THE GENETIC, MOLECULAR, AND EVOLUTIONARY …THE GENETIC, MOLECULAR, AND EVOLUTIONARY DISSECTION OF THE TEOSINTE BRANCHED1 GENE By ... Mary Ann and Terry, whose love and support from

THE GENETIC, MOLECULAR, AND EVOLUTIONARY

DISSECTION OF THE TEOSINTE BRANCHED1 GENE

By

Anthony J. Studer

A dissertation submitted in partial fulfillment

of the requirements for the degree of

Doctor of Philosophy

(Genetics)

at the

UNIVERSITY OF WISCONSIN-MADISON

2011

ii

Table of Contents

Acknowledgements Page iii

Abstract Page iv

List of Tables and Figures Page v

Preface Page 1

Chapter 1 Page 7

A transposon insertion in the maize gene, tb1 functions as an

enhancer and was a causative variant for change in plant architecture

during maize domestication.

Chapter 2 Page 45

Do large effect QTLs fractionate?

A case study at the maize domestication QTL teosinte branched1.

Chapter 3 Page 81

Evidence for a natural allelic series at the maize domestication

gene teosinte branched1.

iii

Acknowledgements

I would first like to express my most sincere gratitude to John Doebley for his mentorship. He

has provided me with guidance, support, knowledge, and opportunity without which I would not

be the scientist that I am today. His poise and thoughtfulness will serve as a standard to which I

hope to achieve. He has earned my deepest respect as a scientist and individual. I would also like

to thank my family, above all my supportive wife, Erin. She is the one thing in my life that is

always right, even when everything else seems to be going wrong. I also owe great thanks to my

parents, Mary Ann and Terry, whose love and support from a young age has helped shape who I

am today. My appreciation extends to my undergraduate mentor, Dr. Bernard Mikula, who

helped nurture my young scientific enquires at the very beginning of my career, and still weekly

adds scientific perspective to my sometimes narrow thinking. I also would like to thank the

members of the Doebley lab, especially Bao, Huai, Jesse and Tina. I feel blessed to have found

such close friends. It was a true joy to work and learn alongside them. Last, but certainly not

least, I thank all of my friends, especially Pete. He is like a brother to me, and I am glad that I

had him with me on this journey.

Special thanks also go to my committee, Rick Amasino, Shawn Kaeppler, Patrick

Masson, and Rick Vierstra for their thoughtful advice. I would also like to thank Jeff Ross-Ibarra

and Qiong Zhao for their population genetics contributions to Chapter 1.

iv

Abstract

Maize was domesticated approximately 9,000 years ago from its wild progenitor, teosinte, and

serves as a model for evolution. This research focused on the domestication gene teosinte

branched1 (tb1), which controls morphological differences between maize and teosinte. The

following chapters document the genetic changes which occurred due to selection applied by

ancient farmers during domestication. The results presented here have not only advanced the

study of maize domestication, but also have a broader scientific impact and provide examples of

genetic changes that drive evolution. The causative differences in the upstream regulatory region

of tb1 between maize and teosinte suggest that transposon insertions provide a source of

variation on the molecular level. Insertions such as these produce phenotypic variation that can

be selected on during evolution. Our results from studying the tb1 regulatory differences between

maize and teosinte suggest the genetic architecture underlying natural phenotypic variation can

be more complex than coding region mutations. tb1 provides an example of complex gene

regulation, including long distance cis-regulatory regions and multiple linked QTL with epistatic

interactions. Finally, the study of the natural allelic series at tb1 suggests tb1 was not only

involved in maize domestication, but also the morphological diversification of teosinte taxa.

Taken together these results help us understand sources of genetic and phenotypic variation, and

the genetic architecture that drives evolution.

v

List of Tables and Figure

Chapter 1

Figure 1: Photographs of maize and teosinte plants. Page 15

Figure 2: The phenotypic additive effects for seven Page 19

intervals across the tb1 genomic region.

Figure 3: Sequence diversity in maize and teosinte Page 21

across the control region.

Figure 4: Control region constructs and corresponding Page 26

normalized luciferase expression levels.

Figure S1: Map of introgression lines. Page 33

Figure S2: Phenotypic additive effects for the smallest Page 35

introgression segments.

Table S1: Primer sequences for genotyping. Page 37

Table S2: Germplasm assayed for transposon insertions. Page 38

Table S3: Input values for HKA tests. Page 44

Chapter 2

Figure 1: Map of introgression lines. Page 50

Table 1: Experiment I results. Page 57

Figure 2: NIRIL frequency distributions for least-squares Page 59

trait means.

Figure 3: Map of QTL detected in Experiment II. Page 62

vi

Table 2: Experiment II results. Page 64

Table 3: Experiment II reanalysis. Page 67

Figure 4: Epistatic interactions between tb1 and Page 68

additional linked QTL.

Figure 5: QTL model. Page 74

Table S1: RFLP markers used during backcrossing Page 80

of T1L in Experiment II.

Chapter 3

Figure 1: Map of introgression lines. Page 86

Figure 2: Phenotypic means. Page 90

Figure 3: Additive Effects. Page 92

Figure 4: Principal components plot. Page 99

Figure 5: Phylogentic trees. Page 102

Table S1: Introgressed teosinte germplasm. Page 111

Table S2: Primer sequences for genotyping and sequencing. Page 112

1

Preface

The underlying genetic architecture of variation driving evolution has remained an unanswered

question in biology. Although many evolutionary biologists study variation in natural

populations, their work at the molecular level is limited due to the lack of genetic tools for non-

model systems. The domestication of crop plants has recently been recognized as a valuable

model for natural evolution because it represents an animal-plant interaction similar to the

selective pressures seen in the wild (Purugganan and Fuller 2009). In our research, we use the

domestication of maize (Zea mays ssp. mays) from its wild progenitor, teosinte (Z. mays ssp.

parviglumis), as a model for evolution. The well-developed techniques available in maize, and its

cross compatibility with teosinte, provide an excellent opportunity to study the genetics of

selection which leads to morphological changes (Doebley 2004).

Maize was domesticated approximately 9,000 years ago in the Balsas River Valley in

Mexico (Doebley 2004). During this relatively short time, maize diverged significantly with

respect to both plant and ear architecture. The morphological changes are so striking that it was

long debated whether teosinte was in fact the ancestor of maize (Bennetzen et al. 2001). For

example, teosinte has a highly branched architecture compared to maize, which shows much

greater apical dominance. A teosinte plant has multiple long branches off its main stalk. Each

branch is tipped by a tassel and produces many small ears at its nodes. In contrast, a modern

maize plant has only one or two short branches, each of which is tipped by a large grain-bearing

ear. The difference in size between a teosinte and maize ear is substantial. The small ears of

teosinte have only 10 or 12 grain, while a single ear of maize can have 300 or more kernels.

These differences in morphology are characteristic of domestication, which converts a plant

2

adapted to grow in the wild, into a plant adapted to thrive in a cultivated environment (Doebley

et al. 2006). Furthermore, the phenotypic changes driven by ancient farmers were modified

without knowledge of the genetic factors controlling these traits.

teosinte branched1 (tb1) is one of the genes controlling the morphological differences

between maize and teosinte. tb1 was first identified as a large effect quantitative trait locus

(QTL) on the long arm of chromosome 1, and affects both plant and ear morphology (Doebley

and Stec 1991, 1993). The QTL at tb1 was later cloned and the maize allele was shown to be

expressed at twice the level of the teosinte allele in developing branches and in immature ears

(Doebley et al. 1997). Clark et al. fine-mapped the QTL causing the expression level difference

to a 12 kilobase (kb) control region located between 58.7 kb and 69.5 kb upstream of the tb1

open reading frame (ORF) (2006). Allele specific assays were used to show that this 12 kb

segment functions as a long distance cis-regulatory region. These previous studies provide

evidence that the morphological divergence of maize from teosinte is due to a change in the

regulation of tb1 rather than a change in the coding region. However, the causative difference in

the control region has yet to be identified.

The expression pattern and function of tb1 have also been elucidated. tb1 encodes a

basic-Helix-Loop-Helix transcription factor, which is a member of the TCP (TB1, CYC, PCFs)

family of transcriptional regulators (Cubas et al. 1999; Lukens and Doebley 2001). The

expression of tb1 in axillary buds represses organ growth and thereby reduces outgrowth of

axillary branches (Hubbard et al. 2002). Conserved expression patterns and repressor function

have been reported in many other plant species including Arabidopsis, bamboo, barley, rice,

sorghum, and wheat (Finlayson 2007; Peng et al. 2007; Ramsay et al. 2011; Takeda et al. 2003;

Kebrom et al. 2006; Lewis et al. 2008). Correlations between tb1 expression levels and

3

branching were also observed in these studies. The conservation of tb1 expression, function, and

sequence suggests its vital role in plant morphology (Lukens and Doebley 2001; Mondragon-

Palomino and Trontin 2011).

This work focuses on the differences between tb1 in maize and teosinte. By studying the

differences at tb1 selected on during domestication, it is possible to gain insight into the types of

changes at the molecular level that lead to whole plant phenotypes necessary for adaptive

evolution. Several different strategies were employed to study tb1 including molecular,

quantitative, and evolutionary genetic techniques. The research presented here has been

organized into three chapters.

1) The first chapter focuses on the upstream control region of tb1, which regulates the two

fold increase in expression seen in maize compared to teosinte. This work began with the

fine-mapping of the control region previously described. We used recombination

mapping to reduce introgressed segments of a teosinte long arm of chromosome 1 to only

a few hundred base-pairs in an otherwise all maize background. These efforts defined two

independent components of the control region. Sequences from a diverse sample of maize

and teosinte were used to assay nucleotide diversity and evidence for selection in the

control region. From this, four fixed differences were identified between the common

maize and teosinte haplotypes, two of which are transposon insertions in maize. Transient

assays in maize protoplasts were used to test these fixed differences for function. This

experiment identified a repressor sequence in the control region and shows that one of the

transposon insertions enhances gene expression. All results are consistent with observed

differences between maize and teosinte with respect to tb1 expression levels and whole

4

plant phenotypes. Molecular dating of the transposons place the time of insertion prior to

domestication, suggesting selection acted on standing genetic variation instead of new

mutation.

2) The second chapter addresses the possibility of the large effect QTL identified at tb1

fractionating into additional tightly linked QTL. Two experiments were used to ask: 1) is

the upstream control region of tb1 the only segment on the chromosome arm affecting

plant and ear morphology, and 2) where do these additional QTL map? We provide

evidence for single QTL at tb1 affecting plant architecture traits. In addition to tb1, four

linked QTL were found which affect ear morphology. Two of these additional QTL act

epistatically with tb1. These results provide evidence that single QTL peaks do not

always correspond to single genes.

3) The final chapter investigates the allelic series at tb1 conferred by nine teosinte

introgressions into a maize isogenic background. This experiment goes beyond statistical

inference, and controls other possible sources of variation to provide strong evidence for

a natural allelic series at tb1. Unlike classic natural allelic series which control simple

phenotypes, the variation at tb1 is an example of a naturally occurring series for

morphological traits. The alleles separate into distinct phenotypic classes corresponding

to the taxonomic origin of the teosinte introgressions. Moreover, these classes also

correspond to known morphological differences between the teosinte taxa. These results

suggest tb1 was not only involved in maize domestication, but also the morphological

divergence between teosintes.

5

References

Bennetzen, J., E. Buckler, V. Chandler, J. Doebley, J. Dorweiler, et al., 2001 Genetic evidence

and the origin of maize. Latin Amer. Antiquity 12: 84-86.

Clark, R. M., T. Nussbaum Wagler, P. Quijada, and J. Doebley, 2006 A distant upstream

enhancer at the maize domestication gene tb1 has pleiotropic effects on plant and

inflorescent architecture. Nat. Genet. 38: 594-597.

Cubas, P., N. Lauter, J. Doebley, and E. Coen, 1999 The TCP domain: a motif found in proteins

regulating plant growth and development. The Plant Journal 18: 215-222.

Doebley, J. and A. Stec, 1991 Genetic analysis of the morphological differences between maize

and teosinte. Genetics 129: 285-295.

Doebley, J. and A. Stec, 1993 Inheritance of the morphological differences between maize and

teosinte: comparison of results for two F2 populations. Genetics 134: 559-570.

Doebley, J., A. Stec, and L. Hubbard, 1997 The evolution of apical dominance in maize. Nature

386: 485-488.

Doebley, J., 2004 The genetics of maize evolution. Annu. Rev. Genet. 38: 37-59.

Doebley, J. F., B. S. Gaut, and B. D. Smith, 2006 The molecular genetics of crop domestication.

Cell 127: 1309-1321.

Finlayon, S. A., 2007 Arabidopsis TEOSINTE BRANCHED1-LIKE 1 regulates axillary bud

outgrowth and is homologous to monocot TEOSINTE BRANCHED1. Plant Cell

Physiol. 28: 667-677.

Hubbard, L., P. McSteen, J. Doebley, and S. Hake, 2002 The expression patterns and mutant

6

phenotype of teosinte branched1 correlate with growth suppression in maize and teosinte.

Genetics 162: 1927-1935.

Kebrom, T. H., B. L. Burson, and S. A. Finlayson, 2006 Phytochrome B represses teosinte

branched1 expression and induces sorghum axillary bud outgrowth in response to light

signals. Plant Physiol. 140: 1109-1117.

Lewis, J. M., C. A. Mackintosh, S. Shin, E. Gilding, S. Kravchenko, et al., 2008 Overexpression

of the maize Teosinte Branched1 gene in wheat suppresses tiller development. Plant Cell

Rep. 27: 1217-1225.

Lukens, L. N. and J. Doebley, 2001. Molecular evolution of the teosinte branched gene among

maize and related grasses. Mol. Biol. Evol. 18: 627-638.

Mondragon-Palomino, M. and C. Trontin, 2011 High time for a roll call: gene duplication and

phylogenetic relationships of TCP-like genes in monocots. Ann. Bot.

doi: 10.1093/aob/mcr059.

Peng, H.- Z., E.- P. Lin, Q.- L. Sang, S. Yao, Q.- Y. Jin, et al., 2007 Molecular cloning,

expression analysis and primary evolution studies of REV- and TB1-like genes in

bamboo. Tree Physiol. 27: 1273-1281.

Purugganan, M. D., and D. Q. Fuller, 2009 The nature of selection during plant domestication.

Nature 457: 843-848.

Ramsay, L., J. Comadran, A. Druka, D. F. Marshall, W. T. B. Thomas, et al. 2011

INTERMEDIUM-C, a modifier of lateral spikelet fertility in barley, is an ortholog of the

maize domestication gene TEOSINTE BRANCHED1. Nat. Genet. 43: 169-173.

7

Chapter 1

A transposon insertion in the maize gene, tb1 functions as an

enhancer and was a causative variant for change in plant

architecture during maize domestication

8

Abstract

Maize and its progenitor, teosinte, show a striking difference in plant architecture that is partially

governed by a regulatory element or “control region” in the tb1 gene. We show that the tb1

control region is complex, having two components with independent effects on the plant

phenotypes that distinguish maize and teosinte. The common maize haplotype for the control

region possesses two transposable element insertions (Hopscotch and Tourist) that are not found

in the common teosinte haplotypes. Using transient expression assays, we show that the

Hopscotch insertion acts as an enhancer of gene expression, consistent with the higher level of

tb1 expression seen in maize. Molecular dating indicates that the Hopscotch and Tourist

insertions predate maize domestication by at least 10,000 years, indicating that selection acted on

standing variation rather than new mutation. Our results highlight how transposons can

contribute to evolution and domestication through alterations in gene regulation.

9

Introduction

Multiple lines of experimentation suggest that genetic diversity created by transposable elements

(TEs) is an important source of functional variation upon which selection acts during evolution

(Naito et al. 2009; Xiao et al. 2008; White et al. 1994; Bejerano et al. 2006; Mackay et al. 1992;

Torkamanzehi et al. 1992). TEs have been associated with adaptation to temperate climates in

Drosophila (Gonzalez et al. 2010), a SINE element insertion has been associated with the

domestication of small dog breeds from the grey wolf (Gray et al. 2010), and there is even

evidence that TEs were targets of selection during human evolution (Britten 2010). While

examples of TEs associated with host gene function continue to grow, formal proof that TEs are

causative and not just correlated with functional variation is limited. Here, we show that a TE

(Hopscotch) insertion in a regulatory region of the maize domestication gene, tb1 acts as an

enhancer of gene expression and partially explains the increased apical dominance in maize as

compared to its wild progenitor, teosinte. Molecular dating indicates that the Hopscotch insertion

predates maize domestication by at least 10,000 years, indicating that selection acted on standing

variation rather than new mutation.

