecha- nisms adjust the activity of this enzyme over a range of several lOO-fold, assuring the production of sufficient mevalonate for conversion into essential sterol and nonsterol products while avoiding toxic overaccumulation (Goldstein and Brown, 1990).

Interest in the quantitatively minor products of mevalonate metabolism has been heightened by the discovery that the growth-promoting activities of wild-type or oncogenic p21“ proteins are dependent on the presence of a farnesyl group attached in thioether linkage to a cysteine residue (Hancock et al., 1989; Casey et al., 1989; Schafer et al., 1990). This attachment is catalyzed by a cytosolic enzyme that uses farnesyl pyrophosphate as a donor (Reiss et al., 1990). If a Ras protein is altered so that it can no longer accept a farnesyl group, the protein loses its ability to stimulate the growth of cells. This finding raises the possibility that growth of Ras- dependent tumors may be slowed or arrested by agents that inhibit the synthesis of farnesyl groups or their attachment to Ras proteins (Hancock et al., 1989; Schafer et al., 1989). The search for such inhibitors would be facilitated if assays of protein prenylation could be performed efficiently in living cells.

The study of prenylated proteins in living cells is most conveniently carried out by incubating the cells with radio- active mevalonate and following its incorporation into pren- ylated proteins through polyacrylamide gel electrophoresis and autoradiography. Although such studies have produced important results, they have been hampered by inefficient entry of mevalonate into cells and the consequent difficulty in incorporating detectable amounts of radioactivity into low abundance products. This problem can be circumvented in part by incubating the cells with inhibitors of HMG-CoA reductase such as compactin or lovastatin, which prevent dilution of the exogenous labeled mevalonate by endogenously synthesized unlabeled mevalonate (Brown and Goldstein, 1980). However, even when these inhibitors are used, only small amounts of radioactivity are incorporated into preny- lated proteins. Typically, autoradiographic detection of such proteins requires exposures of several days to weeks (Schmidt et al., 1984; Maltese, 1990).

The abbreviations used are: HMG-CoA, 3-hydroxy-3-methylglu- taryl-coenzyme A; LDL, low density lipoprotein; CHO, Chinese ham- ster ovary; MeLoCo medium, selection medium containing mevalon- ate, LDL, and compactin; PCR, polymerase chain reaction; kb, kilo- base(s).

23113

23114 cDNA Cloning of a Mevalonate Transporter

To overcome the problem of inefficient uptake of mevalon- ate, in the present study we have isolated a complementary DNA copy (cDNA) of a messenger RNA that produces a protein that facilitates mevalonate entry into cells. This cDNA was derived from a line of Chinese hamster ovary (CHO) cells that was isolated by Faust and Krieger (1987) and shown to have high mevalonate uptake. These cells were discovered as a by-product of a complex strategy that was designed to isolate the gene for the low density lipoprotein (LDL) receptor. This strategy took advantage of the fact that mammalian cells in tissue culture require cholesterol for growth. They can obtain cholesterol from two sources: endog- enous synthesis from acetyl CoA through a multi-enzyme pathway that includes HMG-CoA reductase; and uptake from exogenous lipoproteins by means of the cell surface receptor for plasma LDL (Brown and Goldstein, 1980). Krieger et al. (1981) described a method to produce cells with mutations in the gene for the LDL receptor. Kingsley and Krieger (1984) used this method to isolate a clone of CHO cells, designated ldlA-7, that fail to produce active LDL receptors as a result of a mutation in the LDL receptor gene. Krieger and co- workers then tried to determine whether the defect in these cells could be corrected by introducing genomic DNA from normal CHO cells into the ldlA-7 cells by calcium phosphate- mediated transfection. The DNA was introduced together with the bacterial ne0 gene that renders mammalian cells resistant to the antibiotic G418 (reviewed in Faust and Krie- ger (1987)).

In order to select for cells that had acquired the gene for the LDL receptor, Faust and Krieger (1987) grew the trans- fected cells in a medium called MeLoCo. This medium con- tains ordinary culture medium supplemented with serum from which the cholesterol-carrying lipoproteins have been re- moved; compactin, an inhibitor of HMG-CoA reductase; and a low concentration of LDL. Importantly, the MeLoCo me- dium also contains a low concentration of mevalonate (250 p ~ ) that provides sufficient substrate for the synthesis of nonsterol products, but is ordinarily not sufficient to meet the demands for the bulk product, cholesterol (Brown and Goldstein, 1980). Under these conditions the cells should only grow if they produce LDL receptors and thus satisfy their cholesterol requirement.

After transfection of CHO cell DNA into the ldlA-7 cells, Faust and Krieger (1987) isolated a single clone of cells, designated met-18b-2, that was able to grow in the MeLoCo medium. They expected these cells to have acquired the gene for the LDL receptor, but surprisingly the cells did not pro- duce LDL receptors. Instead, the cells had acquired the ability to efficiently utilize the mevalonate in the culture medium so that this low concentration of mevalonate was sufficient to satisfy their demands for cholesterol synthesis.

Faust and Krieger (1987) went on to show that the met- 18b-2 cells took up and used [3H]mevalonate from the culture medium at a rate that was 10-40-fold faster than the rate in CHO cells. Uptake appeared to be mediated by a saturable transporter that showed half-maximal rates at about 0.3 mM (R,S)-mevalonate. Indirect evidence suggested that the trans- porter was specific for the physiologic R form of mevalonate. It did not appear to take up other organic anions such as acetoacetate, P-hydroxybutyrate, pyruvate, or octanoate.

In the current study, we have used an expression cloning strategy to isolate a cDNA that encodes the protein respon- sible for rapid mevalonate uptake in met-18b-2 cells. The cDNA, designated pMev, encodes MeV, a hydrophobic protein of 494 amino acids that is predicted to contain 12 membrane- spanning regions. When pMev is inserted into human, ham-

ster, monkey, or mouse cells by calcium phosphate-mediated transfection, the cells take up [3H]mevalonate with high ef- ficiency, thereby facilitating the study of mevalonate metab- olism in these cells. The nucleotide sequence of pMev differs from the corresponding cDNA in parental CHO cells at one nucleotide position that changes a codon for phenylalanine in the wild-type protein to cysteine in MeV. We conclude that Mev arose from a cellular gene by a point mutation that has endowed the protein with the ability to enhance mevalonate uptake. Mev may be the mevalonate transporter itself or a protein that stimulates the transporter. The point mutation that gave rise to Mev is an example of a gain-of-function mutation in animal cells.

EXPERIMENTAL PROCEDURES

Materials-Mevalonolactone (purchased from Fluka) and compac- tin (provided by Akira Endo, Tokyo Noko University, Tokyo, Japan) were converted to the sodium salts (Brown et al., 1978). [3-14C]Pyruvic acid (14.5 mCi/mmol) and (R,S)-[5-3H]mevalonolactone (27.8-35 Ci/ mmol) were obtained from Du Pont-New England Nuclear. The radiolabeled mevalonolactone was evaporated to dryness, mixed with varying amounts (10-140 pl) of unlabeled 0.2 M sodium mevalonate, incubated with 0.35 ml of 0.1 N NaOH at 37 "C for 1 h, neutralized with 70 pl of 0.5 N HCl, and used immediately for experiments. 6- Fluoromevalonate (provided by Gary Quistad, Sandoz Crop Protec- tion, Palo Alto, CA) was stored at -80 "C as a stock solution (0.27 M) in ethanol. ldlA-7 cells (Kingsley and Kreiger, 1984), met-18b-2 cells (Faust and Kreiger, 1987), human embryonic kidney 293 cells, and CHO-K1 cells were obtained, respectively, from Monty Kreiger (MIT), Jerry Faust (Tufts University School of Medicine), Arnold Berk (University of California at Los Angeles), and the American Type Culture Collection. cDNA probes for rat cyclophilin and rat glyceraldehyde-3-phosphate dehydrogenase were obtained from Karl Normington of this department.

General Methods-Standard molecular biology techniques were used (Sambrook et al., 1989). Total cellular RNA was 'isolated from solid organs or from cell lines by the guanidinium thiocyanate/CsCl centrifugation procedure (Chirgwin et al., 1979). Poly(A)+ RNA was isolated by oligo(dT)-cellulose chromatography using a Pharmacia LKB Biotechnology Inc. mRNA purification kit. Blot hybridization of RNA was carried out (Lehrman et al., 1987) with either single- stranded 3ZP-labeled M13 DNA probes (Church and Gilbert, 1984) or with double-stranded 32P-labeled probes primed with random hexanu- cleotides (Feinberg and Vogelstein, 1983).

