of March 18, 2018.This information is current as

AnergyTarget of CREB/CREM Binding in T Cell

180 Site of the IL-2 Promoter Is the−The

Ronald H. SchwartzJonathan D. Powell, Cara G. Lerner, Gerald R. Ewoldt and

http://www.jimmunol.org/content/163/12/66311999; 163:6631-6639; ;J Immunol 

Referenceshttp://www.jimmunol.org/content/163/12/6631.full#ref-list-1

, 26 of which you can access for free at: cites 44 articlesThis article

        average*  

4 weeks from acceptance to publicationFast Publication! •    

Every submission reviewed by practicing scientistsNo Triage! •    

from submission to initial decisionRapid Reviews! 30 days* •    

Submit online. ?The JIWhy

Subscriptionhttp://jimmunol.org/subscription

is online at: The Journal of ImmunologyInformation about subscribing to

Permissionshttp://www.aai.org/About/Publications/JI/copyright.htmlSubmit copyright permission requests at:

Email Alertshttp://jimmunol.org/alertsReceive free email-alerts when new articles cite this article. Sign up at:

Print ISSN: 0022-1767 Online ISSN: 1550-6606. Immunologists All rights reserved.Copyright © 1999 by The American Association of1451 Rockville Pike, Suite 650, Rockville, MD 20852The American Association of Immunologists, Inc.,

is published twice each month byThe Journal of Immunology

by guest on March 18, 2018

http://ww

w.jim

munol.org/

Dow

nloaded from

by guest on March 18, 2018

http://ww

w.jim

munol.org/

Dow

nloaded from

The 2180 Site of the IL-2 Promoter Is the Target of CREB/CREM Binding in T Cell Anergy

Jonathan D. Powell,1 Cara G. Lerner, Gerald R. Ewoldt, and Ronald H. Schwartz

Anergic T cells display a marked decrease in their ability to produce IL-2 even in the presence of optimal TCR and costimulatorysignals. Using IL-2 enhancer/promoter-driven reporter constructs, we have previously identified a region that appears to be atarget for cis transcriptional repression in anergy. This region of the promoter, which shares partial homology with a consensusAP-1-binding sequence, is located about2180 bp from the transcriptional start site. In the present study, we demonstrate thatcAMP response element-binding protein/cAMP response element modulator (CREB/CREM), activating transcription factor-2/c-Jun, and Jun-Jun/Oct complexes bind to this site. However, the induction of anergy by prolonged stimulation through the TCRled to an increase in binding of only the CREB/CREM complex. Furthermore, the level of binding of this complex appeared tobe up-regulated in both resting and restimulated anergic T cells. Finally, an IL-2 promoter-driven reporter construct that con-tained a mutation that specifically reduced the binding of the CREB/CREM complex displayed a decreased ability to be affectedby anergy, while a construct that contained a mutation that decreased the binding of the Jun-Jun/Oct complex was still susceptible toanergy. These findings suggest that the2180 region of the IL-2 promoter is the target of a CREB/CREM transcriptional inhibitor thatcontributes to the repression of IL-2 production in T cell anergy. The Journal of Immunology,1999, 163: 6631–6639.

T he production of IL-2 and subsequent proliferation by Tlymphocytes require two signaling events (1). Signal onerefers to engagement of the TCR. The second signal or

costimulation is believed to be predominantly mediated by signal-ing through CD28 and results in increased transcription and sta-bilization of IL-2 mRNA. T cells that receive signal 1 in the ab-sence of costimulation not only fail to produce IL-2 andproliferate, but they do not proliferate to subsequent rechallenge, astate known as T cell clonal anergy (2, 3). A hallmark of anergicT cells is that their ability to produce IL-2 even in the presence ofoptimal TCR and costimulatory signals is significantly reduced.On the other hand, anergic T cell clones proliferate fully to exog-enous IL-2, and in fact, incubating them in IL-2 reverses the an-ergic state, restoring their ability to produce IL-2 on rechallenge(4–6).

Examination of TCR-mediated signal transduction in anergiccells has revealed that there is normal CD3z-chain phosphoryla-tion and serine/threonine phosphorylation of the TCRg-chain (7,8). Signaling through the calcium pathway appears to be intact inthat the translocation of NF-AT (1) from the cytoplasm to thenucleus remains unaffected (9). On the other hand, Li et al. (10)were able to demonstrate decreased Jun N-terminal kinase andearly response kinase activation in anergic cells. Fields et al. alsofound a decrease in early response kinase activity and, in addition,showed that the decrease in mitogen-activated protein (MAP)2 ki-

nase activity was a result of decreased p21ras activation (11). In-deed, using multimerized 12-O-tetradecanoylphorbol-13-acetate-responsive element (TRE)-driven reporter constructs, it has beenshown that anergic T cells have a marked decrease in the inductionof TRE-mediated transcription upon stimulation (12). In anergy,presumably, a block in the MAP kinase pathway would result indecreased Jun and Fos induction/activation, and subsequently adecrease in IL-2 transcription.