Materials and Methods

Plant materials

Nine introgression lines generated by Clark and colleagues (2006) were used for fine-mapping

the control region (Figure S1). Nine additional introgression lines were recovered using the same

strategy as used by Clark and colleagues (2006). This entailed backcrossing homozygous

introgression lines to W22, and screening individual F2 progeny for cross-overs in the

10

introgressed chromosomal segment. Genotyping was accomplished using a set of eight PCR-

based indel markers (GS1-8, Table S1), tagged with a 5' HEX or FAM label and then assayed

using an ABI 3700 fragment analyzer.

Phenotypic and genotypic data collection

Plants were grown at the University of Wisconsin West Madison Agricultural Research Station,

Madison, WI, USA during summers of 2006-2009. F2 seed derived from the cross of each of the

homozygous introgression lines to W22 were planted in a completely randomized design using

grids with 0.9 meter spacing between plants in both dimensions. This spacing minimized the

degree to which plants shaded their neighbors. The following three traits were phenotyped:

cupules per rank (CUPR; number of cupules in a single rank from base to the tip of the ear),

lateral branch length (LBLH; length, in cm, of uppermost lateral branch), and tillering (TILL; the

ratio of the sum of tiller heights/plant height). All plants were genotyped individually using a

combination of the eight PCR based markers described above.

Phenotypic data analysis

The tb1 genomic region was divided into 16 segments based on the recombination breakpoints of

the 18 introgression lines. To examine the near-colinearity of these segments with one another,

the CORR procedure of SAS was used to calculate the correlation coefficient between segments.

If the correlation between two segments is high then the model will not adequately fit the two

segments simultaneously. Thus not all segments can be used in a single model. Only if two

segments show a correlation coefficient less than 0.8 were they included as separate factors in

the model. Our final analysis included seven segments which represent the entire tb1 genomic

11

region. The number of plants included for each trait model are as follows: 5491 (TILL), 4591

(LBIL), and 3499 (CUPR). The MIXED procedure of SAS was used to test each segment for an

effect on phenotype. Segments (1-7) were considered fixed effects while year (2006-2009), the

introgression line by ear interaction term, and the introgression line by segment interaction terms

were treated as random effects. The linear model used was

Yhijkl = + ah + bi + cj*dk + cj*ah + ehijkl

where Yhijkl is the trait value for the lth

plant with hth

segments from the kth

ear of the jth

introgression line in the ith

year, is the overall mean of the experiment, ah is the segment effect,

bi is the year effect, cj*dk is the introgression line by ear interaction, cj*ah is the introgression line

by segment interaction, and ehijkl is the sampling error. The random effects of this full model were

subjected to the Likelihood Ratio Test for significance for each trait. Effects that were not

significant were dropped from the model on a trait by trait basis.

Nucleotide diversity

A sample of 16 maize landraces made haploid for DNA extraction (Tenaillon et al. 2001) and 17

inbred teosinte lines were used to assay nucleotide diversity in the control region (Table S2).

Sequencing of PCR fragments for the 33 individuals was done using standard PCR conditions

and Applied Biosystems BigDye kit at the University of Wisconsin Biotechnology Center using

Sanger sequencing methods. Initial alignment of nucleotide sequences was performed using

ClustalW (Thompson et al. 1994) and then finished by hand. Nucleotide diversity (π) was

12

calculated using a 500 base-pair sliding window with a 25 base-pair step with a correction for

small sample size. Nucleotide sites in the alignment were only used for calculating π if at least

ten individuals had ungapped/unambiguous calls from the maize and from the teosinte groups.

Tests for neutrality

The HKA tests (Hudson et al. 1987) for neutrality were performed using DnaSP (Rozas et al.

2003). Zea diploperennis was used as an outgroup, and its sequence was aligned with that of the

33 individuals used in the nucleotide diversity survey. A set of six previously described (Zhao et

al. 2010) neutral loci were used as control genes (Table S3). For each HKA test, an overall 2

value was calculated by taking the sum of the individual 2 values calculated for the six

individual neutral loci. These overall 2 values were then used to obtain overall P-values.

Minimum spanning tree

The minimum spanning tree was constructed using the same 33 individuals as used in the

nucleotide diversity survey (Table S2). The alignment of the sequences was trimmed of gaps and

missing data and then imported into Arlequin version 3.5 (Excoffier and Lischer 2010), which

was used to define the haplotypes and calculate the minimum spanning tree among haplotypes.

Arlequin's distance matrix output was used in Hapstar (Teacher and Griffiths 2010) to draw the

minimum spanning tree.

13

Insertion frequencies

The frequency of Tourist and Hopscotch insertions were calculated using a diverse set of 139

maize chromosomes and 148 teosinte chromosomes (Table S2). The frequency of each insertion

was assayed using a three primer PCR reaction (Table S1) which allowed both homozygous and

heterozygous individuals to be scored on a 2% agarose gel using standard PCR conditions.

Insertion dating

Initial alignment of nucleotide sequences of the Tourist and Hopscotch elements was performed

using ClustalW (Thompson et al. 1994) and then finished by hand. Diversity analyses were

performed using the “compute” function of the analysis package of libsequence (Thornton 2003).

Of the 16 maize alleles sequenced, 15 have the Hopscotch insertion. These 15 alleles had 2

insertion/deletions and 16 segregating sites, of which 13 were singleton mutations and three were

found in two sequences. If we assume a star phylogeny, we can estimate the time since insertion

of the Hopscotch as T=S(15µL)-1

, where T is time in generations, S is the number of segregating

sites, L is the length of the sequence in bp and µ is the per generation mutation rate per bp. Given

1524bp of sequence, 16 segregating sites, a generation time of one year, and a mutation rate of

3x10-8

(Clark et al. 2005), this gives an estimate of approximately 23,300 years. While these

assumptions (star phylogeny, mutation rate, ignoring doubletons) are clearly unrealistic,

changing any of them leads to an increase in the estimated time of insertion.

Protoplast transient assays

Two reporter constructs were developed for the transient assays. A reporter construct containing

the Cauliflower Mosaic Virus (CaMV) 35S minimal promoter (Benefey and Chua 1990) driving

14

expression of the firefly luciferase gene was used for testing control region segments. The

second reporter containing the rice actin1 promoter driving expression of the Renilla luciferase

gene was used as an internal transformation control. Transient expression assays using maize

mesophyll protoplasts were performed following a detailed protocol from the Sheen lab (Sheen

2002) with transformation condition modified as follows. Briefly, 2-4 x 105 freshly isolated

protoplasts in 400 µl electroporation buffer were mixed with 50 µl of plasmids. The protoplast-

plasmids mixes were transferred into 0.5 ml cuvettes and electroporated with Gene Pulser II

Electroporation System (Bio-Rad) set at 250 volts. Each sample received 3 pulses of 1.5 msec

each with a 20 sec pause between the pulses. After electroporation, protoplasts were incubated

for 18 hrs at 25 °C and then harvested. The harvested protoplasts were lysed with CCLR (Cell

Culture Lysis Reagent, Promega) and assayed using a Dual-Luciferase Reporter Assay System

(Promega) following manufacturer’s instruction. 4-6 biological replicates, each with two

technical replicates, were assayed per construct.

Results and Discussion

During its domestication, maize underwent a dramatic transformation in both plant and

inflorescence architecture as compared to its wild progenitor, teosinte (Doebley 2004). Like

many wild grasses, teosinte has a highly branched architecture (Figure 1). The main stalk of a

teosinte plant has multiple long branches, each tipped by a tassel and bears many small ears of

grain at its nodes. By comparison, the stalk of a modern maize plant has only one or two short

branches, each of these tipped by the large grain-bearing ears. The difference in size of the

teosinte and maize ears is substantial. The small ears of teosinte have only 10 or 12 grain, while a

15

Figure 1: Teosinte and maize plants. a, Highly branched teosinte plant and b, a teosinte lateral

branch with terminal tassel. c, Unbranched maize plant and d, maize ear shoot (i.e. lateral

branch).

16

a c db

17

single ear of maize can have 300 or more kernels. Overall, maize shows much greater apical

dominance with the development of the branches repressed relative to the development of the

main stalk.

The teosinte branched1 (tb1) gene is a major contributor to the increase in apical

dominance during maize domestication. tb1 was first identified as a quantitative trait locus

(QTL) (Doebley et al. 1995), and subsequently shown to encode a member of the TCP family of

transcriptional regulators (Cubas et al. 1999). tb1 acts as a repressor of organ growth, and

thereby contributes to apical dominance by repressing the outgrowth of branches. Prior research

has shown that the maize allele of tb1 is expressed more highly than the teosinte allele, thereby

conditioning greater repression of branching (Doebley al. 1997). The regulatory element or

“control region” modulating this difference in expression is located between 58.7 kb and 69.5 kb

upstream of the tb1 open reading frame (ORF) (Clark et al. 2006). Although the region

containing the causative factor distinguishing maize and teosinte was narrowed to this ~11 kb

interval, the nature of this factor, whether simple or multipartite, and the identity of the exact

causative polymorphism(s) have not been elucidated.

We used genetic fine-mapping to locate the factors influencing phenotype in the control

region. We isolated 18 maize-teosinte recombinant chromosomes, each containing a unique

teosinte portion of the tb1 genomic region, and we made these 18 recombinant chromosomes

isogenic in a common maize inbred background (Figure S1). This collection of recombinant

chromosomes enabled us to divide the tb1 genomic region into seven segments based on

recombination breakpoints. The isogenic lines for these recombinant chromosomes were

evaluated over four growing seasons and the phenotypes of more than 5500 plants recorded. The

resulting data were analyzed using a mixed linear statistical model, enabling us to test each

18

segment for an affect on phenotype. This analysis confirmed that the control region previously

described by Clark and colleagues (2006) is responsible for differences in both plant and ear

architecture between maize and teosinte (Figure 2). Moreover, our data show that the control

region is complex, having two independent components effecting phenotype. These two

components, which we call the proximal and distal components, are separated by recombination

breakpoints located ~63.9 kb upstream of the tb1 ORF. The independent phenotypic effects of

the proximal and distal components are readily seen in lines that segregate for only one or the

other of these components (Figure S2).

Previous analyses indicated that the tb1 genomic region shows evidence for a selective

sweep during domestication that extends from the ORF to -58.6 kb but ends before -93.4 kb

(Clark et al. 2004). To better define the extent of the sweep, we performed population genetic

analyses for the region between -57.4 and -67.6 kb using a diverse set of maize and teosinte

lines. Nucleotide diversity () at -58 kb is high in teosinte but low in maize (Figure 3a). Between

-58 and -65 kb, nucleotide diversity is low in both maize and teosinte, but lower in maize. The

low diversity for both maize and teosinte in this region suggests that this region is evolving under

functional constraint. Beyond 65 kb upstream of the ORF, diversity rises in both maize and

teosinte. The rise in nucleotide diversity in maize beyond -65 kb suggests that the selective

sweep ends near this point.

We applied the HKA test (Hudson et al. 1987) to address whether individual segments of

the control region show evidence of past selection. Our results confirm previous findings (Zhao

2006) that the region from -65.6 kb to -67.6 kb (segments A and B in Figure 3) does not depart

significantly from neutral expectations, but that the neutral model can be rejected for the region

from -58.8 to -57.4 (segment D). We also tested, for the first time, an additional segment

19

Figure 2: The phenotypic additive effects for seven intervals across the tb1 genomic region. The

horizontal axis represents the tb1 genomic region to scale. Base-pair positions are relative to

AGPv2 position 256,745,977 of the maize reference genome sequence. The tb1 ORF as well as

the nearest upstream predicted gene (PG3) are shown. The previously defined control region

(CR) (Clark et al. 2006) is shown in red, and is divided into its proximal and distal components.

Vertical columns represent the additive effects shown with standard error bars for each of the

three traits in each of the seven intervals that were tested for an effect on phenotype. Black

columns are statistically significant [P(Bonferroni)<0.05]; white bars are not statistically

significant [P(Bonferroni)>0.05].

20

21

Figure 3: Sequence diversity in maize and teosinte across the control region. a, Nucleotide

diversity across the tb1 upstream control region. Base-pair positions are relative to AGPv2

position 256,745,977 of the maize reference genome sequence. P-values correspond to HKA

neutrality tests for regions A through D as defined by the dotted lines. Green shading signifies

evidence for neutrality, and red shading signifies regions of non-neutral evolution. Nucleotide

diversity () for maize (yellow line) and teosinte (green line) were calculated using a 500 base

pair sliding window with a 25 base pair step. The distal and proximal components of the control

region with four fixed sequence differences between the most common maize haplotype and

teosinte haplotypes are shown below. b, A minimum spanning tree for the control region with 16

diverse maize and 17 diverse teosintes sequences. Size of the circles for each haplotype group

(yellow, maize; green, teosinte) is proportional to the number of individuals with that haplotype.

22

4885 bp

Hopscotch

408 bp

Tourist

M

T

0

0.02

0.04

0.06

HKA Neutrality Tests

P = 0.95 P = 0.41 P = 0.04 P = <0.0001

-67kb -66kb -65kb -64kb -58kb

A B C D

a.

Distal

Component

Proximal

Component

b.

Maize ClusterHaplotype

Teosinte ClusterHaplotype

23

(segment C, from -65.6 to -63.7 kb) in the middle of the control region, which our data show

significantly rejects the neutral model. Prior results (Clark et al. 2004) demonstrated that the

sweep extends from -58 kb to the tb1 ORF; thus overall, the sweep includes approximately 65.6

kb from the control region to the ORF.

Phenotypic fine-mapping with the recombinant chromosomes indicated that the factors

controlling phenotype lie between 58.7kb and 69.5kb upstream of the ORF. Population genetic

analysis indicates that the selective sweep extends only to -65.6 kb. Together, these two sources

of information suggest that the causative polymorphisms lie between -58.7 and -65.6 kb of the

ORF. We looked in greater detail at sequence diversity for maize and teosinte in the ~7 kb

segment that these two methods define. A minimum spanning tree for a sample of 16 diverse

maize and 17 diverse teosintes in this region revealed two distinct clusters of haplotypes – one

composed mostly of maize sequences and the other composed mostly of teosinte sequences

(Figure 3b). We designated these clusters as the maize cluster haplotype (MCH) and teosinte

cluster haplotype (TCH). There are four fixed differences between the sequences in the maize

and teosinte clusters (Figure 3a). Two of these fixed differences were single nucleotide

polymorphisms, and two were large insertions in maize cluster haplotype relative to the teosinte

cluster haplotype. A BLAST search of the two insertion sequences revealed that one is a

Hopscotch retrotransposon and the other is a Tourist MITE (Miniature Inverted-repeats

Transposable Element). These TE insertions are located in the proximal (Hopscotch) and distal

(Tourist) components of the control region as delineated by phenotypic fine-mapping.

To estimate the frequency of the two haplotype groups in maize and teosinte, we assayed

139 additional diverse maize chromosomes and 148 additional diverse teosinte chromosomes

(Table S2). For this purpose, we used the Hopscotch and Tourist insertions as markers for the

24

haplotype groups. The MCH is present in >95% of the maize chromosomes assayed but <5% of

teosinte chromosomes. The fact that the MCH is not fixed in maize suggests either that the initial

selective sweep was not complete or that post domestication gene flow from teosinte to maize

has reintroduced the TCH into the maize gene pool. Correspondingly, the presence of the MCH

in teosinte may represent either a haplotype variant that existed in teosinte prior to domestication

or post domestication gene flow from maize into teosinte, which is known to occur (Fukunaga

2005).

Inspection of the sequence alignment of the Hopscotch-Tourist region suggests that the

two insertions differ in relative age. The Tourist has accumulated greater nucleotide diversity

(=0.0054) since insertion, including a pair of sites that fail the four-gamete test, indicative of

recombination among Tourist sequences. Nucleotide diversity in the Hopscotch insertion is much

lower (=0.0016) and shows no evidence of past recombination. These observations point to the

Hopscotch insertion being more recent than the Tourist. Our sequences do show evidence of

recombination between the Hopscotch and a SNP in the flanking sequence between the two

insertions, likely explaining how the Hopscotch insertion has come to be associated with

multiple alleles of the Tourist element.

These nucleotide diversity data allow us to ask whether the Hopscotch insertion arose

during or prior to domestication. We estimated the time to most recent common ancestor

(TMRCA) of the Hopscotch alleles assuming strong directional selection and a star phylogeny.

Using a relatively high mutation rate (3x10-8

/bp/yr) (Clark et al. 2005), this method yields an

estimate (~23,000 years) much older than the time since domestication (~9,000 BP) (Doebley

2004), suggesting the Hopscotch insertion (and thus the older Tourist as well) existed as standing

25

genetic variation in the teosinte ancestor of maize. Violation of the assumptions of strong

selection, a high mutation rate, and a star phylogeny would lead to an underestimate of the

TMRCA and are in this sense conservative. Thus, we conclude that the Hopscotch insertion

predated the domestication process by more than 10,000 years and that the Tourist insertion is

even older.

