The influence of nanotopography on organelle organization ... · of nanotopography is the ability to guide plasma membrane distribution and cytoskeleton dynamics [16]. The initially

The influence of nanotopography on organelle organizationand communication

Wen Song1,§, Mengqi Shi1,§, Bei Chang1, Mingdong Dong2 (), and Yumei Zhang1 ()

1 State Key Laboratory of Military Stomatology & National Clinical Research Center for Oral Diseases & Shaanxi Key Laboratory of Oral

Diseases, Department of Prosthodontics, School of Stomatology, The Fourth Military Medical University, Xi’an 710032, China 2 Interdisciplinary Nanoscience Center (iNANO), Aarhus University, Aarhus 8000, Denmark § These authors contributed equally to this work.

Received: 11 February 2016 Revised: 28 April 2016 Accepted: 3 May 2016 © Tsinghua University Press and Springer-Verlag Berlin Heidelberg 2016 KEYWORDS micro-/nanotopography, osteogenic differentiation, vesicle trafficking, organelle-specific GTPases, endoplasmic reticulum stress, unfolded protein response

ABSTRACT Cellular differentiation can be affected by the extracellular environment,particularly extracellular substrates. The nanotopography of the substrate may be involved in the mechanisms of cellular differentiation in vivo. Organelles are major players in various cellular functions; however, the influence of nano-topography on organelles has not yet been elucidated. In the present study, amicropit-nanotube topography (MNT) was fabricated on the titanium surface,and organelle-specific fluorescent probes were used to detect the intracellularorganelle organization of MG63 cells. Communication between organelles,identified by organelle-specific GTPase expression, was evaluated by quantitativepolymerase chain reaction and western blotting. Transmission electron microscopywas performed to evaluate the organelle structure. There were no significantdifferences in organelle distribution or number between the MNT and flat surface. However, organelle-specific GTPases on the MNT were dramatically downregulated. In addition, obvious endoplasmic reticulum lumen dilationwas observed on the MNT surface, and the unfolded protein response (UPR)was also initiated. Regarding the relationships among organelle trafficking, UPR,and osteogenic differentiation, our findings may provide important insights intothe signal transduction induced by nanotopography.

1 Introduction

Cell behaviors, such as morphology, proliferation, migration, and differentiation, are closely related to the nanotopography of extracellular substrate [1]. Uncovering the mechanisms linking the substrate

nanotopography with cell responses will help us understand the transmission of signals from physical features to biological processes. Unfortunately, the mechanisms for topographic sensing and response remain unclear, despite the proposal of many theories [1]. For example, for osteogenic differentiation of

Nano Research 2016, 9(8): 2433–2444 DOI 10.1007/s12274-016-1129-3

Address correspondence to Mingdong Dong, [email protected]; Yumei Zhang, [email protected]

| www.editorialmanager.com/nare/default.asp

2434 Nano Res. 2016, 9(8): 2433–2444

cells on the titanium implant surface, numerous studies have confirmed that osteogenic differentiation is dependent on substrate nanotopography [2, 3]. However, the mechanisms mediating this process have not been fully elucidated, even though several hypotheses have been reported. Previous publications from our group have shown that several signaling molecules, including Wnt/β-catenin, integrin-linked kinase (ILK)/extracellular signal-regulated kinase (ERK) 1/2, ILK/p38, and N-cadherin, are involved in micropit-nanotube topography (MNT)-mediated osteoblast differentiation [4–6]. Most other theories have suggested that cell function is regulated by both the elasticity and geometry of the extracellular matrix (ECM) [7–9], among which the role of nuclear lamin-A is critical [10]. In fact, all cell behaviors are theoretically carried out in intracellular organelles, and many studies have indicated that osteogenic differentiation is accomplished through cooperation of several organelles [11–13]. For example, proteins are synthesized and processed by organelles during osteogenic differen-tiation, and their sizes, morphologies, numbers, and distributions may also be changed. Hence, our first hypothesis in the present study was that substrate nanotopography may influence cell behaviors by altering the organization of intracellular organelles.

Organelles achieve mutual communication through vesicle trafficking. The organelle signpost is a key

molecule for accurate identification, budding, and fusion of the organelle membrane [14]. There are two types of signposts determining organelle identity: organelle-specific GTPases and organelle-specific phosphoinositides [14, 15]. Organelle-specific GTPases, including Rab and Arf families (Scheme 1(a)), have been well characterized. Consequently, the communi-cation profiles of organelles can be elucidated by evaluating changes in Rab and Arf family proteins; however, no studies have evaluated such changes on nanotopographic surfaces. A significant feature of nanotopography is the ability to guide plasma membrane distribution and cytoskeleton dynamics [16]. The initially aligned cytoskeletal component is thought to be the major determinant of cell orientation, and microtubules are the first element during focal contact between cells and nanotopography [17, 18]. Thus, microtubules are the key regulator during nanotopographic signal transduction. Additionally, vesicles are transported alongside microtubules within cells, and disruption of microtubules may directly influence vesicle transportation [19, 20]. Consequently, we propose our second hypothesis that microtubules are disturbed by nanotopography, which may cause dislocation of vesicles and result in delayed organelle communication (Schemes 1(b) and 1(c)).

