The effect of 4-hydroxypanduratin A on the mitogen-activated proteinkinase-dependent activation of matrix metalloproteinase-1 expressionin human skin fibroblasts

Jae-Seok Shim a, Young-Sun Han b, Jae-Kwan Hwang a,b,*a Department of Biomaterials Science and Engineering, Yonsei University, Seoul, Republic of Koreab Department of Biotechnology, Yonsei University, 134 Shinchon-dong, Seodaemun-gu, Seoul 120-749, Republic of Korea

Journal of Dermatological Science 53 (2009) 129–134

A R T I C L E I N F O

Article history:

Received 26 June 2008

Received in revised form 2 September 2008

Accepted 3 September 2008

Keywords:

Kaempferia pandurata

4-Hydroxypanduratin A

Ultraviolet (UV) irradiation

Matrix metalloproteinase-1 (MMP-1)

Mitogen-activated protein kinases (MAPKs)

Activator protein-1 (AP-1)

A B S T R A C T

Background: Exposure of ultraviolet (UV) light on the skin induces photoaging associated with up-

regulated matrix metalloproteinases (MMPs) activities. The MMP-1 expression due to UV irradiation can

be mediated by mitogen-activated protein kinases (MAPKs) such as extracellular signal-regulated kinase

(ERK), Jun-N-terminal kinase (JNK) and p38 kinase activation.

Objective: We investigated the effects of 4-hydroxypanduratin A, isolated from Kaempferia pandurata

Roxb., on the expression of MMP-1 and activation of MAPKs signal pathways in UV-irradiated human skin

fibroblasts.

Methods: The fibroblasts were treated with 4-hydroxypanduratin A for indicated times and the cells were

irradiated with UVB. MMP-1 protein expression and phosphorylation of MAPKs were determined by

Western blot. Activator protein-1 (AP-1) DNA binding activity was investigated using electrophoretic

mobility shift assay (EMSA).

Results: 4-Hydroxypanduratin A in the range of 0.001–0.1 mM significantly reduced the expression of

MMP-1 levels and inhibited UV-induced MAPKs activation. Moreover, inhibition of MAPKs by 4-

hydroxypanduratin A resulted in decreasing c-Fos expression and c-Jun phosphorylation induced by UV,

which led to inhibiting AP-1 DNA binding activity.

Conclusions: The results suggest that 4-hydroxypanduratin A can be a potential candidate for the

prevention and treatment of skin aging brought about by UV.

� 2008 Japanese Society for Investigative Dermatology. Published by Elsevier Ireland Ltd. All rights reserved.

Contents lists available at ScienceDirect

Journal of Dermatological Science

journa l homepage: www. int l .e lsev ierhea l th .com/ journa ls / jods

1. Introduction

Ultraviolet (UV) irradiation is well known to induce photo-damage and premature skin aging [1]. UV irradiation induces thesynthesis of matrix metalloproteinases (MMPs) in fibroblasts andup-regulation of some MMPs is responsible for the enhanceddegradation of dermal collagen during UV-induced skin aging [2].

MMPs are synthesized by a variety of cell types and most ofthem are secreted from cells as latent forms (proMMPs). Activationof proMMPs is primarily brought about by the action of proteolyticcascades, mainly catalysed by neutral proteinases [3]. MMPs are afamily of structurally related matrix-degrading enzymes that play

* Corresponding author at: Department of Biotechnology, Yonsei University, 134

Shinchon-dong, Seodaemun-gu, Seoul 120-749, Republic of Korea.

Tel.: +82 2 21235881; fax: +82 2 3627265.

E-mail address: jkhwang@yonsei.ac.kr (J.-K. Hwang).

0923-1811/$30.00 � 2008 Japanese Society for Investigative Dermatology. Published b

doi:10.1016/j.jdermsci.2008.09.002

important roles in various destructive processes, includinginflammation, tumor invasion and skin aging [4]. Moreover, theexpression of various UV-induced MMPs in dermal fibroblastsleads to the breakdown of collagen and other extracellular matrixproteins and is thus related to photoaging in human skin [5].