Having identified only four fixed differences in the proximal and distal components of

the control region, we used transient assays in maize leaf protoplasts to test all four differences

for effects on gene expression. Maize and teosinte chromosomal segments for the proximal and

distal components of the control region were cloned into reporter constructs 5' of the minimal

promoter of the cauliflower mosaic virus (mpCaMV), the firefly luciferase ORF, and the

nopaline synthase (NOS) terminator (Figure 4). Each construct was assayed for luminescence

after transformation by electroporation into maize protoplast. The constructs for the distal

component contrast the effects of the Tourist insertion plus the single fixed nucleotide

substitution that distinguish maize and teosinte. Both the maize and teosinte constructs for the

distal component repressed luciferase expression relative to the minimal promoter alone. The

maize construct with the Tourist excised gives luciferase expression equivalent to the native

maize and teosinte constructs and less expression than the minimal promoter alone. These results

indicate that this segment is functionally important, acting as a repressor of luciferase expression

and by inference of tb1 expression in vivo. However, we did not observe any difference between

the maize and teosinte constructs as anticipated. One possible cause for the failure to see an

expression difference between the maize and teosinte constructs would be that additional

proteins required to reveal the difference are not present in maize leaf protoplast. Nevertheless,

the results do indicate that the distal component has a functional element, acting as a repressor.

26

Figure 4: Constructs and corresponding normalized luciferase expression levels. Transient

assays were performed in maize leaf protoplasts. Each construct is drawn to scale. The construct

backbone consists of the minimal promoter from the cauliflower mosaic virus (mpCaMV, grey

box), luciferase ORF (luc, white box), and the nopaline synthase terminator (black box).

Proximal and distal components of the control region (hatched boxes) from maize and teosinte

were cloned into restriction sites 5' of the minimal promoter. “” denotes the excision of either

the Tourist or Hopscotch element from the maize construct. Horizontal green bars show the

normalized mean with standard error bars of each construct.

27

28

The functional importance of this segment is supported by its low level of nucleotide diversity

(Figure 3a), suggesting a history of purifying selection.

The constructs for the proximal component of the control region contrast the effects of

the Hopscotch insertion plus a single fixed nucleotide substitution that distinguish maize and

teosinte. The construct with maize sequence including the Hopscotch increased expression of the

luciferase reporter two-fold relative to the teosinte construct for the proximal control region and

the minimal promoter alone (Figure 4). Luciferase expression was returned to the level of the

teosinte construct and the minimal promoter construct by deleting the Hopscotch element from

the full maize construct. These results indicate that the Hopscotch element enhances luciferase

expression and by inference tb1 expression in vivo. They also indicate that the Hopscotch rather

than the fixed SNP difference between maize and teosinte is the causative polymorphism. The

observed enhancement of gene expression by the Hopscotch element is consistent with the

known higher level of tb1 expression in maize as compared to teosinte.

Our observation of a TE providing an enhancer element in tb1 is similar to that observed

with globin genes in primates in which an EVR-9 element has been shown to function as a long

distance enhancer of gene expression (Pi et al. 2010). Similarly, in Drosophila, the LTR of an

Accord element acts an enhancer of Cyp6g1, which metabolizes DDT, thereby conferring

pesticide resistance (Chung et al. 2007; Schmidt et al. 2010). Over 25 years ago, McClintock

proposed that transposable elements represent a key source of variation for evolution (1984).

Remarkably, a transposable element insertion appears to represent the causal variant for one of

the key steps in the domestication of maize, the organism in which McClintock discovered

transposable elements.

29

References

Bejerano, G., C. B. Lowe, N. Ahituv, B. King, A. Siepel, et al., 2006 A distal enhancer and an

ultraconserved exon are derived from a novel retrotransposon. Nature 441: 87-90.

Benefey, P. N., and N. Chua, 1990 The cauliflower mosaic virus 35S promoter: combinatorial

regulation of transcription in plants. Science 250: 959-966.

Britten, R. J., 2010 Transposable element insertions have strongly affected human evolution.

Proc. Natl. Acad. Sci. U.S.A. 107: 19945-19948.

Chung, H., M. R. Bogwitz, C. McCart, A. Adrianopoulos, R. H. ffrench-Constant, et al., 2007

Cis-regulatory elements in the Accord retrotransposon result in tissue-specific expression

of the Drosophila melanogaster insecticide resistance gene Cyp6g1. Genetics 175: 1071-

1077.

Clark, R. M., E. Linton, J. Messing, and J. F. Doebley, 2004 Pattern of diversity in the genomic

region near the maize domestication gene tb1. Proc. Natl. Acad. Sci. U.S.A. 101: 700-

707.

Clark, R. M., S. Tavare, and J. Doebley, 2005 Estimating a nucleotide substitution rate for maize

from polymorphism at a major domestication locus. Mol. Biol. Evol. 22: 2304-2312.

Clark, R. M., T. Nussbaum Wagler, P. Quijada, and J. Doebley, 2006 A distant upstream



Cubas, P., N. Lauter, J. Doebley, and E. Coen, 1999 The TCP domain: a motif found in proteins


Doebley, J., A. Stec, and C. Gustus, 1995 teosinte branched1 and the origin of maize: Evidence

for epistasis and the evolution of dominance. Genetics 141: 333-346.

30

Doebley, J., A. Stec, and L. Hubbard, 1997 The evolution of apical dominance in maize. Nature

386: 485-488.


Excoffier, L., and H. E. L. Lischer, 2010 Arlequin suite ver 3.5: a new series of programs to

perform population genetics analyses under Linux and Windows. Mol. Ecol. Resources

10: 564-567.

Fukunaga K., J. Hill, Y. Vigouroux, Y. Matsuoka, J. Sanchez, et al., 2005 Genetics diversity and

population structure of teosinte. Genetics 169: 2241-2254.

Gonzalez, J., T. L. Karasov, P. W. Messer, and D. A. Petrov, 2010 Genome-wide patterns of

adaptation to temperate environments associated with transposable elements in

Drosophila. PLOS Genet. 6: e10000905.

Gray, M. M., N. B. Sutter, E. A. Ostrander, and R. K. Wayne, 2010 The IGF1 small dog

haplotype is derived from Middle Eastern grey wolves. BMC Biol. 8: 16.

Hudson, R. R., M. Kreitman, and M. Aguade, 1987 A test of neutral molecular evolution based

on nucleotide data. Genetics 116: 153-159.

Mackay, T. F. C., R. F. Lyman, and M. S. Jackson, 1992 Effects of P element insertions on

quantitative traits in Drosophila melanogaster. Genetics 130: 315-332.

McClintock, B., 1984 The significance of responses of the genome to challenge. Science 226:

792-801.

Naito, K., F. Zhang, T. Tsukiyama, H. Saito, N. C. Hancock, et al., 2009 Unexpected

consequences of a sudden and massive transposon amplification on rice gene expression.

Nature 461: 1130-1134.

31

Pi, W., X. Zhua, M. Wua, Y. Wanga, S. Fulzeleb, et al., 2010 Long-range function of an

intergenic retrotransposon. Proc. Natl. Acad. Sci. U.S.A. 107: 12992-12997.

Rozas, J., J. C. Sanchez-DelBarrio, X. Messeguer, and R. Rozas, 2003 DnaSP, DNA

polymorphism analyses by the coalescent and other methods. Bioinformatics 19: 2496-

2497.

Schmidt, J. M., R. T. Good, B. Appleton, J. Sherrard, G. C. Raymant, et al., 2010 Copy number

variation and transposable elements feature in recent, ongoing adaptation at the Cyp6g1

locus. PLOS Genet. 6: e10000998.

Sheen, J. 2002 “A transient expression assay using maize mesophyll protoplasts”

(http://genetics.mgh.harvard.edu/sheenweb).

Teacher, A. G. F. and D. J. Griffiths, 2010 HapStar: automated haplotype network layout and

visualization. Mol. Ecol. Resources 11: 151-153.

Tenaillon, M. I., M. C. Sawkins, A. D. Long, R. L. Gaut, and J. F. Doebley, et al., 2001 Patterns

of DNA sequence polymorphism along chromsome 1 of maize (Zea mays ssp. mays L).

Proc. Natl. Acad. Sci. U.S.A. 98: 9161-9166.

Thompson, J. D., D. G. Higgins, and T. J. Gibson, 1994 CLUSTAL W: improving the sensitivity

of progressive multiple sequence alignment through sequence weighting, position-

specific gap penalties and weight matrix choice. Nucl. Acids Res. 22: 4673-4680.

Thornton, K. 2003 libsequence: a C++ class library for evolutionary genetic analysis.

Bioinformatics 19: 2325-2327.

Torkamanzehi, A., C. Moran, and F. W. Nicholas, 1992 P element transposition contributes

substantial new variation for a quantitative trait in Drosophila melanogaster. Genetics

131: 73-78.

32

White, S. E., L. F. Habera, and S. R. Wessler, 1994 Retrotransposons in the flanking regions of

normal plant genes: A role for copia-like elements in the evolution of gene structure and

expression. Proc. Natl. Acad. Sci. U.S.A. 91: 11792-11796.

Xiao, H., N. Jiang, E. Schaffner, E. J. Stockinger, and E. van der Knaap, 2008 A retrotransposon-

mediated gene duplication underlies morphological variation of tomato fruit. Science

319: 1527-1530.

Zhao, Q., 2006 Molecular population genetics of maize regulatory genes during maize evolution.

Ph.D Thesis, University of Wisconsin-Madison, Madison, WI.

Zhao, Q., A. L. Weber, M. D. McMullen, K. Guill, and J. Doebley, 2010 MADS-box genes of

maize: frequent targets of selection during domestication. Genet. Res. Camb.

doi:10.1017/S0016672310000509.

33

Figure S1: tb1 locus teosinte recombinant chromosomes. The horizontal axis represents the tb1

genomic region to scale. Base-pair positions are relative to AGPv2 position 256,745,977 of the

maize reference genome sequence. The tb1 ORF as well as the nearest upstream predicted gene

(PG3) are shown. The previously defined control region (CR) is shown in red, and is divided into

its proximal and distal components. Thick black lines represent teosinte chromosome segments

and narrow lines represent maize chromosome segments. Introgression lines with blue

background shading were developed and described previously. Introgression lines with red

background shading were developed during the course of this study.

34

tb1PG3

(kb)

-160 -140 -120 -100 -80 -60 -40 -20 0

CR

35

Figure S2: Phenotypic additive effects for the smallest introgression segments.

Three introgression segments are compared. These introgression segments include the full

control region (I44), the proximal component only (I46), and the distal component only (I38).

The length of each introgressed segment is included for both the corresponding maize and

teosinte alleles. The size of the introgression segments vary between maize and teosinte because

of insertion/deletion polymorphisms. Additive effects for each of the introgression segments are

shown with standard errors. These effects highlight the independent phenotypic contribution of

both the proximal and distal components of the control region (CR).

36

0.0

-1.5

-1.0

-0.5

0.75

0.00

0.25

0.50

0.75

0.00

0.25

0.50

Tillering Internode Length Cupules per Rank

tb1PG3 CR Introgression Length (bp)

~27,931 ~30,620

10,617 8,383

5,428 532

37

Table S1: Primer sequences for genotyping.

Primer Namea

Primer Sequence (5' to 3')

GS1-F ACACCGCCACCGACATCT

GS1-R TTGTCCCTGAACGGCCAATA

GS2-F TGGCCAATAAATGTACTAGGTCAC

GS2-R TGATCATACCACCTCTCTATGCAG

GS3-F CATGAACATGCCGTGTGCT

GS3-R TTCTAGTACCTAGTGCGCCCGTAG

GS4-F AGTAGGCCATAGTACGTAC

GS4-R CTCTTTACCGAGCCCCTACA

GS5-F AGTGGACAACCGAACGAAGA

GS5-R GAAGCAACTATCAACACAAGCCTT

GS6-F TGTTGTTGGTGATGGAGTCG

GS6-R CGTGTGTGTGATCGAATGGT

GS7-F AGCCAGGATCAATGGCATAC

GS7-R AGCAAAGGGCATGTGTTACC

GS8-F GTTAACCATGAGACGGCCAC

GS8-R GTCAGAATCCCCTGCTCG

Primer Nameb

Primer Sequence (5' to 3')

FM-F0372 ACCAGCAAGCAGCAAGAAAT

IM-R0375 TTGAGTGTCGCCTAGACTGC

RM-R0377 CCTACTTTTTCATCTCCCGC

FH-F0378 CTGCGATGATGCAAGGAGTA

IH-R0379 CTCAATGCATGCCGTTATTG

FH-R0381 CGTTGTCGACAGTCTCCTCA

aPrimer sequences of markers used for genotyping and detecting new recombinant chromosomes.

bPrimer sequences used for detection of Tourist and Hopscotch elements at the tb1 locus.

38

Table S2: Germplasm assayed for transposon insertions.