In the present study, an MNT fabricated by convenient acid etching and anodization on a pure

Scheme 1 Potential influence of nanotopography on organelle transportation. (a) Diagram of intracellular organelle trafficking and well-characterized organelle-specific GTPases. (b) On a flat surface, the cell plasma membrane is spread out in a plane, and no tension is loaded on the microtubules. The vesicles and endosomes are located on microtubules. (c) On the MNT surface, the focal contacts between the plasma membrane and nanotopography are altered, and microtubule disturbance occurs. At this time, the vesicles and endosomes may drop down from the microtubules. ER: endoplasmic reticulum; Golgi: Golgi apparatus; PM: plasma membrane; EE: early endosome; LE: late endosome; LY: lysosome; V: vesicle.

www.theNanoResearch.com∣www.Springer.com/journal/12274 | Nano Research

2435 Nano Res. 2016, 9(8): 2433–2444

titanium surface was used as a model nanotopographic surface. We attempted to determine organelle organiza-tion and communication profiles on the MNT surface in order to provide novel insights into nanotopographic signal transduction.

2 Experimental

2.1 Specimen fabrication

A pure titanium square plate (99.8% purity, 1 cm × 1 cm × 0.2 cm) was provided by Northwest Institute for Nonferrous Metal Research (Xi’an, China). The sample was polished with SiC sandpaper to 2,000 grid and ultrasonically cleaned sequentially in acetone, absolute ethanol, and deionized water. For fabrication of the MNT, the polished sample was first etched in 0.5 wt.% hydrofluoric acid for 20 min and then anodized in 0.5 wt.% hydrofluoric acid at 20 V provide by a direct current power supply [21]. The specimen was sterilized with 75% ethanol before cell culture.

2.2 Cell culture

MG63 human osteoblasts (ATCC, Manassas, VA, USA) were maintained in growth medium containing α-MEM supplemented with 10% fetal bovine serum (FBS) and 1% penicillin/streptomycin. At 80% confluence, cells were detached with trypsin and seeded directly on titanium specimens at a density of 20,000 cells/cm2. For osteogenic induction, the cells were maintained in osteogenic medium containing 50 μg/mL ascorbic acid, 10 mM sodium β-glycerophosphate, and 100 nM dexamethasone (MP Biomedicals, USA).

2.3 Cell vitality and alkaline phosphatase activity

The cytotoxicity of titanium specimens was tested after 1 and 3 days of culture using a Cell Counting Kit-8 (CCK-8; Beyotime, China). Briefly, the specimens were transferred into new 24-well plates and washed in prewarmed phosphate-buffered saline (PBS). The CCK-8 reagent was then diluted in phenol-free medium (1:10) and added to each well (500 μL per well). The supernatants were transferred to 96-well plates after incubating for 3 h, and the absorbance was read at 465 nm using a spectrometer (BioTek,

USA). The osteogenic differentiation of MG63 cells was determined using an alkaline phosphatase (ALP) detection kit (Nanjing Jiancheng Bioengineering Institute, China). Briefly, the cells were induced in osteogenic medium. After 7 days of induction, cells were lysed with 10% Triton X-100 through freeze/thaw cycles. The lysate was transferred into 96-well plates and incubated at 37 °C with reagent for 15 min. The activity was calculated by measuring the optical density at 520 nm and normalized to the total protein.

2.4 Confocal laser-scanning microscopy (CLSM)

The organelle distribution in situ was determine using CLSM observations after staining with organelle- specific fluorescent probes. Briefly, after culture for 1 day or differentiation for 3 days, cells were incubated with organelle probes (KeyGEN BioTECH, Nanjing, China) including DiOC6(3), NBD C6-ceramide, MitoTracker Green FM, and LysoTracker Green DND according to the manufacturer’s instructions. The membranes were then stained with DiD (KeyGEN BioTECH), and the nuclei were stained with Hoechst (Invitrogen, Waltham, MA, USA). The cells were fixed in prewarmed 4% paraformaldehyde and imaged immediately by CLSM (Olympus, Japan). The z-position was chosen based on the optimal focus of the nucleus. Additionally, cells cultured for 1 day were also subjected to z-stack scanning. The ratio of organelle area (green) to nucleus area (blue) was calculated using ImageJ.