Cell Culture-All cells were grown in monolayer at 37 "C in an atmosphere of 5-9% COz. Human embryonic kidney 293 cells were maintained in medium A (Dulbecco's modified Eagle's medium con- taining 10% (v/v) fetal calf serum, 100 units/ml penicillin, and 100 pg/ml streptomycin). CHO-K1 cells and ldlA-7 cells were grown in medium B (a 1:l mixture of Ham's F-12 medium and Dulbecco's modified Eagle's medium containing 5% fetal calf serum, 100 units/ ml penicillin, and 100 pg/ml streptomycin). Met-18b-2 cells were grown in medium C (medium B supplemented with 20 p~ compactin and 0.2 mM sodium mevalonate). Experiments were carried out with either medium D (medium A in which the fetal calf serum was dialyzed against 0.9% (w/v) NaCl prior to use) or medium E (medium B with dialyzed fetal calf serum).

Construction of cDNA Expression Library-Poly(A)+ RNA pre- pared from met-18b-2 cells was used to construct a size-selected, directional cDNA library with a kit purchased from GIBCO-BRL (catalog number 8256SA) with minor modifications. Poly(A)+ RNA (5 pg) was denatured with methylmercuric hydroxide at room tem- perature prior to first strand synthesis. NotI-(dT)-primed cDNA was synthesized and ligated to SalI adapters according to the manufac- turer's protocol. cDNAs greater than -800 base pairs in length were isolated from an 0.8% (w/v) agarose gel by electroelution and purified by Geneclean (BiolOl, La Jolla, CA) and Elutip minicolumns (Schleicher & Schuell) prior to ligation into the SalI-Not1 sites of a plasmid expression vector pRc/CMV7S (see below). The ligation mixture was electroporated into Escherichia coli HBlOl cells, y.ielding a cDNA library with greater than 1 X lo7 independent recombinants. Approximately 560 pools of plasmids (1 X lo3 independent cDNAs per pool) were grown overnight in 50-ml cultures of LB medium. Plasmid DNA was purified using Qiagen-tip 100 columns (Qiagen, Inc., Chatsworth, CA) prior to transfection.

cDNA Cloning of a Mevalonute Transporter 23115

Plasmid pRc/CMV7S was constructed from pRc/CMV7SaCAT (kindly provided by Mark Evans of this department) by excising a 1- kb DNA stuffer fragment (designated &AT) with SalI and NotI in order to create the cloning site for the cDNA library. pRc/CMV7S contains the CMV promoter-regulatory region, bovine growth hor- mone polyadenylation signal (bGH poly(A)), and the gene for (2418 resistance (neo) (see Fig. 1). The parent plasmid pRc/CMV7SaCAT2 was created by ligating a 3-kb MluI-SalI fragment from Rc/CMV (Invitrogen) into the MluI-XhoI sites of pGEM7Zf+ (Promega) and then converting the sole Hind111 site to a unique SalI site. A 1-kb stuffer fragment, designated &AT, was inserted between the SalI and NotI sites. This fragment was removed before insertion of the library, as described above.

Expression CloningofpMev from Met-lab-2-derived mRNA-Pools of cDNAs in pRc/CMV7S were transfected into 293 cells, which were subsequently analyzed for uptake and metabolism of [3H]mevalonate in a transient expression assay. On day 0, replicate dishes of 2 x lo5 cells per 60-mm dish were plated in medium A. On day 1, duplicate dishes of cells were each transfected by the calcium phosphate method (Sambrook et al., 1989) with 5 pg of the cDNA plasmid pool plus 0.5 pg of pVA, a plasmid encoding adenovirus VA RNA,, which is believed to enhance translation (Akusjarvi et al., 1987). On days 2 and 4, the cells received fresh medium A and D, respectively. On day 5, the cells were incubated with medium D supplemented with 50 pM compactin, 0.1 mM [3H]mevalonate (70-100 dpm/pmol), 2 mM ["C]pyruvate (80 dpm/nmol), and 10 mM Hepes at pH 7.4. ['4C]Pyruvate was included as an internal control to correct for variations in cell number and the recovery of radioactive lipids. After incubation for 1 h at 37 "C, the medium was discarded, and each cell monolayer was dissolved in 3 ml of hexane/isopropanol(3/2, v/v) for 15 min at room temperature. The organic solvents were vigorously vortexed with 1 mlO.1 N NaOH, which trapped unincorporated [3H]mevalonate in its anionic form in the aqueous phase. An aliquot of the upper organic phase (1 ml) was counted in a scintillation counter. The amount of [3H]mevalonate taken up by the cells and converted into organic-extractable products is represented as the ratio of 3H/14C radioactivity.

For monolayers transfected with the vast majority of plasmid cDNA pools, the 3H/14C ratio was 2 to 3. In a screen of 560 pools of 1 X lo3 cDNAs each, three pools gave a 'H/"C ratio of >7 and were considered to be positive. The DNA from one positive pool, number 370, was electroporated into E. coli HBlOl to generate multiple pools of -100 independent transformants. Plasmids were isolated and transfected into 293 cells, which were assayed for [3H]mevalonate uptake as described above. Plasmid DNA from one positive pool of 100 cDNAs was retransformed, and 144 colonies from this transfor- mation were randomly picked and plated onto a 12 X 12 matrix. Bacterial cultures were prepared from pooled samples from each row and column of the matrix. Plasmids were isolated from these cultures and transfected into 293 cells, which were assayed for [3H]mevalonate incorporation into lipids. Two positive rows and columns were iden- tified. Plasmids isolated from bacterial colonies at the intersection of the positive rows and columns of the original matrix were assayed individually for [3H]mevalonate incorporation into lipids. As ex- pected, two of the four plasmids identified as positives were subse- quently shown to have identical restriction maps. These cDNA clones were designated 370-64-26d and 370-64-31a. All subsequent studies were carried out with clone 370-64-26d, hereafter designated as pMev. Overlapping cDNA clones were inserted into bacteriophage M13 vectors and sequenced by automated methods using an Applied Bio- systems Model 373A DNA sequenator and the M13 universal primer or specific internal primers. The two other positive pools identified in the primary screen contained a cDNA of the same size and restriction map as pMev.

Stable Transfection of CHO CeUs with pMev-CHO cells were seeded on day 0 at 3 X lo5 cells/lOO-mm dish in medium B. On the following day, they were transfected with 10 pg/dish of pMev that had been precipitated with calcium phosphate (van der Eb, 1980). The cells were incubated with DNA for 5 h in a 5% C02 incubator a t 37 "C and then refed with medium B. On day 2, the cells were fed medium B supplemented with 700 pg/ml G418, and selection was maintained for 8 days after which G418-resistant colonies were iso- lated and analyzed for their ability to take up and metabolize [3H] mevalonate. One strongly positive colony was cloned by dilution plating, and one of its clones (designated as the TR-1875-5 cell line) was expanded for further studies.

cDNA Cloning of pMev-wt from CHO-derived mRNA-A double-

' M. Evans, unpublished data.

stranded bacteriophage cDNA library was constructed from CHO cell poly(A)+ RNA as described above. cDNAs greater than 1 kb in length were ligated into the NotI-SalI arms of Xgt22A. After in vitro pack- aging (GIBCO-BRL X Packaging Kit), the phage were plated out on host strain E. coli C600 hfl-. Approximately 4 X lo5 plaques were transferred to replicate filters and probed with 1 X lo6 cpm/ml of a uniformly 32P-labeled random hexanucleotide-primed HindIII-BglII DNA fragment from pMev. One positive clone, designated pMev-wt, with an insert of -3.5 kb was plaque-purified. Phage DNA was subcloned into pBlueScriptI1 SK+ (Stratagene) and M13 for restric- tion mapping and sequencing, respectively. The entire coding region of pMev-wt was sequenced on one strand; the cDNA corresponding to amino acids 288-419 was sequenced on both strands. Another positive clone with an insert of -2.2 kb was plaque-purified, subcloned into pBlueScript SK+, and determined to have the entire coding region by restriction mapping.

