The Good, the bad and the ugly of Genetic Engineering

• Genetic engineering

–Scientists change the DNA code of an organism in order to:

•Make transgenic organisms

•Clone an organism

Transgenic Organisms

• Organisms which have a gene from another organism in their DNA

Practical applications• Plants with “insecticide” genes

Practical applications• Cows with

extra copies of growth hormones

Practical applications• Bacteria that

make human insulin protein for diabetics

Practical applications?• Cool Glow-in-the-dark Mice!!

How?

• Jelly Fish have a protein called GFP (Green fluorescent protein)

• Gives them that “glow”

How?

• So… They must have a gene (DNA) that has the info to make GFP

GFP Protein = glowing jelly fish

mRNA transcribed from GFP Gene

GFP Gene (DNA)

Transcription

Translation

How?

• What makes us different is What genes we have not how we make the proteins!!!

• So all you need to do is give an organism a new gene and it will be able to make the protein!

How?Jelly fish nucleus with GFP

gene Remove GFP gene

Mouse nucleus without GFP gene

Add GFP gene

Mouse nucleus with GFP gene

GFP protein made

Glowing Mice

Insulin made by bacteria

• Diabetes: dysfunctional Insulin gene; no or low amounts of insulin protein made–Means we can’t regulate blood sugar

levels

– we can force bacteria to make insulin for us

Insulin made by bacteria

• Same process: Tell me how!

1.Find healthy insulin gene in human

2.Cut it out and insert it in bacteria

3.Bacteria then MAKE human insulin even though they have no use for it!

4.We extract the insulin from bacteria and use it in injections

Cloning

• Creating an organism that is genetically identical to its only parent.

Cloning

• Mammals usually mix info from two parents

• In cloning all the chromosomes of the baby come from 1 parent.

Sheep 1 Take 1 body cell (udder)

Extract Nucleus

Sheep 2 Take 1 egg cell

Remove nucleus

Inject nucleus into Egg

Zap to stimulate

cell division

Implant egg into

surrogate sheep

(sheep 3)

Wait for Dolly to be born

Which sheep is Dolly identical to??Why?

Which sheep have to be female?

Snuppy: cloned Afghan Hound

Genetic Testing

Checking a fetus to determine if the baby has any disease.

- Cystic fibrosis

- Tay Sach’s Disease

- Down Syndrome

Genetic Testing

• Done BEFORE birth

• Can detect two kinds of mutations–Chromosomal: easily visible, major

mutations

–Gene mutations: checking for mutated gene; must know what you are looking for!

Amniocentesis

Amniocentesis

Extracting amniotic fluid from womb

Contains cells from fetus

DNA or protein can be isolated and examined

Can check for:

1.Mutations in certain genes (must be looking for something specific)

2.Chromosome abnormalities

3.Abnormal protein levels

DNA finger printing

• Used to compare two people’s DNA

• Used in paternity cases

• Used for crime scene analysis

DNA finger printing

DNA finger printing

• Based on the idea that EVERYONE’s DNA is unique, like a fingerprint

• BUT related individuals will have more similarities

How to do a DNA fingerprint

• Get a sample of DNA and digest it with restriction enzymes– restriction enzymes cut DNA at

specific sequences.

–For example: EcoRI cuts DNA every time it sees the sequence GAATTC

How to do a DNA fingerprint

• If everyone’s DNA is unique, the enzyme will cut each persons DNA differently

• Example: • TCATGAATTCATTGCCGAATTCCGTGAATCCAGAATTCGGACTA

• TCATGAAGTCATTGCCGAATTCCGTGAATCCAGACTTCGGACTA

How to do a DNA fingerprint

• Run cut up DNA on through electrophoresis

• Click here for animation

How to do a DNA fingerprint

• Small pieces travel fast and move further down the gel slab.

• Large pieces move slower and stay closer to the injection point.