2.5 Flow cytometry

The organelle number, indicated by the fluorescence intensity after incubation with organelle probes, was quantified by flow cytometry (CFlow BD Accuri C6; BD, USA). Cells were detached by trypsin and subjected to organelle probe detection. The excessive probes were removed by washing with prewarmed PBS, and the cells were suspended in 100 μL PBS; cytometry measurements were then performed immediately. A total of 10,000 cells were collected, and the FL1-A intensity versus cell count was plotted. The geomean of FL1-A intensity was calculated by subtracting the intensity of cells without staining.


2436 Nano Res. 2016, 9(8): 2433–2444

2.6 Real-time quantitative polymerase chain reaction (qPCR)

Total RNA was isolated using TRIzol Reagent (Invitrogen). Complementary DNA (cDNA) was then synthesized using a ReverTra Ace qPCR RT Kit (TOYOBO LIFE SCIENCE, Japan). Real-time quanti-tative PCR was performed to amplify the cDNA using SYBR Green Realtime PCR Master Mix (TOYOBO LIFE SCIENCE) on a CFX96 instrument (Bio-Rad, Hercules, CA, USA). Target gene expression was calculated based on the Ct values. The primers sequences are listed in Table 1.

2.7 Western blotting

The total protein was extracted using a Protein Extraction Kit (Beyotime). After quantification using a BCA kit (Beyotime), 20 μg total protein was loaded into each lane for separation by sodium dodecyl

sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and transferred onto a polyvinylidene fluoride (PVDF) membrane. After sealing and incubation with antibodies, the band was detected using enhanced chemoluminescence reagent (Santa Cruz Biotechnology, Santa Cruz, CA, USA). The antibody information is provided in Table 2.

2.8 Electron microscopy

The topographies of the fabricated specimens were observed by scanning electron microscopy (SEM; S-4800; Hitachi Japan) directly after drying under ambient conditions. For observation by transmission electron microscopy (TEM), cells were harvested from the metal substrate by trypsinization and fixed immediately in 4% paraformaldehyde/2.5% glutaral-dehyde (1:1). The cells were then subjected to a second fixation in 1% osmium tetroxide solution. After dehydration by ethanol, the sample was embedded

Table 1 Primers used for qPCR

Gene Forward 5’-3’ Reverse 5’-3’

Sar1 (ID: 56681) TGATCTTGGTGGGCACGAGCA CCACGAGGCGAGAATGATCTGC

Arf1 (ID: 375) GATGCTGTCCTCCTGGTGTTCG GTTCCTGTGGCGTAGTGAGTGC

ARFRP1 (ID: 10139) GTGGATGTGGGAAAGGCTCG GTCACCACCTTCTCAAACGC

Arf6 (ID: 382) GCTCTGGCGGCATTACTACACT GGTCCTGCTTGTTGGCGAAGAT

Rab5 (ID: 5868) GAGGAGCACAAGCAGCCATAGT TTGCTAGGTCGGCCTTGTTTCC

Rab7 (ID: 7879) GAGCAGGCGTTCCAGACGATTG CCTTGGCCCGGTCATTCTTGTC

PERK (ID: 9451) ATGTGGAAGATGGGACTATG GAAGCATTATCACAGCCAGA

ATF4 (ID: 468) AGGTGTTGGTGGGGGACTTG CTGACCAACCCATCCACAGC

GRP78 (ID: 3309) CAACCAAAGACGCTGGAACT TGGTGAGAAGAGACACATCG

CHOP (ID: 1649) CCTATGTTTCACCTCCTGGA GAATCTGGAGAGTGAGGGCT

Table 2 Antibodies used for western blotting

Name Description Manufacture

Anti-SAR1 antibody Goat polyclonal, 22 kD ABCAM (ab111814)

Anti-ARF1 antibody Rabbit mAb, 45 kD CST (#14608)

Anti-ARFRP1 antibody Rabbit polyclonal, 22–25 kD Elabscience (EPP10520)

Anti-ARF6 antibody Rabbit polyclonal, 18 kD ABCAM (ab77581)

Anti-Rab5 antibody Rabbit polyclonal, 24 kD ABCAM (ab18211)

Anti-Rab7 antibody Rabbit polyclonal, 23 kD Elabscience (EAP0289)

Secondary antibody HRP-goat anti-rabbit IgG Elabscience (SAEP003)

Secondary antibody HRP-rabbit anti-goat IgG Elabscience (SAEP004)


2437 Nano Res. 2016, 9(8): 2433–2444

in epoxy resin, sectioned using a diamond edge razor, and stained with uranyl acetate-lead citrate. The intracellular organelles were observed using a Tecnai transmission electron microscope (FEI, Hillsboro, OR, USA) to evaluate the shape and size of the rough endoplasmic reticulum (ER).