PCR Sequencing of Genomic DNA-A 338-base pair PCR product was obtained by amplifying genomic DNA from CHO cells, met-18b- 2 cells, and Syrian hamster white blood cells with the following primers: oligo A, 5-AGTAATTATGGTAAGAGTCAGCATT-3 cor- responding to base pairs 1043-1067 in pMev; and oligo B, 5-CA- CAATGGTCACCAAGCCCACAGCA-3 corresponding to base pairs 1357-1381 in pMev. The thermal profile used was 94 "C for 1 min, 65 "C for 1 min, then 72 "C for 1 min for 35 cycles. The PCR- amplified DNA products were either used without gel purification (Syrian hamster DNA) or isolated from a 1.8% agarose gel (CHO and met-18b-2 cell DNA). All three samples were centrifuged on a Cen- tricon-100 microconcentrator before direct PCR sequencing (Lee, 1991) with end-labeled primer B. The thermal PCR sequencing conditions included 20 cycles of 95 "C for 30 s, 60 "C for 30 s, 70 "C for 30 s, followed by 10 cycles of 95 "C for 1 min, 70 "C for 1 min. An aliquot of each sequencing reaction was loaded on a 6% acrylamide denaturing gel and electrophoresed at 60 watts for 2 h at room temperature. The gels were dried and exposed to XAR-5 film for 2 h (Syrian hamster) or 10 h (CHO and met-18b-2).

Zmmunoblot Analysis-A polyclonal anti-peptide antibody directed against the COOH terminus of Mev (IgGC811) was produced by immunizing rabbits with a synthetic peptide (C)QNSSGDPAEEE- SPV (Peninsula Laboratories) corresponding to amino acids 481-494 (Fig. 3). The peptide was coupled to keyhole limpet hemocyanin using m-maleimidobenzoic acid N-hydroxysuccinimide ester (Sigma) (Har- low and Lane, 1988). IgG fractions were prepared from rabbit serum (preimmune or immune) by protein A-agarose chromatography (Be- isiegel et d., 1981). Proteins were transferred from 8% SDS-polyacryl- amide gels to nitrocellulose membranes. The membranes were incu- bated in buffer A (35 mM Tris-HC1 (pH 7.4), 0.5 M sodium chloride, 10% (w/v) nonfat dried milk, and 0.2% (v/v) Tween 20) for 2 h at room temperature, after which the following sequential steps were used incubation with either preimmune or immune polyclonal anti- body at 20 pg/ml in buffer A for 1 h at room temperature; two 15- min washes with vigorous shaking with buffer B (35 mM Tris-HC1 (pH 7.4), 0.5 M sodium chloride, 0.1% SDS, 1% Nonidet P-40, and 0.5% (w/v) sodium deoxycholate); incubation at room temperature for 20 min with donkey anti-rabbit horseradish peroxidase-conjugated secondary antibody (1:2000 dilution; Amersham, Catalog number RPN 2108) in buffer A supplemented with 1% Nonidet P-40; and two 15-min washes in buffer B. The membranes were then subjected to enhanced chemiluminescence detection according to the manufactur- er's protocol (Amersham) and exposed to Kodak XAR-5 film at room temperature for 75 s.

RESULTS

The strategy for the expression cloning of the cDNA re- sponsible for mevalonate uptake in met-18b-2 cells is outlined in Fig. 1 and described in detail under "Experimental Proce- dures.'' A size-fractionated cDNA library was prepared from met-18b-2 cells in an expression vector that uses the CMV promoter. Plasmids prepared from pooled cultures of 1000 bacterial transformants each were introduced into human kidney 293 cells by means of calcium phosphate-mediated transfection. After 4 days the 293 cells were assayed for mevalonate transport by incubation with a mixture of [3H] mevalonate and [14C]pyruvate. T h e cells were incubated with compactin to block endogenous mevalonate synthesis. After 60 min, an organic extract of the cells was prepared with

23116 cDNA Cloning of a Mevalonate Transporter Poly (A)+rnRNA from met-18b-2 cells

1 Directional cDNA Library in pCMV Expression Vector

W H PolyA

pVA -1 Transfect cDNA pools into 293 cells

Transient Expression

1 WMevalonate 14C-Pyruvate

Dissolve in hexane/isopropanol Extract with O.IN NaOH Count upper organic phase

1 3H/14C-ratio

FIG. 1. Expression cloning of pMev. The steps in expression cloning are described under “Experimental Procedures” and discussed under “Results.”

hexane/isopropanol, and the 3H/14C ratio was measured. The [14C]pyruvate was included as an internal control to correct for variations in the number of cells in the dish, the rate of overall lipid synthesis, and the recovery of lipids.

A total of 560 pools of 1000 transformants each were screened, and three pools gave a positive result as evidenced by a ’H/14C ratio that was clearly above that produced by the other pools. Fig. 2A shows the results of one screening exper- iment, conducted in duplicate, which showed a positive result for plasmid pool 370. For comparison, in each screening experiment we included dishes of 293 cells that had not been transfected or were transfected with control (salmon sperm) DNA. We also included dishes of met-18b-2 cells as a positive control for the assay.

From pool 370, we prepared 27 subpools of approximately 100 plasmids each, and two of these subpools gave positive results in the mevalonate uptake assay (Fig. 2B). We then plated 144 individual plasmids from subpool 370-64 on a 12 X 12 matrix and assayed pools of plasmids from each row and column. Two of the rows gave positive results (Fig. 2C), as did two of the columns (not shown). The four plasmids at the intersections of the positive rows and columns were assayed individually, and two of these were positive, as expected (Fig. 20) . Restriction maps of these two plasmids were identical, and one of them (26d) was designated pMev and used for further study.

The sequence of the cDNA insert in pMev shows one long open reading frame that encodes a protein of 494 amino acids plus 5- and 3-untranslated regions of 194 and 1624 base pairs, respectively (Fig. 3). The putative initiator methionine is preceded by three stop codons within 50 base pairs, and it is placed within a good consensus for initiation of translation as defined by Kozak (1984).

Hydrophobicity plots calculated by the method of Kyte and Doolittle (1982) with a window of 9 residues showed that the Mev protein has 12 relatively distinct hydrophobic segments of 19 to 28 residues each (Fig. 4). These 12 putative mem- brane-spanning regions are underlined in Fig. 3. The two longest stretches of hydrophilic residues are located between the 6th and 7th membrane-spanning regions and following the 12th membrane-spanning region. A search of several protein data banks failed to reveal any proteins with signifi- cant sequence identities. We also found no evidence for the consensus sequences for nucleotide binding, which are present

100

40

30

20

10

0

CDNA Subpool Number

2 cDNA Subpod Number 6 E

4 Single cDNAs from No. 370-64

f Smgle cDNA Clones u

FIG. 2. Screening assays for [3H]mevalonate uptake and in- corporation into cellular lipids in transfected 293 cells. Pools of cDNA plasmids were transiently transfected into 293 cells as described under “Experimental Procedures.” The horizontal axis de- notes cDNA plasmid pools of 1000 (A), subpools derived from positive pools ( B and C ) , and single clones (D) transfected into duplicate dishes (closed and open bars). Three control assays (shown at the left side of each panel) were routinely performed in each transfection experiment with the indicated cell lines: none (nontransfected 293 cells); control DNA (293 cells transfected with 5 pg salmon sperm DNA); and met-18b-2 (nontransfected met-18b-2 cells). In A, 27 of 560 pools, each containing 1 X lo3 independent cDNAs from the met- 18b-2 library, were assayed for [3H]mevalonate incorporation into lipids. The concentration of [3H]mevalonate was 0.1 mM at 100 dpm/ pmol. Positive pool 370 was subdivided into 68 subpools, of which the data for 27 are shown in B. 144 colonies from subpool 370-64 were randomly picked and plated onto a 12 X 12 matrix. Pools of cDNA plasmids prepared from bacterial cultures of each row (u-l, C ) and each column (25-36, not shown) were assayed for [3H]mevalonate incorporation, and four positive pools were identified rows a and d ( C ) and columns 26 and 31 (not shown). Each of the four clones at the intersection of the positive rows and columns were assayed for [3H]mevalonate incorporation (D).

in the cytoplasmic sequences of several transporters (Walker et al., 1982). The protein has two potential sites of N-linked glycosylation, which are boxed in Fig. 3.