Germplasm Type Racename Sourcea

Accession Touristb

Hopscotchb

Maize Landrace* Assiniboine NCRPIS PI213793 M M

Maize Landrace* Bolita INIFAP OAX68 M M

Maize Landrace* Cateto Sulino CIMMYT URG II M M

Maize Landrace* Chalqueno INIFAP MEX48 M M

Maize Landrace* Chapalote INIFAP SIN2 M M

Maize Landrace* Conico INIFAP PUE32 M M

Maize Landrace* Costeno ICA VEN453 M M

Maize Landrace* Cristalino Norteno NCGRP CHI349 M M

Maize Landrace* Dzit Bacal CIMMYT GUA131 M M

Maize Landrace* Gordo CIMMYT CHH160 M M

Maize Landrace* Guirua NCGRP MAG450 M M

Maize Landrace* Nal-tel INIFAP YUC7 M M

Maize Landrace* Pisccorunto PCIM APC13 M M

Maize Landrace* Sabanero NRC SAN329 M M

Maize Landrace* Serrano INIFAP GUA14 M T

Maize Landrace* Zapalote Chico CIMMY OAX70 M M

Inbred Teosinte Balsas JFD TIL01 T T


Inbred Teosinte Jalisco JFD TIL03 M M






Inbred Teosinte Balsas JFD TIL09 M M


Inbred Teosinte Jalisco JFD TIL11 T T


Inbred Teosinte Jalisco JFD TIL14 T T


Inbred Teosinte Balsas JFD TIL17 M M

Inbred Teosinte Chalco JFD TIL18 T T

Inbred Teosinte Central Plateau JFD TIL25 T T

Non-inbred Teosinte Balsas CIMMYT 8779 T T

Non-Inbred Teosinte Balsas INIFAP JSG Y LOS-113 T T

Non-Inbred Teosinte Jalisco INIFAP JSG Y SMH-355 M M

Non-Inbred Teosinte Balsas NCRPIS PI566688 T H


39


Accession Touristb

Hopscotchb

Non-Inbred Teosinte Balsas INIFAP JSG-377 T T

Non-Inbred Teosinte Balsas INIFAP C-9-78 T T

Non-Inbred Teosinte Balsas CIMMYT 11401 T T


Non-Inbred Teosinte Jalisco INIFAP JSG Y MAS-400 T T

Non-Inbred Teosinte Jalisco INIFAP JSG Y SMH-352 T T

Non-Inbred Teosinte Balsas HHI IC #3 T T









Non-Inbred Teosinte Balsas GWB BK Site 4 T T






Non-Inbred Teosinte Jalisco INIFAP JSG-203 T T

Non-Inbred Teosinte Jalisco BFB 967 T T













Non-Inbred Teosinte Jalisco INIFAP JSG Y LOS-43 T T


Non-Inbred Teosinte Jalisco INIFAP MAS-15 T T



40


Accession Touristb

Hopscotchb

Non-Inbred Teosinte Balsas CIMMYT 11361 T H




Non-Inbred Teosinte Balsas NCRPIS PI566686 T T


Non-Inbred Teosinte Balsas CIMMYT 11355 T H


Non-Inbred Teosinte Balsas CIMMYT 8767 M M




Non-Inbred Teosinte Jalisco CIMMYT 9477 T T


















Maize Landrace Arrocillo Amarillo INIFAP VER 311 M M

Maize Landrace Aysuma ICA BOV 331 M M

Maize Landrace Canilla ICA VEN 604 M M

Maize Landrace Capia Blanco CIMMYT ARG 499 M M

Maize Landrace Cariaco NRC COR 334 M M

Maize Landrace Cateto Nortista Precoce CIMMYT SUR I M M

Maize Landrace Cateto Sulino CIMMYT URG II M M

Maize Landrace Chalqueno INIFAP MEX 48 M M

Maize Landrace Chillo NRC ECU 458 M M

Maize Landrace Chococeno ICA ECU 964 M M

41


Accession Touristb

Hopscotchb

Maize Landrace Conejo INIFAP GRO 157 M M

Maize Landrace Confite Puneno PCIM PUN 4 M M

Maize Landrace Conico INIFAP PUE 109 M M

Maize Landrace Conico INIFAP MEX 108 M M

Maize Landrace Coroico ICA BOV 992 M M

Maize Landrace Cuban Flint CIMMYT CUB 63 M M

Maize Landrace Dente Paulista CIMMYT SP III M M

Maize Landrace Dulce de Jalisco INIFAP ZAC 182 M M

Maize Landrace Dzit Bacal CIMMYT GUA 130 M M

Maize Landrace Dzit Bacal INIFAP QOO 20 M M

Maize Landrace Guirua NCGRP MAG 443 M M

Maize Landrace Harinoso Tarapaqueno NRC CHI 421 M M

Maize Landrace Imbricado ICA CUN 372 M M

Maize Landrace Jala CIMMYT JAL 44 M M

Maize Landrace Karapampa NRC BOV 961 M M

Maize Landrace Kculli PCIM CUZ 66 M M

Maize Landrace Montana ICA NAR 426 M M

Maize Landrace morado ICA BOV 567 M M

Maize Landrace motozinteco INIFAP CHS 650 M M

Maize Landrace mushito INIFAP MIC 328 M M

Maize Landrace Nal-tel INIFAP CAM 48 M M

Maize Landrace Nal-tel INIFAP YUC 148 M H

Maize Landrace Nal-tel de Altura INIFAP CHS 196 M M

Maize Landrace Onaveno INIFAP SON 105 H M

Maize Landrace Pepitilla INIFAP MOR 99 M M

Maize Landrace Pira ICA VEN 485 M M

Maize Landrace Pisccorunto PCIM APC 13 M M

Maize Landrace Sabanero NRC SAN 329 M M

Maize Landrace Serrano INIFAP GUA 14 M H

Maize Landrace Serrano Mixe INIFAP OAX 565 T M

Maize Landrace Tablilla de Ocho CIMMYT NAY 185 M M

Maize Landrace Tuson INIFAP TRN 10 M M

Maize Landrace Tuxpeno Norteno INIFAP COA 21 M M

Maize Landrace Tuxpeno Norteno INIFAP CHH 121 M M

Inbred Landrace Araguito NCRPIS MR01 M M

Inbred Landrace Assiniboine NCRPIS MR02 T M

Inbred Landrace Bolita NCRPIS MR03 M M

Inbred Landrace Cateto NCRPIS MR05 M M

Inbred Landrace Chapalote NCRPIS MR06 M M

Inbred Landrace Comiteco NCRPIS MR07 M M

42


Accession Touristb

Hopscotchb

Inbred Landrace Costeno NCRPIS MR08 M M

Inbred Landrace Cravo Riogranense NCRPIS MR09 M M

Inbred Landrace Cristalino Norteno NCRPIS MR10 M M

Inbred Landrace Cuban Flint NCRPIS MR11 M M

Inbred Landrace Havasupai NCRPIS MR12 M M

Inbred Landrace Hickory King NCRPIS MR13 M M

Inbred Landrace Longfellow Flint NCRPIS MR14 M M

Inbred Landrace Pisankalla NCRPIS MR17 M M

Inbred Landrace Reventador NCRPIS MR18 M M

Inbred Landrace Santa Domingo NCRPIS MR19 T M

Inbred Landrace Shoe Peg NCRPIS MR20 M M

Inbred Landrace Tabloncillo NCRPIS MR21 M M

Inbred Landrace Tuxpeno NCRPIS MR22 M M

Inbred Landrace Zapalote Chico NCRPIS MR23 M M

Inbred Landrace Chullpi NCRPIS MR24 M M

Inbred Landrace Pororo NCRPIS MR25 M M

Inbred Landrace Pollo NCRPIS MR26 M M

Maize Inbred NCRPIS B73 M M

Maize Inbred NCRPIS Mo17 M M

Maize Inbred NCRPIS B97 M M

Maize Inbred NCRPIS CML52 M M








Maize Inbred NCRPIS Hp301 M M

Maize Inbred NCRPIS Il14H M M

Maize Inbred NCRPIS Ki3 M M

Maize Inbred NCRPIS Ki11 M M

Maize Inbred NCRPIS Ky21 M M

Maize Inbred NCRPIS M37W M M

Maize Inbred NCRPIS M162W M M

Maize Inbred NCRPIS MO18W M M

Maize Inbred NCRPIS MS71 M M

Maize Inbred NCRPIS NC350 M M

Maize Inbred NCRPIS NC358 M M

Maize Inbred NCRPIS Oh7B M M

43


Accession Touristb

Hopscotchb

Maize Inbred NCRPIS Oh43 M M

Maize Inbred NCRPIS P39 M M

Maize Inbred NCRPIS Tx303 M M

Maize Inbred NCRPIS Tzi8 M M

Maize Inbred NCRPIS W22 M M

*Maize landrace made haploid for DNA extraction and sequencing.

a Source information can be found at www.panzea.org.

b"M" denotes the common maize haplotype (presence of the element), "T" denotes the common teosinte haplotype

(absence of the element).

44

Table S3: Input values for HKA tests.

Loci a

Sb

Lc

Nd

Ke

AY104395 10 477 11 4.909

AY106816 39 532 13 37.615

AY107192 13 495 14 6.286

AY107248 21 538 14 7.286

AY111546 4 674 15 3.000

AY111711 26 528 15 13.200

Segment A 40 740 16 15.688

Segment B 89 1086 16 80.938

Segment C 20 1723 15 35.267

Segment D 9 1392 16 47.313

aSix neutral loci and four segments tested in this paper (Fig. 3a).

bNumber of segregating sites.

cNumber of total sites excluding gaps.

dSample size.

eAverage nucleotide difference.

45

Chapter 2

Do large effect QTLs fractionate?

A case study at the maize domestication QTL teosinte branched1

46

Abstract

Quantitative trait loci (QTL) mapping is a valuable tool for studying the genetic architecture of

trait variation. Despite the large number of QTL studies reported in the literature, the identified

QTL are rarely mapped to the underlying genes and it is usually unclear whether a QTL

corresponds to one or multiple linked genes. Similarly, when QTL for several traits co-localize,

it is usually unclear whether this is due to the pleiotropic action of a single gene or multiple

linked genes, each affecting one trait. The domestication gene teosinte branched1 (tb1) was

previously identified as a major domestication QTL with large effects on the differences in plant

and ear architecture between maize and teosinte. Here we present the results of two experiments

that were performed to determine if the single gene tb1 explains all trait variation for its genomic

region or if the domestication QTL at tb1 fractionates into multiple linked QTL. For traits

measuring plant architecture, we detected only one QTL per trait and these QTL all mapped to

tb1. These results indicate that tb1 is the sole gene for plant architecture traits that segregates in

our QTL mapping populations. For most traits related to ear morphology, we detected multiple

QTL per trait in the tb1 genomic region including a large effect QTL at tb1 itself plus one or two

additional linked QTL. tb1 is epistatic to two of these additional QTL for ear traits. Overall,

these results provide examples for both a major QTL that maps to a single gene, as well as a case

in which a QTL fractionates into multiple linked QTL.

47

Introduction

Quantitative trait loci (QTL) mapping studies have become widely used to elucidate the genetic

architecture of trait variation in many organisms (Mackay et al. 2009). A common observation in

these studies is that QTL of large effect are often detected. Noor et al. (2001) have questioned

whether such large effect QTL represent single genes or groups of tightly linked genes. These

authors have suggested that such large effect QTL, upon closer examination, might fractionate

into multiple linked small effect QTL, representing multiple genes. A single QTL does not

necessarily equal a single gene. Even in cases where QTL effects have been fine mapped to a

specific gene, the research may not formally exclude the presence of additional linked genes that

contribute to the overall QTL effect for that genomic region.

Doebley and Stec (1991, 1993) identified a QTL of large effect on the long arm of maize

chromosome 1 controlling the differences in plant and ear architecture between maize and

teosinte. These authors proposed that tb1, a known mutant of maize, was the gene underlying this

QTL because tb1 falls within the 1 LOD support interval for the QTL, and because the tb1

mutant and the QTL affect the same suite of traits. Subsequently, Doebley et al. (1995) used a

complementation test that showed that the teosinte allele of the QTL fails to complement the tb1

mutant of maize, indicating that they are alleles of the same gene. However, complementation

tests do not provide formal proof because of the potential for non-allelic non-complementation.

Additional support for the hypothesis that tb1 is the gene underlying the major

domestication QTL was obtained after the cloning of tb1 (Doebley et al. 1997). With a

knowledge of the molecular identity of tb1, Doebley et al. (1997) showed that the maize allele of

this gene is expressed at twice the level of the teosinte allele in the developing branch and in

48

immature ears. Thus, a change in gene regulation was hypothesized to be the causative difference

between maize and teosinte. Finally, Clark et al. (2006) provided formal proof that tb1 is the

QTL by fine-mapping the QTL to a 12 kb “control region” located ~58-69 kb upstream of the

tb1 open reading frame. These authors further demonstrated that this control region contains a

factor that acts as a cis-regulatory element with the maize allele conditioning a higher level of

tb1 expression than the teosinte allele. However, their data does not address the possibility of

additional QTL linked to tb1, and indeed some of their data suggest that such additional linked

QTL may exist, i.e. that tb1 fractionates into multiple linked QTL.

In this paper, we report two experiments performed to address whether there are

additional QTL closely linked to tb1. In Experiment I, we analyzed a mapping population in

which the tb1 control region identified by Clark et al. (2006) is fixed for the teosinte haplotype,

but the regions flanking it are segregating for maize vs. teosinte chromosomal segments. If there

are additional QTL linked to the control region, then there should be phenotypic effects

associated with the segregating maize vs. teosinte chromosomal segments despite the fact that

the tb1 control region is not segregating. Conversely, if the control region alone explains all

phenotypic effects, then there should be no phenotypic effects associated with the flanking

chromosomal regions. In Experiment II, we analyzed a set of nearly isogenic recombinant inbred

lines (NIRILs) for the tb1 genomic region to see if we could detect any QTL other than tb1. This

experiment has more power than a standard QTL analysis to detect closely linked QTL because

the NIRILs have an isogenic background and the NIRILs were grown in replicate to obtain better

estimates of QTL effects.

Based on these two experiments, we confirm that tb1 is a large effect QTL contributing to

the differences in plant and ear architecture between maize and teosinte. In fact, tb1 is the only

49

QTL for plant architecture traits that we detected. However, we identify four additional QTL

affecting ear architecture. One of these additional QTL is located only 6 cM upstream of tb1.

Two of these additional QTL have significant epistatic interactions with tb1. Thus, our results

provide examples for both a major QTL that maps to a single gene as shown for plant

architecture, as well as a case in which a QTL fractionates into multiple QTL as shown for ear

architecture.


Plant materials

Segments of the long arm of chromosome 1 from teosinte were introgressed into a maize inbred

W22 background for both Experiments I and II. For Experiment I, a segment of the long arm of

chromosome 1 from a teosinte (Zea mays ssp. mexicana; collection Wilkes-Panindicuaro) was

introgressed into W22 via six generations of backcrossing (Figure 1). A BC6S1 line (I01) that

was homozygous for the teosinte alleles at markers bnlg615 and bnlg1671, which flank tb1, was

recovered. I01 was then crossed to W22 and the F2 progeny of this cross were screened for

crossovers near tb1. A plant with one of the newly identified recombinants was itself crossed to

W22, and the F2 progeny of this cross were screened for crossovers near tb1. From this process, a

homozygous introgression line (I16) containing an ~69 kb segment of teosinte chromosome

which encompasses the tb1 upstream control region and part of the ORF was recovered (Clark et

al. 2006). Homozygous I01 and I16 lines were crossed and the resulting F1 plants were selfed to

produce an F2 population for Experiment I.

50

Figure 1: Map of the introgression lines used. All introgressed segments are drawn to scale.

Black shaded areas indicate teosinte chromosome segments, unshaded areas represent maize

chromosome segments. Markers flanking the introgressions and the position of tb1 are shown for

reference. The introgressed segment in I16 is only ~69 kb.

51

52

For Experiment II, a segment of the long arm of chromosome 1 (T1L) from a teosinte

(Zea mays ssp. parviglumis; Iltis and Cochrane collection 81) was introgressed into W22 via six

generations of backcrossing (Figure 1). During the backcrossing process, molecular markers

were used both to follow the target segment surrounding the QTL on the long arm of

chromosome 1, as well as to eliminate teosinte chromosome segments at other major

domestication QTL identified by Doebley and Stec (1993) (Table S1). Six separate BC6 plants

heterozygous for the target segment were selfed to give six BC6S1 families (designated families

A-E). These six families were selfed an additional five generations to produce a set of 153

homozygous nearly isogenic recombinant inbred lines (NIRILs). These 153 lines were

distributed among the six families as follows: A: 24, B: 31, C: 39, D: 25, E: 19, F: 15. These

lines possess a set of maize-teosinte recombinant chromosomes for the tb1 genomic region in the

W22 genetic background. These 153 lines make up the QTL mapping population of Experiment

II.

Molecular markers and linkage map

Plants in Experiment I were genotyped using a PCR-based indel marker, GS3, previously

described by Clark et al. (2006). GS3 is located in the coding region of tb1 and segregates in the

I01 I16 F2 population. Plants in Experiment II were genotyped using a set of 25 PCR-based

markers: 16 SSRs, 6 insertion or deletion (indel), and 3 markers scored for the presence/absence

of a PCR product. Marker information is available at either Panzea (www.panzea.org) or

MaizeGDB (www.maizegdb.org). There were a total 174 crossovers among the 153 lines,

averaging 1.1 crossovers per line. The distribution of crossovers among lines was as follows: 0

(46 lines), 1 (52 lines), 2 (44 lines), 3 (10 lines) and 4 (1 line). A genetic map was constructed

53

using the Kosambi map function and a genotyping error rate of 0.0001 as parameter values for

the “est.map” command in the R/qtl module of the R statistical computing package (Broman et

al. 2003).

Phenotypic data collection

The plants for Experiment I were grown at the University of Wisconsin West Madison

Agricultural Research Station, Madison, WI, USA during summer 2006. F2 seed from three ears

(A, B, and C) generated by three separate I01 I16 crosses was planted in a randomized

complete block design using a grid with 0.9 meter spacing between plants in both dimensions.

This spacing minimized the degree to which plants shaded their neighbors. The following five

traits were phenotyped for Experiment I: cupules per rank (CUPR; number of cupules in a single

rank from base to the tip of the ear), ear diameter (ED; diameter, in mm, of the midsection of

each ear), lateral branch internode length (LBIL; mean internode length, in cm, of the uppermost

lateral branch), tillering (TILL; the ratio of the sum of tiller heights/plant height), and tiller

number (TILN; the number of tillers per plant). CUPR and ED were both measured on the

uppermost, well-formed lateral inflorescence (ear) of each plant.

The NIRILs for Experiment II, along with the backcross parent W22, were grown using a

randomized complete block design at the University of Wisconsin West Madison Agricultural

Research Station, Madison, WI, USA during summer 2008. The design included three replicates

(blocks A, B, and C) with a single 10-plant plot of each NIRIL per replicate. Each plot was 3.7 m

long and 0.9 m wide. The plots within each block were arranged in a grid with row and column

designations so that position effects could be included during data analysis. Three plants were

phenotyped per plot. In addition to the five traits measured in Experiment I, the following three

54

traits were evaluated: 10-kernel length (10KL; length, in mm, of 10 consecutive kernels in a

single rank along the ear), ear length (EL; distance, in cm, from the base to the tip of the ear),

and percent staminate spikelets (STAM; percentage of male spikelets in the inflorescence).

10KL, CUPR, ED, EL, and STAM were all measured on the uppermost, well-formed lateral

inflorescence (ear) of each plant.

Data analysis

For Experiment I, we used the GLM procedure of SAS (Littel et al. 1996) to compare the effects

of the I01 and I16 introgression segments on phenotypes. Genotype (homozygous I01,

homozygous I16, or heterozygous) and ear parent (A, B or C) were considered as fixed effects.

The general linear model used was

Yijk = µ + ai + bj + eijk

where Yijk is the trait value for the kth

plant from the jth

ear parent with ith

genotype, is the

overall mean of the experiment, ai is the genotype effect, bj is the ear parent effect, and eijk is the

sampling error. Using this model, the effects of the different introgressions (I01 vs. I16) were

evaluated.

For Experiment II, we obtained least-squares means for each NIRIL using the MIXED

procedure of SAS (Littel et al. 1996). The NIRIL (or parental) lines and families (A-E) were

considered fixed effects while blocks (A, B, and C) and plot coordinates were treated as random

effects. The linear model used was

55

Yhijklm = + ah(bi) + bi + cj + dk + fl + ehijkl + ghijklm

where Yhijklm is the trait value for the mth

plant at lth

column and kth

row in the jth

block of the hth

NIRIL nested in the ith

family, is the overall mean of the experiment, ah is the NIRIL (or

parental) line effect, bi is the family effect, cj is the block effect, dk is the row effect, fl is the

column effect, and ehijkl is the experimental error (random variation among plots), and ghijklm is

the (within-plot) sampling error. All fixed effects were significant and were included in the

model for the calculation of the least-squares means. The random effects of this full model were

subjected to the Likelihood Ratio Test for significance for each trait. Effects that were not

significant were dropped from the model on a trait by trait basis.