2.9 Statistical analysis

All experiments were independently repeated three times and presented as means ± standard deviations. The means were compared by Student’s t-tests, and differences with P values of less than 0.05 were con-sidered statistically significant.

3 Results and discussion

3.1 Fabrication of the MNT and evaluation of biological performance

We first fabricated the MNT on a polished pure titanium surface by acid etching and anodization, which has been proven to effectively promote osteogenic differentiation in our previous studies [22, 23]. The polish scratches could be observed under lower SEM magnification (Fig. 1(a)) and became invisible under higher magnification (Fig. 1(b)). Regular micropits were obtained after hydrofluoric acid etching and could be observed under lower SEM magnification (Fig. 1(c)). Afterwards, titania nanotubes with diameters of 80–100 nm were vertically aligned by anodization on the micropit substrate (Fig. 1(d)). The human osteoblast cell line MG63 was used for the biological evaluation. Consistent with previous studies, the hybrid MNT exhibited no obvious cytotoxicity (Fig. 1(e)), whereas the osteogenic differentiation indicated by alkaline phosphatase (ALP) activity was strongly augmented (Fig. 1(f)).

3.2 Organelle horizontal distribution

Next, we explored the distribution and number of organelles. Organelle-specific fluorescent probes were used to detect the primary intracellular organelles, including the ER, Golgi apparatus (Golgi), mitochondria (Mit), and lysosomes (LY), after incubation in normal medium for 1 day or in osteogenic medium for 3 days. On the first day, the ER was distributed throughout

Figure 1 Specimen preparation and biological performance. The pure titanium plate was polished to obtain a flat surface. The polish scratches could be observed under lower SEM magnification (a) and were not visible under higher magnification (b). The MNT was prepared by acid etching and anodization on a flat surface. Micropits were observed under lower magnification (c), whereas regular vertically aligned nanotube arrays were observed under higher magnification (d). (e) The cytotoxicities of the two topographies were checked by CCK-8 analysis after 1 and 3 days of culture of MG63 cells. (f) The osteogenic differentiation of MG63 cells on the two topographies was compared by measuring intracellular alkaline phosphatase activity after induction in osteogenic medium for 7 days. *P < 0.05.

the entire cytoplasm, whereas most of the Golgi was located near the nucleus (Fig. 2(a)). The Mit and LY were located adjacent to one side of the nucleus along the long axis of cells (Fig. 2(a)). After induction for 3 days, the cell number increased obviously, and cell membranes interacted closely (Fig. 2(a)). The areas of the ER and Golgi were enlarged significantly (Fig. 2(a)). The Mit and LY were dispersed throughout the cytoplasm (Fig. 2(a)). However, there were no obvious visible differences between the MNT and flat surface. The area ratios between organelles and nuclei were calculated using ImageJ software. No significant differences were observed between the MNT and flat surface on days 1 (Fig. 2(b)) or 3


2438 Nano Res. 2016, 9(8): 2433–2444

(Fig. 2(c)). These data indicated that the organelles spread similarly in the horizontal direction in our observed sections.

3.3 Organelle vertical distribution

The vertical alignment of the ER was further observed by z-stack scanning. Notably, the ER was located above the nucleus on the MNT surface, but was found at the same z position on the flat surface (Fig. 3(a)). The total vertical fluorescence signal span on MNT was “thicker” than that on the flat surface (Fig. 3(c)). This phenomenon may be explained by the micropits on the MNT surface. In order to follow the surface

topography, cells on the MNT surface had to be folded such that the organelles and nuclei were not at the same z position. On the flat surface, cells were spread in a two-dimensional space, as were the organelles and nuclei (Fig. 3(d)).

3.4 Organelle number

Flow cytometry was performed after incubation in normal medium for 1 day or in osteogenic medium for 3 days (Fig. 4). The intensity distribution of the MNT (red line) and flat surface (green line) was exhibited in a single plot (Fig. 4(a)). Obvious differences between the MNT and flat surface could be observed

Figure 2 Observations of the horizontal distribution of organelles by confocal laser-scanning microscopy after interaction with the two topographies for 1 day (normal medium) or 3 days (osteogenic medium). (a) Cells were incubated with organelle probes (DiOC6(3); NBD C6-ceramide; MitoTracker Green FM; LysoTracker Green DND) according to the manufacturer’s instructions. The plasma membranes were tracked using DiD, and nuclei were stained with Hoechst. Images were taken at the section of showing maximumnuclear focus. (b) and (c) Ratios between the organelle area (green) and nucleus area (blue), as calculated by ImageJ.


