View
216
Download
2
Embed Size (px)
Citation preview
Cell membrane components• Mostly proteins:
– on the surface receptor– Below the surface mostly enzymes– Across allows compounds to move in and out of the cell
(channels or pumps)
Factors affecting transport: cell membrane
• The cell needs to absorb and excrete various compounds throughout its life.
These compounds need to pass through the membrane which is made from a phospholipid bilayer
• The phospholipid bilayer is formed by phospholipid molecules bipolar molecule: the fatty acid side is hydrophobic, the phosphoric side is hydrophilic
• The membrane is permeable to:
- H2O- Gases (O2, CO2, N2)- Lipids- Small, neutral
molecules (such as urea)
• The membrane is impermeable to:
- Small, charged molecules
- “large molecules” such as amino acids, glucose and larger
these compounds must go through channels present in the membrane in order to enter or exit the cell
Factors affecting transport: Chemical gradient
• Compound moves from an area of high concentration to low concentration (or concentration gradient)
• All compounds permeable to the phospholipid bilayer will move this way
Passive transport
• Compounds will move from area of high concentration toward area of lower concentration
• No ATP is needed for this type of transport
Diffusion
• Compounds move toward the area of lower concentration
• Compounds permeable to the cell membrane will move through diffusion. (Compounds unable to pass through the membrane will only pass if membrane channels open)
Osmosis
• Each compound obeys the law of diffusion
• However, some compounds are unable to cross the cell membrane (glucose, electrolytes…)
• Water can cross will enter or exit the cell depending its concentration gradient
• Note: the cell membrane is a semipermeable membrane
Solution tonicity
• Isotonic solution: solution which has the same compound concentration as the cell
• Hypotonic solution: solution having a compound in lower concentration compared to the cell
• Hypertonic solution: solution having a compound in higher concentration compared to the cell
Facilitated diffusion
• Some compounds are unable to diffuse through the membrane.
• They will be allow to cross if the membrane has proteins that can bind these compounds and enable to cross toward the area of lower concentration
Active transport
• Compounds move from area of low concentration toward area of higher concentration
• ATP (energy) is needed pump
ATPase pumps
• The most common: Na/K pumps reestablish membrane potential. Present in all cells.
• Two K+ ions are exchanged with 3 Na + ions
Nucleus
• Contains the chromosomes – 46 in human
• Chromosomes are made of DNA wrapped around proteins (the histones)
Cytoplasm – Ribosomes - Golgi apparatus
• Cytoplasm = cytosol (water + nutrients + salts) + endoplasmic reticulum (membrane)
• Endoplasmic reticulum: can have ribosomes attached to it (rough) or nothing (smooth)
• Ribosomes = special structures in charge of synthesizing proteins
• Golgi apparatus = special area of the ER where proteins are processed
Cell functions
• Multiplication for growth, differentiation
and gamete formation
• Protein synthesis– Transcription – DNA RNA– Translation – RNA proteins
• Interphase: phase between mitosis
• During interphase, the cell grows, functions G1
• If the cell decides to undergo division (mitosis), it will replicate its DNA first S phase
• Then, it will prepare for mitosis G2 (during G2 the cell synthesizes the proteins needed for mitosis
• When everything is ready, then the cell undergo mitosis.
Cell multiplication
• You can watch a few movies on mitosis (no need to remember the names of the various phases)
• Just remember that the daughter cells are identical
• http://www.youtube.com/watch?v=VlN7K1-9QB0
• http://www.youtube.com/watch?v=CzPGhYiGyZ8
• http://www.youtube.com/watch?v=Ru8zC_JRyTI
Protein synthesis: 2 steps• Step 1: a copy of the gene
(located in the nucleus DNA) is made. This copy is a single strand of mRNA = transcription
• Step 2: mRNA then, travels to the cytoplasm where it will be read by the ribosomes. The ribosomes will use the code to assemble the various amino acids
• http://www.youtube.com/watch?v=41_Ne5mS2ls
Step 2: Translation• The ribosomes use the
genetic code in order to know what amino acid to plug in the sequence
• The code is the sequence of 3 nucleotides (=codon) on the mRNA
• http://www.youtube.com/watch?v=1NkLqjQkGHU
Lets practice
• Part of the template strand on the DNA is:
• ATGGCCGTATTGCATCCGAGCTGAATT
• What will be the mRNA strand produced during transcription?
Lets practice
• Part of the template strand on the DNA is:
• ATGGCCGTATTGCATCCGAGCTGAATT
• WHICH STRAND IS THE CORRECT STRAND?
• TACCGGCATAACGTAGGCTCGACTTAA
• Or
• UACCGGCAUAACGUAGGCUCGACUUAA
• This strand travels toward the cytoplasm where ribosomes will translate it.
• UACCGGCAUAACGUAGGCUCGACUUAA
• The process is rather complex. We just want to understand the principle:
• The ribosome will see the first codon UAA and will look for the matching “anticodon-amino acid”.
• The genetic code will show which one it is.
• UAC-CGG-CAU-AAC-GUA-GGC-UCG-ACU-UAA
• Next codon is CGG Arginine
• Next CAU Histidine
• AAC ?
• GUA ?
• GGC ?
• UCG ?
• ACU ?
• UAA ?