To confirm that expression of pMev can lead to enhanced mevalonate uptake, we prepared a permanent line of CHO cells that were transfected with pMev, which is under control of the CMV promoter and contains in the same plasmid the neo gene that confers resistance to G418. Clones of cells that grew in (3418 were analyzed for mevalonate uptake. To study mevalonate uptake in the absence of extensive metabolism, we performed the uptake studies in the presence of 6-fluoro- mevalonate, which blocks the decarboxylation of mevalonate pyrophosphate and thus prevents the conversion of t3H]mev-

1

4 1

8 1

1 2 1

1 6 1

2 0 1

2 4 1

281

32 1

3 6 1

4 0 1

44 1

4 8 1

cDNA Cloning of a Mevalonate Transporter 5 ’ CGCGACGTGACTGGT CGGCCGTGTGGGTGCTGCAGCCMCGMCC CGGCGGCGGCGGCGGCMGGGMGCGAGCG

GGMCCCM;GCTCCGAGGMCTGCGGCCCG CGCCGCCGCGTCACGCACCCTCTGGGCGCC GCGAGACACACATMCGATMTAGATTTGC ATTGCATTTTGGGATTCATCTAcAcTTAM

ATGCCACCTGCMTTGGAGGACC~~~TTGGA TATACCCCCCCAGATGGAGGTGGGGGT~~~ GCAGTGGTAGTTGGAGCTTTCATTTCTATT GGCTTCTCTTATGCATTTCCC~TCCATC ~ e t p r o p r o ~ a ~ ~ e G ~ y G ~ y p ~ o V a l G l y TyrThrProProAspGlyGlyTrpGlyTrp N a V a l V a l V a l G l y A l a P h e I l e ~ e r I ~ ~ GlyPheSerTyrAlaPheProLYsser*le

ACCGTCTTCTTT-G-TTGGTATA TTCMTGCTMTACCAGTGMGTGTCATGG ATATCATCCATCATGTTGGCTGTCATGTAT GCTGGRGGTCCTATCAGCAGTGTCCTGGTG ThrValPhePheLySG1UI1eGlUGlyIle p h + i + h r s e K G l U v a l s e r r

MTAMTATGGCAGCCGTCCAGTMTGATC GCTGGTG~TGCTTGTCTGGTTGTGGCTTG ATTGCAGCTTCTTTCTGTMCACAGTGCAG GMCTTTACTTGTGCATCGGTGTcATTGGA AsnLySTyrG1ySerArqproVILnetIle NaGlyGlyCysLeUSerGlyCySGlyLeU IleAlaAlaSerPheCysAsnThrValGIn GlULeUTYrLeuCY.IleG1YvalIleGlY

GGTCTTGGGCTTGCTTTCMCTTGAACCCA GCTCTGACCITGATTGGCAMTATTTCTAC MGAAGCGACCATTGGCCMTGGGCTGGCC ATGGCAGGCAGCCCTGTGTTCCTCTCTACC

- GlyLeuGlyLeuAlapheAsnLeuAsnPro NaLeuThr~tIleGlyLysTyrPheTyr LysLysArqProLeuAl~snGlyLeuAla MetAlaGlYSerPrOValPheLeuSerThr

CTGGCTCCACTTMTCAGGCTTTCTTTGGT ATTTTTGGCTGGAGAG~GCTTCCTMTT CTTGGTGGCCTCCTACTMACTGTTGTGTA GCTGGATCCCTGATGCGGCCMTAGGGCCT LeuAlaproLeuAsnGlnA1aPhePheGly IlePheGlyTrpArqGlySerPheLeuIle LeuGlyGlyLeuLeULeuASnCYSCYSVal NaGlYSerLeuMetArqProIle~lYprO

MGCCAGGCMGATAG-CTAMGTCC A A A G M T C T C T T C A G G M G C T C T C T GAGGCMACACAGATCTCATGGGAGGMGC C C C A M G G A ~ G C G A T C A G T C T T A C A G LysProGlyLysIleGluLysLeuLysSer LysGluSerLeuGlnGluAlaGlyLysSer GluAlaASnThrAspLeuMetGlyGlySer PrOLySGlyGluLysArqSerValLeuGln

ACMTTMTMGTTCCTGGACCTGTCCCTG TTTGccCACAGAGGCTTTTTGCTGTACCTG TCTGGGMTGTAGTCATGTTTTTTGGACTG TTTACCCCTTTGGTCTTTCTTAGTMTTAT

ThrIleAsnLysPheLeuAspLeUSerLeu PheAlaHisArqGlyPheLcuLeuTyrLeu SerGlyAsnValVaMetPhePheGlyLeu PheThrProLeuValPheLeuSerAsnTyr

GGTMGAGTCAGCATTACTCCAGTGAGAAG TCAGCCTTCCTCCTTTCCATTCTGGCCTTT GTTGATATGGTAGCCAGACCTTCCATGGM CTTGUGCCMCACCMGTGGATCAGACCT GlyLysserGlnnisTyrSerSerGluLya SerAlaPheLeuLeuSerIleLeWaPhe ValAspMetValN~rqProSerMetGly LeuAlaAlaAsnThrLysTrpIleArqPro

CGGATCCAGTACTTCTTTGCTGCTTCTGTG GTTGCCMTGGAGTGTGCCATTTGCTAGCA CCTTTGTCTACMGCTACATCGGGTTCTGT ATCTACGCGGGAGTCTTTGGATTTGCCTGT ArgIleGlnTyrPhePheAlaAlaSerVal ValAlaAsnGlyValCysHisLeULeuAla ProLeuSerThrSerTyrIleGlyPheCys IleTyrAlaGlyValPheGlyPheAlaCys

GGTTGGCTCAGCTCCGTATTATTTGAMCA TTGATGGACCTTGTTGGTCCCCAGAGGTTC TCCAGTGCTGTGGGCTTGGTGACCATTGTG GMTGCTGTCCTGTCCTTCTAGGGCCACCA Gly-TrpLeuserserValLeuPheGluThr LeuMetAspLeuValGlyProGlnAKqPhe SerSerAlaVa1GlyLeUValThrIleVal GluCysCysProValLeuLeuGlyProPro

CTTTTAGGCCGCCTTMTGACATGTATGGA GACTACAMTACACGTACTGGGCTTGTGGC GTGATCCTCATCATTGCAGGTATCTATCTC TTCATTGGCATGGGCATCMTTATCGACTT LeuLeuGlyArqLeuAsnAspHetTyrGly AspTyrLysTyrThrTyrTrpNaCysGly ValIleLeuIleIleAlaGlyIleTyrLeu PheIleGlyMetGlyIleAsnTyrArqLeu - GTGGCCAMGAACAGMAGCAGMGAGAAG CAGAMCAGGAAGMGGTAMGAGGACGAC ACCAGCACTGATGTTGATGAGMACCMAG GMTTMCAAAAGCMCAGAGTCCCCGCAG ValA1aLysGluGlnLysA1aGluGluLys GlnLysGlnGluGluGlyLysGluAspAsp ThrSerThrAspValAspGluLysProLys GluLeuThrLysAlaThrGluSerProGln

CAGAATAGCTCCGGAGACCCCGCAGMGAG GAGAGTCCTGTCTGMCTGMGCATGMTA GAGCAGTGTGTGACCCMGACATCTGAMC CATTCTGCTGGCCTCTAGTCTACCAGTGGT Gl~-~lyAspPro~aGluGlu GluSerProValEnd

GCTCMTGCAGACAGTGGACATTTGTGTGG AAAACCTACCAGGTGTTCATTGGTGGAATT TTGTTTTGTTTTGTTTTGTTTTTGTTTTTG TTCACTCCTTACCMTGCCAGAGTTTAAAA TTTACTATGCTTTAGGTAGGATTGGTTGG CAAAGGATATGGGAMGMGTGTAGGGATT TGTTTTTTTGTTTTTGTTTTTTTTTTMTC TTAGCTTTTMCAGTGTCATGAAGATTATA