2439 Nano Res. 2016, 9(8): 2433–2444

in all stained organelles except the ER and lysosomes on day 1 (Fig. 4(a)). Quantitative data were calculated as the ratio of the MNT to the flat surface. Despite the lack of statistical significance detected between the MNT and flat surface, all measured organelle intensities, except for that of the Golgi apparatus, were slightly higher on the MNT surface than on the flat surface on day 1 (Fig. 4(a)). After 3 days of osteogenic differentia-tion, the intensities of all four measured organelles were higher on the MNT surface than on the flat surface, although there were no significant differences (Fig. 4(b)).

Organelle distribution and numbers are closely related to cell functions [24]. During osteogenic differentiation, the LY are dispersed to promote collagen production [13]. The Golgi is enlarged to process proteins for secretion [25], and the Mit

numbers and functions are mandatory for osteogenic signal transduction [12]. However, our results did not show major differences. One possible reason for this observation may be that topography-mediated cellular differentiation exhibits different organelle organiza-tion than normal chemical-mediated differentiation. According to Buxboim et al., the ECM elasticity/ cytoskeletal force/nuclear axis is the central axis modulating cell sensitivity [7]. Because the stiffnesses of the MNT and flat surface are similar, a single geometric alteration may not be able to influence organelle organization significantly. The limitations of our detection method may also be another reason for this observation. Fluorescent probes are not as sensitive and specific as organelle-specific markers, which are much more expensive and complex. Additionally, optical methods have limited magnification, and

Figure 3 Observation of the vertical distributions of organelles by confocal laser-scanning microscopy after interaction with the two topographies for 1 day (normal medium). (a) The ER was stained with DiOC6(3). The plasma membranes were tracked with DiDstaining, and the nuclei were stained with Hoechst. Z-stack scanning was performed from the emergence to disappearance of the nucleusat 2-µm intervals. (b) Illustration of confocal z-stack scanning direction. (c) Z-stack scanning from the emergence to disappearance of the plasma membrane at 2-µm intervals. (d) Diagram depicting the related position of the plasma membrane, nucleus, and ER.


2440 Nano Res. 2016, 9(8): 2433–2444

detailed structural information cannot be obtained. Moreover, our current study represented the first attempt to systematically uncover the organelle organization profiles on the MNT surface and suggested that organelle distribution and number were not the key factors mediating osteogenic differentiation on the MNT surface.

3.5 Organelle-specific GTPase expression

Because organelle communication is mainly realized by vesicle trafficking, we were interested in deter-mining whether such communication could be affected

by the MNT. As illustrated in Fig. 5(a), there are two main intracellular trafficking pathways, i.e., the secretory pathway from the ER to the Golgi to the plasma membrane (PM) and the endocytosis pathway from the PM to the early endosome (EE) to the late endosome (LE) or LY. Based on the location of the organelles, these two trafficking pathways can be configured by several well-characterized GTPase families, including Sar1, Arf1, ARFRP1, Arf6, Rab5, and Rab7. Thus, the expression levels of these targets were measured by qPCR. On day 1 of incubation, all organelle-specific GTPases were downregulated on

Figure 4 Flow cytometry analysis of the organelle fluorescence intensity after interaction with the two topographies for 1 day (normal medium) or 3 days (osteogenic medium). (a) Cells were harvested by trypsinization and labeled with organelle-specific fluorescent probes. A total of 10,000 cells were collected, and the green channel fluorescence intensity was recorded. (b) and (c) Quantitative data ofthe fluorescence intensity.


2441 Nano Res. 2016, 9(8): 2433–2444

the MNT surface compared with that on the flat topography, and statistical significance was observed for Arf1 and ARFRP1 (Fig. 5(b)). After 3 days of differentiation in osteogenic medium, all of the measured GTPases were slightly upregulated on the MNT compared with that on the flat surface; however, with the exception of Rab7, these differences were not statistically significant (Fig. 5(c)). The organelle- specific expression of GTPase protein was further determined by western blotting. Consistent with the findings for mRNA expression, all the GTPases examined in this study were downregulated on the MNT surface on day 1, but were recovered to a level similar to those of the flat surface after 3 days of induction (Fig. 5(d)). A semiquantitative analysis by ImageJ indicated that all the examined GTPases were significantly attenuated on the MNT surface on day 1, but rebounded after 3 days of induction (Figs. 5(e) and 5(f)).

