The Human Genome ProjectThe Human Genome Project(Lecture 7)(Lecture 7)

What did they do?What did they do? Why did they do it?Why did they do it? What will it mean for What will it mean for

humankind?humankind?

Brief history of the work…Brief history of the work… Proposed in 1985Proposed in 1985 1988. Initiated and 1988. Initiated and

funded by NIH and US funded by NIH and US Dept. of Energy ($3 Dept. of Energy ($3 billion set aside)billion set aside)

1990. Work begins.1990. Work begins. 1998. Celera announces 1998. Celera announces

a 3-year plan to complete a 3-year plan to complete the project years earlythe project years early

Published in Science and Published in Science and Nature in February, 2001Nature in February, 2001

The Human Genome Project The Human Genome Project Began in 1990Began in 1990

The Mission of the HGP: The quest to The Mission of the HGP: The quest to understand the human genome and the understand the human genome and the role it plays in both health and disease. role it plays in both health and disease.

“The true payoff from the HGP will be the ability to better diagnose, treat, and prevent disease.” --- Francis Collins, Director of the HGP and the National Human Genome Research Institute (NHGRI)

Goals of HGPGoals of HGP Create physical map of the 24 human Create physical map of the 24 human

chromosomes (22 autosomes, X & Y)chromosomes (22 autosomes, X & Y) Identify the entire set of genes & map them all Identify the entire set of genes & map them all

to their chromosomesto their chromosomes Determine the nucleotide sequence of the Determine the nucleotide sequence of the

estimated 3 billion base pairsestimated 3 billion base pairs Analyze genetic variation among humansAnalyze genetic variation among humans Map and sequence the genomes of model Map and sequence the genomes of model

organismsorganisms

Model organismsModel organisms

Bacteria (Bacteria (E. coliE. coli, influenza, several others), influenza, several others) Yeast (Yeast (Saccharomyces cerevisiaeSaccharomyces cerevisiae)) Plant (Plant (Arabidopsis thalianaArabidopsis thaliana)) Roundworm (Roundworm (Caenorhabditis elegansCaenorhabditis elegans)) Fruit fly (Fruit fly (Drosophila melanogasterDrosophila melanogaster)) Mouse (Mouse (Mus musculusMus musculus))

Goals of HGP (cont’d)Goals of HGP (cont’d)

Develop new laboratory and computing Develop new laboratory and computing technologies to make all this possibletechnologies to make all this possible

Disseminate genome information Disseminate genome information Consider ethical, legal, and social Consider ethical, legal, and social

issues associated with this researchissues associated with this research

Brief history of the work…Brief history of the work… Proposed in 1985Proposed in 1985 1988. Initiated and 1988. Initiated and

funded by NIH and US funded by NIH and US Dept. of Energy ($3 Dept. of Energy ($3 billion set aside)billion set aside)

1990. Work begins.1990. Work begins. 1998. Celera announces 1998. Celera announces

a 3-year plan to complete a 3-year plan to complete the project years earlythe project years early

Published in Science and Published in Science and Nature in February, 2001Nature in February, 2001

The Beginning of the Project The Beginning of the Project Most the first 10 years of the project were Most the first 10 years of the project were

spent improving the technology to spent improving the technology to sequence and analyze DNA.sequence and analyze DNA.

Scientists all around the world worked to Scientists all around the world worked to make detailed maps of our chromosomes make detailed maps of our chromosomes and sequence model organisms, like and sequence model organisms, like worm, fruit fly, and mouse.worm, fruit fly, and mouse.

How they did it…How they did it… DNA from 5 humansDNA from 5 humans 2 males, 3 females2 males, 3 females 2 caucasians, one each 2 caucasians, one each

of asian, african, hispanicof asian, african, hispanic

Cut up DNA with Cut up DNA with restriction enzymesrestriction enzymes

Ligated into BACs & Ligated into BACs & YACs, then grew them upYACs, then grew them up

Sequenced the BACsSequenced the BACs Let a supercomputer put Let a supercomputer put

the pieces togetherthe pieces together

DNA

Cut segments inserted into BACs

Known sequence

Lots of overlap

How they did it…How they did it… DNA from 5 humansDNA from 5 humans 2 males, 3 females2 males, 3 females 2 caucasians, one each 2 caucasians, one each

of asian, african, hispanicof asian, african, hispanic

Cut up DNA with Cut up DNA with restriction enzymesrestriction enzymes

Ligated into BACs & Ligated into BACs & YACs, then grew them upYACs, then grew them up

Sequenced the BACsSequenced the BACs Let a supercomputer put Let a supercomputer put

the pieces togetherthe pieces together

What did they find?