ATATGTGCCTTMGTTTTAGTTTTAGMCT CTTTAGAGAGCCTTAACTTTTWTCATT CTGCTGMTTCATCTATTTTAAATGTTTTA AAAGGAAMATMCMCTMCTTGCTTGAG GTMCTCTMCCTTMTCTTGTTTTGTTGT TGTTTGTMTGCTTTGTCAGAGATTGTTAC TGGAACATTTATGGATATACTAGTTA AAAGTTGGRGGTTTATAAAATACTGACTM AGTATTTTTCTAGCATCATAGTTGCCTCM GTAGGTGCCTGCTAGGTATATATTTMGAA ATTTAAAGCATGMATTCTGGMACATCTT GGCTGTTATAGCCACAGTCTGTCTGTCTGT CATCTGCTGGGGACTTCTCAGATGCTTACT GCMGCCTAGTGCTAGMTGTTGTCACTAA ATTGCTACCTTGCTCCTCTTCAGAGACATT GAGTGGTTACAGGTCATTGCCATTTTTGM ATCTACTGCAAMAAGTTAGTATTAAAATC TACAAAACTTTTMCACAGTCTGATTTAAT ATAGACAGGTATTTCAGGCATCTGCTAAAT TCAGTTTAGTTTTCC-CCCTAGTTATG

GTATGAMCTCTTGTMTCTTTGAGTATGT GTGGGTTTTGGGGGGCCTGGTGGTTCTGAG GATTGAACCCAGGGCCACMGCATGCTMG CACATGCTGTACCACTGAGCCACATCCCAC CAGCACCCTGGMTCCTCCTTMCCCCCCGAG ACCTTTGCTCTTTGATTTTTGATAGTTCCA TTTATATCCTAGTTTAGAGCTGTATGCGAG ATATCAGTATGGACTIL~ATGTGTGTGCTAG TTTTGTTTTTTACATTGTTTTTCAGTATTT GCAAAACCMGAGGGCCAGAGTTTGGCCCC GGGGMGCCMTAMGAT-TAGGGAGG GRGTTTGCTGAGTTCACTTGATTTCAGTM GTACCCACCTCCCTGCCACATACACCMGG CTTAMGAGMACTTATATCATGCTTAGAA TTATTGGACATAGCCTTACCTCTACAMCC TTAGCTTTCGTGACCCTTTTCACTTACCTG MATATAGAAMTGGGTTCAATGTAAGGAT AGGAGGMGGATGGGCAGGATTGGAATTGT AGTATTTTTTAAAACCMTATCTTCTMAT AGAGACAGAAAAGATATATGACACTAAATT

GTACTCMTGCATCTWTACCATTGTAA TTGACGGGGTGAAMTATCCATTTAAAACC TTGTAAGMGCCGACTTTTTCCAMTlUM CATTTATTTTATTTTTAG-

hAMGGGCGGCCGC 3 ’

23117 91

211

3 3 1

4 5 1

5 7 1

6 9 1

8 1 1

9 3 1

1 0 5 1

1 1 7 1

1 2 9 1

1 4 1 1

1 5 3 1

1651

1 7 7 1

1 8 9 1 2 0 1 1

2 1 3 1

2 2 5 1

2 3 7 1 2 4 9 1 2 6 1 1 2 7 3 1

2 8 5 1 2 9 7 1

3091 3211 3331

334 5

FIG. 3. Nucleotide and predicted amino acid sequences of pMev. Nucleotide residues are numbered on the right; amino acid residues are numbered on the kit. Residue 1 is the putative initiator methionine. Two sites of potential N-linked glycosylation are boxed. Twelve potential transmembrane regions are underlined. Sequences of the 5’-SaZI adaptor and the 3’-NotI primer-adaptor used in the construction of the c D N A library are denoted by the double underline.

alonate into all products beyond mevalonate pyrophosphate (Nave et al., 1985). Fig. 5A shows a time course of uptake of [3H]mevalonate in one of these clones as compared with CHO cells and with the original met-18b-2 cells. Uptake was linear for 30 min. The transfected CHO cells had a mevalonate uptake rate that was similar to the uptake rate in the met- 18b-2 cells and much faster than the rate in CHO cells. At the 30-min time point, the uptake process in the transfected cells and the met-18b-2 cells was saturable (Fig. 5B), and the calculated K,,, value for (R,S)-mevalonate was 1.5-2 mM in both cell types.

In cells expressing the Mev gene product, the efficient uptake of [3H]mevalonate permits ready labeling of mevalon- ate-derived proteins. Fig. 6 shows an experiment in which

parental CHO cells, met-18b-2 cells, and CHO cells trans- fected with pMev were incubated with [3H]mevalonate, and detergent extracts were subjected to SDS-polyacrylamide electrophoresis followed by autoradiography for 48 h. In the detergent-soluble fraction of the met-18b-2 cells and the pMev-transfected CHO cells, intense bands of radioactivity were seen in the position of 20-25 kDa, corresponding to Ras proteins and Ras-related small GTP-binding proteins, as well as higher molecular weight proteins. Additional radiolabeled proteins were seen in the detergent-insoluble fraction. In contrast, no radiolabeled proteins were visible in the extracts of parental CHO cells at 48 h (Fig. 6, lunes 1 and 4 ) and even after 7 days (not shown).

On Northern blots of mRNA from met-18b-2 cells, radio-

23118 cDNA Cloning of a Mevalomte Transporter

0 100 2 0 0 3 0 0 400 500 I , I I I I I I , , ~ l l l l ~ l l l l ~ l l l l ~

FIG. 4. Hydropathy plot of the amino acid sequence of MeV. Positive values represent increased hydrophobicity. The residue spe- cific hydropathy index was calculated over a window of 9 residues by the method of Kyte and Doolittle (1982) using the Genetics Computer Group Sequence Analysis Software Package, Version 7.1 (Devereux et al., 1984).

Amfno Asld Residue Number

Time (minutes) pH]Mevalonale (mM)

FIG. 5. Uptake of [SH]mevalonate by monolayers of CHO cells (O), CHO cells transfected with pMev (0), and met-18b- 2 cells (A). On day 0, replicate dishes of 4 X lo4 cells per 60-mm dish were plated in medium B and refed on day 2 with identical medium. On day 3, each monolayer was preincubated for 30 min in medium E containing 10 mM Hepes at pH 7.4,50 p~ compactin, and 0.5 mM fluoromevalonate, after which [3H]mevalonate (A, 0.1 mM at 880 dpm/pmol; B, the indicated concentration at 92-880 dpm/pmol) was added. After incubation at 37 "C for the indicated time ( A ) or 30 min ( B ) , each monolayer was washed at 4 "C three times (5 min/ wash) with 2 ml of buffer (50 mM Tris-HC1 (pH 7.4), 155 mM NaCl, and 2 mg/ml bovine serum albumin), followed by three 5-min washes with 2 ml of buffer without albumin. Each monolayer was then incubated at room temperature for 30 min in 1 ml of 0.1 N NaOH, after which one aliquot of the cell suspension (0.1 ml) was counted in 10 ml of scintillation fluid, and another aliquot (50 pl) was used to measure the content of cellular protein (Lowry et al., 1951). Each value represents the average of duplicate incubations.

labeled pMev detects a relatively abundant mRNA of 3.6 kb (Fig. 7). Surprisingly, an mRNA of similar size and abundance was also detected in the parental CHO cells (Fig. 7). A relatively abundant mRNA of similar size was detected in the heart of the Syrian hamster (Fig. 8A). A low level of a similarly sized transcript was detected in several other tissues including the brain, lung, ovary, spleen, and testis. In the Sprague- Dawley rat, the mRNA detected by pMev was also relatively abundant in the heart, but a similar level was seen in kidney (Fig. 8B). Liver, intestine, and testis also revealed reasonable amounts of this transcript, and the other tissues all had low but detectable levels.

The finding of an abundant Mev mRNA in the parental CHO cells was surprising since these cells do not take up mevalonate efficiently (Fig. 5). To confirm that the CHO cells were actually expressing Mev protein, we performed immu- noblots with a polyclonal anti-peptide antibody directed against a 14-amino acid segment from Mev as predicted from the cDNA sequence. Fig. 9 shows that this antibody reacted with a protein that migrated on SDS gels with an apparent molecular weight of 43,000. This protein was present in roughly equal amounts in parental CHO and met-18b-2 cells. Antibody binding to the 43-kDa protein was abolished in the presence of the synthetic peptide used to make the antibody (Fig. 9, lanes 5 and 6) but not by an irrelevant synthetic peptide (data not shown). The anomalous migration on SDS gels of Mev (whose calculated molecular weight is 54,000) was

I Soluble I lnsolublej

. . . . . . .