Exposure of human skin in vivo to UV irradiation also activatesmultiple cell surface cytokine and growth factor receptors, mitogen-activated protein kinases (MAPKs) signaling modules such asextracellular signal-regulated kinase (ERK), Jun-N-terminal kinase(JNK) and p38 kinase, which rapidly induces activator protein-1 (AP-1) activity [6]. Transcription of several MMPs is regulated by AP-1.For AP-1 complex formation, Jun proteins form homodimers orheterodimers with Fos proteins. Moreover, increased AP-1 activity isresponsible for the degradation of extracellular matrix proteins,such as collagen, by inducing MMPs [7].

Kaempferia pandurata Roxb. is a perennial herb of theZingiberaceae family, and is mainly cultivated in tropical countries,including Indonesia and Thailand. The fresh rhizome has been used

y Elsevier Ireland Ltd. All rights reserved.

Fig. 1. The chemical structure of 4-hydroxypanduratin A.

J.-S. Shim et al. / Journal of Dermatological Science 53 (2009) 129–134130

as a food material and also as a folk medicine for the treatment ofcolic disorder, aphrodisiac, dry cough, rheumatism and muscularpains [8]. Several studies showed various biological activities of K.

pandurata, including antiinflammatory, antitumor, antidiarrhea,antidysentery, antiflatulence and antiepidermophytid effects[9,10]. It has been reported that the rhizomes of K. pandurata

contain essential oil, pinostrobin, cardamonin, boesenbergin, 5,7-dimethoxyflavone, 1,8-cineole, panduratin A, 4-hydroxypandur-atin A, etc. [11]. 4-Hydroxypanduratin A (Fig. 1) isolated from K.

pandurata showed antioxidative, antimutagenic, anti virus and antiHIV-1 protease activities [8,12–14]. However, its anti-aging effecthas not yet been examined to date. In this study, we investigatedthe MMP-1 inhibition and suppressive cellular mechanisms of 4-hydroxypanduratin A in UV-irradiated human skin fibroblasts.

2. Materials and methods

2.1. Plant material

Dried rhizomes of K. pandurata Roxb. were collected in Jakarta,Indonesia, and identified by Dr. Baek N.I., Department of OrientalMedicinal Materials and Processing, Kyunghee University (Yongin,Korea). A voucher specimen (H082) is deposited in the Departmentof Biotechnology, Yonsei University (Seoul, Korea).

2.2. Extraction and isolation

The ground K. pandurata Roxb. (100 g) was extracted with 95%ethanol (400 ml), and the extract (11.95 g) was further fractio-nated with ethyl acetate (2 � 200 ml). The ethyl acetate fractionwas applied to a silica gel column (5 cm � 45 cm, 650 g of silica gel;70–230 mesh, Merck & Co., Whitehouse Station, NJ, USA) andeluted with n-hexane–chloroform–ethyl acetate 15:5:1.5(2000 ml, v/v/v) to give seven fractions (fractions 1–7). Fraction6 (700–900 ml, 0.16 g) was further separated with methylenechloride-methanol 19:1 (1000 ml, v/v), yielding fraction 6-B(0.08 g). Fraction 6-B was eluted with 100% methanol (600–800 ml) using recycling preparative HPLC [(JAIGEL W-252 column,20.0 mm i.d. � 500 mm L, Japan Analytical Industry Co., Ltd.,Tokyo, Japan); detection by UV absorption at 365 nm; mobilephase used was 100% MeOH; flow rate 3 ml/min] and compound 6-B-2 (200–300 ml, 0.01 g) was finally obtained as a singlecompound. Comparison of several spectral data of compound 6-B-2 including 13C NMR, 1H NMR, 13C DEPT, 1H–1H COSY, 1H–13CHSQC, 1H–13C HMBC and FAB-MS with those in literature [14]suggested the chemical structure to be 4-hydroxypanduratin A(98%, Fig. 1) or 2,4,6-trihydroxyphenyl-[30-methyl-20-(30 0-methy-but-20 0-enyl)-60-phenylcyclohex-30-enyl] methanone.

