ORIGINAL PAPER

The Down-Regulation of Neuroligin-2 and the Correlative ClinicalSignificance of Serum GABA Over-Expression in Hirschsprung’sDisease

Hongchao Yang • Jianyi Niu • Jian Wang •

Fan Zhang • Qiangye Zhang • Wentong Zhang •

Aiwu Li

Received: 23 January 2014 / Revised: 17 April 2014 / Accepted: 12 May 2014

� Springer Science+Business Media New York 2014

Abstract The goal of this study was to investigate the

expression level of neuroligin-2 in different colon tissue

segments of children with Hirschsprung’s disease (HSCR)

and the correlative clinical significance of serum Gamma-

Aminobutyric Acid (serum GABA) in HSCR. Neuroligin-2

was assessed by Immunohistochemistry staining method on

routine paraffin section from different colon tissue seg-

ments of HSCR (ganglionic colonic segment, transitional

colonic segment and aganglionic colonic segment). Wes-

tern-blot analysis and real-time fluorescence quantitative

PCR(qRT-PCR) were applied to compare and evaluate the

expression levels of neuroligin-2 from three segments of

HSCR, and we used Enzyme-linked Immunosorbent Assay

(ELISA) method to detect and compare the serum GABA

between HSCR and non-HSCR. Immunohistochemistry

staining demonstrated that intensive neuroligin-2 staining

was detected in the ganglion cells in the ganglionic colonic

and transitional colonic segments from the HSCR children;

however, neuroligin-2 staining was down-regulated

significantly in the aganglionic colonic segments. The

expression levels of neuroligin-2 mRNA and protein in the

aganglionic colonic segment were decreased compared to

the ganglionic colonic segment and transitional colonic

segment (P \ 0.05). And the level of serum GABA was

significantly higher in HSCR than that in non-HSCR. The

expression of neuroligin-2 varies from different segments

of HSCR. The down-regulation of neuroligin-2 in agan-

glionic colonic segments may be correlated with the

excessive intestine contraction and further result in HSCR.

The over-expression of serum GABA may be considered as

a new diagnostic method of HSCR.

Keywords Hirschsprung’s disease � Neuroligin-2 gene �Serum GABA

Introduction

Hirschsprung’s disease (HSCR), which is also called

aganglionosis, is a congenital disorder that affects 1 of

5,000 human births and is characterized by colonic stasis

due to the absence of enteric neurons in the distal gut [1],

leading to tonic contraction of the affected segment,

intestinal obstruction and massive distension of the proxi-

mal bowel. In 80 % of cases, the aganglionic tract involves

the short segment HSCR, while only 20 % of cases it

extends towards the long segment HSCR [2].

To date, the cause of HSCR still remains unclear, but

there is a common understanding that HSCR is a complex

disease influenced by multiple genetic factors and envi-

ronmental factors. Several genes such as ret proto-onco-

gene (RET), sex determining region Y-box 10(SOX10) and

endothelin receptor B (EDNRB), which play important

roles in the formation of ENS, have been identified

Hongchao Yang and Jianyi Niu have contributed equally to this work

and should be considered co-first authors.

H. Yang � J. Wang � Q. Zhang � W. Zhang � A. Li (&)

Department of Pediatric Surgery, Qilu Hospital, Shandong

University, 44#, Wenhua Xi Road, Jinan 250012, Shandong,

People’s Republic of China

e-mail: liaiwu2012@126.com

J. Niu

Qingzhou Clinical School, Weifang Medical University,

Qingzhou 262500, Shandong, People’s Republic of China

F. Zhang

Department of E.N.T, Qilu Hospital, Shandong University,

44#, Wenhua Xi Road, Jinan 250012, Shandong,

People’s Republic of China

123

Neurochem Res

DOI 10.1007/s11064-014-1334-y

involved in the pathogenesis of HSCR in human beings [3],

the alteration and abnormal expression of these genes,

however, only account for 30 % of the cases of HSCR [4].

