34
The Future of Genomics in the Beef industry Prof Mike Goddard

The Future of Genomics in the Beef industry - c.cld.pwc.cld.pw/99/cms/files/04.15pmGoddard.pdf · Genomics in the Beef industry ... ls h2=0.1 h2=0.3 h2=0.5 h2=0.8. ... DNA technology

Embed Size (px)

Citation preview

Page 1: The Future of Genomics in the Beef industry - c.cld.pwc.cld.pw/99/cms/files/04.15pmGoddard.pdf · Genomics in the Beef industry ... ls h2=0.1 h2=0.3 h2=0.5 h2=0.8. ... DNA technology

The Future of Genomics in the

Beef industry

Prof Mike Goddard

Page 2: The Future of Genomics in the Beef industry - c.cld.pwc.cld.pw/99/cms/files/04.15pmGoddard.pdf · Genomics in the Beef industry ... ls h2=0.1 h2=0.3 h2=0.5 h2=0.8. ... DNA technology

Future developments

More accurate EBVs

Genotype x environment interactions

Payment based on genotype

Multiple uses of DNA

Structural change

Page 3: The Future of Genomics in the Beef industry - c.cld.pwc.cld.pw/99/cms/files/04.15pmGoddard.pdf · Genomics in the Beef industry ... ls h2=0.1 h2=0.3 h2=0.5 h2=0.8. ... DNA technology

More accurate EBVs

Current prediction equations are useful but

just a start

Dairy already has accuracy = 0.8

Can we achieve this for beef?

Page 4: The Future of Genomics in the Beef industry - c.cld.pwc.cld.pw/99/cms/files/04.15pmGoddard.pdf · Genomics in the Beef industry ... ls h2=0.1 h2=0.3 h2=0.5 h2=0.8. ... DNA technology

More accurate EBVs

More animals in the training data

Genome sequence data

Biological knowledge about genes and mutations

Find causative mutations

Better statistical methods

Page 5: The Future of Genomics in the Beef industry - c.cld.pwc.cld.pw/99/cms/files/04.15pmGoddard.pdf · Genomics in the Beef industry ... ls h2=0.1 h2=0.3 h2=0.5 h2=0.8. ... DNA technology

More accurate EBVs

More animals in the training data

Genome sequence data

Biological knowledge about genes and mutations

Find causative mutations

Better statistical methods

Page 6: The Future of Genomics in the Beef industry - c.cld.pwc.cld.pw/99/cms/files/04.15pmGoddard.pdf · Genomics in the Beef industry ... ls h2=0.1 h2=0.3 h2=0.5 h2=0.8. ... DNA technology

Effect of number of animals on

accuracy of prediction equation

0

0.1

0.2

0.3

0.4

0.5

0.6

0.7

0.8

0.9

1

0 2000 4000 6000 8000 10000 12000 14000 16000 18000 20000

Number of individuals in reference population

Accura

cy o

f G

EB

V in u

n-p

henotp

yed indiv

iduals

h2=0.1

h2=0.3

h2=0.5

h2=0.8

Page 7: The Future of Genomics in the Beef industry - c.cld.pwc.cld.pw/99/cms/files/04.15pmGoddard.pdf · Genomics in the Beef industry ... ls h2=0.1 h2=0.3 h2=0.5 h2=0.8. ... DNA technology

More accurate EBVs

More animals in the training data

Holstein experience of accuracy of EBV

3500 bulls +5000 cows

(14,000)

Milk 0.73 0.78

Longevity 0.55 0.60

Page 8: The Future of Genomics in the Beef industry - c.cld.pwc.cld.pw/99/cms/files/04.15pmGoddard.pdf · Genomics in the Beef industry ... ls h2=0.1 h2=0.3 h2=0.5 h2=0.8. ... DNA technology