2.3. Instrumentation

NMR spectra were recorded on a Bruker Avance-600 spectro-meter (Rheinstein, Germany) at 600 MHz for 1H and 13C in CDCl3

with TMS as an international standard. Complete proton andcarbon assignments were based on 1D (1H, 13C, 13C DEPT) and 2D(1H–1H COSY, 1H–13C HSQC, 1H–13C HMBC) NMR experiments.Mass spectra (FAB-MS) were measured using JMS-700 (JEOL Ltd.,Tokyo, Japan). All instrumental data are available upon request.

2.4. Cell culture and cell viability

Human skin fibroblast cells (CCD-986sk) were purchased fromAmerican Type Culture Collection (ATCC, Manassas, VA, USA). Cellswere cultured in Dulbeccos’s Modified Eagle’s Medium (DMEM;Gibco, Grand Island, NY, USA) supplemented with antibiotics (100 U/ml of penicillin A and 100 U/ml of streptomycin) and 10% heat-inactivated fetal bovine serum (Gibco). Cells were maintained at37 8C in a humidified incubator containing 5% CO2. The tetrazoliumdye colorimetric test (MTT test) was used to determine the viabilityof fibroblast cells [15]. The MTT assay is based on ability of functionalmitochondria to catalyze the reduction of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide to insoluble formazan, theconcentration of which can be measured spectrophotometrically.

2.5. UV irradiation

The fibroblast cells were grown in 6 cm culture dishes (SPL,Seoul, Korea) and subsequently the medium was replaced by 2 mlof phosphate-buffered saline (PBS). Then, the cells were exposed to20 mJ/cm2 of UVB light (312 nm UVB light source, Bio-Sun lamps,Vilber Lourmat, Marine, France). UV strength was measured usinga Waldman UV meter (Model No. 585100, Waldman, Germany).After irradiation, the cells were washed with PBS and cultured for48 h in the serum-free media with or without samples. Sameconditions without UVB irradiation were given in the controlgroup. A green tea polyphenol, epigallocatechin 3-O-gallate (EGCG;>95%, Sigma–Aldrich Co., St. Louis, MO, USA), was also included inthis study as a positive control.

2.6. Western blot analysis

Fibroblast-conditioned medium and cell lysates were collected,and then protein concentrations were determined with protein assayreagents (Bio-Rad Laboratories Inc., Hercules, CA, USA). For theWestern blotting, equal amount ofproteins were boiled for 3 min andchilled on ice, subjected to 10% sodium dodecylsulfate polyacryla-mide gel electrophoresis (SDS-PAGE), and electrophoreticallytransferred to a nitrocellulose membrane (Amersham International,Little Chalfont, UK). The membranes were saturated with 5%powdered skim milk in TBST (10 mM Tris, pH 7.5, 100 mM NaCl,0.1% Tween 20), and then blots were incubated with 1:1000 dilutedprimary antibody (Santa Cruz Biotechnology Inc., Santa Cruz, CA,USA) for 2 h. After washing with TBST, the membranes were probedwith 1:2000 secondary antibody (Santa Cruz Biotechnology Inc.) for1 h and washed with TBST three times. Blotted antibody was visua-lized by chemiluminescence (ECL) detection system (AmershamInternational). The densities of bands were measured by RFLPscanversion 2.1 software program (Scanalytics Inc., Fairfax, VA, USA).

2.7. Reverse-transcriptase PCR

Total RNA was isolated with Trizol reagent (Invitrogen, Madison,WI, USA) from human skin fibroblast cells. The oligonucleotideprimers of MMP-1 and GAPDH target genes were designed using a

J.-S. Shim et al. / Journal of Dermatological Science 53 (2009) 129–134 131

PCR primer selection program at the website of the Virtual GenomicCenter from the GenBank database. The reaction solution (25 ml finalvolume) contained 0.5 ml of AMV reverse transcriptase (5 Unit),12.5 ml of AccessQuickTM RT-PCR System Master Mix (2�) (Promega,Madison, WI, USA) and 100 pM of each primer. The total RNA wasreverse-transcribed and amplified according to the manufacturer’sinstructions with a thermal cycler (PerkinElmer PCR Thermal Cycler,PerkinElmer, Wellesley, MA, USA). PCR consisted of 25 amplificationcycles (94 8C, 30 s; 50 8C, 1 min; 72 8C, 1 min) for MMP-1 using theoligonucleotide primer sets detailed in Table 1. In parallel, theGAPDH house-keeping gene was amplified in each RNA sample.Reaction products were electrophoresed in 1% agarose gels andvisualized with ethidium bromide.