The least-squares means estimates were used for QTL mapping in Experiment II, which

was conducted in the R/qtl module of the R statistical computing package (Broman et al. 2003).

For each trait, an initial QTL scan was performed using simple interval mapping with a 0.25 cM

step (Lander and Botstein 1989) and the position of the highest LOD score was recorded.

Statistical significance of the peak LOD score was assessed using 10,000 permutations of the

data (Doerge and Churchill 1996). Then, the position and effect of the QTL was refined using the

Haley-Knott Regression method (Haley and Knott 1992) by executing the “calc.genoprob”

command (0.25 cM step size and assumed genotyping error rate of 0.001), followed by the

“fitqtl” command. To search for additional QTL, the “addqtl” command was used. If a second

QTL was detected, then “fitqtl” was used to test a model containing both QTL and their

interaction effect. If both QTL remained significant, the “refineqtl” command was used to re-

estimate the QTL positions based on the full model including both QTL. Finally, each QTL was

56

removed from the model and then added back using the “addqtl” command to re-confirm its

significance and position. Approximate confidence intervals for the locations of the QTL were

obtained via 1.5 LOD support intervals to each side of the position of the LOD maximum.

We calculated broadsense heritabilities (H2) for Experiment II on a line mean-basis

rH

egeg

g

/)( 222

2

2

where 2

g is the genotypic variance,

2

ge is the genotype environment interaction variance, and

2

e is the experimental error variance divided by the number of replicates (r = 9). We used the

MIXED procedure of SAS to fit a linear random-effect model for the estimation of the variance

components (Littel et al. 1996). All data for both Experiments 1 and 2 are available at

www.panzea.org.

Results

Experiment I: To test whether the tb1 control region identified by Clark et al. (2006) is

sufficient to explain all of the phenotypic effects observed when a teosinte segment of the long

arm of chromosome 1 is introgressed into W22, we analyzed an F2 family from an I01 (full

introgression segment) I16 (tb1 control region only) cross (Figure 1). A general linear model

was used to compare the effects among the genotypic classes in this family (Table 1). For plant

57

Table 1: Experiment I results: the comparison of introgressed segment I01 to I16

Trait Additive Effects P-Value Units

CUPR -1.1044 <0.0001 Count

ED -1.7403 <0.0001 mm

LBIL -0.0620 0.4600 cm

TILL 0.0042 0.9344 Ratio

TILN -0.0612 0.2402 Count

58

architecture (branching) traits (LBIL, TILL, and TILN), we could not reject the null hypothesis

that I01 and I16 have equal effects on phenotype, indicating that there are no additional QTL for

these traits beyond the control region identified by Clark et al. (2006). However, for ear

morphology traits (CUPR and ED), I01 and I16 have significantly different phenotypic effects.

Thus, there must be QTL in addition to the tb1 control region for ear traits.

Experiment II: Quantitative trait variation. Given that Experiment I indicated that there are one

or more ear trait QTL linked to the tb1 control region, we attempted to map these QTL using a

set of 153 NIRILs in Experiment II. These lines were grown in a randomized block design with

three blocks and one plot of each line per block. The least-squares means for each trait for each

NIRIL were estimated using a mixed linear model. The heritabilities of the traits are generally

high with all values being greater than 0.7 (Figure 2).

Histograms of the trait distributions show a large degree of separation between the

phenotypic means for the two parental lines for all traits except EL (Figure 2). For example, for

TILN, the maize parent has a mean value of approximately 0.5 tillers, while the teosinte parent

has a value of 2 tillers. For all traits, the mean values for the maize parental line was located

toward the edge of the trait distributions representing more maize-like phenotypes, while the

mean values for the teosinte parental line was associated with more teosinte-like phenotypes. The

trait distributions tend to be somewhat bimodal and/or skewed (Figure 2). 10KL has a distinctly

bimodal distribution while other traits are more weakly bimodal (CUPR, LBIL, and TILL). For

traits with a bimodal distribution, the means for the maize and teosinte parental lines are each

located at one of the two modes of the distribution. In all cases the trait distributions are skewed

toward teosinte-like phenotypic values. This skew toward teosinte-like phenotypes occurs due to

the excess of NIRILs with the maize genotype in the NIRIL population. For example, 44 NIRILs

59

Figure 2: Frequency distribution of nearly isogenic recombinant inbred lines (NIRILs) least-

squares means of the eight traits measured in this study. The arrows and black bars indicate the

bin containing the parental lines: maize inbred W22 (W) and introgression line W22-T1L (T).

Heritabilities were calculated on a plot-bases for each trait. Traits are abbreviated as follows: 10-

kernel length (10KL, in mm), cupules per rank (CUPR), ear diameter (ED, in cm), ear length

(EL, in cm), lateral branch internode length (LBIL, in cm), staminate spikelets (STAM, percent),

tillering (TILL), and tiller number (TILN).

60

15

10

5

0 1 2 3Tillering (ratio)

TILL

H2 = 0.7615

10

5

0 1 2 3Tiller number (count)

TILN

H2 = 0.74

6 8 10 12

20

15

10

5

Lateral branchinternode length (cm)

LBIL

H2 = 0.91

0 10 20 30 40 50

150

100

50

Percent staminatespikelets

STAM

H2 = 0.84

30

20

10

12 14 16Ear length (cm)

EL

H2 = 0.73

30

20

10

30 35 40Ear diameter (mm)

ED

H2 = 0.94

35

25

15

40 50 60Length of ten kernels (mm)

5

10KL

H2 = 0.95

25

15

5

25 30 35Cupules per rank (count)

CUPR

H2 = 0.83

61

were recovered that genotyped maize at all 25 markers, whereas only two NIRILs were

recovered that genotyped teosinte throughout the region.

Ear length (EL) is the one trait for which the maize and teosinte parental lines are the

least differentiated (Figure 2). This is because ear length is a composite of two other traits – the

number of kernels or cupules along the length of the ear (CUPR) and the length of each cupule or

kernel (10KL). For CUPR, the maize parent line has a larger number of cupules (kernels) than

the teosinte parent line, contributing to a longer ear relative to teosinte. However for 10KL, the

maize parent line has less elongated cupules, giving it a shorter ear relative to teosinte. Thus,

overall the maize and teosinte parent lines have ears that are roughly equivalent in length but

with different underlying morphological bases.

QTL mapping. We identified 12 QTL for the eight traits in the 63.1 cM region on

chromosome 1 (Figure 3, Table 2). The LOD thresholds (P=0.01) for QTL detection were

between 2.42 and 2.58, depending on the trait. All 12 QTL have associated LOD scores of 5.5 or

greater, thus they have strong statistical support. For five of the eight traits (EL, LBIL, STAM,

TILL, and TILN), a single QTL was detected, while for three traits (10KL, CUPR, and ED) two

or more QTL were detected. Significant interaction effects were also detected for the two QTL

controlling 10KL and ED. The R2 values for the genetic models for the traits range from 0.15 to

0.88. In most cases, the model R2 values correspond closely to the H

2 values. For example, R

2 vs.

H2 are 0.88 vs. 0.95 for 10KL, 0.69 vs. 0.83 for CUPR, 0.73 vs. 0.94 for ED, and 0.70 vs. 0.76

for TILL. This correspondence indicates that the detected QTL and interactions explain all or

most of the heritable variation among the NIRILs.

Single QTL were identified for five of the eight traits analyzed: EL, LBIL, STAM, TILL,

and TILN. Four of the five single QTL (lbil1.1, stam1.1, till1.1, tiln1.1) have 1.5 LOD intervals

62

Figure 3: Map of the 12 QTL detected in this study on chromosome arm 1L. Horizontal bars for

each QTL represent the 1.5 LOD support interval and the narrow vertical line marks the position

of the peak LOD score: black-bars indicate additive QTL and grey-bars indicate QTL with

interactions. The red line marks the position of tb1. QTL names are based upon the trait name

abbreviations followed by the chromosome number; the numbers after the period enumerate the

QTLs detected for each trait. Traits are abbreviated as follows: 10-kernel length (10KL, in mm),

cupules per rank (CUPR), ear diameter (ED, in cm), ear length (EL, in cm), lateral branch

internode length (LBIL, in cm), staminate spikelets (STAM, percent), tillering (TILL), and tiller

number (TILN). The genetic map below the QTL plot indicates the extent of the introgressed

W22-T1L segment. The position of each marker locus is shown in cM.

63

64

Table 2: Experiment II results: QTL summary data

QTL Position

(cM)

LOD

Score

CI (cM) Additive

Effect

Units LOD

Cutoff

R2 H2

10kl1.1 40.25 24.9 39.00 - 41.25 3.5 mm 13.5

10kl1.2 46.25 26.1 45.75 - 46.75 6.0 mm 14.5

10kl1.1:2 9.8 6.6 mm 4.2

10KL_Model 70.1 16.1 mm 2.58 87.9 0.95

cupr1.1 29.00 6.5 22.50 - 33.25 -1.7 Count 6.8

cupr1.2 46.50 26.3 45.25 - 49.25 -3.5 Count 38.1

CUPR_Model 38.4 -5.2 Count 2.51 68.5 0.83

ed1.1 8.50 9.3 0.00 - 11.75 -1.7 mm 8.8

ed1.2 31.00 10.1 28.00 - 34.25 -1.4 mm 9.7

ed1.3 45.00 22.5 44.25 - 46.75 -2.7 mm 26.5

ED1.2:3 5.2 -2.4 mm 4.6

ED_Model 43.1 -8.2 mm 2.45 72.7 0.94

el1.1 23.75 5.5 21.75 - 28.00 -0.8 cm 2.45 15.3 0.73

lbil1.1 45.00 36.5 44.25 - 45.50 2.4 cm 2.42 66.7 0.91

stam1.1 39.50 13.6 37.25 - 45.50 10 Percent 2.45 31.5 0.84

till1.1 45.25 40.2 44.50 - 46.25 1.3 Ratio 2.56 70.2 0.76

tiln1.1 45.50 37.1 44.50 - 46.50 1.2 Count 2.42 67.2 0.74

65

that include tb1 (Figure 3). The QTL for EL (el1.1) is located 21 cM upstream of tb1and its 1.5

LOD support interval is well separated from tb1. The single QTL at tb1 for LBIL, TILL, and

TILN all have relatively large effects with large R2 and H

2 values (Table 2, Figure 3). The

position and effect of lbil1.1, till1.1, and tiln1.1, suggest that tb1 explains all or most of the

genetic variation for these traits. These three large effect single QTL over tb1 all pertain to plant

architecture traits. The remaining five traits are not governed by a single QTL at tb1 and these

five traits are all ear traits. These results indicate that large effect QTL at tb1 accounts for all of

the variation for plant traits among these lines, although ear traits have a more complex genetic

architecture. These results are consistent with the results of Experiment I.

Multiple QTL were identified for 10KL, CUPR, and ED (Table 2, Figure 3). In all cases,

the multiple QTL for a single trait act in the same direction with the maize alleles contributing to

a maize-like phenotype and the teosinte alleles to a teosinte-like phenotype. For two traits (10KL

and ED), significant interaction effects were identified between QTL. For all traits with multiple

QTL, the QTL with the largest LOD score for each trait had a 1.5 LOD interval that includes, or

is less than 1 cM away from, tb1. For example, ed1.3, which falls directly over tb1, has a large

LOD score (22.5), while the other two QTL for ED have much smaller LOD scores (10.1 and

9.3). Thus, these data suggest that tb1 is the major QTL for 10KL, CUPR, and ED, even if there

are other QTL within the introgressed segment.

Refining QTL positions. For 10KL and CUPR, the largest effect QTL falls near tb1 but

tb1 lies outside the 1.5 LOD support interval. Since there are two QTL for each of these traits,

we reassessed whether the presence of multiple QTL was biasing the estimates of the QTL

positions. We subdivided the dataset to fix one of the QTL for a single genotype (maize or

teosinte) and then scanned the segregating region that remained for QTL. By scanning for QTL

66

with these subsets of the data, we can reevaluate whether there are two QTL in the positions

indicated by our initial analysis.

For 10kl1.1, two subsets of the data were analyzed: lines fixed for the maize allele of

10kl1.2, and lines fixed for the teosinte allele of 10kl1.2. When 10kl1.2 is fixed for the teosinte

allele, 10kl1.1 is still detected and in the same position (Table 3). When 10kl1.2 is fixed for the

maize allele, 10kl1.1 is not detected. This result was not unexpected because of the large

interaction term between 10kl1.1 and 10kl1.2. These results indicate that 10kl1.1 is real but only

has an effect on phenotype when the teosinte allele is present at 10kl1.2 due to an epistatic

interaction. Thus, 10kl1.2 is epistatic to 10kl1.1. This epistatic interaction is plainly visible when

the mean 10KL values for the different two-locus genotypic classes are compared (Figure 4A).

For 10kl1.2, two subsets of the data were analyzed: lines fixed for the maize allele at

10kl1.1, and lines fixed for the teosinte allele at 10kl1.1. When 10kl1.1 is fixed for the teosinte

allele, 10kl1.2 is still detected and in the same position (Table 3). When 10kl1.1 is fixed for the

maize allele, 10kl1.2 is still detected but it is shifted in position to fall over tb1. Thus, the

presence of 10kl1.2 is confirmed, and this analysis shows that the effects are independent of the

allelic composition at 10kl1.1. However, the conflicting results on its position indicate some

uncertainty about its exact location. One possibility is that 10kl1.2 is located at tb1.

For cupr1.1, two subsets of the data were analyzed: lines fixed for the maize allele of

cupr1.2, and lines fixed for the teosinte allele of cupr1.2. When cupr1.2 is fixed for the teosinte

allele, cupr1.1 is still detected but it is shifted in position to be over ed1.2 (Table 3). When

cupr1.2 is fixed for the maize allele, cupr1.1 is not detected. This result was not surprising

because an interaction term between cupr1.1 and cupr1.2 was nearly significant in the original

analysis (P-value of 0.0106 with a 0.01 cutoff). These results indicate that cupr1.1 is real but

67

Table 3: Experiment II reanalysis: Refined QTL positions

QTL Fixed Markera

Refined

Position (cM)

Original

Position (cM)

LOD

Scoreb

Refined CI

(cM)

Original CI

(cM)

10kl1.1 PZD00119-T 40.38 40.25 10.0 38.64 - 41.48 39.00 - 41.25

10kl1.1 PZD00119-M - 40.25 - - 39.00 - 41.25

10kl1.2 umc1298-T 46.23 46.25 9.2 45.73 - 46.93 45.75 - 46.75

10kl1.2 umc1298-M 45.37 46.25 11.0 42.24 - 51.63 45.75 - 46.75

cupr1.1 PZD00119-T 30.56 29.00 4.1 25.16 - 35.33 22.50 - 33.25

cupr1.1 PZD00119-M - 29.00 - - 22.50 - 33.25

cupr1.2 umc1914-T 48.99 46.50 12.8 45.79 - 51.78 45.25 - 49.25

cupr1.2 umc1914-M 46.18 46.50 18.9 44.43 - 49.20 45.25 - 49.25

a "M" indicates that the marker was fixed for the maize allele and "T" indicates that the marker

was fixed for the teosinte allele.

bLOD scores obtained with a subset of the full data in which one of the two QTL affecting the

trait was fixed for a single genotype.

68

Figure 4: Mean phenotypic values of four genotypic classes. The x-axis denotes the number of

lines representing each genotypic class (N) and the alleles (maize: M, teosinte: T) for the closest

marker to the QTL effecting the trait and tb1 respectively. A and C (etb1.2) closest marker is

umc1298. B and D (etb1.1) closest marker is PZD00116. Eight of the 153 lines had missing data

for PZD00116 and were not included. Error bars represent the standard error for each genotypic

class. Traits are abbreviated as follows: 10-kernel length (10KL, in mm), cupules per rank

(CUPR), ear diameter (ED, in cm), staminate spikelets (STAM, percent).

69

A.

MM TM MT TTGenotype

42

44

46

48

50

52

5410kl1.1 (etb1.2)10kl1.2 (tb1)

B.

26

27

28

29

30

31

32

MM TM MT TT

cupr1.1 (etb1.1)cupr1.2 (tb1)

C.

0

2

4

6

8

10

12stam1.1 (etb1.2)tb1

33

34

35

36

37

38

39D.

ed1.1 (etb1.1)ed1.2 (tb1)

N 96 4 9 44 80 18 15 32

MM TM MT TTGenotype MM TM MT TT

N 96 4 9 44 80 18 15 32

70

only has an effect on phenotype when the teosinte allele is present at cupr1.2 because of an

epistatic interaction between these two QTL. This epistatic interaction is plainly visible when the

mean CUPR values for the different two-locus genotypic classes are compared (Figure 4B).