Neuroligins are a family of postsynaptic transmembrane

proteins that bind to presynaptic neurexins [5], whereby

they form a trans-synaptic signal transduction complex and

mediate a bidirectional signaling between the presynaptic

axon and the postsynaptic target [6]. Presynaptic neurexins

and postsynaptic neuroligins likely work together with

other synaptic cell adhesion molecules of the cadherin and

ephrin families, and secreted proteins such as pentraxins, to

mediate central nervous system (CNS) synaptogenesis [7].

In the CNS, neurexins and neuroligins gained major

interest upon discovery that they induce formation and

function of synapses in recombinant non-neuronal cell

systems, and reports of preferential distribution of neurol-

igin-1 in glutamatergic synapses (excitatory synapses) and

neuroligin-2 in GABAergic synapses (inhibitory synapses)

[8–10] fuelled considerable efforts to elucidate their role in

synapse formation and specification. And it has been con-

firmed that [11] the expression level of glutamate and

GABA could reflect the expression level of neuroligin-1

and neuroligin-2, respectively.

Studies have demonstrated that there is bi-directional

communication between the enteric nervous system

(ENS) and the CNS [12]. And the brain is continuously

informed by afferent nerves detecting gut activity, nev-

ertheless it has been established that psychological state

has a great impact on gut function [13]. Whether neu-

roligins which expressed in CNS are expressed in ENS?

Our previous study had identified that [14, 15] neuroligins

were expressed on the ENS of human beings with HSCR

and the expression was down-regulated in aganglionic

colonic segments.

In the present study, we choose to further investigate the

expression of neuroligin-2 on ENS of HSCR and the serum

GABA related with neuroligin-2 and discuss whether the

pathogenesis of HSCR is involved with the abnormal

inhibitory synapses and whether the serum GABA could be

used as a new diagnostic method of HSCR.

Materials and Methods

Patients and Samples

Our study was approved by the ethics committee of Qilu

Hospital, Shandong University. The experimental samples

were collected from the surgical excision waste tissue and

preoperative routine blood collection. And no harm had

been done to patients at all, the special written consent was

not necessary according to the opinion of the ethics com-

mittee of Qilu Hospital, Shandong University.

Fifty two patients (2 months–5 years, 39 boys, and 13

girls) pathologically confirmed HSCR and 52 patients

(1–5 years, 48 boys, and 4 girls) with indirect inguinal

hernia (IIH) were regarded as control group were involved

in this study and they were all treated in Department of

Pediatric Surgery, Qilu Hospital, Shandong University

from September 2011 to June 2013. The cases of short-

segment type and long-segment type with HSCR were 42

and 10, respectively. All HSCR patients were treated with

Soave’s pull-through procedure. The children with HSCR

were not treated by any drugs before operative treatment.

Reagents

The detailed information of antibodies and primers was

listed in Tables 1 and 2, respectively and other reagents

were also available commercially: Protein extraction kit

(Beyotime, China), BCA Protein concentration determi-

nation kit (Beyotime, China), SDS-PAGE Gel Preparation

kit (Beyotime, China), Total RNA isolation kit (RNAiso

Plus, TaKaRa, Japan), Reverse transcription kit (Prime-

Script� RT reagent Kit with gDNA Eraser, TaKaRa,

Japan), SYBR� Premix Ex TaqTM Tli RNaseH Plus (Ta-

KaRa, Japan), Serum Gamma-Aminobutyric Acid ELISA

kit (E90900Ge, Uscn Life Science Inc., China).

Methods

Samples Preparation

Samples of aganglionic, transitional and ganglionic colon

segments were harvested from the surgical excision waste

colon of children patients with HSCR at the length of 3 cm

respectively. Specimens were divided into two parts. One

part was fixed in 10 % buffered formaldehyde for the

preparation of Immunohistochemistry. Immediately,

another part of fresh colon tissue was snap-frozen in liquid

nitrogen and stored at -80 �C in disinfected tubes until

used for the Quantitative real-time polymerase chain

reactions (qRT-PCR) assay and Western-blot analysis.

1.5 ml fresh blood sample was collected by preoperative

routine blood collection from all 104 patients (52 HSCR

and 52 IIH) and was allowed to clot for two hours at room

temperature before centrifugation (20 min, 1,0009g). Then

the serum samples were stored in aliquot at -80 �C and

prepared for ELISA.