92 - 69 -

46 - 5 2 30 -

14 -

FIG. 6. Incorporation of [SH]mevalonate into cellular pro- teins in CHO cells (lanes Z and 4 ) , met-18b-2 cells (lanes 2 and b), and CHO cells transfected with pMev (lanes 3 and 6). On day 0, 2.5 X IO5 cells for each type were plated into a 60-mm dish in medium B and refed on day 2 with identical medium. On day 3, each monolayer was incubated at 37 "C with 1 ml of medium E containing 100 p~ compactin for 1 h, followed by 1 ml of fresh medium E containing 100 p~ compactin and 110 pCi/ml [3H]meva- lonate (specific activity, 35 Ci/mmol). After incubation for 6 h, each cell monolayer was washed twice with 2 ml of phosphate-buffered saline, scraped into buffer containing 50 mM Tris-HC1 (pH 8), 0.15 M NaCl, 0.5% (v/v) Nonidet P-40,l mM EDTA, 1 mM EGTA, 10 pg/ ml leupeptin, and 0.5 mM phenylmethylsulfonyl fluoride. The cellular extract was centrifuged at 14,000 X g for 5 min at 4 "C. Aliquots of the detergent-soluble fraction (80 pg of protein) and insoluble fraction (80 pg of protein) were subjected to electrophoresis on a 140 X 120 X 1.5 mm, 12.5% SDS-polyacrylamide gel (Laemmli, 1970). The gel was impregnated with Entensify (Du Pont-New England Nuclear), dried, and exposed to Kodak XAR-5 x-ray film with an intensifying screen at -80 "C for 48 h. No radiolabeled bands were seen in lanes 1 and 4 after a 7-day exposure. I4C-Labeled molecular weight standards (Amersham) were run in an adjacent lane.

7.5- 4.4-

2.4- Mev

1 A- .. .

Cyclophilin

FIG. 7. Blot hybridization of MeV mRNA in CHO cells and met-l8b-2 cells. An aliquot of poly(A)+ RNA (5 pg) from the indicated cell line was subjected to electrophoresis on a 1.5% agarose gel and blotted onto a nylon membrane as described under "Experi- mental Procedures." The RNA was probed at 42 "C with a single- stranded, uniformly 32P-labeled M13 cDNA probe (3.5 X lO'cpm/ml) corresponding approximately to nucleotides 550-750 of pMev (Fig. 3). The filter was washed as described in Fig. 8 and exposed to Kodak XAR-5 film with an intensifying screen for 5 h at -80 "C. The same filter was reprobed with a 32P-labeled M13 probe to rat cyclophilin cDNA (5 X lo6 cpm/ml), washed in 1 X SSC with 0.1% SDS at 37 "C for 2 h, and exposed to Kodak XARd film for 15 min at -80 "C.

confirmed by SDS gel analysis of the translation product of pMev mRNA produced in a reticulocyte lysate system (data not shown). Furthermore, transfection of pMev into 293 cells (see below, Fig. 11) and simian COSm6a cells ( d a t a not shown) produced a 43-kDa protein by immunoblot analysis.

The above data suggested that the protein produced by pMev in met-18b-2 cells had acquired a new property, namely,

cDNA Cloning of a Mevalonute Transporter 23119

7.5 - 4.4 - 2.4 - 1.4 -

Mev

e Cyclophilin

.- m e * @ a GAPDH

B. Sprague-Dawley Rat

4.4 - ' Mev

2.4 -

1.4 -

FIG. 8. Tissue distribution of Mev mRNA in Syrian ham- sters (A) and rats ( B ) by blot hybridization RNA. A, total RNA was isolated from the indicated Syrian hamster tissue, and an aliquot (30 pg) was subjected to electrophoresis on a 1.5% agarose gel and blotted onto a nylon membrane as described under "Experimental Procedures." Hybridization was carried out a t 42 "C with a single- stranded, uniformly 3ZP-labeled M13 DNA probe corresponding ap- proximately to nucleotides 680-880 of pMev (1.2 X lo6 cpm/ml). The filter was washed in 0.2 X SSC containing 0.1% (w/v) SDS at 65 "C for 30 min and exposed to Kodak XAR-5 film with an intensifying screen for 6 days at -40 "C. The positions of RNA standards run in an adjacent lane are indicated. The same filter was then reprobed initially with a 32P-labeled M13 DNA probe corresponding to rat cyclophilin cDNA (1 X lo7 cpm/ml), washed in 2 X SSC with 0.1% SDS at 25 "C for 10 min, and exposed to Kodak XAR-5 film for 2 h a t -40 'C. The filter was subsequently reprobed with a uniformly 32P-labeled random hexanucleotide primed-DNA probe for rat glyc- eraldehyde-3-phosphate dehydrogenase (GAPDH, 5 X lo6 cpm/ml), washed in 0.1 X SSC with 0.1% SDS at 65 "C for 6 h, and exposed to Kodak XAR-5 film with an intensifying screen for 20 h at -40 "C. B, poly(A)+ RNA was isolated from the indicated rat tissue, and an aliquot (20 pg) was subjected to Northern gel analysis as described above. Hybridization was carried out a t 42 "C with the same 32P- labeled M13 probe as used above (2 X lo6 cpm/ml). The filter was washed in 2 X SSC containing 0.1% SDS at 65 "C for 45 min and exposed to Kodak XAR-5 film with an intensifying screen for 22 h at -40 "C. The filter was subsequently reprobed with a uniformly 32P- labeled random hexanucleotide primed DNA probe for rat cyclophilin (5 X 10' cpm/ml), washed in 0.2 X SSC with 0.1% SDS at 65 "C for 30 min, and exposed to Kodak XAR-5 film with an intensifying screen for 4 h a t -40 "C.

the ability to cause enhanced uptake of mevalonate. To de- termine whether this new property was attributable to a mutation in the Mev gene, we isolated a plasmid containing the entire Mev sequence from a cDNA library that was constructed from RNA isolated from parental CHO cells. We designate this cDNA pMev-wt (for wild-type). The nucleotide sequence of the entire coding region of pMev-wt was identical to that of pMev from met-18b-2 cells except for one base pair position: an adenosine at position 1290 instead of the cytosine detected in pMev. This change altered the codon at amino acid 360 in the loth membrane-spanning region from cysteine in Mev to phenylalanine in MeV-wt. The nucleotide difference at position 1290 was confirmed by sequencing this region from

Preimmune IgG-C8I 1 IgG IgG-C811 + Peptide 1 2 3 4 5 6 v F V 7"

97"- g 66- -

"

X - r' 45 -

9 0 30"- 0- 0 -

FIG. 9. Immunoblot analysis of MeV protein in CHO cells and met-18b-2 cells. On day 0 ,3 X lo6 cells per 60-mm dish were plated in medium B and refed on day 2. On day 3, each monolayer was washed twice with phosphate-buffered saline, scraped into buffer containing 50 mM Tris-HC1 (pH 8), 0.15 M NaCl, 0.5% Nonidet P- 40, 1 mM EDTA, 1 mM EGTA, 10 pg/ml leupeptin, and 0.5 mM phenylmethylsulfonyl fluoride. Aliquots of a 14,000 X g supernatant fraction (80 pg of protein) from CHO cells ( l anes I, 3, and 5) and met-18b-2 cells (lanes 2, 4, and 6 ) were separated on a 8% SDS- polyacrylamide gel (140 X 120 X 1.5 mm), transferred to nitrocellu- lose, and incubated with the indicated antibody for immunoblot analysis as described under "Experimental Procedures." The nitro- cellulose membranes in lanes 5 and 6 were also incubated with 25 pM of the synthetic peptide against which the antibody was made.

1283 1283

met-18b-2

- Y G A T C G A T C G A T C E

1296 I I

1296

FIG. 10. Comparison of the nucleotide and deduced amino acid sequences of MeV from CHO cells, met-18b-2 cells, and Syrian hamster in the region of amino acid 360. Genomic DNA from the indicated source was amplified by PCR and sequenced as described under "Experimental Procedures." Autoradiographs of the DNA sequencing gels in the region of amino acid 360 shows a heterozygous A-to-C transversion at base pair 1290 in met-18b-2 genomic DNA as compared with CHO cell and Syrian hamster DNA. The DNA sequence shown corresponds to the noncoding strand.

two independent clones from the CHO cDNA library. It was also confirmed by direct sequencing of an amplified copy of this region after reverse transcription of mRNA from CHO and met-18b-2 cells followed by PCR (data not shown).