2.8. Electrophoretic mobility shift assay (EMSA)

Fibroblast cells were pretreated with the indicated concentra-tions of 4-hydroxypanduratin A for 24 h, washed with PBS, andirradiated with UV (20 mJ/cm2) in PBS. To prepare nuclearfractions, cells were washed with PBS, harvested and resuspendedin 100 ml of lysis buffer (10 mM HEPES, 10 mM KCl, 0.1 mM EDTA,1 mM DTT, 0.5 mM PMSF, pH 7.9) for 15 min on ice. After 30 ml of5% NP-40 was added, the tubes were vortexed vigorously for 15 s.Cytosol fractions were removed by centrifugation at 13,000 rpmfor 5 min and nuclear pellets were solubilized with extractionbuffer (20 mM HEPES, 0.4 M NaCl, 1 mM EDTA, 1 mM DTT, 1 mMPMSF, pH 7.9). Equal amounts of nuclear proteins were thensubjected to gel shift assay according to the manufacturer’sinstructions (Gel Shift Kit System, Panomics, Fremont, CA, USA).Briefly, equal amounts of nuclear proteins were mixed with poly D(I–C) and binding buffer, and incubated at room temperature for10 min. Biotin-labeled AP-1 Probe was added to the reactionmixtures and incubated at 15 8C for 30 min in a thermal cycler(PerkinElmer PCR Thermal Cycler, PerkinElmer). After incubation,samples were loaded onto 6% polyacrylamide gel in TBE buffer, andelectrophoretically transferred to a nitrocellulose membrane(Amersham International). The labeled complex was visualizedby chemiluminescence (ECL) detection system (Amersham Inter-national). The densities of bands were measured by RFLPscanversion 2.1 software program (Scanalytics Inc.).

2.9. Statistics

Each experiment was performed at least in triplicate. All dataare presented as the mean � standard deviation (S.D.). Statisticalsignificance was determined using the Student’s t-tests. Thedifference between treated and control groups were also analyzedby ANOVA and Duncan’s test (SPSS 12.0). *p-Values < 0.05 wereconsidered statistically significant.

3. Results

3.1. Effect on the UV-induced cell viability

To examine UV-induced MMP-1 expression in culturedfibroblasts, cells were exposed to 0–30 mJ/cm2 of UV irradiation.

Table 1Characteristics of the specific primers used for RT-PCR analysis.

Genes Primers (from 50 to 30) Size (bp)

MMP-1 Forward: AGCGTGTGACAGTAAGCTAA 409

Reverse: GTTTTCCTCAGAAAGAGCAGCAT

GAPDH Forward: ATTGTTGCCATCAATGACCC 565

Reverse: AGTAGAGGCAGGGATGAT

UV irradiation significantly enhanced MMP-1 expression levels,compared with a non-irradiated control. Because cell viability wasmore than 90% up to 20 mJ/cm2 (data not shown), cells wereexposed to UV 20 mJ/cm2. To investigate the dose-dependenteffects of 4-hydroxypanduratin A, skin fibroblasts were treatedwith various doses (0.001–0.1 mM) of 4-hydroxypanduratin A, butthere was no significant difference in cell proliferation betweencontrol and 4-hydroxypanduratin A-treated cells, suggesting thatthe effect of 4-hydroxypanduratin A was not attributable to itscytotoxicity (data not shown).