For cupr1.2, two subsets of the data were analyzed: lines fixed for the maize allele at

cupr1.1, and lines fixed for the teosinte allele at cupr1.1. When cupr1.1 is fixed for the teosinte

allele, cupr1.2 is still detected and it is located in the same position (Table 3). When cupr1.1 is

fixed for the maize allele, cupr1.2 is still detected but it is shifted in position to fall over tb1.

Thus, the presence of cupr1.2 is confirmed, and this analysis shows that the effects are

independent of the allelic composition at cupr1.1. However, the conflicting results on its position

indicate some uncertainty about its exact location. One possibility is that cupr1.2 is located at

tb1.

We also reassessed the position of stam1.1. The 1.5 LOD interval for this QTL includes

tb1; however, the maximum LOD is located near 10kl1.1. We evaluated whether a model

involving two linked QTL for STAM would best explain the data. Since tb1 was expected to

affect STAM based on the known effects of the tb1 mutant allele (Doebley et al. 1997), we

considered a model with one QTL at tb1 and a second QTL at the position of the LOD maximum

for stam1.1. The original analysis may have failed to define two separate QTL because of their

proximity to one another. We examined the mean values for STAM of the four genotypic

combinations of stam1.1 and tb1 (Figure 4C). From this figure, stam1.1 only has an effect on

phenotype when there is a teosinte allele at tb1. However, tb1 has a strong effect on phenotype

whether stam1.1 is fixed for the maize or the teosinte allele. The highest value for STAM is

obtained when there are teosinte alleles at both tb1 and stam1.1. These results suggest that there

are two QTL interacting to control STAM: stam1.1 with an effect that is dependent on the

71

teosinte allele at tb1; and tb1 with an effect regardless of the genotype of stam1.1. Thus, tb1 is

epistatic to stam1.1.

Discussion

Clark et al. (2006) studied how a ~54 cM teosinte chromosome segment encompassing the tb1

gene affected plant and ear architecture when it was introgressed into maize inbred W22. Their

analyses enabled them to map a factor controlling these phenotypes to a region between ~58-69

kb upstream of the tb1 open reading frame. Their experiments demonstrated that this “control

region” has strong effects on phenotypes, but they did not formally exclude the possibility that

there are other linked QTL in the introgressed teosinte chromosome segment.

A closer examination of the results by Clark et al. (2006) suggests that there may be other

QTL linked to tb1. Their results do indicate the tb1 control region explains all effects on plant

architecture. For example, their full ~54 cM (~59 Mbp) introgression segment (I01) has effects

on plant architecture that are indistinguishable from those of a partial <1 cM introgression

containing only ~69 kb surrounding the tb1 control region (I16). However, for traits related to

ear architecture, their results appear more complex. For example, their smaller introgression

(I16) appears to have a weaker effect on CUPR than their full ~54 cM introgression. In general,

their introgression lines containing larger segments of the teosinte genome appear to have

stronger effects on ear traits (CUPR and 10XCUP) than their introgression lines possessing

smaller introgressed segments that are shortened on either the proximal or distal side of the tb1

control region. These observations suggest that there are additional QTL linked to tb1 with

72

effects on ear traits. However, due to their experimental design, a direct comparison of

introgressed segments could not be made.

To determine if there are additional QTL for plant and ear architecture linked to tb1, we

performed an experiment (Experiment I) to test whether a minimal introgression of the tb1

control region (I16) was sufficient to produce the same phenotypes as a full introgression

segment (I01) that extended both proximal and distal to tb1. The results of Experiment I showed

no difference among the genotypic classes in the F2 population derived from the I01 I16 cross

for plant architecture phenotypes (LBIL, TILL, and TILN). This result indicates that the control

region identified by Clark et al. (2006) is the only QTL for plant architecture located in the

introgressed chromosome segment. However, the three genotypic classes in the F2 population did

differ from one another for the ear morphology phenotypes (ED and 10KL). Thus, Experiment I

indicates that there are additional QTL linked to the tb1 control region that affect ear

morphology.

To map these additional QTL, a second experiment (Experiment II) was done using a set

of NIRILs. These lines contained recombinant chromosomes with cross-overs throughout the

region, giving us the ability to map QTL to relatively small intervals. The replicated design of

the experiment gave relatively high heritabilities for the traits, providing power to detect QTL

with modest effects. Because our study used lines that are isogenic except for the ~63 cM region

surrounding tb1, there were no QTL segregating in other regions of the genome that could

complicate our ability to detect QTL near tb1. The analysis of these NIRILs confirmed that tb1 is

a large effect QTL for seven of the eight traits analyzed (10KL, CUPR, ED, LBIL, STAM, TILL,

and TILN). In particular, our results indicate that tb1 is the only QTL for plant architecture traits

including: LBIL, TILL, and TILN. These results are consistent with previous studies (Doebley et

73

al. 1997; Clark et al. 2006). However, our analysis also detected several additional linked QTL

located proximal to tb1, two of which interact epistatically with tb1. These additional QTL only

affect ear traits (10KL, CUPR, ED, EL, and STAM).

Based on the results of Experiments I and II, we proposed a model for the number and

positions of QTL in the introgressed segment (Figure 5). This model assumes that tb1 and its

neighboring QTL have pleiotropic effects on multiple traits. From prior work, it is known that

tb1 has pleiotropic effects on 10KL, CUPR, LBIL, STAM, TILL, and TILN (Doebley et al.

1997; Clark et al. 2006). Our data confirm these observations as we detected pleiotropic effects

of a QTL at tb1 on all these traits as well as ED. Thus, we hypothesize that tb1 is a QTL for

seven traits (Figure 5). Our analyses reveal another QTL 14 cM proximal of tb1 with effects on

CUPR and ED, and which interacts epistatically with tb1. We designate this QTL enhancer of

tb1.1 (etb1.1). Our analyses also revealed another QTL 6 cM proximal of tb1 with effects on

10KL and STAM, and which interacts epistatically with tb1. We designate this QTL enhancer of

tb1.2 (etb1.2). The epistatic interaction of tb1 with both etb1.1 and etb1.2 is plainly visible in

Figure 4. These results suggest the epistatic interaction between tb1 and etb1.2 (Figure 4A, C) is

stronger than the interaction between tb1 and etb1.1 (Figure 4B, D). Two additional QTL exist in

the introgressed segment: ed1.1 and el1.1. These two QTL each affect a single trait (ED and EL,

respectively) and neither shows an epistatic interaction with tb1. Together these five QTL

explain the maize-like versus teosinte-like phenotypes of the two parental lines (W22 and W22-

T1L).

The data from Clark et al. (2006) also suggest the presence of additional QTL effecting

CUPR downstream of tb1. For example, introgression lines containing the full teosinte

74

Figure 5: Map of the five QTL in our working model. Arrows indicate estimated positions of

each QTL. Traits listed correspond to the phenotypes that map to each QTL. Flanking markers

are included for reference. Traits are abbreviated as follows: 10-kernel length (10KL, in mm),

cupules per rank (CUPR), ear diameter (ED, in cm), ear length (EL, in cm), lateral branch

internode length (LBIL, in cm), staminate spikelets (STAM, percent), tillering (TILL), and tiller

number (TILN).

75

76

introgressed segment (I01) have a strong effect on CUPR, while lines with the maize allele

downstream of tb1 have a weaker effect. An additional QTL downstream of tb1 contributing to

CUPR may be the reason that cupr1.2 was not located directly over tb1 in our experiment, but

instead peaked distal to tb1 (Figure 3). It is possible that our analysis did not identify a distal

QTL because of its proximity to tb1, and/or its effect size on CUPR.

Two QTL (etb1.1 and etb1.2) identified in our experiments interact epistatically with tb1

(Figure 4). Such epistatic interactions are generally difficult to detect in QTL mapping studies

(Mackay et al. 2009), and thus the amount of epistasis detected in QTL mapping experiments

varies from study to study (Flint and Mackay 2009). A QTL mapping experiment for flowering

time in maize demonstrated that epistasis has a negligible effect on this trait, while other

examples in the literature from Arabidopsis, flies, mice, and rice show large epistatic effects for

various traits (Buckler et al. 2009; Flint and Mackay 2009).

There are at least two reasons that we were able to detect epistatic QTL. First, our

experiments focused on a relatively small genomic region. Thus, we did not suffer the loss of

statistical power that comes along with performing a large number of pair-wise tests of epistasis

as occurs with whole-genome scans for epistasis (Holland 2007). Second, the epistatic

interactions detected in our analyses have relatively large effect sizes so that relatively little

statistical power is needed to reject a false null hypothesis (Table 2). It may also be important

that maize and teosinte diverged 10,000 generation ago and maintain separate gene pools and

evolutionary trajectories. Thus, over time, maize and teosinte may have been selected for specific

combinations of alleles at multiple loci, one combination adapted to natural conditions and the

other to agricultural circumstances.

77

Both experiments I and II support the hypothesis that there are additional QTL linked to a

major domestication locus (tb1). We detect these additional QTL in our teosinte × W22 mapping

populations. It is unknown whether these QTL were involved in maize domestication or simply

differentiate the maize inbred W22 and our specific teosinte parents. We do not know if these

QTL would have been detected had we used a different modern maize inbred or even a primitive

maize variety. To address this possibility, we are currently attempting to clone etb1.2. Once the

gene underlying etb1.2 has been identified, we will have a critical tool for investigating its

potential role in maize domestication and its interaction with tb1.

78

References

Broman K.W., H. Wu, S. Sen and G.A. Churchill, 2003 R/qtl: QTL mapping in experimental

crosses. Bioinformatics 19: 889-890.

Buckler, E. S., J. B. Holland, P. J. Bradbury, C. Acharya, P. J. Brown et al., 2009 The genetic

architecture of maize flowering time. Science 325: 714–718.

Clark, R, T. Nussbaum-Wagler, P. Quijada and J. Doebley, 2006 A distant upstream enhancer at

the maize domestication gene, tb1, has pleiotropic effects on plant and inflorescence

architecture. Nature Genetics 38: 594-597.

Doebley, J. and A. Stec, 1991 Genetic analysis of the morphological differences between maize

and teosinte. Genetics 129: 285-295.

Doebley, J. and A. Stec, 1993 Inheritance of the morphological differences between maize and

teosinte: comparison of results for two F2 populations. Genetics 134: 559-570.

Doebley, J., A. Stec and C. Gustus, 1995 teosinte branched1 and the origin of maize: evidence

for epistasis and the evolution of dominance. Genetics 141: 333-346.

Doebley, J., A. Stec and L. Hubbard, 1997 The evolution of apical dominance in maize. Nature

386: 485-488.

Doerge R. W. and G. A. Churchill, 1996 Permutation tests for multiple loci affecting a

quantitative character. Genetics 142: 285-294.

Flint, J., and T. F. C. Mackay, 2009 Genetic architectures of quantitative traits in flies, mice and

human. Genome Research. 19: 723–733.

Haley, C. S. and S. A. Knott, 1992 A simple regression method for mapping quantitative trait

loci in line crosses using flanking markers. Heredity 69: 315–324.

79

Holland, J. B., 2007 Genetic architecture of complex traits in plants. Current Opinion in Plant

Biology 10: 156-161.

Lander E.S. and D. Botstein, 1989 Mapping Mendelian factors underlying quantitative traits

using RFLP linkage maps. Genetics 121: 185-199.

Littel, R.C., G.A. Milliken, W.W. Stroup and R.D. Wolfinger, 1996 SAS system for mixed

models. SAS Institute, Cary, NC.

Mackay, T. F. C., E. A. Stone and J. F. Ayroles, 2009 The genetics of quantitative traits:

challenges and prospects. Nature Reviews Genetics 10: 565-577.

Noor, M. A. F., A. L. Cunningham and J. C. Larkin, 2001 Consequences of recombination rate

variation on quantitative trait locus mapping studies: simulations based on the Drosophila

melanogaster genome. Genetics 159: 581–588.

80

Table S1: RFLP Markers used during backcrossing of T1L in Experiment II

Marker Chromosome Marker Chromosome

bnl5.62 1 umc2a 3

umc157 1 php20725 4

umc37b 1 umc19 4

npi255 1 umc127a 4

BZ2 1 bnl10.17b 4

bnl8.10 1 umc15 4

npi615 1 bnl8.23 4

umc107 1 bnl8.33 5

npi225 1 bnl6.25 5

bnl8.45 2 umc90 5

umc53 2 umc27 5

npi320 2 umc166 5

npi421 2 bnl7.71 5

umc6 2 npi412 5

umc34 2 umc54 5

umc134 2 umc127b 5

umc131 2 umc104a 5

umc2b 2 bnl6.29 6

umc5a 2 umc65 6

php20005 2 umc21 6

umc122 2 umc46 6

umc49a 2 umc132 6

umc36 2 umc62 6

umc32 3 npi114 8

umc121 3 bnl9.11 8

php20042 3 umc117 8

umc42b 3 umc7 8

umc161 3 npi253 9

umc18 3 umc113 9

TE1 3 umc81 9

bnl5.37 3 umc95 9

bnl8.01 3 bnl3.04 10

umc60 3 umc130 10

bnl12.97 3 umc49b 10

php10080 3 umc117b 10

npi425 3 bnl7.49 10

81

Chapter 3

Evidence for a natural allelic series at the maize domestication gene

teosinte branched1

82

Abstract

Despite numerous quantitative trait loci and association mapping studies, our understanding of

the extent to which natural allelic series contribute to the variation of complex traits is limited. In

this study, we investigate the occurrence of a natural allelic series for complex traits at the

teosinte branched1 (tb1) gene in natural populations of teosinte (Zea mays ssp. parviglumis, Z.

mays ssp. mexicana, and Z. diploperennis). Previously, tb1 was shown to confer large effects on

both plant architecture and ear morphology traits. tb1 has been studied extensively as a key gene

involved in the domestication of maize from teosinte; however, the effect of tb1 on trait variation

in natural populations of teosintes has not been investigated. We compare the effects of nine

teosinte alleles of tb1 that were introgressed into an isogenic maize inbred background. Our

results provide evidence for a natural allelic series at tb1 for several complex morphological

traits. The teosinte introgressions separate into three distinct phenotypic classes, which

correspond to the taxonomic origin of the alleles. The effects of the three allelic classes also

correspond to known morphological differences between the teosinte taxa. Our results suggest

that tb1 contributed to the morphological diversification of teosinte taxa as well as to the

domestication of maize.

83

Introduction

Over the past several decades, there has been considerable interest in the genetic architecture of

trait variation in natural populations as defined by number of genes involved and the effect sizes

of these genes (Tanksley 1993; Mackay 2001). A key component of this issue is how variation is

structured at individual genes. Are genes typically biallelic, like Mendel’s classic loci, or do

genes often harbor “allelic series,” i.e. multiple alleles with measurably different effects on

traits? While allelic series are known for pigmentation and other simple phenotypic traits, such

as the extension allelic series controlling coat color in rabbits (Fontanesi et al. 2006), allelic

series for complex morphological traits are not well-documented. The unambiguous

documentation of a natural allelic series for complex traits would further the understanding of the

genetic architecture of variation in natural populations.

Maize and its wild relatives, the teosintes, are an attractive system for the study of natural

variation and complex traits. Maize and the teosintes belong to the genus Zea which has four

species that are native to Mexico and Central America: Z. perennis, Z. luxurians, Z.

diploperennis and Z. mays (Doebley and Iltis 1980). The latter species includes four subspecies:

one for domesticated maize (ssp. mays) plus three subspecies for teosinte (sspp. parviglumis,

mexicana and huehuetenangensis), each with a distinct eco-geographic distribution. Of these

three wild subspecies, ssp. parviglumis has been identified as the wild progenitor of maize

(Doebley 2004). Since these teosinte taxa are interfertile with maize, one can leverage the

genetic tools of maize to study variation in teosinte. Some of these teosinte taxa are widespread

and contain abundant natural genetic variation. The teosintes are an appealing gene pool in

which one could search for natural allelic series for complex traits.

84

Among the ~35,000 maize genes, an attractive candidate for the study of natural allelic

series is teosinte branched1 (tb1). This gene controls plant architecture (apical dominance) and

ear morphology (Doebley et al. 1997). tb1 is a member of the TCP family of transcription factors

(Cubas et al. 1999), and it is one of the key genes involved in the domestication of maize

(Doebley 2004). During maize domestication, ancient farmers selected an allele of tb1 that is

expressed about twice as strongly as most teosinte alleles. The factor controlling this difference

in gene expression has been mapped to a regulatory region 58 to 69 kb upstream of the tb1 ORF

(Clark et al. 2006). Since teosinte possessed natural allelic variation at tb1 upon which ancient

farmers could apply selection, it seems plausible that teosinte might contain a natural allelic

series at this gene for traits related to plant architecture and ear morphology.