To further confirm the existence of the mutation in the met-18b-2 cells, we determined the sequence of this region after PCR amplification of genomic DNA from parental CHO cells, fresh Syrian hamster leukocytes, and met-18b-2 cells (Fig. 10). The CHO and Syrian hamster DNA had a single nucleotide (adenosine) at nucleotide position 1290. In con- trast, the met-18b-2 cell DNA was heterozygous at this posi- tion, showing roughly equal proportions of adenosine (encod- ing the wild-type protein) and cytosine (encoding the mutant protein).

Fig. 11 compares the incorporation of [3HJmevalonate into cellular lipids in 293 cells transfected transiently with pMev- wt and pMev. Both cDNAs produced comparable amounts of protein as detected by immunoblot analysis (Fig. 11, inset).

23120 cDNA Cloning of a Mevalonate Transporter

I I

"?

0 0 0.2 0.4 0.6 0.8 1

Time (hours)

FIG. 11. Incorporation of [3H]mevalonate into cellular lipids in 293 cells transfected with pMev (O), pMev-wt (0), and control vector DNA (A). Replicate dishes of 2 X lo5 cells per 60- mm dish were plated in medium A, transiently transfected with 5 pg of the indicated DNA (see below) plus 0.5 pg of pVA, radiolabeled with 0.1 mM ['H]mevalonate (128 dpm/pmol) for the indicated time at 37 "C, and extracted with hexane/isopropanol for measurement of cellular ['Hllipids as described under "Experimental Procedures." Duplicate dishes of transfected cells were washed twice with phos- phate-buffered saline, scraped into buffer containing 62.5 mM Tris- HC1 (pH 6.8), 15% SDS, 8 M urea, 10% (w/v) sucrose, 100 mM dithiothreitol, and 10 mM EDTA, and harvested for measurement of total protein content (pMev, 0.86 mg/dish; pMev-wt, 0.88; control DNA, 1.28). The data are expressed as the amount of [3H]mevalonate incorporated into cellular lipids per mg of protein. Each value is the average of duplicate incubations. A zero-time blank (0.01 nmol/mg) was subtracted from each value. The inset shows an immunoblot analysis of an aliquot of the solubilized cells (5 pg of protein) trans- fected in the same experiment, separated on a 8% SDS-polyacryl- amide gel (80 X 70 X 0.75 mm), transferred to nitrocellulose, and probed with 20 pg/ml IgG-C811 as described in Fig. 9. In this experiment, the Safl-Not1 fragment of pMev and pMev-wt were ligated into SaA-NotI-digested pCMV6, which is identical to pCMV4 (Andersson et al., 1989) except that pCMV6 lacks the translational enhancer sequence.

However, pMev produced a major increase in [3H]mevalonate incorporation into cellular lipids, but pMev-wt had no detect- able effect (Fig. 11).

DISCUSSION

This paper reports the isolation of pMev, a cDNA whose expression leads to enhanced uptake of mevalonate in mam- malian tissue culture cells. MeV, the protein encoded by pMev, contains 494 amino acids and is extremely hydrophobic. A hydropathy plot suggests that Mev is a membrane protein that contains 12 hydrophobic membrane-spanning regions separated by short hydrophilic loops ranging from 3 to 22 residues. The only exception is a 60-residue hydrophilic seg- ment separating membrane spans 6 and 7, which divides the molecule in half. There is also a segment of 56 hydrophilic amino acids at the COOH terminus.

The structure of MeV, as predicted from the cDNA se- quence, suggests that the protein functions directly as a mevalonate transporter. A similar membrane topology with 12 putative transmembrane segments has been modeled for other transport proteins, such as the glucose transporter (Mueckler et al., 1985); several members of the ATP-binding cassette (ABC) superfamily of transporters, such as the mul- tidrug resistance protein (P-glycoprotein) (Gottesman and Pastan, 1988); and a family of transporters for neurotrans- mitters including dopamine, serotonin, norepinephrine, and y-aminobutyric acid (Snyder, 1991). Like MeV, the glucose transporter and the P-glycoprotein each contain a large cy- toplasmic hydrophilic loop that divides the multiple mem-

brane-spanning domains into two symmetric halves. The hy- drophilic loops in some transporters, such as the P-glycopro- tein, contain ATP binding sites that are recognizable by certain amino acid motifs. Such motifs are absent in MeV, as they are in the glucose transporters and the neurotransmitter transporters. We cannot rule out the possibility that Mev is a regulator of some other protein that transports mevalonate, but this seems unlikely based on its predicted transporter- like structure.

When pMev is introduced into CHO cells by transfection, the cells acquire the characteristic properties of the met-18b- 2 cells from which pMev was derived. They take up mevalon- ate rapidly by a saturable process, which suggests a carrier- mediated event (Fig. 5). The affinity for mevalonate is rela- tively low with K,,, values for (R,S)-mevalonate of 2 mM (for met-18b-2 cells) and 1.5 mM (CHO transfected with pMev) as measured in the current study. If the carrier is specific for the physiologic R form of mevalonate as previously suggested (Faust and Krieger, 1987), the affinity would be 2-fold higher than these measured values. The concentration of mevalonate in cells is much lower than this value, suggesting that the uptake mechanism is carrier-mediated facilitated transport rather than energy-dependent transport against an electro- chemical gradient. It should be noted that the apparent K, value observed in the current study for met-18b-2 cells (2 mM) is several-fold higher than that reported by Faust and Krieger (1987). The explanation for this difference is un- known.

The linearity of mevalonate uptake with time up to 30 min is likely attributable to rapid phosphorylation by mevalonate kinase, which prevents back-diffusion (Fig. 5). We cannot rule out the possibility that the actual rate of mevalonate uptake is the same in control and MeV-expressing cells, but that the MeV-expressing cells retain more mevalonate owing to more rapid phosphorylation. Mev does not resemble mev- alonate kinase structurally (Tanaka et al., 1990), but it might be a protein that regulates mevalonate kinase, thus allowing mevalonate to be retained. We have ruled out the possibility that Mev acts by enhancing any of the reactions distal to mevalonate kinase, because it enhances mevalonate uptake in cells in which the metabolism of mevalonate pyrophosphate is blocked with 6-fluoromevalonate (Fig. 5). Definitive dem- onstration that Mev is a mevalonate carrier will require studies of the ability of the isolated Mev protein to directly mediate transport in vitro.

A most interesting aspect of these studies is the observation that the gene encoding Mev arose from a pre-existing gene through a point mutation that allowed the encoded protein to gain a new function, namely, the enhancement of mevalonate uptake. Although such gain-of-function mutations are ob- served in invertebrates, they have been observed less fre- quently in mammalian cells. Perhaps the clearest parallel to the current results is the finding of Owen et al. (1983), who described a variant form of al-antitrypsin in which a single amino acid substitution converted the protein from its normal function as an inhibitor of elastase to that of an inhibitor of thrombin. The mutation occurred in a patient who had a bleeding disorder, owing to the altered protein. The notion that amino acid substitutions in the membrane-spanning regions of membrane transporters can alter their specificity for ligands is exemplified by studies of mutations in the P- glycoprotein (Gros et al., 1991; Devine et al., 1992).

Presumably the mutation in met-18b-2 cells occurred spon- taneously, and this allowed the cells to survive the intense selection pressure of growth in MeLoCo medium (see the Introduction). Although Faust and Krieger (1987) transfected

cDNA Cloning of a Mevalonate Transporter 23121

these cells with CHO DNA, there is no evidence that this procedure had any influence on the occurrence of the Mev mutation. The met-18b-2 cells show no signs of having taken up the cotransfected ne0 resistance gene marker (Faust and Krieger, 1987), and there is no overexpression of the Mev mRNA (Fig. 7). Moreover, the genomic sequencing experi- ment of Fig. 10 indicates that the met-18b-2 cells have one copy of the wild-type gene and one copy of the mutated Mev gene, which would be expected for a dominant gain-of-func- tion mutation.