3.2. Effect on the UV-induced MMP-1 expression

Since K. pandurata extract (0.01–0.5 mg/ml) significantlyreduced the expression of MMP-1 at the protein and mRNA levelsin a dose-dependent manner (data not shown), further purificationwas performed to isolate 4-hydroxypanduratin A as a bioactivecompound. As shown in Fig. 2, UV irradiation elevated the MMP-1protein levels and treatment of UV-irradiated fibroblastswith 0.001–0.1 mM of 4-hydroxypanduratin A down-regulatedthe UV-induced MMP-1 protein expressions in a dose-dependentmanner compared with the UV-irradiated control. A RT-PCR wasperformed to determine how 4-hydroxypanduratin A affectedMMP-1 gene expression. The MMP-1 mRNA level was increased inUV-irradiated fibroblasts and treatment with 0.001–0.1 mM of 4-hydroxypanduratin A decreased the expression of MMP-1 mRNAlevels in a dose-dependent manner compared with the UV-irradiated control (Fig. 3). Accordingly, this 4-hydroxypanduratin Amay inhibit MMP-1 production through its transcriptionalmodulation. EGCG, well known as a natural anti-aging agent[16], was used as a positive control and 4-hydroxypanduratin Ashowed higher activity than EGCG at the same concentration in theprotein and mRNA levels. The result implies that 4-hydroxypan-duratin A may function as an anti-photoaging agent.

3.3. Effect on the UV-induced phosphorylation of MAPKs

To investigate whether 4-hydroxypanduratin A inhibits UV-induced phosphorylation of MAPKs family such as ERK, JNK and p38,

Fig. 2. The effect of 4-hydroxypanduratin A on the production of MMP-1 protein by

UV irradiation of human fibroblasts. The UV (20 mJ/cm2) exposed cells were

cultured for 48 h. MMP-1 protein expressions were determined in culture media by

Western blotting. EGCG was used as a positive control. (A) A representative Western

blot from three independent experiments. (B) Relative MMP-1 protein expression

levels. Data are expressed as %control and each column represents the mean � S.D.

of three determinations. Asterisks indicate a significant difference compared with the

control group, *p < 0.05.

Fig. 3. The effect of 4-hydroxypanduratin A on the production of MMP-1 mRNA by

UV irradiation of human fibroblasts. The UV (20 mJ/cm2) exposed cells were

cultured for 24 h. MMP-1 mRNA expressions were determined by RT-PCR. The

respective intensities of GAPDH are almost equivalent in the same PCR reaction.

EGCG was used as a positive control. (A) A representative RT-PCR from three

independent experiments. (B) Relative MMP-1 mRNA expression levels. Data are

expressed as %control and each column represents the mean � S.D. of three

determinations. Asterisks indicate a significant difference compared with the control

group, *p < 0.05.

J.-S. Shim et al. / Journal of Dermatological Science 53 (2009) 129–134132

expression of phosphorylated forms of MAPKs family wereexamined in fibroblasts. UV-irradiated fibroblasts have been shownto elevate the expression of phosphorylated MAPKs family [6]. Asshown in Fig. 4, 4-hydroxypanduratin A inhibited UV-induced

Fig. 4. The effect of 4-hydroxypanduratin A on the UV-induced phosphorylation o

hydroxypanduratin A for 24 h and irradiated with UV (20 mJ/cm2), and then the cells we

blotting. EGCG was used as a positive control. (A) A representative Western blot from

expressed as %control and each column represents the mean � S.D. of three determination

phosphorylation of ERK, JNK and p38 kinase compared with the UV-irradiated control in a dose-dependent manner without alteringtotal ERK, JNK and p38 kinase. The results suggested that 4-hydroxypanduratin A may regulate the expression of MMP-1 by UVirradiation via the ERK, JNK and p38 kinase pathways. 4-Hydro-xypanduratin A exhibited stronger activity than EGCG known as anatural anti-aging agent at the same dose (0.1 mM).

3.4. Effect on the UV-induced AP-1 activity and expression

of c-Jun and c-Fos

The effect of 4-hydroxypanduratin A on AP-1 activation wasexamined to determine the molecular mechanism of MMP-1down-regulation in UV-irradiated fibroblast cells. The presentinvestigation has shown that treatment with 4-hydroxypandur-atin A strongly suppressed UV-induced AP-1 DNA binding activityin a dose-dependent manner (Fig. 5). Because the AP-1 complex iscomposed of Jun and Fos family members, we investigated theeffects of 4-hydroxypanduratin A on UV-induced c-Jun phosphor-ylation and c-Fos expression. Treatment with 4-hydroxypandur-atin A inhibited UV-induced c-Jun phosphorylation and c-Fosexpression in a dose-dependent manner compared with the UV-irradiated control, which was higher than EGCG at the sameconcentration (Fig. 6).