CACACTTGCATGTGAGAGCTTCTAATATCTAAATTAATGTTGAATCATTATTCAGAAACAGAGAGCTAACTGTTATCCCATCCTGACTTTATTCTTTATG AGAAAAATACAGTGATTCCCACACTTGCATGTGAGAGCTTCTAATATCTAAATTAATGTTGAATCATTATTCAGAAACAGAGAGCTAACTGTTATCCCATCCTGACTTTATTCTTTATG AGAAAAATACAGTGATTCCAAGTTACCAAGTTAGTGCTGCTTGCTTTATAAATGAAGTAATATTTTAAAAGTTGTGCATAAGTTAAAATTCAGAAATAAAACTTCATCCTAAAACTCTGTGTGTTGCTTTAAATAATCAAGTTACCAAGTTAGTGCTGCTTGCTTTATAAATGAAGTAATATTTTAAAAGTTGTGCATAAGTTAAAATTCAGAAATAAAACTTCATCCTAAAACTCTGTGTGTTGCTTTAAATAATCAGAGCATCTGC TACTTAATTTTTTGTGTGTGGGTGCACAATAGATGTTTAATGAGATCCTGTCATCTGTCTGCTTTTTTATTGTAAAACAGGAGGGGTTTTAATACTGGAGGAACAAAGAGCATCTGC TACTTAATTTTTTGTGTGTGGGTGCACAATAGATGTTTAATGAGATCCTGTCATCTGTCTGCTTTTTTATTGTAAAACAGGAGGGGTTTTAATACTGGAGGAACAACTGATGTACCTCTGAAAAGAGA AGAGATTAGTTATTAATTGAATTGAGGGTTGTCTTGTCTTAGTAGCTTTTATTCTCTAGGTACTATTTGATTATGATTGTGAAAATAGAATTTATCCCTGATGTACCTCTGAAAAGAGA AGAGATTAGTTATTAATTGAATTGAGGGTTGTCTTGTCTTAGTAGCTTTTATTCTCTAGGTACTATTTGATTATGATTGTGAAAATAGAATTTATCCCTCATTAAATGTAAAATCAACAGGAGAATAGCAAAAACTTATGAGATAGATGAACGTTGTGTGAGTGGCATGGTTTAATTTGTTTGGAAGAAGCACTTGCCCCAGAAGATACACAATCTCATTAAATGTAAAATCAACAGGAGAATAGCAAAAACTTATGAGATAGATGAACGTTGTGTGAGTGGCATGGTTTAATTTGTTTGGAAGAAGCACTTGCCCCAGAAGATACACAATGAAATTCATGTTATTGAGTAGAGTAGTAATACAGTGTGTTCCCTTGTGAAGTTCATAACCAAGAATTTTAGTAGTGGATAGGTAGGCTGAATAACTGACTTCCTATC ATTTTCAGGTTGAAATTCATGTTATTGAGTAGAGTAGTAATACAGTGTGTTCCCTTGTGAAGTTCATAACCAAGAATTTTAGTAGTGGATAGGTAGGCTGAATAACTGACTTCCTATC ATTTTCAGGTTCTGCGTTTGATTTTTTTTACATATTAATTTCTTTGATCCACATTAAGCTCAGTTATGTATTTCCATTTTATAAATGAAAAAAAATAGGCACTTGCAAATGTCAGATCACTTGCCTGTGGTCTGCGTTTGATTTTTTTTACATATTAATTTCTTTGATCCACATTAAGCTCAGTTATGTATTTCCATTTTATAAATGAAAAAAAATAGGCACTTGCAAATGTCAGATCACTTGCCTGTGGTCATTCGGGTAGAGATTTGTGGAGCTAAGTTGGTCTTAATCAAATGTCAAGCTTTTTTTTTTCTTATAAAATATAGGTTTTAATATGAGTTTTAAAATAAAATTAATTAGAAAAAGGCAACATTCGGGTAGAGATTTGTGGAGCTAAGTTGGTCTTAATCAAATGTCAAGCTTTTTTTTTTCTTATAAAATATAGGTTTTAATATGAGTTTTAAAATAAAATTAATTAGAAAAAGGCAAATTACTCAATATATATAAGGTATTGCATTTGTAATAGGTAGGTATTTCATTTTCTAGTTATGGTGGGATATTATTCAGACTATAATTCCCAATGAAAAAACTTTAAAAAATGCTAGTGAATTACTCAATATATATAAGGTATTGCATTTGTAATAGGTAGGTATTTCATTTTCTAGTTATGGTGGGATATTATTCAGACTATAATTCCCAATGAAAAAACTTTAAAAAATGCTAGTGATTGCACACTTAAAACACCTTTTAAAAAGCATTGAGAGCTTATAAAATTTTAATGAGTGATAAAACCAAATTTGAAGAGAAAAGAAGAACCCAGAGAGGTAAGGATATAACCTTACCTTGCACACTTAAAACACCTTTTAAAAAGCATTGAGAGCTTATAAAATTTTAATGAGTGATAAAACCAAATTTGAAGAGAAAAGAAGAACCCAGAGAGGTAAGGATATAACCTTACCAGTTGCAATTTGCCGATCTCTACAAATATTAATATTTATTTTGACAGTTTCAGGGTGAATGAGAAAGAAACCAAAACCCAAGACTAGCATATGTTGTCTTCTTAAGGAGCCCTCCCCTAGTTGCAATTTGCCGATCTCTACAAATATTAATATTTATTTTGACAGTTTCAGGGTGAATGAGAAAGAAACCAAAACCCAAGACTAGCATATGTTGTCTTCTTAAGGAGCCCTCCCCTAAAAGATTGAGATGACCAAATCTTATACTCTCAGCATAAGGTGAACCAGACAGACCTAAAGCAGTGGTAGCTTGGATCCACTACTTGGGTTTGTGTGTGGCGTGACTCAGGTAATCTAAAAGATTGAGATGACCAAATCTTATACTCTCAGCATAAGGTGAACCAGACAGACCTAAAGCAGTGGTAGCTTGGATCCACTACTTGGGTTTGTGTGTGGCGTGACTCAGGTAATCTCAAGAATTGAACATTTTTTTAAGGTGGTCCTACTCATACACTGCCCAGGTATTAGGGAGAAGCAAATCTGAATGCTTTATAAAAATACCCTAAAGCTAAATCTTACAATATTCTCAAGCAAGAATTGAACATTTTTTTAAGGTGGTCCTACTCATACACTGCCCAGGTATTAGGGAGAAGCAAATCTGAATGCTTTATAAAAATACCCTAAAGCTAAATCTTACAATATTCTCAAGAACACAGTGAA ACAAGGCAAAATAAGTTAAAATCAACAAAAACAACATGAAACATAATTAGACACACAAAGACTTCAAACATTGGAAAATACCAGAGAAAGATAATAAATATAACACAGTGAA ACAAGGCAAAATAAGTTAAAATCAACAAAAACAACATGAAACATAATTAGACACACAAAGACTTCAAACATTGGAAAATACCAGAGAAAGATAATAAATATTTTACTCTTTAAAAATTTAGTTAAAAGCTTAAACTAATTGTAGAGAAAA AACTATGTTAGTATTATATTGTAGATGAAATAAGCAAAACATTTAAAATACAAATGTGATTACTTAAATTTTACTCTTTAAAAATTTAGTTAAAAGCTTAAACTAATTGTAGAGAAAA AACTATGTTAGTATTATATTGTAGATGAAATAAGCAAAACATTTAAAATACAAATGTGATTACTTAAATTAAATATAATAGATAATTTACCACCAGATTAGATACCATTGAAGGAATAATTAATATACTGAAATACAGGTCAGTAGAATTTTTTTCAATTCAGCATGGAGATGTAAAAAATGAAAATAAATATAATAGATAATTTACCACCAGATTAGATACCATTGAAGGAATAATTAATATACTGAAATACAGGTCAGTAGAATTTTTTTCAATTCAGCATGGAGATGTAAAAAATGAAAATTAATGCAAAAAATAAGGGCACAAAAAGAAATGAGTAATTTTGATCAGAAATGTATTAAAATTAATAAACTGGAAATTTGACATTTAAAAAAAGCATTGTCATCCAAGTAGATGTGTTAATGCAAAAAATAAGGGCACAAAAAGAAATGAGTAATTTTGATCAGAAATGTATTAAAATTAATAAACTGGAAATTTGACATTTAAAAAAAGCATTGTCATCCAAGTAGATGTGTCTATTAAATAGTTGTTCTCATATCCAGTAATGTAATTATTATTCCCTCTCATGCAGTTCAGATTCTGGGGTAATCTTTAGACATCAGTTTTGTCTTTTATATTATTTATTCTGTTTACTACTCTATTAAATAGTTGTTCTCATATCCAGTAATGTAATTATTATTCCCTCTCATGCAGTTCAGATTCTGGGGTAATCTTTAGACATCAGTTTTGTCTTTTATATTATTTATTCTGTTTACTACATTTTATTTTGCTAATGATATTTTTAATTTCTGACATTCTGGAGTATTGCTTGTAAAAGGTATTTTTAAAAATACTTTATGGTTATTTTTGTGATTCCTATTCCTCTATGGACACCAAGGCTATTTTATTTTGCTAATGATATTTTTAATTTCTGACATTCTGGAGTATTGCTTGTAAAAGGTATTTTTAAAAATACTTTATGGTTATTTTTGTGATTCCTATTCCTCTATGGACACCAAGGCTATTGACATTTTCTTTGGTTTCTTCTGTTACTTCTATTTTCTTAGTGTTTATATCATTTCATAGATAGGATATTCTTTATTTTTTATTTTTATTTAAATATTTGGTGATTCTTGGTTTTCTCAGCCATTGACATTTTCTTTGGTTTCTTCTGTTACTTCTATTTTCTTAGTGTTTATATCATTTCATAGATAGGATATTCTTTATTTTTTATTTTTATTTAAATATTTGGTGATTCTTGGTTTTCTCAGCCATCTATTGTCAAGTGTTCTTATTAAGCATTATTATTAAATAAAGATTATTTCCTCTAATCACATGAGAATCTTTATTTCCCCCAAGTAATTGAAAATTGCAATGCCATGCTGCCATGTGGATCTATTGTCAAGTGTTCTTATTAAGCATTATTATTAAATAAAGATTATTTCCTCTAATCACATGAGAATCTTTATTTCCCCCAAGTAATTGAAAATTGCAATGCCATGCTGCCATGTGGTACAGCATGGGTTTGGGCTTGCTTTCTTCTTTTTTTTTTAACTTTTATTTTAGGTTTGGGAGTACCTGTGAAAGTTTGTTATATAGGTAAACTCGTGTCACCAGGGTTTGTTGTACAGATCATACAGCATGGGTTTGGGCTTGCTTTCTTCTTTTTTTTTTAACTTTTATTTTAGGTTTGGGAGTACCTGTGAAAGTTTGTTATATAGGTAAACTCGTGTCACCAGGGTTTGTTGTACAGATCATTTTGTCACCTAGGTACCAAGTACTCAACAATTATTTTTCCTGCTCCTCTGTCTCCTGTCACCCTCCACTCTCAAGTAGACTCCGGTGTCTGCTGTTCCATTCTTTGTGTCCATGTGTTCTCTTTTGTCACCTAGGTACCAAGTACTCAACAATTATTTTTCCTGCTCCTCTGTCTCCTGTCACCCTCCACTCTCAAGTAGACTCCGGTGTCTGCTGTTCCATTCTTTGTGTCCATGTGTTCTCATAATTTAGTTCCCCACTTGTAAGTGAGAACATGCAGTATTTTCTAGTATTTGGTTTTTTGTTCCTGTGTTAATTTGCCCAGTATAATAGCCTCCAGCTCCATCCATGTTACTGCAAAGAAATAATTTAGTTCCCCACTTGTAAGTGAGAACATGCAGTATTTTCTAGTATTTGGTTTTTTGTTCCTGTGTTAATTTGCCCAGTATAATAGCCTCCAGCTCCATCCATGTTACTGCAAAGAACATGATCTCATTCTTTTTTATAGCTCCATGGTGTCTATATACCACATTTTCTTTATCTAAACTCTTATTGATGAGCATTGAGGTGGATTCTATGTCTTTGCTATTGTGCATATTGCTGCAAGCATGATCTCATTCTTTTTTATAGCTCCATGGTGTCTATATACCACATTTTCTTTATCTAAACTCTTATTGATGAGCATTGAGGTGGATTCTATGTCTTTGCTATTGTGCATATTGCTGCAAGAACATTTGTGTGCATGTGTCTTTATGGTAGAATGATATATTTTCTTCTGGGTATATATGCAGTAATGCGATTGCTGGTTGGAATGGTAGTTCTGCTTTTATCTCTTTGAGGAATTGCCATGAACATTTGTGTGCATGTGTCTTTATGGTAGAATGATATATTTTCTTCTGGGTATATATGCAGTAATGCGATTGCTGGTTGGAATGGTAGTTCTGCTTTTATCTCTTTGAGGAATTGCCATGCTGCTTTCCACAATAGTTGAACTAACTTACACTCCCACTAACAGTGTGTAAGTGTTTCCTTTTCTCCACAACCTGCCAGCATCTGTTATTTTTTGACATTTTAATAGTAGCCATTTTAACTCTGCTTTCCACAATAGTTGAACTAACTTACACTCCCACTAACAGTGTGTAAGTGTTTCCTTTTCTCCACAACCTGCCAGCATCTGTTATTTTTTGACATTTTAATAGTAGCCATTTTAACTGGTATGAAATTATATTTCATTGTGGTTTTAATTTGCATTTCTCTAATGATCAGTGATATTGAGTTTGTTTTTTTTCACATGCTTGTTGGCTGCATGTATGTCTTCTTTTAAAAAGTGTCTGTTGGTATGAAATTATATTTCATTGTGGTTTTAATTTGCATTTCTCTAATGATCAGTGATATTGAGTTTGTTTTTTTTCACATGCTTGTTGGCTGCATGTATGTCTTCTTTTAAAAAGTGTCTGTTCATGTACTTTGCCCACATTTTAATGGGGTTGTTTTTCTCTTGTAAATTTGTTTAAATTCCTTATAGGTGCTGGATTTTAGACATTTGTCAGACGCATAGTTTGCAAATAGTTTCTCCCATTCCATGTACTTTGCCCACATTTTAATGGGGTTGTTTTTCTCTTGTAAATTTGTTTAAATTCCTTATAGGTGCTGGATTTTAGACATTTGTCAGACGCATAGTTTGCAAATAGTTTCTCCCATTCTGTAGGTTGTCTGTTTATTTTGTTAATAGTTTCTTTTGCTATGCAGAAGCTCTTAATAAGTTTAATGAGATCCTGATATGTTAGGCTTTGTGTCCCCACCCAAATCTCATCTTGAATTATATGTAGGTTGTCTGTTTATTTTGTTAATAGTTTCTTTTGCTATGCAGAAGCTCTTAATAAGTTTAATGAGATCCTGATATGTTAGGCTTTGTGTCCCCACCCAAATCTCATCTTGAATTATATCTCCATAATCACCACATGGAGAGACCAGGTGGAGGTAATTGAATCTGGGGGTGGTTTCACCCATGCTGTTCTTGTGATAGTGAATGAGTTCTCACGAGATCTAATGGTTTTATGAGGTCTCCATAATCACCACATGGAGAGACCAGGTGGAGGTAATTGAATCTGGGGGTGGTTTCACCCATGCTGTTCTTGTGATAGTGAATGAGTTCTCACGAGATCTAATGGTTTTATGAGGGGCTCTTCCCAGCTTTGCCTGGTACTTCTCCTTCCTGCCGCTTTGTGAAAAAGGTGCATTGCGTCCCTTTCACCTTCTTCTATAATTGTAAGTTTCCTGAGGCCTTCCCAGCCATGCTGAAGGCTCTTCCCAGCTTTGCCTGGTACTTCTCCTTCCTGCCGCTTTGTGAAAAAGGTGCATTGCGTCCCTTTCACCTTCTTCTATAATTGTAAGTTTCCTGAGGCCTTCCCAGCCATGCTGAACTTCAAGTCAATTAAACCTTTTTCTTTATAAATTACTCAGTCTCTGGTGGTTCTTTATAGCAGTGTGAAAATGGACTAATGAAGTTCCCATTTATGAATTTTTGCTTTTGTTGCAATTGCTTCTTCAAGTCAATTAAACCTTTTTCTTTATAAATTACTCAGTCTCTGGTGGTTCTTTATAGCAGTGTGAAAATGGACTAATGAAGTTCCCATTTATGAATTTTTGCTTTTGTTGCAATTGCTTTTGACATCTTAGTCATGAAATCCTTGCCTGTTCTAAGTACAGGACGGTATTGCCTAGGTTGTCTTCCAGGGTTTTTCTAATTTTGTGTTTTGCATTTAAGTGTTTAATCCATCTTGAGTTGATTGACATCTTAGTCATGAAATCCTTGCCTGTTCTAAGTACAGGACGGTATTGCCTAGGTTGTCTTCCAGGGTTTTTCTAATTTTGTGTTTTGCATTTAAGTGTTTAATCCATCTTGAGTTGATTTTTGTATATTGTGTAAGGAAGGGGTCCAGTTTCAATCTTTTGCATATGGCTAGTTAGTTATCCCAGTACCATTTATTGAAAAGACAGTCTTTTCCCCATCGCTCGTTTTTGTCAGTTTTTTTTTGTATATTGTGTAAGGAAGGGGTCCAGTTTCAATCTTTTGCATATGGCTAGTTAGTTATCCCAGTACCATTTATTGAAAAGACAGTCTTTTCCCCATCGCTCGTTTTTGTCAGTTTTATTGATGATCAGATAATCATAGCTGTGTGGCTTTATTTCTGGGTTCTTTATTCTGTTCTATTGGTTTATGTCCCTGTTTTTGTGCCAGTACCATGCTGTTTTGGTTAACATAGCCCTGTAGTATTGATGATCAGATAATCATAGCTGTGTGGCTTTATTTCTGGGTTCTTTATTCTGTTCTATTGGTTTATGTCCCTGTTTTTGTGCCAGTACCATGCTGTTTTGGTTAACATAGCCCTGTAGTATAGTTTGAGGTCAGATAGCCTGATGCTTCCAGCTTTGTTCTTTTTCTTAAGATTGCCTTGGCTATTTGGCCTCTTTTTTGGTTCCACATGAATTTTAAAACAGTTGTTTCTAGTTTTTGAAATAGTTTGAGGTCAGATAGCCTGATGCTTCCAGCTTTGTTCTTTTTCTTAAGATTGCCTTGGCTATTTGGCCTCTTTTTTGGTTCCACATGAATTTTAAAACAGTTGTTTCTAGTTTTTGAAGAATGTCATTGGTAGTTTGATAGAAATAGCATTTAATCTGTAAATTGATTTGTGCAGTATGGCCTTTTAATGATATTGATTCTTCCTATCCATGAGCATGATATGTTTTCCATTTTGTTTGGAATGTCATTGGTAGTTTGATAGAAATAGCATTTAATCTGTAAATTGATTTGTGCAGTATGGCCTTTTAATGATATTGATTCTTCCTATCCATGAGCATGATATGTTTTCCATTTTGTTTGTATCCTCTCTGATTTCTTTGTGCAGTGTTTTGTAATTCTCAT TGTAGAGATTTTTCACCTCCCTGGTTAGTTGTATTTTACCCTAGATATTT TATTCTTTTTGTGAAAATTGTGAATGGGATTATCCTCTCTGATTTCTTTGTGCAGTGTTTTGTAATTCTCAT TGTAGAGATTTTTCACCTCCCTGGTTAGTTGTATTTTACCCTAGATATTT TATTCTTTTTGTGAAAATTGTGAATGGGATTGCCTTCCTGATTTGACTGC CAGCTTGGTTACTGTTGGTTTATAGAAATGCTAGTGATTTTTGTACATTG ATTTTCTTTCTAAAACTTTGCTGAAGTTTTTTTTATTAGCAGAAGGAGCTTGCCTTCCTGATTTGACTGC CAGCTTGGTTACTGTTGGTTTATAGAAATGCTAGTGATTTTTGTACATTG ATTTTCTTTCTAAAACTTTGCTGAAGTTTTTTTTATTAGCAGAAGGAGCTTTGGGGCTGAGACTATGGGGTTTTCTAGATATAGAATCATGTCAGCTTCAAATAGGGATAATTTTACTTCCTCTCTTCCTATTTGGATGCCCTTTATTTCTTTCTCTTGCCTGATTACTCTGTTGGGGCTGAGACTATGGGGTTTTCTAGATATAGAATCATGTCAGCTTCAAATAGGGATAATTTTACTTCCTCTCTTCCTATTTGGATGCCCTTTATTTCTTTCTCTTGCCTGATTACTCTGGCTGGGATTTCCTATGTTGAATAGGAGT CATGAGAGAGGGCATCAAATCTACACATATCAAATACTAACCTTGAATGTCTAGATATTT TATTCTTTTTGTGAAAATTGTGAATGGGATGCTGGGATTTCCTATGTTGAATAGGAGT CATGAGAGAGGGCATCAAATCTACACATATCAAATACTAACCTTGAATGTCTAGATATTT TATTCTTTTTGTGAAAATTGTGAATGGGAT