Immunohistochemistry Staining

Paraffin-embedded blocks of different full-thickness colon

segments were sectioned with cross-sections at a thickness

of 4 lm, then heated to 65 �C, dewaxed in xylene (15 min,

3 times) and graded alcohols (100, 95, 80, 70 %; 5 min

Neurochem Res

123

each). Antigen retrieval was performed with 0.01 M citrate

buffer at pH 6.0 at 95 �C for 20 min. After incubation with

3 % H2O2 in methanol for 15 min at 37 �C to block

endogenous peroxidases, the sections were blocked with

6 % Bull Serum Albumin in PBS and incubated with pri-

mary antibody: anti-neuroligin-2 (1:50 dilution, goat

polyclonal, sc-14089, Santa Cruz Biotechnology, USA)

overnight at 4 �C. After washing with 0.1 M PBST (pH

7.4) (5 min, 3 times), antibodies were detected using the

Polink-2 plus� Polymer HRP Detection System for Goat

Primary Antibody (PV-9003, ZSGB-BIO, China) accord-

ing to the manufacturer’s instructions. The reaction was

visualized with the 3,30-diaminobenzidine tetrahydrochlo-

ride DAB Kit. Then sections were counterstained with

Harris’s haematoxylin, differentiated using hydrochloric

acid ethanol and blued using ammonia water. After dehy-

dration in graded alcohols and clearing with dimethylben-

zene, the slides were mounted with neutral gum and

examined using the Image-Pro� Plus analytical imaging

system (Media Cybernetics, Bethesda, MD, USA).

Western-Blot Analysis

20 mg frozen specimens from three different segments of

HSCR were homogenized. Then, 200 ll lysis buffer

(RIPA:PMSF 100:1, Cell Lysis Buffer, Beyotime, China)

was added to the homogenate. The supernatant containing

total protein from the tissue homogenate was separated by

centrifuging for 15 min at 12,000 r/min. Protein concentra-

tions were measured using a BCA protein kit to normalize the

amount of total protein. Samples containing equal amounts

of proteins (30 lg/sample) were separated on an 8 % SDS-

PAGE and then electrophoretically transferred to polyvi-

nylidene fluoride membranes (PVDF). After blocking with

6 % (w/v) nonfat milk and washing with Tris-buffered sal-

ine-Tween solution (TBST), membranes were incubated

with primary antibodies anti-neuroligin-2 (1:200, goat

polyclonal, sc-14089, Santa Cruz Biotechnology, USA) and

anti-b-actin (1:2,000, mouse polyclonal, ZSGB-BIO, China)

overnight at 4 �C. After washing, the blots were incubated

with HRP-conjugated secondary antibodies: rabbit anti-goat

IgG and goat anti-rat IgG (1:5,000, ZSGB-BIO, China) at

room temperature for 60 min, respectively. The membranes

were subsequently detected with the ECL system according

to the manufacturer’s instructions, and the expression levels

of neuroligin-2 were expressed by the relative gray values

(neuroligin-2 IOD/b-actin IOD), which was analyzed by the

Gel-Pro analyzer 4.0 Software.

RNA Isolation and qRT-PCR Assay

Total RNA was isolated from 25 mg specimens of three

different segments of HSCR by Total RNA Isolation Kit

(RNAiso Plus, TaKaRa, Japan) according to the manufac-

turer’s instructions. The quantity of RNA was assessed

spectrophotometrically. The OD260/280 of the RNA

Table 1 Detailed information

of antibodiesAntigen Primary antibody Dilution Applications Source

Neuroligin-2 Goat-anti-human polyclonal 1:50 Detect Nlgn-2 with

immunohistochemistry on

paraffin-embedded

sections

Santa Cruz,

USA

Neuroligin-2 Goat-anti-human polyclonal 1:200 Detect Nlgn-2 with

Western-blot

Santa Cruz,

USA

b-Actin Rat-anti-human Secondary

antibody

1:2,000 Western-blot internal

reference

ZSGB-BIO,

China

Anti-

neuroligin-2

Poly-HRP anti-goat IgG 1:200 Label Nlgn-2 on on

paraffin-embedded

sections

ZSGB-BIO,

China

Anti-

neuroligin-2

HRP-conjugated rabbit-anti-

goat IgG

1:5,000 Detect Nlgn-2 with

Western-blot

Santa Cruz,

USA

Anti-b-actin HRP-conjugated goat-anti-rat

IgG

1:5,000 Detect b-actin with

Western-blot

Santa Cruz,

USA

Table 2 Detailed information

of primers

F upstream primer, R

downstream primers

Primers Primer sequences (50 ? 30) Annealing temperature (�C) Product size (bp)