4. Discussion

4-Hydroxypanduratin A (Fig. 1) isolated from K. pandurata is akind of cyclohexenyl chalcone compound. Chalcones, belonging tothe flavonoid family, are natural products possessing a variety ofbiological properties such as antiinflammatory, analgesic, antic-ancer, hepatoprotective and antioxidant activities [17]. It was also

f MAPKs. The fibroblasts were pretreated with indicated concentrations of 4-

re further cultured for 1 h. The phosphorylation of MAPKs was detected by Western

three independent experiments. (B) Relative MAPKs expression levels. Data are

s. Asterisks indicate a significant difference compared with the control group, *p < 0.05.

Fig. 5. The effect of 4-hydroxypanduratin A on the UV-induced DNA binding activity

of AP-1. The fibroblasts were pretreated with indicated concentrations of 4-

hydroxypanduratin A for 24 h and irradiated with UV (20 mJ/cm2), and then the

cells were further cultured for 10 h. AP-1 DNA binding activity of nuclear extracts

was detected by EMSA. EGCG was used as a positive control. (A) A representative

EMSA from three independent experiments. (B) Relative AP-1 complex expression

levels. Data are expressed as %control and each column represents the mean � S.D.

of three determinations. Asterisks indicate a significant difference compared with the

control group, *p < 0.05.

J.-S. Shim et al. / Journal of Dermatological Science 53 (2009) 129–134 133

reported that chalcones significantly inhibited melanin formationin human melanocyte cells [18]. However, its anti-aging effect onthe expression of MMP-1, particularly related to the signalingpathways, has not yet been examined to date.

Fig. 6. The effect of 4-hydroxypanduratin A on the UV-induced phosphorylation/expressi

of 4-hydroxypanduratin A for 24 h and irradiated with UV (20 mJ/cm2), and then the cel

was detected by Western blotting. EGCG was used as a positive control. (A) A representa

expression levels. Data are expressed as %control and each column represents the mean �the control group, *p < 0.05.

UVB wavelengths penetrate the epidermis and are nearly fullyabsorbed in the upper dermis whereas UVA penetrates to thedeeper dermis. However, shorter wavelength UVB is more effectivethan UVA in induction of photoaging in human and experimentalanimals [19]. In this study, UVB exposure to cultured humandermal fibroblasts resulted in marked increase of MMP-1 secretionand activation of MAPKs and AP-1.

MMPs play a key role in the pathophysiological mechanism ofphotoaging. A major mechanism by which UV irradiation causesdetrimental changes to skin connective tissue is via induction ofMMPs [20]. Therefore, natural compounds from medicinal plantsthat can decrease the level of MMPs production have been themain focus of recent research. EGCG in green tea is well known asantioxidant, anticancer, antiinflammatory and immunomodula-tory agents. EGCG treatment was also reported to decrease theMMPs expression levels in the dermis due to its MAPKs pathwayinhibitory effect, however, EGCG was examined at high concen-trations, and its MMP-1 inhibitory effect was usually associatedwith the inhibition of reactive oxygen species (ROS) production orany antioxidant effect [21]. In our study it was shown that 4-hydroxypanduratin A at concentration of 0.001–0.1 mM, whichwas not toxic to human skin fibroblast cells in vitro, significantlydecreased the MMP-1 expression at the protein and mRNA levels ina dose-dependent manner, and also 4-hydroxypanduratin A wasmore effective than EGCG for MMP-1 inhibition (Figs. 2 and 3).