More accurate EBVs

More animals in the training data

More Australian data BINs

Commercial use of tests

Data from other countries

Canada, USA …

Collaborate with dairy industry

Page 9: The Future of Genomics in the Beef industry - c.cld.pwc.cld.pw/99/cms/files/04.15pmGoddard.pdf · Genomics in the Beef industry ... ls h2=0.1 h2=0.3 h2=0.5 h2=0.8. ... DNA technology

More accurate EBVs

More animals in the training data

Need to use multiple breeds

But

Problem combining data across breeds

Page 10: The Future of Genomics in the Beef industry - c.cld.pwc.cld.pw/99/cms/files/04.15pmGoddard.pdf · Genomics in the Beef industry ... ls h2=0.1 h2=0.3 h2=0.5 h2=0.8. ... DNA technology

More accurate EBVs

Problem combining data across breeds

Training Validation

Within breed prediction

Jersey Holstein

Jersey 0.45 0.14

Holstein 0.17 0.62

Across breed prediction

Jersey + 0.49 0.62

Holstein

Page 11: The Future of Genomics in the Beef industry - c.cld.pwc.cld.pw/99/cms/files/04.15pmGoddard.pdf · Genomics in the Beef industry ... ls h2=0.1 h2=0.3 h2=0.5 h2=0.8. ... DNA technology

Feed conversion efficiency

Chr 1 in Beef (▲) and Dairy (♦)

Page 12: The Future of Genomics in the Beef industry - c.cld.pwc.cld.pw/99/cms/files/04.15pmGoddard.pdf · Genomics in the Beef industry ... ls h2=0.1 h2=0.3 h2=0.5 h2=0.8. ... DNA technology

More accurate EBVs

Page 13: The Future of Genomics in the Beef industry - c.cld.pwc.cld.pw/99/cms/files/04.15pmGoddard.pdf · Genomics in the Beef industry ... ls h2=0.1 h2=0.3 h2=0.5 h2=0.8. ... DNA technology

Breed 1 Breed 2

common + T rare

rare + C common

rare - T common

common - C rare

Page 14: The Future of Genomics in the Beef industry - c.cld.pwc.cld.pw/99/cms/files/04.15pmGoddard.pdf · Genomics in the Beef industry ... ls h2=0.1 h2=0.3 h2=0.5 h2=0.8. ... DNA technology

More accurate EBVs

Genome sequence data

Cost decreased from $1B to $1000

International reference panel

1000 cattle genome project

Page 15: The Future of Genomics in the Beef industry - c.cld.pwc.cld.pw/99/cms/files/04.15pmGoddard.pdf · Genomics in the Beef industry ... ls h2=0.1 h2=0.3 h2=0.5 h2=0.8. ... DNA technology

Why sequence data?

• The causative mutations are in the data set!

• Genomic EBVs – No longer have to rely on LD with SNP

– Higher accuracy of prediction (rare variants)?

– Better persistence of accuracy across generations

– Better prediction across breeds?

• Causal mutations have consistent effects across breeds

Page 16: The Future of Genomics in the Beef industry - c.cld.pwc.cld.pw/99/cms/files/04.15pmGoddard.pdf · Genomics in the Beef industry ... ls h2=0.1 h2=0.3 h2=0.5 h2=0.8. ... DNA technology

1000 Bull genomes project • Sequencing still more expensive than SNP chip genotyping

• Alternative strategy

– Sequence key ancestors and impute genotypes from sequenced

animals into all animals genotyped with SNP chips

• Common need for reference file of sequence

• 1000 bull genomes project

Provide a database of sequenced bulls

Global effort!