In order to explain the initial suppression of vesicle trafficking on the MNT surface, we proposed the hypothesis that the MNT may be a type of substrate geometric stressor that would induce the mild cellular stress response (CSR). The CSR is a general term indicating a wide range of molecular changes when cells undergo environmental stressors. Several studies have shown that osteogenic differentiation is enhanced

when cells are subjected to mild CSR, such as heat stress [26], ER stress [27], hypoxia [28], and autophagy [29]. In addition, intracellular trafficking and CSR are closely related [30]. Through a literature search, we focused our attention on the unfolded protein response (UPR), which is a specific CSR program within cells that functions to alleviate ER stress [31]. One reason is that Sar1, a key molecule mediating protein exit from the ER, was found to be downregulated on the MNT surface, based on our observations. This implied that protein accumulation may occur within the ER lumen, representing a primary cause of ER stress [32]. Additionally, ER stress itself also reduces Sar1-mediated COPII vesicle formation [33], which may cause deceleration of intracellular trafficking. Alternatively, the crosstalk between UPR signaling and osteogenic differentiation may explain these findings. Indeed, studies have shown that UPR signaling and osteogenic differentiation share many common molecules, such as cysteine-rich with EGF-like domains 2 (CRELD2) [34] and OASIS [35]. Consequently, it is reasonable to deduce that the enhanced osteogenic capability of the MNT surface may also be attributed to UPR activation.

3.6 ER stress and UPR activation

To confirm the aforementioned hypothesis, cells on the MNT and flat surfaces were collected by trypsinization

Figure 5 Intracellular organelle trafficking profiles determined by analysis of organelle-specific GTPase expression after interaction with the two topographies for 1 day (normal medium) or 3 days (osteogenic medium). (a) and (b) mRNA expression levels of organelle signposts determined by qPCR. (c) Western blotting of organelle-specific GTPases. (d) and (e) Semiquantitative data of western blots,as analyzed by ImageJ. *P < 0.05.


2442 Nano Res. 2016, 9(8): 2433–2444

and analyzed by TEM. Significant ER lumen dilation, a characteristic ER morphological phenomenon that occurs during ER stress [36], was observed in the MNT group (Fig. 6(a)). Moreover, analysis of gene expression by qPCR suggested upregulation of the pancreatic eIF-2alpha kinase (PERK) pathway (Fig. 6(b)), a major UPR pathway [37]. Based on these data, we believe that the cells on the MNT surface were suffering from ER stress and that the UPR program was initiated. Similar to many other types of stresses, ER stress is also a dual-functional process determining cell fate [38]. Excessive ER stress beyond cell tolerance will cause cell apoptosis [39] or death [40], whereas mild ER stress can be balanced by various pathways and enhance osteogenesis [27]. Because cell vitality on the MNT was not significantly influenced and the expression of C/EBP homologous protein (CHOP), which promotes apoptosis under ER stress, was not upregulated, the degree of ER stress should be mild.

4 Conclusions

Overall, our findings showed that intracellular trafficking was suppressed after initial contact with

Figure 6 ER stress and UPR detection. (a) Cells were harvested for TEM observations after interaction with the two topographies for 24 h. The asterisk indicates dilation of the ER lumen. ER: endoplasmic reticulum; Mit: mitochondria; Nu: nucleus. (b) Detection of UPR signaling by qPCR. *P < 0.05.

the nanotopographic extracellular environment. These data strongly implied that the cells were suffering from mild ER stress; this mechanism may explain the nanotopography-guided cellular differentiation observed in this study.

Acknowledgements

This work was granted by the National Natural Science Foundation of China (Nos. 81470785 and 81530051) and Program for Changjiang Scholars and Innovative Research Team in University (No. IRT13051). We appreciate the grant from Department of Oral and Maxillofacial Surgery, School of Stomatology, the Fourth Military Medical University. The authors also thank the help from Department of Toxicology, the Ministry of Education Key Lab of Hazard Assessment and Control in Special Operational Environment, Shaanxi Provincial Key Lab of Free Radical Biology and Medicine, School of Public Health.

References

[1] Bettinger, C. J.; Langer, R.; Borenstein, J. T. Engineering substrate topography at the micro- and nanoscale to control cell function. Angew. Chem., Int. Ed. 2009, 48, 5406–5415.

[2] Park, J.; Bauer, S.; von der Mark, K.; Schmuki, P. Nanosize and vitality: TiO2 nanotube diameter directs cell fate. Nano Lett. 2007, 7, 1686–1691.

[3] Park, J.; Bauer, S.; Schlegel, K. A.; Neukam, F. W.; von der Mark, K.; Schmuki, P. TiO2 nanotube surfaces: 15 nm—An optimal length scale of surface topography for cell adhesion and differentiation. Small 2009, 5, 666–671.

[4] Wang, W.; Zhao, L. Z.; Ma, Q. L.; Wang, Q. T.; Chu, P. K.; Zhang, Y. M. The role of the Wnt/β-catenin pathway in the effect of implant topography on MG63 differentiation. Biomaterials 2012, 33, 7993–8002.