In this paper, we present evidence for a natural allelic series at tb1. We introgressed nine

teosinte chromosomal segments encompassing tb1 into the isogenic background of a maize

inbred line. These tb1 alleles included four from Z. mays ssp. mexicana, four Z. mays ssp.

parviglumis and one Z. diploperennis. We compare the effects of these introgressions to one

another and to a maize reference allele for four morphological traits previously shown to be

controlled by this gene (Clark et al. 2006). We show that the teosinte introgressions separate into

three distinct phenotypic classes and that these classes correspond to the taxonomic origin of the

alleles. Moreover, the effects of the alleles match the known morphological differences between

these taxa. Our results suggest that tb1, which contributed to maize domestication, also played a

role in the morphological divergence of teosinte taxa.

85


Plant materials

Segments of the long arm of chromosome 1 from nine different teosintes (IS1-9, Table S1) were

introgressed into a maize inbred W22 background via six generations of backcrossing. During

the backcrossing process, RFLP markers (NPI615, umc140, tb1, umc107, bnl15.18, kn1)

flanking tb1 were used to follow the target segment. After the 6th

generation of backcrossing, the

BC6 plants were selfed and PCR-based markers were used to map each of the teosinte

introgressed chromosomal segments (Figure 1, Table S2). A population of 120 BC6S1 plants

from each of the nine introgression stocks was grown and genotyped using two PCR-based indel

markers (Table S2). We then selected ~25 plants of each homozygous genotypic class

(homozygous maize, homozygous teosinte) from each of the nine populations for phenotypic

analysis.

Phenotypic data collection and analysis

Plants were grown at the University of Wisconsin West Madison Agricultural Research Station,

Madison, WI, USA during the summer of 2009. BC6S1 plants segregating for the introgressed

teosinte chromosomal segments were planted in a randomized grid with 0.9 meter spacing

between plants in both dimensions. This spacing minimized the degree to which plants shaded

their neighbors. Using BC6S1 plants allowed us to compare individuals containing the

introgressed teosinte chromosomal segments with individuals homozygous for the W22 segment.

Seed for each of the nine populations was obtained from a single ear, thus eliminating any

concern that differences among genotypic classes within a population are due to ear-parent

86

Figure 1: Physical map of the introgression lines. All introgressed segments are drawn to scale,

and vertical dotted lines show AGPv2 reference position (Mb). Shaded areas indicate teosinte

chromosome segments based on taxonomic origin: (blue) Zea diploperennis, (red) Z. mays ssp.

parviglumis, and (green) Z. mays ssp. mexicana; unshaded areas represent maize chromosome

segments. Markers used for genotyping are shown along the chromosomes as solid black lines

and listed in Table S2. The position of tb1 is shown for reference.

87

IS1

IS9

Chromosome 1L

88

effects.

The following five traits were phenotyped: cupules per rank (CUPR; number of cupules

in a single rank from base to the tip of the ear), lateral branch internode length (LBIL; mean

internode length, in cm, of the uppermost lateral branch), tillering (TILL; the ratio of the sum of

tiller heights/plant height), and percent staminate spikelets (STAM; percentage of male spikelets

in the inflorescence). CUPR and STAM were both measured on the uppermost, well-formed

lateral inflorescence (ear) of each plant.

The data were analyzed using the software package JMP IN 4.0.4, for calculating means,

standard errors, ANOVAs, Levene's tests, and principal component analysis (PCA). The PCA

was calculated based on the trait correlation matrix.

Nucleotide sequence analysis

Polymerase chain reaction (PCR) was done using Qiagen Taq DNA Polymerase following the

manufactures instructions and standard methods. One primer set was used to amplify the coding

region (GGACATATGAGTAGGCCACACTCCTCC, GATTTGCAGCTCATCAAGAAA) and

two additional internal primers were used to sequence the PCR product

(TCATGGACAACGATGAGTGG, CCAAGAAAATCGGCCAATAA). Two primer sets were

used to amplify the control region (CGGTCAAAGAGTAGGGCAAG,

GCGTCTGTTCCGCATTCA and ACTCAACGGCAGCAGCTACCTA,

CGTGTGTGTGATCGAATGGT). Sequencing of PCR fragments was done using Applied

Biosystems (ABI) BigDye and an ABI 3730xl DNA Analyzers at the University of Wisconsin

Biotechnology Center DNA Sequencing Facility. Initial alignment of nucleotide sequences was

performed using ClustalW (Thompson et al. 1994) and then finished by hand. Neighbor Joining

89

Trees were constructed in PAUP 4.0b10 (Swofford 2003) using the absolute number of

differences after gaps and missing or ambiguous bases were removed from the alignment.

Results

Allele means and variances: To test each of the tb1 teosinte chromosomal segments for an

effect on phenotype relative to the control W22 chromosome segment, the mean of each

genotypic class for each of the nine introgression lines was plotted for the four phenotypes

(Figure 2): the number of cupules per rank (CUPR), the internode length on the uppermost lateral

branch (LBIL), the amount of tillering (TILL), and the percent staminate spikelets on the primary

lateral inflorescence (STAM). These traits represent ear morphology (CUPR and STAM) and

plant architecture (LBIL and TILL), which are some of the major morphological differences

between maize and teosinte. One of the teosinte introgressed segment (IS6) does not have data

for ear morphology traits because all of the ears (from introgression and control plants) were

sterile (without kernels).

Our initial question was: do the introgressed tb1 teosinte chromosomal segments confer a

different phenotype than the maize (W22) control segment? For cupules per rank (CUPR), an

ANOVA indicates that plants containing a teosinte chromosomal segment have a significant

decrease in the number of cupules compared to plants with a W22 segment (F= 14.43; P-value =

0.0058; Figure 2). This is the expected result, given that teosinte has fewer kernels per ear than

maize. The average additive effect of a teosinte introgressed segment (IS) is -1.8 cupules per

rank with a range from -0.2 for IS4, to -3.4 for IS3 (Figure 3).

The second question we asked was: do teosinte segments confer a different number of

90

Figure 2: Phenotypic means. Points are shaded based on taxonomic origin of the tb1

introgressed segment: (purple) Zea mays ssp. mays control lines, (blue) Z. diploperennis, (red) Z.

mays ssp. parviglumis, and (green) Z. mays ssp. mexicana. Error bars represent the standard error

for each genotypic class. The x-axis shows the introgression segments; the y-axis shows trait

means.

91

1 2 3 4 5 6 7 8 9

26

30

28

32

24

22

1 2 3 4 5 6 7 8 9

4

8

6

10

2

0

4

8

6

10

1 2 3 4 5 6 7 8 9

5

7

9

1 2 3 4 5 6 7 8 90

2

1

3

2.5

0.5

1.5

92

Figure 3: Additive effects. Traits are abbreviated as follows: cupules per rank (CUPR), lateral

branch internode length (LBIL, in cm), staminate spikelets (STAM, percent), and tillering

(TILL). The x-axis shows the introgression segments; the y-axis shows additive effects. Error

bars represent the standard deviation for each genotypic class. Bars are shaded based on

taxonomic origin: (blue) Zea diploperennis, (red) Z. mays ssp. parviglumis, and (green) Z. mays

ssp. mexicana.

93

CUPR

4 2 5 9 7 8 1 3

-2.0

-3.0

-4.0

-1.0

0.0

STAM

4 5 7 9 2 3 8 1

1.0

0.5

0.0

-0.5

1.5

2.0LBIL

5 3 9 6 2 1 4 8 7

6 5 8 4 2 9 3 7 1

TILL1.0

0.5

0.0

0.75

0.25

IS Lines IS Lines

2.0

1.0

0.0

-1.0

3.0

4.0

IS Lines IS Lines

94

cupules per rank relative to one another? An ANOVA indicates significant differences among

the teosinte introgressions (F= 32.42; P-value <0.0001; Figure 2). For example, IS1 has a mean

CUPR of 23.0, while IS4 has a mean CUPR of 29.1. In contrast, two teosinte introgressions (IS2

and IS4) have additive effects statistically equivalent to 0.0, indicating that some teosinte

segments have equivalent effects to the W22 segment. These results suggest that different

introgressed tb1 teosinte chromosomal segments possess distinct genetic factors which confer

different numbers of cupules per rank.

Finally, we asked: do the control plants for different introgressions (i.e. plants

homozygous maize W22 for the segment) confer different numbers of cupules relative to one

another? The expectation is that each of the recovered control lines will be phenotypically

equivalent since they all carry the W22 segment, even though they are products of different

backcrossing populations. Consistent with this expectation, there are no significant differences

among the W22 control lines (F= 1.51; P-value = 0.17). On average, the W22 control lines have

29.8 CUPR with a range of 29.4 for IS7 to 30.5 for IS8. Because there are significant differences

among teosinte introgressions but not among control lines, these results argue that there are

“allelic” differences among teosinte introgressions for CUPR.

A different pattern of variation was observed for the proportion of staminate spikelets

(STAM) in the primary lateral inflorescence (Figure 2). STAM is considered a domestication

trait because a teosinte plant has a primary lateral branch that is tipped in a tassel whereas in

maize this branch is tipped by an ear. The majority of teosinte introgressions and all of the

recovered W22 control lines produce ears with less than 1% staminate spikelets. However, there

are three teosinte introgressions that show an additive effect of greater than 1% staminate

spikelets with IS1 having the highest additive effect of 3% (Figure 3). Despite these observed

95

differences, an ANOVA narrowly failed to support a difference between the teosinte

introgressions and the W22 control lines (F= 4.84; P-value = 0.0637) for STAM. However, an

ANOVA that compares teosinte introgressions with >1% STAM to their matched W22 control

lines showed a significant difference between these groups (F= 117.523; P-value = 0.0004). A

significant difference among teosinte introgressions was also observed (F= 7.13; P-value

<0.0001), and there is no significant variation among the W22 control lines (F= 1.01; P-value =

0.43). Overall, these results reveal significant differences among the lines with teosinte

chromosomal segments but not among control lines, and thus indicate that there are “allelic”

differences among the teosinte introgressions for STAM.

For tillering, plants with a tb1 teosinte chromosomal segment show greater tillering than

the corresponding control plants carrying the W22 segment (Figure 2). This increase in tillering

is consistent with the known difference in tillering between maize and teosinte. An ANOVA

indicates that plants containing a teosinte chromosomal segment have an increase in the amount

of tillering relative to plants with a W22 segment (F= 70.87; P-value <0.0001). The average

additive effect of a teosinte introgressed segment is an increase in tillering by 0.6 with a range of

0.4 for IS6, to 0.7 for IS1. An ANOVA indicates significant differences among the teosinte

introgressions (F= 6.22; P-value <0.0001). For example, IS6 has a mean tillering score of 1.8

while IS3 has a mean tillering score of 2.8 (Figure 2). These results suggest that the different

introgressed tb1 teosinte chromosomal segments possess distinct genetic factors which confer

different amounts of tillering. However, tillering is different from the previous two traits

examined because contrary to expectation, there is considerable heterogeneity among the W22

control lines (F= 5.77; P-value <0.0001). On average, the W22 control lines have a tillering

score of 1.2 with a range of 0.7 for IS7, to 1.5 for IS3 and IS8. These results suggest that there

96

are factors other than tb1 affecting phenotype. Therefore, we cannot conclude that the observed

differences in tillering among the teosinte introgressions are caused by tb1 alone.

Since significant heterogeneity for tillering was observed among the control lines, two

possible explanations were considered for this unexpected result. First, significant phenotypic

differences between control lines could be observed if additional genetic factors segregated

between backcrossing populations at other loci in the genome unlinked to the target segment

encompassing tb1. Such factors would increase (or decrease) the trait mean for both plants with

the introgressed teosinte chromosomal segment and the corresponding control plants. Therefore,

it is important to only compare the phenotypes of plants containing teosinte segments to W22

control lines that originate from the same backcrossing population. Another explanation is that

environmentally determined seed quality differs among the ear-parents for different

introgressions. This is particularly possible since only a single ear parent was used for each

introgression. Ear-parent effects such as seed weight, seed maturity and speed of germination can

influence adult phenotype. Thus, environmentally induced ear-parent effects could account for

the differences seen among the control lines derived from different ears. This result highlights

the importance of only comparing the phenotypes of plants containing a particular teosinte

segment to the W22 control plants derived from the same ear.

Given the heterogeneity among W22 control lines for tillering, we asked: is the variance

among teosinte introgressions greater than among the control lines? This is the expectation if

there are multiple functionally different teosinte alleles at tb1 effecting tillering. To answer this

question we compared the variances among the teosinte introgressions to that among the control

lines for TILL using Levene's test. This test showed an equal variance among teosinte

introgressions and control lines (F= 0.0089; P-value = 0.9262). This result does not support an

97

allelic series at tb1 for tillering because the variances among the different teosinte introgressions

and the control lines are equivalent.

For lateral branch internode length (LBIL), the teosinte introgressions have longer

branches than the maize control lines with one exception – IS5 has branches equivalent in length

to its matched control line (Figure 2). An ANOVA indicates that overall plants containing a

teosinte tb1 chromosomal segment have longer lateral branch internodes than plants with a W22

segment (F= 15.7039; P-value = 0.0026). The average additive effect of a teosinte introgression

segment on internode length is 0.7 cm with a range of -0.1 cm for IS5, to 1.5 cm for IS7. Most

teosinte introgressions confer longer internodes resulting in a longer lateral branch as seen in

teosinte as compared to maize. However as mentioned above, one introgression (IS5) has an

additive effect that is statically equivalent to 0.0. These results suggest that the severity of the

phenotype may vary depending on the specific teosinte chromosomal segment at tb1. An

ANOVA indicates that there are significant differences among lines containing different teosinte

tb1 segments for lateral branch internode length (F= 21.01; P-value <0.0001). However, there is

also a significant difference among W22 control lines (F= 8.04; P-value <0.0001). Thus,

differences among the teosinte introgression lines could be solely the result of ear-parent effects

as discussed above.

Since there were significant differences among W22 control lines for LBIL, we used the

Levene's test to ask whether the variance among teosinte introgressions for LBIL is equivalent to

the variance among the control lines as expected if there is not an allelic series at tb1. This test

indicates that there is greater variance among teosinte introgressions as compared to the control

lines (F= 5.084; P-value = 0.0385), suggesting that the teosinte introgressions may possess

different allelic effects for LBIL. A graph of the additive effects for internode length highlights

98

the small effect of IS5, and the large effect IS7 has on internode length compared to the rest of

the teosinte introgressions (Figure 3).

Allelic Classes: To assess whether the different tb1 teosinte introgressions could be classified

into groups based on phenotype, a principal component analysis was performed using the four

traits as input data. IS6 was not included in the analysis because it lacks data for two of the four

traits. Two components were retained from the analysis, which explain 64% and 27% of the

observed variance, respectively. The ear morphology traits, cupules per rank and staminate

spikelets, load to component 1, which is represented by the x-axis in Figure 4. The plant

architecture traits, tillering and lateral branch internode length, load to component 2, which is

represented by the y-axis in Figure 4. The W22 control point plots to the lower left quadrant of

the graph with distance from this point corresponding to stronger teosinte-like phenotypes

(Figure 4).

The principal component analysis suggests that there are three classes of teosinte

introgressions. The first class is composed of a single introgression (IS5) which plots away from

the rest of the teosinte introgressions and is located in the quadrant containing the W22 control

point. This result suggests that IS5 is a weak "allele" and confers a phenotype that is only

modestly different from the W22 control. This relationship can also be observed by looking at

IS5 for each trait individually (Figures 2-3). The second class is composed of IS2, 4, 7, and 9, all

of which plot to the upper left quadrant (Figure 4). This quadrant represents teosinte

introgressions that have relatively strong effects on plant architecture traits (tillering and lateral

branch internode length), but little effect on ear morphology traits (cupules per rank and

staminate spikelets). The final class is composed of IS1, 3, and 8 and occupies the right half of

the graph along the x-axis (Figure 4). These teosinte introgressions have strong effects on ear

99

Figure 4: Principal components plot. The x-axis shows component 1which represents ear

morphology traits; the y-axis shows component 2 which represents plant morphology traits. Dots

are shaded based on taxonomic origin: (purple) Zea mays ssp. mays, (blue) Z. diploperennis,

(red) Z. mays ssp. parviglumis, and (green) Z. mays ssp. mexicana.

100

IS1 (PAR)

IS2 (MEX)

IS3 (PAR)

IS4 (MEX)

IS5 (DIP)

IS8 (PAR)IS9 (MEX)

W22 (MAY)

1 2

1

2

-1

-2

-1

IS7 (MEX)

Component 1

101

morphology traits as well as on plant architecture traits. In particular, IS1, 3, and 8 have a high

percentage of male spikelets (Figures 2-3).