Page 18: The Future of Genomics in the Beef industry - c.cld.pwc.cld.pw/99/cms/files/04.15pmGoddard.pdf · Genomics in the Beef industry ... ls h2=0.1 h2=0.3 h2=0.5 h2=0.8. ... DNA technology

10,000 cow genomes project

ATTCTGGGGGCCTTACTCCC

ATTGTGGGGGCCATACGCCC

ATTCTGGGGGCCTTACGCCC

ATTGTGGGGGCCATACTCCC

ATTCTGGGGGCCTTACTCCC ATTGTGGGGGCCATACGCCC

ATTGTGGGGGCCATACTCCC

Page 19: The Future of Genomics in the Beef industry - c.cld.pwc.cld.pw/99/cms/files/04.15pmGoddard.pdf · Genomics in the Beef industry ... ls h2=0.1 h2=0.3 h2=0.5 h2=0.8. ... DNA technology

10,000 cow genomes project

ATTCTGGGGGCCTTACTCCC

ATTGTGGGGGCCATACGCCC

ATTCTGGGGGCCTTACGCCC

ATTGTGGGGGCCATACTCCC

ATTCTGGGGGCCTTACTCCC ATTGTGGGGGCCATACGCCC

ATTGTGGGGGCCATACTCCC

Page 20: The Future of Genomics in the Beef industry - c.cld.pwc.cld.pw/99/cms/files/04.15pmGoddard.pdf · Genomics in the Beef industry ... ls h2=0.1 h2=0.3 h2=0.5 h2=0.8. ... DNA technology

More accurate EBVs

Genome sequence

1000 bull genome sequence project

133 bulls in first run (Holstein and Simmental)

11 fold coverage each

Found

15.8M SNP

1.6M insertions and deletions

Error rate = Disagree with 700k SNP chip = 0.0031

Page 21: The Future of Genomics in the Beef industry - c.cld.pwc.cld.pw/99/cms/files/04.15pmGoddard.pdf · Genomics in the Beef industry ... ls h2=0.1 h2=0.3 h2=0.5 h2=0.8. ... DNA technology

More accurate EBVs

Genome sequence data

Cost decreased from $1B to $1000

International reference panel

1000 cattle genome project

32 Angus and 24 Brahman

Impute sequence from SNP genotypes

Mutations causing variations in the sequence

more accurate and stable EBVs

All your cattle could have their own genome sequence!

Page 22: The Future of Genomics in the Beef industry - c.cld.pwc.cld.pw/99/cms/files/04.15pmGoddard.pdf · Genomics in the Beef industry ... ls h2=0.1 h2=0.3 h2=0.5 h2=0.8. ... DNA technology

More accurate EBVs

Biological information

Which genes affect each trait

eg calpatstatin affects tenderness

Eg SNPs associated with human height are in genes – Known to cause skeletal abnormalities

– Growth hormone pathway

– TGFB pathway (Marfan syndrome)

Which mutations affect the function of the gene

eg mutations that make a protein that doesn’t function

Incorporate into prediction equations

Page 23: The Future of Genomics in the Beef industry - c.cld.pwc.cld.pw/99/cms/files/04.15pmGoddard.pdf · Genomics in the Beef industry ... ls h2=0.1 h2=0.3 h2=0.5 h2=0.8. ... DNA technology

More accurate EBVs

More animals in the training data

Genome sequence data

Biological knowledge about genes and mutations

Find causative mutations

Better statistical methods

Page 24: The Future of Genomics in the Beef industry - c.cld.pwc.cld.pw/99/cms/files/04.15pmGoddard.pdf · Genomics in the Beef industry ... ls h2=0.1 h2=0.3 h2=0.5 h2=0.8. ... DNA technology

Better statistical methods

Accuracy*

BLUP Bayes R

Holstein 0.57 0.62

Jersey 0.43 0.49

* Correlation (GEBV, DYD)

Page 25: The Future of Genomics in the Beef industry - c.cld.pwc.cld.pw/99/cms/files/04.15pmGoddard.pdf · Genomics in the Beef industry ... ls h2=0.1 h2=0.3 h2=0.5 h2=0.8. ... DNA technology

Better statistical methods

Accuracy

BLUP Bayes R

Weight 0.34 0.36

Tenderness 0.19 0.35

Fat depth 0.27 0.26

Page 26: The Future of Genomics in the Beef industry - c.cld.pwc.cld.pw/99/cms/files/04.15pmGoddard.pdf · Genomics in the Beef industry ... ls h2=0.1 h2=0.3 h2=0.5 h2=0.8. ... DNA technology

Genotype by environment interactions

Eg FTO x exercise on fatness in humans

Possible uses

Which Charolais bulls to sell to northern producers?