Neuroligin-2 F: CCAGTCTCCCGTCTACTTTTACA 59 316

R: CTGCTTCTCCTTGCTGTTGAAT

b-Actin F: AGCGAGCATCCCCCAAAGTT 60 285

R: GGGCACGAAGGCTCATCATT

Neurochem Res

123

samples ranged between 1.70 and 2.00. Then 1 lg of total

RNA was used in a 20 ll cDNA synthesis reaction at 37 �C

for 15 min, followed by 85 �C for 5 s, the SYBR� Premix Ex

Taq TM II(Perfect Real Time), which included 59 gDNA

Eraser Buffer 2 ll,gDNA Eraser 1 ll,Total RNA 1 lg, 59

PrimeScript� Buffer 2(for Real Time)4 ll,PrimeScript. RT

Enzyme Mix I 1 ll, RT Primer Mix 1 ll. The qRT-PCR

reactions were performed with reference to SYBR� Premix

Ex TaqTM (Tli RNaseH Plus) quantitative fluorescence kit in

Roche Applied Science LightCycler� 480 Real-time PCR

systems, and SYBR� Premix Ex TaqTM (Tli RNaseH Plus)

(29) 10 ll, PCR Forward and Reverse Primers (10 lM)

1 ll, cDNA 2 ll were added in the reverse transcription

system.

After the reaction, the Ct of neuroligin-2 mRNA from

each sample was measured and the 2-DDCt was calculated.

The results were expressed relative to the number of b-actin

transcripts used as an internal control. All experiments were

conducted in triplicate. The primers and annealing temper-

atures used for the amplification of human neuroligin-2 and

the endogenous control b-actin were shown in Table 2.

Enzyme-Linked Immunosorbent Assay

The 104 serum samples (52 HSCR and 52 IIH) stored in

aliquot at -80 �C were used for the detection of serum

GABA with reference to the Serum Gamma-Aminobutyric

Acid ELISA kit (E90900Ge, Uscn Life Science Inc.,

China) specification. Then after the reaction, the O.D.

value was measured at 450 nm and then the actual con-

centration of samples could be calculated according to the

standard concentration. Each sample was examined in

triplicates with the average value as the final result.

Statistical Analyses

GraphPad Prism� 5 for Windows software (La Jolla, CA,

USA) was used for the statistical procedures. The data were

expressed as mean ± SEM. Two group comparisons were

evaluated by unpaired t test and multiple comparisons were

analyzed by one-way ANOVA and the Tukey’s test. All

P values were two-sided and a value of P \ 0.05 was

considered statistically significant.

Results

Immunohistochemistry Staining

Immunohistochemistry were performed on paraffin-

embedded sections (from ganglionic, transitional and agan-

glionic segments), and light microscopy was used for

observation. The histological appearance and the expression

of neuroligin-2 were shown in Fig. 1. Intensive neuroligin-2

staining was detected in myenteric plexuses in the ganglionic

and transitional segments (Fig. 1A, a; B, b). The myenteric

plexuses were not formed in aganglionic segment, and

neuroligin-2 staining was down-regulated significantly in

these segments (Fig. 1C, c).

Western-Blot Analysis

Figure 2 represented that neuroligin-2 were expressed sig-

nificantly in ganglionic colonic segments (0.057 ± 0.0018,

n = 52), moderately in transitional colonic segments

(0.039 ± 0.0014, n = 52) and obviously downed-regulated

in aganglionic colonic segments (0.012 ± 0.0011, n = 52),

and the three difference of relative gray values had statistical

significance (P \ 0.05).