UV irradiation activates the cell surface growth factor andcytokine receptors in fibroblasts which stimulate MAPKs signaltransduction pathways. ERK, JNK and p38 are three families ofMAPKs that exist in mammalian cells, each of which forms asignaling module [22]. These signaling pathways converge in thenucleus of cells to induce c-Jun, which heterodimerizes withconstitutively expressed c-Fos to form activated complexes of thetranscription factor AP-1. UV-induced AP-1 stimulates transcrip-

on of c-Jun and c-Fos. The fibroblasts were pretreated with indicated concentrations

ls were further cultured for 2 h. The phosphorylation/expression of c-Jun and c-Fos

tive Western blot from three independent experiments. (B) Relative c-Jun and c-Fos

S.D. of three determinations. Asterisks indicate a significant difference compared with

J.-S. Shim et al. / Journal of Dermatological Science 53 (2009) 129–134134

tion of MMP genes in fibroblasts [23]. The transcriptional activityof AP-1 is dependent not only on the abundance of c-Jun and c-Fosmembers but also on the degrees of phosphorylation/expression ofthese components [24]. Based on these findings, 4-hydroxypan-duratin A can inhibit UV-induced MMP-1 expression in fibroblasts,and this inhibitory effect of 4-hydroxypanduratin A on MMP-1expression may be mediated by the inhibition of the ERK, JNK andp38 kinase dependent pathways (Fig. 4). In this study, we alsofound that 4-hydroxypanduratin A treatment inhibited UV-induced AP-1 DNA binding activity by inhibiting c-Jun phosphor-ylation and c-Fos expression, which resulted in the significantinhibition of UV-induced AP-1 activation (Figs. 5 and 6).

Taken together, the present study demonstrates that 4-hydro-xypanduratin A isolated from K. pandurata significantly inhibits UV-induced MMP-1 expression by suppressing UV-induced AP-1activation, c-Jun phosphorylation and c-Fos expression, whichmay be mediated by the inhibition of ERK, JNK and p38 kinasepathways in cultured fibroblasts. Thus, 4-hydroxypanduratin A canbe employed as a potential candidate for the prevention andtreatment of skin aging. Further studies are necessary to elucidate itsanti-aging mechanisms related to the in vivo animal model test.

Acknowledgement

This work was supported partly by the Yonsei BiomoleculeResearch Initiative of the Brain Korea 21 Project.

References

[1] Fisher GJ, Datta SC, Talwar HS, Wang ZQ, Varani J, Kang S, et al. Molecular basisof sun-induced premature skin aging and retinoid antagonism. Nature1996;379:335–9.

[2] Moon HI, Lee JK, Zee OP, Chung JH. The effect of flavonol glycoside on theexpressions of matrix metalloproteinase-1 in ultraviolet-irradiated culturedhuman skin fibroblasts. J Ethnopharmacol 2005;101:176–9.

[3] Fisher GJ, Choi JC, Bata-Csorge Z, Shao Y, Subhash D, Wang ZQ. Ultravioletirradiation increases matrix metalloproteinase-8 protein in human skin invivo. J Invest Dermatol 2001;117:219–26.

[4] Vincenti MP, Brinckerhoff CE. Transcriptional regulation of collagenase (MMP-1 MMP-13) genes in arthritis: Integration of complex signaling pathways forthe recruitment of gene-specific transcription factors. Arthritis Res2002;4:157–64.

[5] Brenneisen P, Wenk J, Klotz LO, Wlaschek M, Briviba K, Krieg T, et al. Centralrole of ferrous/ferric iron in the ultraviolet B irradiation-mediated signalingpathway leading to increased interstitial collagenase (matrix-degradingmetalloprotease (MMP)-1) and stromelysin-1 (MMP-3) mRNA levels in cul-tured human dermal fibroblasts. J Biol Chem 1998;273:5279–87.

[6] Xu Y, Fisher GJ. Ultraviolet (UV) light irradiation induced signal transduction inskin photoaging. J Dermatol Sci Suppl 2005;1:S1–8.

[7] Huang C, Schmid PC, Ma WY, Schmid HH, Dong Z. Phosphatidylinositol-3kinase is necessary for 12-o-tetra-decanoylphorbol-13-acetate-induced celltransformation and activated protein 1 activation. J Biol Chem 1997;272:4187–4194.

[8] Trakoontivakorn G, Nakahara K, Shinmoto H, Takenaka M, Onishi-KameyamaM, Ono H, et al. Structural analysis of a novel antimutagenic compound, 4-hydroxypanduratin A, and the antimutagenic activity of flavonoids in a Thaispice, fingerroot (Boesenbergia pandurata Schult.) against mutagenic hetero-cyclic amines. J Agric Food Chem 2001;49:3046–50.