Which steers to long feed for B3 market?

Page 27: The Future of Genomics in the Beef industry - c.cld.pwc.cld.pw/99/cms/files/04.15pmGoddard.pdf · Genomics in the Beef industry ... ls h2=0.1 h2=0.3 h2=0.5 h2=0.8. ... DNA technology

Payment based on DNA

DNA can predict tenderness

Genotype a mob of cattle and pay on average genotype

predict growth rate, marbling, tenderness, breed

Page 28: The Future of Genomics in the Beef industry - c.cld.pwc.cld.pw/99/cms/files/04.15pmGoddard.pdf · Genomics in the Beef industry ... ls h2=0.1 h2=0.3 h2=0.5 h2=0.8. ... DNA technology

Multiple uses of DNA

Pedigree discovery

multiple sire mate

Detect carriers of abnormalities

eg Pompe’s disease

Genotype for single genes

eg polled

Diagnose breed composition

Calculate EBVs

Page 29: The Future of Genomics in the Beef industry - c.cld.pwc.cld.pw/99/cms/files/04.15pmGoddard.pdf · Genomics in the Beef industry ... ls h2=0.1 h2=0.3 h2=0.5 h2=0.8. ... DNA technology

Polled test

Test Actual

Horned Scurred Polled

PP 1 1 84

PH 24 119 96

PA 2 2 9

HH 235 15 4

HA 9 7 10

AA 2 0 4

(more from John Henshall at Belmont)

Page 30: The Future of Genomics in the Beef industry - c.cld.pwc.cld.pw/99/cms/files/04.15pmGoddard.pdf · Genomics in the Beef industry ... ls h2=0.1 h2=0.3 h2=0.5 h2=0.8. ... DNA technology

Multiple uses of DNA

Pedigree discovery

multiple sire mate

Detect carriers of abnormalities

eg Pompe’s disease

Genotype for single genes

eg polled

Diagnose breed composition

Calculate EBVs

Page 31: The Future of Genomics in the Beef industry - c.cld.pwc.cld.pw/99/cms/files/04.15pmGoddard.pdf · Genomics in the Beef industry ... ls h2=0.1 h2=0.3 h2=0.5 h2=0.8. ... DNA technology

Can we distinguish breeds by SNP genotypes

Page 32: The Future of Genomics in the Beef industry - c.cld.pwc.cld.pw/99/cms/files/04.15pmGoddard.pdf · Genomics in the Beef industry ... ls h2=0.1 h2=0.3 h2=0.5 h2=0.8. ... DNA technology

Multiple uses of DNA

Pedigree discovery

multiple sire mate

Detect carriers of abnormalities

eg Pompe’s disease

Genotype for single genes

eg polled

Diagnose breed composition

Calculate EBVs

Page 33: The Future of Genomics in the Beef industry - c.cld.pwc.cld.pw/99/cms/files/04.15pmGoddard.pdf · Genomics in the Beef industry ... ls h2=0.1 h2=0.3 h2=0.5 h2=0.8. ... DNA technology

Change in Beef Industry

DNA technology could change the structure of the Beef stud industry

Reduce cost of breeding herd bulls

don’t stop recording

New players in stud industry

poultry example?

?????

Big change in technology

change in structure

Problem = who will pay to update data in training database?

Page 34: The Future of Genomics in the Beef industry - c.cld.pwc.cld.pw/99/cms/files/04.15pmGoddard.pdf · Genomics in the Beef industry ... ls h2=0.1 h2=0.3 h2=0.5 h2=0.8. ... DNA technology

Conclusions

We are only at the beginning of the use of DNA in breeding

cattle

EBVs can become more accurate with addition of data and

continued research

There will be multiple uses of DNA data

Opportunity to select cattle with better FCE, fertility, carcase

and meat quality

The structure of beef cattle genetic improvement may

change