Real-Time Fluorescence Quantitative RT-PCR Assay

To obtain further insights into the expression of the target

genes, we performed qRT-PCR described above in the

method. As shown in Fig. 3, neuroligin-2 mRNA was

significantly expressed at obvious low levels in the agan-

glionic colonic segments [(1.20 ± 0.11) E-5, n = 52]

compared with those of normal ganglionic [(9.46 ± 0.21)

E-5, n = 52)] and transitional colon segments [(4.74 ±

0.23) E-5, n = 52; P \ 0.05].

Enzyme-Linked Immunosorbent Assay

As shown in Fig. 4, concentrations of serum GABA were

measured by ELISA. For serum GABA, there was a sig-

nificant difference in HSCR patients (23.69 ± 2.30) com-

pared to IIH patients (7.65 ± 1.16, P \ 0.05).

Discussion

A number of studies have shown that the excitatory/

inhibitory synapse balance in the brain is believed to be a

key to neuronal plasticity mechanisms such as learning and

memory, and also a likely mediator of mental disorders

such as autism [16–20]. And a mismatch of neurexin and

neuroligin partners across synapses in the brain presumably

leads to loss of synaptic plasticity and/or erroneous wiring,

resulting in behavioral and cognitive deficiencies [21].

Normal gastrointestinal motility results from the coor-

dinated interplay of multiple cooperating mechanisms, both

intrinsic and extrinsic to the gastrointestinal tract [22].

HSCR is a developmental disorder characterized by the

absence of ganglion cells in the lower digestive tract.

Aganglionosis is attributed to a disorder of the enteric

nervous system (ENS) whereby ganglion cells fail to

Neurochem Res

123

innervate the lower gastrointestinal tract during embryonic

development [23]. In recent years, diverse genetic muta-

tions affecting the neural crest cell development have been

described in patients with HSCR, such as RET, GDNF,

NRTN, SOX10, PHOX2B, et al. [24, 25]. However, it

remains unknown whether these pathogenic variations

influence the distribution and function of enteric ganglion

cells, which dominate postnatal alimentary tract motility in

affected infants [26].

According to the bi-directional communication between

CNS and ENS and present study about neuroligin-neur-

exin, we tried to study the pathogenesis of HSCR from the

angle of synapses function and neuroligins. Our prophase

research revealed that [14, 15] neuroligins were expressed

Fig. 1 Expression of neuroligin-2 in HSCR by Immunohistochem-

istry assay. The view of the full-thickness intestinal wall in three

specimens was illustrated with neuroligin-2 staining. Neuroligin-2

was expressed significantly in ganglionic colonic segment, mainly

muscular plexuses (A, a), moderately in transitional segment (B, b),

and obviously downed-regulated in aganglionic colonic segment (C,

c). A and a indicate the normal ganglionic colonic segments. (A, B,

and C magnification: 9200, scale bar 100 lm; a, b, and c magnifi-

cation: 9400, scale bar 50 lm)

Neurochem Res

123

on the postsynaptic neurons and interstitial cells of Cajal in

mesenteric plexus of HSCR patients with a down-regulated

expression levels in the aganglionic colonic segment. On

the basis of our previous research, we went on our study

about the expression of neuroligin-2 and the serum GABA

related with neuroligin-2 and discussed whether the path-

ogenesis of HSCR was involved with the abnormal inhib-

itory synapses and whether the serum GABA could be used

as a new diagnostic method of HSCR.

Clinically, sometimes it is difficult for the diagnosis of

HSCR only based on the preoperative radiology, especially

for the newborn. So a new method to solve this problem must

be found. And, in this study, we tried to detect the serum

GABA which was based on the expression of neuroligin-2

and found its differential expression between HSCR and

non-HSCR which might be meaningful for the diagnosis of

HSCR. Our data showed that neuroligin-2 was expressed

significantly in ganglionic colonic segments, moderately

transitional colonic segments and down-regulated signifi-

cantly in aganglionic colonic segments. Moreover, the

expression level of serum GABA was obviously higher in

HSCR than that in non-HSCR. According to these, it can be

inferred that the abnormality of neuroligin-2 is closely

Fig. 2 Neuroligin-2 expression levels in children with HSCR by

Western blot. Protein extracts from normal ganglionic (1, 2),

transitional (3, 4), and aganglionic (5, 6) colon segments were probed

by Western blot analysis with neuroligin-2 antibodies in HSCR (a).