[5] Wang, W.; Liu, Q.; Zhang, Y. M.; Zhao, L. Z. Involvement of ILK/ERK1/2 and ILK/p38 pathways in mediating the enhanced osteoblast differentiation by micro/nanotopography. Acta Biomater. 2014, 10, 3705–3715.

[6] Liu, Q.; Wang, W.; Zhang, L.; Zhao, L.; Song, W.; Duan, X.; Zhang, Y. Involvement of N-cadherin/β-catenin interaction in the micro/nanotopography induced indirect mechanotrans-duction. Biomaterials 2014, 35, 6206–18.

[7] Buxboim, A.; Ivanovska, I. L.; Discher, D. E. Matrix elasticity, cytoskeletal forces and physics of the nucleus:


2443 Nano Res. 2016, 9(8): 2433–2444

How deeply do cells “feel” outside and in? J. Cell Sci. 2010, 123, 297–308.

[8] Fu, J. P.; Wang, Y. K.; Yang, M. T.; Desai, R. A.; Yu, X.; Liu, Z. J.; Chen, C. S. Mechanical regulation of cell function with geometrically modulated elastomeric substrates. Nat. Methods 2010, 7, 733–736.

[9] Buxboim, A.; Discher, D. E. Stem cells feel the difference. Nat. Methods 2010, 7, 695–697.

[10] Swift, J.; Ivanovska, I. L.; Buxboim, A.; Harada, T.; Dingal, P. C. D. P.; Pinter, J.; Pajerowski, J. D.; Spinler, K. R.; Shin, J. W.; Tewari, M. et al. Nuclear lamin—A scales with tissue stiffness and enhances matrix-directed differentiation. Science 2013, 341, 1240104.

[11] Taniguchi, T.; Kido, S.; Yamauchi, E.; Abe, M.; Matsumoto, T.; Taniguchi, H. Induction of endosomal/lysosomal pathways in differentiating osteoblasts as revealed by combined proteomic and transcriptomic analyses. FEBS Lett. 2010, 584, 3969–3974.

[12] An, J. H.; Yang, J.-Y.; Ahn, B. Y.; Cho, S. W.; Jung, J. Y.; Cho, H. Y.; Cho, Y. M.; Kim, S. W.; Park, K. S.; Kim, S. Y. et al. Enhanced mitochondrial biogenesis contributes to Wnt induced osteoblastic differentiation of C3H10T1/2 cells. Bone 2010, 47, 140–150.

[13] Nabavi, N.; Urukova, Y.; Cardelli, M.; Aubin, J. E.; Harrison, R. E. Lysosome dispersion in osteoblasts accommodates enhanced collagen production during differentiation. J. Biol. Chem. 2008, 283, 19678–19690.

[14] Behnia, R.; Munro, S. Organelle identity and the signposts for membrane traffic. Nature 2005, 438, 597–604.

[15] Munro, S. Organelle identity and the organization of membrane traffic. Nat. Cell Biol. 2004, 6, 469–472.

[16] Sun, X. Y.; Driscoll, M. K.; Guven, C.; Das, S.; Parent, C. A.; Fourkas, J. T.; Losert, W. Asymmetric nanotopography biases cytoskeletal dynamics and promotes unidirectional cell guidance. Proc. Natl. Acad. Sci. USA 2015, 112, 12557–12562.

[17] Kim, D. H.; Provenzano, P. P.; Smith, C. L.; Levchenko, A. Matrix nanotopography as a regulator of cell function. J. Cell Biol. 2012, 197, 351–360.

[18] Oakley, C.; Brunette, D. M. The sequence of alignment of microtubules, focal contacts and actin filaments in fibroblasts spreading on smooth and grooved titanium substrata. J. Cell Sci. 1993, 106, 343–354.

[19] Cooper, G. M. The Cell: A Molecular Approach, 2nd ed; Sinauer Associates: Sunderland, MA, USA, 2000.

[20] Caviston, J. P.; Holzbaur, E. L. F. Microtubule motors at the intersection of trafficking and transport. Trends Cell Biol. 2006, 16, 530–537.

[21] Zhao, L. Z.; Mei, S. L.; Wang, W.; Chu, P. K.; Wu, Z. F.; Zhang, Y. M. The role of sterilization in the cytocompatibility

of titania nanotubes. Biomaterials 2010, 31, 2055–2063. [22] Zhao, L. Z.; Mei, S. L.; Chu, P. K.; Zhang, Y. M.; Wu, Z. F.

The influence of hierarchical hybrid micro/nano-textured titanium surface with titania nanotubes on osteoblast functions. Biomaterials 2010, 31, 5072–5082.