5000 bases per page

How much data make up the How much data make up the human genome?human genome?

3 pallets with 40 boxes per pallet x 5000 3 pallets with 40 boxes per pallet x 5000 pages per box x 5000 bases per page = pages per box x 5000 bases per page = 3,000,000,000 bases!3,000,000,000 bases!

To get accurate To get accurate sequence requires sequence requires 6-fold coverage. 6-fold coverage.

Now: Shred 18 pallets Now: Shred 18 pallets and reassemble.and reassemble.

Human genome contentHuman genome content

1-2 % codes for protein products1-2 % codes for protein products 24% important for translation24% important for translation 75% “junk”75% “junk” Repetitive elementsRepetitive elements

Satellites (regular, mini-, micro-)Satellites (regular, mini-, micro-) TransposonsTransposons RetrotransposonsRetrotransposons ParasitesParasites

BOOK THAT WROTE ITSELF

Comparative GenomicsComparative Genomics

YeastYeast

• 70 human genes are known to repair mutations in yeast

•Nearly all we know about cell cycle and cancer comes from studies of yeast

•Advantages:

•fewer genes (6000)

•few introns

• 31% of yeast genes give same products as human homologues

DrosophilaDrosophila

• nearly all we know of how mutations affect gene function come from Drosophila studies

•We share 50% of their genes

•61% of genes mutated in 289 human diseases are found in fruit flies

•68% of genes associated with cancers are found in fruit flies

•Knockout mutants

•Homeobox genes

C. elegansC. elegans

• 959 cells in the nervous system

• 131 of those programmed for apoptosis

• apoptosis involved in several human genetic neurological disorders

•Alzheimers

•Huntingtons

•Parkinsons

MouseMouse

• known as “mini” humans

•Very similar physiological systems

•Share 90% of their genes

The Human Genome The Human Genome Project Project

at UC Santa Cruzat UC Santa CruzPhoenix EagleshadowPhoenix Eagleshadow

November 9, 2004November 9, 2004

The Challenges were The Challenges were OverwhelmingOverwhelming

First there was the First there was the AssemblyAssembly

The DNA sequence is so long that The DNA sequence is so long that no technology can read it all at no technology can read it all at once, so it was broken into once, so it was broken into pieces.pieces.There were millions of There were millions of clonesclones (small sequence fragments). (small sequence fragments).

The assembly process included The assembly process included finding where the pieces finding where the pieces overlapped in order to put the overlapped in order to put the draft together.draft together.

3,200,000 piece puzzle anyone?

Assembly generated by UCSC

Freeze of sequence data generated by NCBI

Clone layouts generated By Washington University

ACCTTGGCCTGAATCTAGGCTTTGCATCCCTAGTCCTGATCG

sequence Clonemaps

Working draft assembly

The “Working Draft” of the human genome

UCSC put the human UCSC put the human genome sequence on genome sequence on the web July 7, 2000the web July 7, 2000

UCSC put the UCSC put the human genome human genome sequence on CD sequence on CD in October 2000, in October 2000,

with varying with varying resultsresults

Cyber geeks Searched for hiddenMessages, and “GATTACA”

The Completion of the Human The Completion of the Human Genome SequenceGenome Sequence

June 2000 White House June 2000 White House announcement that the majority announcement that the majority of the human genome (80%) of the human genome (80%) had been sequenced (working had been sequenced (working draft).draft).

Working draft made available Working draft made available on the web July 2000 at on the web July 2000 at genome.ucsc.edugenome.ucsc.edu..

Publication of 90 percent of the Publication of 90 percent of the sequence in the February 2001 sequence in the February 2001 issue of the journal issue of the journal NatureNature. .

Completion of 99.99% of the Completion of 99.99% of the genome as finished sequence on genome as finished sequence on July 2003.July 2003.

The Project is not Done…The Project is not Done…

Next there is the Next there is the AnnotationAnnotation:: The The sequencesequence is like a topographical map, is like a topographical map,

the the annotationannotation would include cities, towns, would include cities, towns, schools, libraries and coffee shops! schools, libraries and coffee shops!

