The Cell

Cell membrane components• Mostly proteins:

– on the surface receptor– Below the surface mostly enzymes– Across allows compounds to move in and out of the cell

(channels or pumps)

Factors affecting transport: cell membrane

• The cell needs to absorb and excrete various compounds throughout its life.

These compounds need to pass through the membrane which is made from a phospholipid bilayer

• The phospholipid bilayer is formed by phospholipid molecules bipolar molecule: the fatty acid side is hydrophobic, the phosphoric side is hydrophilic

• The membrane is permeable to:

- H2O- Gases (O2, CO2, N2)- Lipids- Small, neutral

molecules (such as urea)

• The membrane is impermeable to:

- Small, charged molecules

- “large molecules” such as amino acids, glucose and larger

these compounds must go through channels present in the membrane in order to enter or exit the cell

Factors affecting transport: Chemical gradient

• Compound moves from an area of high concentration to low concentration (or concentration gradient)

• All compounds permeable to the phospholipid bilayer will move this way

Passive transport

• Compounds will move from area of high concentration toward area of lower concentration

• No ATP is needed for this type of transport

Diffusion

• Compounds move toward the area of lower concentration

• Compounds permeable to the cell membrane will move through diffusion. (Compounds unable to pass through the membrane will only pass if membrane channels open)

Osmosis

• Each compound obeys the law of diffusion

• However, some compounds are unable to cross the cell membrane (glucose, electrolytes…)

• Water can cross will enter or exit the cell depending its concentration gradient

• Note: the cell membrane is a semipermeable membrane

Solution tonicity

• Isotonic solution: solution which has the same compound concentration as the cell

• Hypotonic solution: solution having a compound in lower concentration compared to the cell

• Hypertonic solution: solution having a compound in higher concentration compared to the cell

Facilitated diffusion

• Some compounds are unable to diffuse through the membrane.

• They will be allow to cross if the membrane has proteins that can bind these compounds and enable to cross toward the area of lower concentration

Figure 4.11a

Active transport

• Compounds move from area of low concentration toward area of higher concentration

• ATP (energy) is needed pump

ATPase pumps

• The most common: Na/K pumps reestablish membrane potential. Present in all cells.

• Two K+ ions are exchanged with 3 Na + ions

Phagocytosis

Figure 4.21c

Receptor-mediated endocytosis

• Cell receptors bind to a compound initiate endocytosis

Nucleus

• Contains the chromosomes – 46 in human

• Chromosomes are made of DNA wrapped around proteins (the histones)

Cytoplasm – Ribosomes - Golgi apparatus

• Cytoplasm = cytosol (water + nutrients + salts) + endoplasmic reticulum (membrane)

• Endoplasmic reticulum: can have ribosomes attached to it (rough) or nothing (smooth)

• Ribosomes = special structures in charge of synthesizing proteins

• Golgi apparatus = special area of the ER where proteins are processed

Mitochondria Lysozomes

• Make ATP (the fuel) for the cell

• Contains digestive enzymes

Cell skeleton

• Tubules• Filaments

• Important for cell shape and cell movement

Cell functions

• Multiplication for growth, differentiation

and gamete formation

• Protein synthesis– Transcription – DNA RNA– Translation – RNA proteins

• Interphase: phase between mitosis

• During interphase, the cell grows, functions G1

• If the cell decides to undergo division (mitosis), it will replicate its DNA first S phase

• Then, it will prepare for mitosis G2 (during G2 the cell synthesizes the proteins needed for mitosis

• When everything is ready, then the cell undergo mitosis.

Cell multiplication

• You can watch a few movies on mitosis (no need to remember the names of the various phases)

• Just remember that the daughter cells are identical

• http://www.youtube.com/watch?v=VlN7K1-9QB0

• http://www.youtube.com/watch?v=CzPGhYiGyZ8

• http://www.youtube.com/watch?v=Ru8zC_JRyTI

Protein synthesis: 2 steps• Step 1: a copy of the gene

(located in the nucleus DNA) is made. This copy is a single strand of mRNA = transcription

• Step 2: mRNA then, travels to the cytoplasm where it will be read by the ribosomes. The ribosomes will use the code to assemble the various amino acids

• http://www.youtube.com/watch?v=41_Ne5mS2ls

Step 2: Translation• The ribosomes use the

genetic code in order to know what amino acid to plug in the sequence

• The code is the sequence of 3 nucleotides (=codon) on the mRNA

• http://www.youtube.com/watch?v=1NkLqjQkGHU

Lets practice

• Part of the template strand on the DNA is:

• ATGGCCGTATTGCATCCGAGCTGAATT

• What will be the mRNA strand produced during transcription?

Lets practice

• Part of the template strand on the DNA is:

• ATGGCCGTATTGCATCCGAGCTGAATT

• WHICH STRAND IS THE CORRECT STRAND?

• TACCGGCATAACGTAGGCTCGACTTAA

• Or

• UACCGGCAUAACGUAGGCUCGACUUAA

• This strand travels toward the cytoplasm where ribosomes will translate it.

• UACCGGCAUAACGUAGGCUCGACUUAA

• The process is rather complex. We just want to understand the principle:

• The ribosome will see the first codon UAA and will look for the matching “anticodon-amino acid”.

• The genetic code will show which one it is.

• UAC-CGG-CAU-AAC-GUA-GGC-UCG-ACU-UAA

• Next codon is CGG Arginine

• Next CAU Histidine

• AAC ?

• GUA ?

• GGC ?

• UCG ?

• ACU ?

• UAA ?

So, why is this important?

• Sometimes, mistakes happen.

• If the code is wrong, then the amino acid placed in the protein chain is the wrong one different shape different function most frequently loss of function Mutation!

• Cause of cancer, many genetic diseases