Strikingly, the PCA reveals that the allelic classes correspond to the taxonomic origin of

each teosinte introgression (Figure 4). The allelic class with the strongest teosinte phenotype

corresponds to introgressions from Z. mays ssp. parviglumis (PAR). The allelic class with

moderate teosinte phenotypes corresponds to introgressions from the Z. mays ssp. mexicana

(MEX). Finally, the allelic class with the weakest teosinte phenotypes corresponds to the

introgression from the species Z. diploperennis (DIP). Thus, the allelic series at tb1 appears to

have a taxonomic basis. Because of the isogenic nature of the introgression lines, the allelic

series is not the result of population structure, but rather a difference at or near tb1.

Although the allele series shows a distinct taxonomic signature, we also asked whether

the allele classes were correlated with the length of the introgressed segments (Figure 1). No

obvious correlation between phenotype and introgression length is observed. For example, the

largest introgression (IS2) does not have the strongest effect on phenotype, nor does the smallest

introgression (IS9) have the weakest effect on phenotype (Figure 3). Moreover, different

introgression lengths are represented in the allelic classes defined in the PCA. This result

supports the conclusion of an allelic series at tb1, as opposed to other linked genes in the

introgressed segments causing the observed allelic differences.

To explore the possibility of a correlation between the nucleotide sequence variation in

tb1 and phenotype, we plotted the phenotypic classes defined by the PCA onto neighbor-joining

trees based upon two portions of the tb1 sequence (Figure 5). One portion is the protein coding

region of the gene and 3’ UTR, and the other corresponds to a known upstream regulatory region

of tb1 (Clark et al. 2006). The teosinte introgressions representing any single class defined by the

102

Figure 5: Phylogenetic trees. (A) A neighbor joining tree based on sequence from the tb1 coding

region. (B) A neighbor joining tree based on sequence from the tb1 upstream control region.

Text color is based on taxonomic origin: (purple) Zea mays ssp. mays, (blue) Z. diploperennis,

(red) Z. mays ssp. parviglumis, and (green) Z. mays ssp. mexicana.

103

B73 (MAY)W22 (MAY)

IS1 (PAR)IS3 (PAR)

IS4 (MEX)

IS5 (DIP)

IS6 (PAR)

IS7 (MEX)

IS8 (PAR)

IS9 (MEX)

IS2 (MEX)

1 change

A

IS2 (MEX)

IS5 (DIP)

1 change

BCoding Region Control Region

104

PCA are scattered across both of the phylogenetic trees, and for the most part, no relationship

between phylogeny and phenotype is apparent. For example, the class representing strong ear

trait phenotypes (IS1, 3, and 8) do not cluster in either phylogeny. One striking feature of both

phylogenies is that IS5, which was derived from a separate species (Z. diploperennis, DIP) and

has unique phenotypic effects, stands apart from all other introgressions in both trees. This result

suggests that the different phenotypes observed for IS5 when compared to the other

introgressions could be due to sequence differences in the upstream control region and/or the

coding sequence of tb1. Neither teosinte introgressions sampled from Z. mays ssp. parviglumis

(PAR) nor Z. mays ssp. mexicana (MEX) clustered on either of the phylogenetic trees.

Discussion

Natural allelic series for simple phenotypic traits such as pigmentation are well documented in

the literature. For example, five alleles have been described at the R locus in maize, which

control plant and kernel pigmentation. Each of these 5 alleles produces a distinct phenotype

based on pigment quantity, spatial patterning in kernels, the timing of pigmentation onset during

development, and which organs are pigmented (kernels, anthers, leafs and/or roots) (Styles et al.

1973). A similar allelic series for pigmentation has been described for the B locus of maize

(Styles et al. 1973; Radicella et al. 1992). Much like these examples from maize, an allelic series

for coat color in mice has been described (Phillips 1966; Jackson 1994). Alleles of the agouti

locus produce distinct coat colors and pattern differences due to factors in both the promoter and

coding region of the gene. Other than pigmentation, allelic series have been described for traits

such as self-incompatibility in plants (Nasralla et al. 1991; Takayama and Isogai 2005).

105

Evidence for natural allelic series for complex or morphological traits has come from

association mapping and QTL studies (Purugganan and Suddith 1998; Todesco et al. 2010;

McKechnie et al. 2010). For example, an allelic series for flowering time was reported among a

diverse set of maize lines which display significant variation in flowering time (Buckler et al.

2009). In this example, statistical evidence for an allelic series is shown; however there is no

formal proof that a single locus with multiple alleles explains the observed phenotypic series

since the occurrence of several tightly linked genes each with two alleles cannot be excluded.

Another concern with evidence for allelic series from QTL and association studies is that the

alleles are each typically characterized in a different genetic background. Thus, it is possible that

the QTL in question has only two alleles which form a large number of apparent allelic classes

based on the background in which they were assayed.

In this paper, we present evidence for a natural allelic series at tb1 for three complex

morphological traits: lateral branch internode length, the number of cupules per rank, and the

number of staminate spikelets (Figures 2-3). Our evidence for allelic series at tb1 largely

eliminates concerns about the influence of genetic background by using isogenic lines. We also

examined the role of linked genes on trait variation associated with tb1 by considering the length

of the introgressed chromosomal segment surrounding tb1 for each of the teosinte introgressions.

We saw no evidence that phenotype is correlated with the length of the introgression segment

(Figures 1, 4), arguing against a role for linked genes contributing to the observed phenotypic

variation. However, ideally, teosinte introgression segments of a uniform length which only

contain the tb1 gene itself should be compared.

The feature that is best correlated with the phenotypic effects of the tb1 alleles that we

examined is the taxonomic origin of these alleles. In a principal components analysis based on

106

phenotype, the eight teosinte introgressions form three classes that correspond to Z. mays ssp.

parviglumis, Z. mays ssp. mexicana and Z. diploperennis (Figure 4). This result not only supports

the existence of an allelic series at tb1, but it also implicates tb1 in the morphological

diversification of these taxa in addition to its role in maize domestication. There are several

enticing correspondences between known morphological differences between these taxa and the

effects associated with the alleles of tb1 we assayed. First, Z. mays ssp. mexicana has more

fruitcases (a greater CUPR value) per ear than either Z. mays ssp. parviglumis or Z.

diploperennis (Iltis and Doebley 1980), and our Z. mays ssp. mexicana alleles have greater

CUPR values than our Z. mays ssp. parviglumis and Z. diploperennis alleles (Figure 3). Second,

Z. diploperennis has shorter lateral branches that are tipped in a mixed male-female inflorescence

unlike other teosintes that have longer lateral branches tipped by tassels (Iltis et al. 1979;

Doebley and Iltis 1980). The one Z. diploperennis allele we assayed has the smallest value for

LBIL (shorter branches) of all nine teosinte alleles assayed (Figure 3).

Given the correlation between taxonomy and allelic effects (Figure 4), we examined the

nucleotide sequences of the control region and coding sequence of tb1 for fixed differences

between taxa that may not have been visible in the phylogenetic trees. No fixed differences were

found between Z. mays ssp. mexicana and Z. mays ssp. parviglumis individuals for either

sequenced region. The Z. diploperennis sequence is highly divergent from the other alleles with

many sequence differences. With such a large number of differences and only a single Z.

diploperennis sample, it is not possible to say which if any are potentially causative. However,

there are two polymorphisms unique to the Z. diploperennis allele of tb1 that cause radical amino

acid changes in the Helix II portion of the TCP domain, which is involved in DNA binding. Both

107

changes are from hydrophobic to hydrophilic amino acids, which could alter protein function.

Further experimentation is needed to test whether these amino acid differences affect phenotype.

In summary, our experiments provide evidence for a natural allelic series at tb1 with effects on

complex morphological traits. It has been previously shown that tb1 played a major role in the

domestication of maize from its wild progenitor, teosinte (Doebley 2004). Since the allelic

classes that we observed at tb1 correspond with taxonomic origin, tb1 may also have played a

role in the morphological diversification of Z. mays ssp. parviglumis, Z. mays ssp. mexicana and

Z. diploperennis. To provide formal proof of the allelic series at tb1 and verify its role in the

divergence of teosinte, the causal polymorphism underlying the phenotypic differences needs to

be identified.

108

References

Buckler, E. S., J. B. Holland, P. J. Bradbury, C. Acharya, P. J. Brown et al., 2009 The genetic

architecture of maize flowering time. Science 325: 714–718.

Clark, R. M., T. Nussbaum Wagler, P. Quijada and J. Doebley, 2006 A distant upstream



Cubas, P., N. Lauter, J. Doebley and E. Coen, 1999 The TCP domain: a motif found in proteins


Doebley, J. F., and H. H. Iltis, 1980 Taxonomy of Zea (Gramineae). I. Subgeneric classification

with key to taxa. Amer. J. Bot. 67: 982-993.

Doebley, J., A. Stec and L. Hubbard, 1997 The evolution of apical dominance in maize. Nature

386: 485-488.


Fontanesi, L., M. Tazzoli, F. Beretti and V. Russo, 2006 Mutations in the melanocortin 1

receptor (MC1R) gene are associated with coat colours in the domestic rabbit

(Oryctolagus cuniculus). Anim. Genet. 37: 489-493.

Iltis, H. H., and J. F. Doebley, 1980 Taxonomy of Zea (Gramineae). II. Subspecific categories in

the Zea mays complex with a generic synopsis. Amer. J. Bot. 67: 994-1004.

Jackson, I. J., 1994 Molecular and developmental genetics of mouse coat color. Annu. Rev.

Genet. 28: 189-217.

Mackay, T. F. C., 2001 The genetic architecture of quantitative traits. Annu. Rev. Genet. 35:

303-339.

109

McKechnie, S. W., M. J. Blacket, S. V. Song, L. Rako, X. Carroll, et al., 2010 A clinally varying

promoter polymorphism associated with adaptive variation in wing size in Drosophila.

Mol. Ecol. 19: 775-784.

Nasrallah, J. B., T. Nishio and M. E. Nasrallah, 1991 The self-incompatibility genes of

Brassica: Expression and use in genetic ablation of floral tissues. Annu. Rev. Plant.

Physiol. Plant. Mol. Biol. 42: 393-422.

Phillips, R. J. S., 1966 A cis-trans position effect at the A locus of the house mouse. Genetics 54:

485-495.

Purugganan, M. D., and J. I. Suddith, 1998 Molecular population genetics of the Arabidopsis

CAULIFLOWER regulatory gene: Nonneutral evolution and naturally occurring variation

in floral homeotic function. Proc. Natl. Acad. Sci. USA 95: 8130–8134.

Radicella, J. P., D. Brown, L. A. Tolar and V. L. Chandler, 1992 Allelic diversity of the maize

B regulatory gene: different leader and promoter sequences of two B alleles determine

distinct tissue specificities of anthocyanin production. Genes Dev. 6: 2152-2164.

Styles, E. D., O. Ceska and K.-T. Seah, 1973 Developmental differences in action of R and B

alleles in maize. Can. J. Genet. Cytol. 15: 59-72.

Swofford, D. L., 2003 PAUP*: Phylogenetic analysis using parsimony (* and other methods),

Version 4.0b10. Sinauer Associates, Sunderland, MA.

Takayama, S., and A. Isogai, 2005 Self-incompatibility in plants. Annu. Rev. Plant Biol. 56:

467-489.

Tanksley, S. D., 1993 Mapping polygenes. Annu. Rev. Genet. 27: 205-233.

110

Thompson, J. D., D. G. Higgins and T. J. Gibson, 1994 CLUSTAL W: improving the sensitivity

of progressive multiple sequence alignment through sequence weighting, position-

specific gap penalties and weight matrix choice. Nucl. Acids Res. 22: 4673-4680.

Todesco, M., S. Balasubramanian, T. T. Hu, M. B. Traw, M. Horton, et al., 2010 Natural allelic

variation underlying a major fitness trade-off in Arabidopsis thaliana. Nature 465: 632-

636.

11

1

Table S1: Introgressed teosinte germplasm

Line Species Subspecies Country State/

Province Population Collector Collection

Lat

Deg

Lat

Min

Long

Deg

Long

Min

IS1 mays parviglumis Mexico Guerrero 1 mile S of Palo Blanco Beadle &

Kato Site 4 17 25 -99 30

IS2 mays parviglumis Mexico Guerrero 30 km S of Chilpancingo Beadle &

Kato Site 2-3 17 12 -99 30

IS3 mays mexicana Mexico Mexico km 43 on hwy from Chalco to

Amecameca Iltis et al. 28622 19 6 -98 42

IS4 mays mexicana Mexico Jalisco 10 km S of Degollado M. Puga 11066 20 22 -102 11

IS5 diploperennis Mexico Jalisco Zarza Mora, 2 km E of Las

Joyas Iltis et al. 1250 19 35 -104 16

IS6 mays parviglumis Mexico Guerrero 1 km N of Mazatlan Beadle &

Kato Site 1 17 30 -99 30

IS7 mays mexicana Mexico Chihuahua Nobogame Beadle s.n. 26 6 -107 0

IS8 mays parviglumis Mexico Guerrero Sites 9-10, Teloloapan-Arcelia

Hwy

Iltis &

Cochrane 81 18 21 -100 12

IS9 mays mexicana Mexico Mexico km 1.8 WSW of Texcoco H. Iltis 28620 19 30 -98 55

112

Table S2: Markers for genotyping

Markers Forward Primer (5’ to 3’) Reverse Primer (5’ to 3’)

umc2569 a

GTGACACCCTAGCCCTCTTAGACA TAGCTGGAGTATGTCGTCTTGGTG

umc2237 a CTCAGCTACAGGAGCGAAGAGG GTCACTGCACGATCCATCACAT

umc1122 a CACAACTCCATCAGAGGACAGAGA CTGCTACGACATACGCAAGGC

umc2396 a TGCATCTTTAGCTACGAGACAACCT TGCATGCATTTTTAGGTTTGGAAT

bngl615 a CTTCCCTCTCCCCATCTCCTTTCCAA GCAACCTGTCCATTCTCACCAGAGGATT

bnlg1025 a TGGTGAAGGGGAAGATGAAG CCGAGACGTGACTCCTAAGC

bnlg1564 a ACGGGAGAACAAAAGGAAGG CTCTCCCTCACATCCGCC

bnlg1629 a GTTGGATGGAAAATTCTAGATCG TTGCGTCATTACAGCAGGAG

bnlg2228 a GCAGCAATCGACACGAGATA CTTGGATCGCACTCCGTC

umc2181 a ATCGGGTCCGGATAGATTTTACAC GTAGCTAGCTTAAGCAGTGCTCCG

mmc0041 a AGGACTTAGAGAGGAAACGAA TTTATCCTTACTTGCAGTTGC

umc1924 a GGATGCGGTCGTACAGTACAAGTAT CTACAACAACTGCTGCTCCCG

umc1991 a GAAATTGATGCAATTCACCCTGAT ATTGAATTGCGTGATGCAAGAGTA

umc1914 a CAACATGAGCGTGCTAAATACTCG ACAGGAACACATGAGGTCATCAAA

umc2047 a GACAGACATTCCTCGCTACCTGAT CTGCTAGCTACCAAACATTCCGAT

umc1298 a AGCTGAACAAAATAAACGGAACGA AGGACAAGAAAAAGAAGAAGCACG

PZD00117.indel1 a CCCGCGGCCCGCCGTCAAGT ATGCGCGGGCAAGCGCACCG

umc1306 a CGAAACAAAACACCCAGCAGTAGT CCAGGATGAATAAATCGTATTGCC

bnlg1502 a AGGTCCTGGCACTAAGAGCA AGAGGTGGTATGATCACCTGG

umc1082 a CCGACCATGCATAAGGTCTAGG GCCTGCATAGAGAGGTGGTATGAT

PZD00101.indel1 a ATCGACCAACCAACTTCTCG GCTTGGCAGTGGGTTAGTGT

umc1726 a GATGAGGAAGAAAAGGGAAAAGGA AGACTCAACCCTAACCCTAATGGG

bnlg1671 a TCACGATCAGCAAGCAATTC CCCCACCAACCTTAGAGTCA

umc1774 a ATGGGACTATGCATGGTATTTTGG TACACCATACGTCACCAGGTTCAC

umc2223 a ACTTCTGCAGAGCGAGCAGG TTTTGGGACTGAAGAAGAAGATCG

umc1500 a TCTCTGACTATTCCACGAGCTCAA CTGGTGCGTGCTACAACTGTG

umc1421 a TGCTACGAACTGGGATACACTCAA AGTGGTGAATGTGCCCTAGGAATA

GS1 b

ACACCGCCACCGACATCT TTGTCCCTGAACGGCCAATA

CR Indel c CGGTCAAAGAGTAGGGCAAG GCGTCTGTTCCGCATTCA

aMarkers used to map the introgressed teosinte segments

bDirectly labeled FAM genescan marker used to genotype IS3 F2 population.

cAgarose gel marker used to genotype all IS F2 populations except IS3.

Documents

THE GENETIC, MOLECULAR, AND EVOLUTIONARY …THE GENETIC, MOLECULAR, AND EVOLUTIONARY DISSECTION OF THE TEOSINTE BRANCHED1 GENE By ... Mary Ann and Terry, whose love and support from