An important question relates to the normal function of the protein encoded by the wild-type Mev gene. As discussed above, the sequence suggests that it is a membrane trans- porter. It may be a transporter for mevalonate that is kept under regulation so that it is nonfunctional. In this case the Phe to Cys mutation at codon 360 may have allowed it to escape regulation. This explanation seems unlikely for several reasons: 1) we have been unable to observe rapid mevalonate uptake into CHO cells under any condition, even when the cells are starved for mevalonate by exposure to compactin, which would be expected to activate any regulated form of mevalonate uptake; 2) the affinity of Mev for mevalonate is much lower than the physiologic concentration of mevalonate in serum, which is about 50-100 nM (Parker et al., 1984), indicating that it would be an ineffective transporter in viuo; and 3) intravenously administered mevalonate is cleared pri- marily by the kidney (Hellstrom et al., 1973), whereas Mev mRNA is expressed most abundantly in heart as well as kidney (Fig. 8). It is possible that wild-type Mev is a high affinity, low capacity transporter for mevalonate and that the Phe to Cys substitution endows it with a lower affinity, but higher capacity. Further detailed studies of the properties of MeV-wt in in vitro transport systems will be necessary to answer this question.

In view of these considerations, we favor the hypothesis that MeV-wt is normally a transporter for some other sub- stance and that the substitution at codon 360 changed the specificity so that it can now bind and transport mevalonate. We do not know the putative normal substrate for MeV-wt, but it seems likely that it is an organic anion that is structur- ally related to mevalonate. It is possible that the mutation that allows mevalonate transport simultaneously abolishes transport of the normal substrate. Alternatively, MeV-wt could transport both substances. Many organic anions bear some superficial relationship to mevalonate. Krieger and Faust (1987) showed previously that the enhanced uptake of mevalonate in the met-18b-2 cells was relatively specific. There was no enhanced uptake of fatty acids or ketone bodies.

A clue to the normal function of MeV-wt may be provided by the tissue distribution of the mRNA. The mRNA is ex- pressed at low levels in most tissues of the body, but in both the Syrian hamster and the rat the expression was highest in the heart. If MeV-wt is normally a transporter, it may carry a substance that is required for cardiac function. Further studies will be necessary to determine the nature of this substance.

The final aspect of these studies that merits discussion is the utility of pMev for studies of mevalonate metabolism in eukaryotic cells. So far, pMev has elicited enhanced mevalon- ate uptake in every cell type into which it has been introduced

(CHO, simian COS cells, human embryonic kidney 293 cells, and mouse 3T3 cells). If this protein can function in other mammalian cells, especially in malignantly transformed cells, and if it can function in yeast, it should facilitate the further study of mevalonate metabolism, and particularly the role of prenylated proteins in cell division and cell biology.

Acknowledgments-We thank Tracye Martin and Edith Womack for invaluable assistance with the tissue culture experiments; Jeff Cormier for excellent help with DNA sequencing; and Jim Metherall and David Russell for helpful discussions.

REFERENCES

Andersson, S., Davis, D. L., Dahlback, H., Jornvall, H., and Russell, D. W. Akusjiirvi, G., Svensson, C., and Nygard, 0. (1987) Mol. Cell. Biol. 7,549-551

Beisiegel, U., Kita, T., Anderson, R. G. W., Schneider, W. J., Brown, M. S.,

Brown, M. S., and Goldstein, J. L. (1980) J. Lipid Res. 21,505-517 Brown, M. S., Faust, J. R., Goldstein, J. L., Kaneko, I., and Endo, A. (1978) J.

Casey, P. J., Solski, P. A., Der, C. J., and Buss, J. E. (1989) Proc. Natl. Acud.

Chirgwin, J. M., Przybyla, A. E., MacDonald, R. J., and Rutter, W. J. (1979)

Church, G. M., andGilbert, W. (1984) Proc. Natl. Acud. Sci. U. S. A. 81,1991-

Devereux, J., Haeberli, P., and Smithies, 0. (1984) Nucleic Acids Res. 12,387-

Devine, S. E., Ling, V., and Melera, P. W. (1992) Proc. Natl. Acud. Sci. U. S. A.

Faust, J., and Krie er, M. (1987) J. Biol. Chem. 262 , 1996-2004 Feinberg, A. P., an8 Vogelstein, B. (1983) A d . Biochem. 132,6-13 Glomset, J. A., Gelb, M. H., and Farnsworth, C. C. (1991) Curr. Opin. Lipidol.

Goldstein, J. L., and Brown, M. S. (1990) Nature 343,425-430 Gottesman, M. M., and Pastan, I. (1988) J. Biol. Chem. 263,12163-12166 Gros, P., Dhir, R., Croop, J., and Talbot, F. (1991) Proc. Natl. Acud. Sci. U. S. A.

Hancock, J. F., Magee, A. I., Childs, J. E., and Marshall, C. J. (1989) Cell 57,

Harlow, E., and Lane, D. (1988) Antibodies: A Laboratory Manual, Cold Spring

Hellstrom, K. H., Siperstein, M. D., Bricker, L. A., and Luby, L. J. (1973) J.

Kingsley, D. M., and Krieger, M. (1984) Proc. Natl. Acud. Sci. U. S. A. 8 1 ,

Kozak, M. (1984) Nucleic Acids Res. 12, 3873-3893 Krieger, M., Brown, M. S., and Goldstein, J. L. (1981) J. Mol. Biol. 150 , 167-

Kyte, J., and Doolittle, R. F. (1982) J. Mol. Biol. 157 , 105-132 Laemmli, U. K. (1970) Nature 227,680-685 Lee, J.-S. (1991) DNA Cell Biol. 10,67-73 Lehrman M. A., Russell D. W., Goldstein, J. L., and Brown, M. S. (1987) J.

Lowry 0. H. Rosebrough, N. J., Farr, A. L., and Randall, R. J. (1951) J. Biol.

Maltese, W. A. (1990) FASEB J. 4 , 3319-3328 Mueckler, M., Caruso, C., Baldwin, S. A., Panico, M., Blench, I., Morris, H. R.,

Allard, W. J., Lienhard, G. E., and Lodish, H. F. (1985) Science 229 , 941-

(1989) J. Biol. Chem. 264,8222-8229

and Goldstein, J. L. (1981) J. BWL Chem. 256,4071-4078

Biol. Chem. 253 , 1121-1128

Scr. U. S. A. 86,8323-8327

Biochemistry 18,5294-5299

1995

395

89,4564-4568

2 , llam

88,7289-7293

1167-1177

Harbor Laboratory, Cold Spring Harbor, NY

Clin. Inuest. 52,1303-1313

5454-5458

184

Biol. C h m . 262,335413361

Cheh. 195,265-275

Nave, J.-F., d'orchymont, H., Ducep, J.-B., Piriou, F., and Jung, M. J. (1985)

Owen, M. C., Brennan, S. O., Lewis, J. H., and Carrell, R. W. (1983) N. Engl.

945

Bwchem. J. 227,247-254

J. Med. 309.694-698 ~ ~~~~

Parker, T. S. McNamara, D. J Brown, C. D., Kolb, R., and Ahrens, E. H., Jr. (1984) J. dlin. Inuest. 7 4 , 796-804

Reiss, Y Goldstein, J. L., Seabra, M. C., Casey, P. J., and Brown, M. S. (1990) Cell 62,81-88

Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular, Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Sprlng Harbor,

Schafer, W. R., Kim, R., Sterne, R., Thorner, J., Kim, S.-H., andRine, J. (1989) NY

Schafer, W. R., Trueblood, C. E., Yang, C.-C., Mayer M. P., Rosenberg, S., Science 245,379-385

Schmidt, R. A., Schneider, C. J., and Glomset, J. (1984) J. Bwl. Chem. 2 5 9 , Poulter, C. D., Kim, S.-H., and Rine, J. (1990) S c k d e 249,>133-1139

10175-10180

- - - , ~~~ ~~~

~ ~ ~ ~ ~ . . Snyder, S. H. (1991) Nature 364,187 Tanaka, R. D., Lee, L. Y Schafer B. L., Kratunis V. J. Mohler W. A.

Robinson, G. W., and M&ey, S. T: (1990) Proc. Nad. Acud: Sei. U. A. A. 87: 2872-2878

van der Eb, A., and Graham, F. (1980) Methods Enzymol. 66,826-839 Walker, J. E., Saraste, M., Runswick, M. J., and Gay, N. J. (1982) EMBO J. 1 ,

~. - ""

945-951