The relative gray values of neuroligin-2 expressed in Western-blot

was 0.057 ± 0.0018 in ganglionic colonic segments, 0.039 ± 0.0014

in transitional segments and 0.012 ± 0.0011 in aganglionic colonic

segments, and the difference of relative gray values had statistical

significance (0.057 ± 0.0018 vs. 0.039 ± 0.0014, * P \ 0.05;

0.057 ± 0.0018 vs. 0.012 ± 0.0011, * P \ 0.05; 0.039 ± 0.0014

vs. 0.012 ± 0.0011, * P \ 0.05) (b)

Fig. 3 Quantitative RT-PCR results of Neuroligin-2 expression in

different colonic segments. The Neuroligin-2 transcript was signif-

icantly decreased in aganglionic colonic segments compared with

other colonic segments (* P \ 0.05)

Fig. 4 Serum GABA in HSCR and IIH patients. We observed that

the level of serum GABA was significantly higher in HSCR

(23.69 ± 2.30) than that in IIH controls (7.65 ± 1.16, * P \ 0.05)

Neurochem Res

123

related to HSCR, and we conclude that the alterative and

abnormal expression of neuroligin-2 may play an important

role in the pathogenesis of HSCR through affecting the

inhibitory synaptic function. And the serum GABA may be

used as a new diagnostic method of HSCR.

Although our study does not provide direct evidence that

neuroligin-2 plays an important role in ENS development,

the neuroligin-2 expression levels in different segments can

be the basis for further investigations on the potential role

of neuroligin-2 and this study provides a new research

perspective for recognizing the molecular mechanism

underlying HSCR development. Of course, additional

studies are required to confirm the superior method for

diagnosing HSCR and we have confidence in the method of

the combination of research and clinic.

Conclusions

The results above show that neuroligin-2 is expressed in

human beings’ ENS, and for HSCR children, the expression

of neuroligin-2 from different colon segments may play an

important role in the pathogenesis of this disease: the obvi-

ously down-regulations of neuroligin-2 in aganglionic

colonic segment may be correlated with the excessive

intestine contraction and further result in HSCR. The

expression level of serum GABA coincided with neuroligin-

2 may be considered as a new diagnostic method of HSCR.

Acknowledgments We appreciate the financial support provided by

the National Natural Science Foundation of China (81270720) and

the Independent Innovation Foundation of Shandong University, II-

FSDU (2012ZD026). We thank all of the patients and their parents

involved in this study.

Conflict of interest The authors declare that there are no conflicts

of interest.

References

1. RobertsRR,Bornstein JC,BergnerAJ,YoungHM (2008)Disturbances

of colonic motility in mouse models of Hirschsprung’s disease. Am J

Physiol Gastrointest Liver Physiol 294(4):996–1008

2. Edery P, Pelet A, Mulligan LM, Abel L, Attie T et al (1994) Long

segment and short segment familial Hirschsprung’s disease: vari-

able clinical expression at the RET locus. J Med Genet

31(8):602–606

3. Heanue TA, Pachnis Vassilis (2007) Enteric nervous system

development and Hirschsprung’s disease: advances in genetic and

stem cell studies. Nat Rev Neurosci 8(6):466–479

4. Emison ES, McCallion AS, Kashuk CS (2005) A common sex-

dependent mutation in a RET enhancer underliea Hirschsprung

disease risk. Nature 434(7035):857–863

5. Sun M, Xing G, Yuan L, Gan G, Knight D et al (2011) Neuroligin

2 is required for synapse development and function at the dro-

sophila neuromuscular junction. J Neurosci 31(2):687–699

6. Ichtchenko K, Nguyen T, Sudhof TC (1996) Structures, alterna-

tive splicing, andneurexin binding of multiple neuroligins. J Biol

Chem 271:2676–2682

7. Siddiqui TJ, Craig AM (2011) Synaptic organizing complexes.

Curr Opin Neurobiol 21:132–143

8. Zhanyan Fu, Vicini Stefano (2009) Neuroligin-2 accelerates

GABAergic synapse maturation in cerebellar granule cells. Mol

Cell Neurosci 42(1):45–55

9. Varoqueaux F, Jamain S, Brose N (2004) Neuroligin 2 is

exclusively localized to inhibitory synapses. Eur J Cell Biol

83:449–456

10. Song JY, Ichtchenko K, Sudhof TC, Brose N (1999) Neuroligin 1

is a postsynaptic cell-adhesion molecule of excitatory synapses.