So, where are the So, where are the genesgenes? ?

How do genes work?And, how do scientists use this information for scientific understanding and to benefit us?

What do genes do anyway? What do genes do anyway? We only have ~27,000 genes, so that means that We only have ~27,000 genes, so that means that

each gene has to do a lot. each gene has to do a lot. Genes make proteins that make up nearly all we are Genes make proteins that make up nearly all we are

(muscles, hair, eyes). (muscles, hair, eyes). Almost everything that happens in our bodies Almost everything that happens in our bodies

happens because of proteins (walking, digestion, happens because of proteins (walking, digestion, fighting disease).fighting disease).

Eye Color and Hair Colorare determined by genes

OROR

Of Mice and Men:Of Mice and Men:It’s all in the genesIt’s all in the genes

Humans and Mice have about the same Humans and Mice have about the same number of genes. But we are so different number of genes. But we are so different from each other, how is this possible?from each other, how is this possible?

One human gene can make many different One human gene can make many different

proteins while a mouse gene can only proteins while a mouse gene can only make a few!make a few!

Did you say cheese?

Mmm, Cheese!

Genes are importantGenes are important By selecting different pieces of a gene, your By selecting different pieces of a gene, your

body can make many kinds of proteins. (This body can make many kinds of proteins. (This process is called process is called alternative splicingalternative splicing.).)

If a gene is “expressed” that means it is turned If a gene is “expressed” that means it is turned on and it will make proteins. on and it will make proteins.

What we’ve learned from our What we’ve learned from our genome so far…genome so far…

There are a relatively small number of human There are a relatively small number of human genes, less than 30,000, but they have a complex genes, less than 30,000, but they have a complex architecture that we are only beginning to architecture that we are only beginning to understand and appreciate.understand and appreciate.

-We know where 85% of genes are in the -We know where 85% of genes are in the sequence.sequence.

-We don’t know where the other 15% are -We don’t know where the other 15% are because we haven’t seen them “on” (they may only because we haven’t seen them “on” (they may only be expressed during fetal development).be expressed during fetal development).

-We only know what about 20% of our genes -We only know what about 20% of our genes do so far. do so far.

So it is relatively easy to locate genes in the So it is relatively easy to locate genes in the genome, but it is hard to figure out what they genome, but it is hard to figure out what they do. do.

How do scientists find genes?How do scientists find genes?

The genome is so large that useful The genome is so large that useful information is hard to find.information is hard to find.

Researchers at UCSC decided to make a Researchers at UCSC decided to make a computational microscopecomputational microscope to help to help scientists search the genome.scientists search the genome.

Just as you would use “google” to find Just as you would use “google” to find something on the internet, researchers something on the internet, researchers can use the “can use the “UCSC Genome BrowserUCSC Genome Browser” ” to find information in the human genome.to find information in the human genome.

Explore it at http://genome.ucsc.edu

The UCSC Genome BrowserThe UCSC Genome Browser

The browser takes you from The browser takes you from early maps of the genome . . . early maps of the genome . . .

. . . to a multi-resolution . . . to a multi-resolution view . . .view . . .

. . . at the gene cluster level . . . . . at the gene cluster level . . ..

. . . the single gene level . . .. . . the single gene level . . .

. . . the single exon level . . .. . . the single exon level . . .

. . . and at the single base . . . and at the single base levellevel

caggcggactcagtggatctggccagctgtgacttgacaag caggcggactcagtggatctagccagctgtgacttgacaag

The Continuing ProjectThe Continuing Project Finding the complete set of genes and annotating Finding the complete set of genes and annotating

the entire sequence. the entire sequence. AnnotationAnnotation is like detailing; is like detailing; scientists annotate sequence by listing what has scientists annotate sequence by listing what has been learn experimentally and computationally been learn experimentally and computationally about its function. about its function.

ProteomicsProteomics is studying the structure and function is studying the structure and function of groups of proteins. Proteins are really important, of groups of proteins. Proteins are really important, but we don’t really understand how they work.but we don’t really understand how they work.

Comparative Genomics Comparative Genomics is the process of is the process of comparing different genomes in order to better comparing different genomes in order to better understand what they do and how they work. Like understand what they do and how they work. Like comparing humans, chimpanzees, and mice that comparing humans, chimpanzees, and mice that are all mammals but all very different.are all mammals but all very different.