[23] Zhao, L. Z.; Liu, L.; Wu, Z. F.; Zhang, Y. M.; Chu, P. K. Effects of micropitted/nanotubular titania topographies on bone mesenchymal stem cell osteogenic differentiation. Biomaterials 2012, 33, 2629–2641.

[24] van Bergeijk, P.; Adrian, M.; Hoogenraad, C. C.; Kapitein, L. C. Optogenetic control of organelle transport and positioning. Nature 2015, 518, 111–114.

[25] Kasap, M.; Karaoz, E.; Akpinar, G.; Aksoy, A.; Erman, G. A unique Golgi apparatus distribution may be a marker for osteogenic differentiation of hDP-MSCs. Cell Biochem. Funct. 2011, 29, 489–495.

[26] Nørgaard, R.; Kassem, M.; Rattan, S. I. S. Heat shock- induced enhancement of osteoblastic differentiation of htert- immortalized mesenchymal stem cells. Ann. N. Y. Acad. Sci. 2006, 1067, 443–447.

[27] Hamamura, K.; Yokota, H. Stress to endoplasmic reticulum of mouse osteoblasts induces apoptosis and transcriptional activation for bone remodeling. FEBS Lett. 2007, 581, 1769–1774.

[28] Wagegg, M.; Gaber, T.; Lohanatha, F. L.; Hahne, M.; Strehl, C.; Fangradt, M.; Tran, C. L.; Schönbeck, K.; Hoff, P.; Ode, A. et al. Hypoxia promotes osteogenesis but suppresses adipogenesis of human mesenchymal stromal cells in a hypoxia-inducible factor-1 dependent manner. PLoS One 2012, 7, e46483.

[29] Pantovic, A.; Krstic, A.; Janjetovic, K.; Kocic, J.; Harhaji- Trajkovic, L.; Bugarski, D.; Trajkovic, V. Coordinated time-dependent modulation of AMPK/Akt/mTOR signaling and autophagy controls osteogenic differentiation of human mesenchymal stem cells. Bone 2013, 52, 524–531.

[30] Levine, A. Regulation of stress responses by intracellular vesicle trafficking? Plant Physiol. Biochem. 2002, 40, 531– 535.

[31] Oslowski, C. M.; Urano, F. Measuring er stress and the unfolded protein response using mammalian tissue culture system. Methods Enzymol. 2011, 490, 71–92.

[32] Tsai, Y. C.; Weissman, A. M. The unfolded protein response, degradation from the endoplasmic reticulum, and cancer. Genes Cancer 2010, 1, 764–778.

[33] Amodio, G.; Venditti, R.; De Matteis, M. A.; Moltedo, O.; Pignataro, P.; Remondelli, P. Endoplasmic reticulum stress reduces COPII vesicle formation and modifies Sec23a cycling at ERESs. FEBS Lett. 2013, 587, 3261–3266.

[34] Oh-hashi, K.; Kunieda, R.; Hirata, Y.; Kiuchi, K. Biosynthesis


2444 Nano Res. 2016, 9(8): 2433–2444

and secretion of mouse cysteine-rich with EGF-like domains 2. FEBS Lett. 2011, 585, 2481–2487.

[35] Murakami, T.; Saito, A.; Hino, S.; Kondo, S.; Kanemoto, S.; Chihara, K.; Sekiya, H.; Tsumagari, K.; Ochiai, K.; Yoshinaga, K. et al. Signalling mediated by the endoplasmic reticulum stress transducer OASIS is involved in bone formation. Nat. Cell Biol. 2009, 11, 1205–1211.

[36] Schuck, S.; Prinz, W. A.; Thorn, K. S.; Voss, C.; Walter, P. Membrane expansion alleviates endoplasmic reticulum stress independently of the unfolded protein response. J. Cell Biol. 2009, 187, 525–536.

[37] Lai, E.; Teodoro, T.; Volchuk, A. Endoplasmic reticulum stress: Signaling the unfolded protein response. Physiology 2007, 22, 193–201.

[38] Tsang, K. Y.; Chan, D.; Bateman, J. F.; Cheah, K. S. E. In vivo cellular adaptation to ER stress: Survival strategies with double-edged consequences. J. Cell Sci. 2010, 123, 2145–2154.

[39] Tabas, I.; Ron, D. Integrating the mechanisms of apoptosis induced by endoplasmic reticulum stress. Nat. Cell Biol. 2011, 13, 184–190.

[40] Sano, R.; Reed, J. C. ER stress-induced cell death mechanisms. Biochim. Biophys. Acta 2013, 1833, 3460–3470.

Documents

The influence of nanotopography on organelle organization ... · of nanotopography is the ability to guide plasma membrane distribution and cytoskeleton dynamics [16]. The initially