Proc Natl Acad Sci USA 96:1100–1105

11. Hoon M, Bauer G, Fritschy JM, Moser T, Falkenburger BH,

Varoqueaux F (2009) Neuroligin 2 controls the maturation of

GABAergic synapses and information processing in the retina.

J Neurosci 29:8039–8050

12. Graf ER, Kang Y, Hauner AM, Craig AM (2006) Structure

function and splice site analysis of the synaptogenic activity of

the neurexin-1 b LNS domain. J Neurosci 26(16):4256–4265

13. Wouters MM, Boeckxstaens GE (2011) Neuroimmune mecha-

nisms in functional bowel disorders. Neth J Med 69(2):55–61

14. Wang J, Mou Y, Zhang Q, Zhang F, Yang H et al (2013)

Expression and significance of neuroligins in myenteric cells of

cajal in Hirschsprung’s disease. PLoS One 8(6):e67205

15. Zhang Q, Wang J, Li A, Liu H, Zhang W et al (2013) Expression

of neurexin and neuroligin in the enteric nervous system and their

down-regulated expression levels in Hirschsprung disease. Mol

Biol Rep 40(4):2969–2975

16. Chih B, Engelman H, Scheiffele P (2005) Control of excitatory

and inhibitory synapse formation by neuroligins. Science

307(5713):1324–1328

17. Graf ER, Zhang X, Jin SX, Linhoff MW, Craig AM (2004)

Neurexins induce differentiation of GABA and glutamate post-

synaptic specializations via neuroligins. Cell 119(7):1013–1026

18. Levinson JN, El-Husseini A (2005) Building excitatory and

inhibitory synapses: balancing neuroligin partnerships. Neuron

48(2):171–174

19. Prange O, Wong TP, Gerrow K, Wang YT, El-Husseini A (2004)

A balance between excitatory and inhibitory synapses is con-

trolled by PSD-95 and neuroligin. Proc Natl Acad Sci USA

101(38):13915–13920

20. Sudhof TC (2008) Neuroligins and neurexins link synaptic

function to cognitive disease. Nature 455(7215):903–911

21. Biswas S, Reinhard J, Oakeshott J, Russell R, Srinivasan MV

et al (2010) Sensory regulation of neuroligins and neurexin I in

the honeybee brain. PLoS One 5(2):e9133

22. Du P, O’Grady G, Davidson JB, Cheng LK, Pullan AJ (2010)

Multiscale modeling of gastrointestinal electrophysiology and

experimental validation. Crit Rev Biomed Eng 38(3):225–254

23. Tam PK, Garcia-Barcelo M (2009) Genetic basis of Hirsch-

sprung’s disease. Pediatr Surg Int 25(7):543–558

24. Amiel J, Sproat-Emison E, Garcia-Barcelo M, Lantieri F, Bur-

zynski G et al (2008) Hirschsprung disease, associated syndromes

and genetics: a review. J Med Genet 45(1):1–14

25. Brooks AS, Bertoli-Avella AM, Burzynski GM, Breedveld GJ,

Osinga J et al (2005) Homozygous nonsense mutations in

KIAA1279 are associated with malformations of the central and

enteric nervous systems. Am J Hum Genet 77(1):120–126

26. Shimotake T, Tomiyama H, Aoi S, Iwai N (2003) Discrepancy

between macroscopic and microscopic transitional zones in Hir-

schsprung’s disease with reference to the type of RET/GDNF/

SOX10 gene mutation. J Pediatr Surg 38(5):698–701

Neurochem Res

123