[9] Tuchinda P, Reutrakul V, Claeson P, Pongprayoon U, Sematong T, Santisuk T,et al. Anti-inflammatory cyclohexenyl chalcone derivatives in Boesenbergiapandurata. Phytochemistry 2002;59:169–73.

[10] Calliste CA, Le Bail JC, Trouillas P, Pouget C, Habrioux G, Chulia AJ, et al.Chalcones: Structural requirements for antioxidant, estrogenic and antipro-liferative activities. Anticancer Res 2001;21:3949–56.

[11] Mahidol C, Tantiwachwuttikul P, Reutrakul V, Taylor WC. Constituents ofBoesenbergia pandurata (synKaempferia pandurata). III. Isolation and synthesisof (�)-boesenbergin B. Aust J Chem 1984;37:1739–45.

[12] Cheenpracha S, Karalai C, Ponglimanont C, Subhadhirasakul S, Tewtrakul S.Anti-HIV-1 protease activity of compounds from Boesenbergia pandurata.Bioorg Med Chem 2006;14:1710–4.

[13] Kiat TS, Pippen R, Yusof R, Ibrahim H, Khalid N, Rahman NA. Inhibitory activityof cyclohexenyl chalcone derivatives and flavonoids of fingerroot, Boesenber-gia rotunda (L.), toward dengue-2 virus NS3 protease. Bioorg Med Chem Lett2006;12:3337–40.

[14] Shindo K, Kato M, Kinoshita A, Kobayashi A, Koike Y. Analysis of antioxidantactivities contained in the Boesenbergia pandurata Schult. Rhizome. BiosciBiotechnol Biochem 2006;70:2281–4.

[15] Mosmann T. Rapid colorimetric assay for cellular growth and survival: appli-cation to proliferation and cytotoxicity assays. J Immunol Meth 1983;65:55–63.

[16] Tobi SE, Gilbert M, Paul N, McMillan TJ. The green tea polyphenol, epigallo-catechin-3-gallate, protects against the oxidative cellular and genotoxicdamage of UVA radiation. Int J Cancer 2002;102:439–44.

[17] Jaipetch T, Reutrakul V, Tantiwachwuttikul P, Santisuk T. Flavonoids inthe black rhizomes of Boesenbergia pandurata. Phytochemistry 1983;22:625–626.

[18] Nerya O, Vaya J, Musa R, Izrael S. Glabrene and isoliquiritigenin as tyrosinaseinhibitors from Licorice roots. J Agric Food Chem 2003;51:1201–7.

[19] Debacq-Chainiaux F, Borlon C, Pascal T, Royer V, Eliaers F, Ninane N, et al.Repeated exposure of human skin fibroblasts to UVB at subcytotoxic leveltriggers premature senescence through the TGF-b1 signaling pathway. J CellSci 2005;118:743–58.

[20] Vincenti MP, White LA, Schroen DJ, Benbow U, Brinckerhoff CE. Regulatingexpression of the gene for matrix metalloproteinase-1 (collagenase): Mechan-isms that control enzyme activity, transcription, and mRNA stability. Crit RevEukaryot Gene Expr 1996;6:391–411.

[21] Bae JY, Choi JS, Choi YJ, Shin SY, Kang SW, Han SJ, et al. (�)Epigallocatechingallate hampers collagen destruction and collagenase activation in ultraviolet-B-irradiated human dermal fibroblasts: involvement of mitogen-activatedprotein kinase. Food Chem Toxicol 2008;46:1298–307.

[22] Robinson MJ, Cobb MH. Mitogen-activated protein kinase pathways. Curr OpinCell Biol 1997;9:180–6.

[23] Rittie L, Fisher GJ. UV-light-induced signal cascades and skin aging. Ageing ResRev 2002;1:705–20.

[24] Hirano T, Higa S, Arimitsu J, Naka T, Okada A, Shima Y. Luteolin, a flavonoid,inhibits AP-1 activation by basophils. Biochem Biophys Res Commun 2006;340:1–7.