Our laboratory, and recently others, have suggested that the pro-found block in IL-2 production seen in T cell anergy is not only theresult of a decrease in the production of positive transcription fac-tors as a result of the block in the MAP kinase pathway, but alsoinvolves active negative regulation of IL-2 transcription (13, 14).We have identified a region of the IL-2 promoter that appears to bea target ofcis-negative transcriptional regulation in anergic cells(13). Using T cell clones stably transfected with IL-2 promoter-driven reporter constructs, it was shown that the region locatedabout2180 bp upstream of the transcription start site was neces-sary for the reporter to be susceptible to anergy. Thus, a mutationof this site in a construct that contained the native IL-2 promoterabrogated the ability of the reporter to be down-regulated after theinduction of anergy. These observations suggest that the down-regulation of IL-2 production in anergic T cells involves more thanjust a failure to induce and activate Jun and Fos proteins.

The2180 region of the promoter lies between an NF-kB bind-ing site and the CD28 response element (CD28RE), and is knownas the distal AP-1 site. This designation is based on the fact that thesequence at this site differs from the consensus AP-1 site by 1 bpand proteins from nuclear extracts that had been affinity purifiedusing consensus AP-1 double-stranded oligonucleotides couldbind to this region (15). Jain et al., in their analysis of AP-1 sitesof the IL-2 promoter, failed to demonstrate any binding of proteinsto this site in EMSA (16). On the other hand, some groups havebeen able to demonstrate binding at this site, but by unidentifiedproteins that did not appear to be AP-1 (12, 15, 17).

In light of our functional data demonstrating a role for the2180site in the prevention of IL-2 transcription during anergy, we de-cided to reexamine this region as a possible target for transcription

Laboratory of Cellular and Molecular Immunology, National Institute of Allergy andInfectious Diseases, National Institutes of Health, Bethesda, MD 20892

Received for publication July 9, 1999. Accepted for publication September 30, 1999.

The costs of publication of this article were defrayed in part by the payment of pagecharges. This article must therefore be hereby markedadvertisementin accordancewith 18 U.S.C. Section 1734 solely to indicate this fact.1 Address correspondence and reprint requests to Dr. Jonathan D. Powell, Laboratoryof Cellular and Molecular Immunology, Building 4, Room 111, National Institutes ofHealth, Bethesda, MD 20892-0420. E-mail address: jpowell@niaid.nih.gov2 Abbreviations used in this paper: MAP, mitogen-activated protein; ATF, activatingtranscription factor; CBP, CREB-binding protein; CD28RE, CD28 response element;CREB, cAMP response element-binding protein; CREM, cAMP response elementmodulator; EGR, early gene response; HMG(I) Y, high mobility group (I) Y; PCC,pigeon cytochromec; TRE, 12-O-tetradecanoylphorbol-13-acetate response element.

Copyright © 1999 by The American Association of Immunologists 0022-1767/99/$02.00

by guest on March 18, 2018

http://ww

w.jim

munol.org/

Dow

nloaded from

factor binding. Our approach was 2-fold. First, we utilized nuclearextracts from the thymoma EL-4 as well as recombinant proteinsin EMSAs. This provided us with an abundant source of transcrip-tion factors and facilitated the optimization of binding conditionsas well as the identification of factors that could bind to this site.This approach yielded the identification of four protein-DNA-binding complexes, three of which were determined to consist ofAP-1 and cAMP-responsive element-binding protein (CREB) fam-ily members. Second, we examined extracts from anergic T cellclones to determine which of these factors might play a role in thetranscriptional block seen in anergy. The binding of only one ofthese complexes, which consists of CREB-1 and cAMP-responsiveelement modulator (CREM) proteins, was up-regulated in anergicextracts. Most importantly, using IL-2 promoter-driven reporterconstructs containing mutations that selectively reduced the bind-ing of the CREB-1/CREM complex, we are able to demonstrate arole for the binding of this complex in promoting the inhibition ofIL-2 transcription in anergy.

Materials and MethodsCell lines and culture conditions

EL-4 is a murine T cell lymphoma and A.E7 is a CD41, Th1, pigeoncytochromec (PCC)-specific T cell clone (18, 19). Both EL-4 cells and theA.E7 T cell clone were maintained in medium consisting of equal volumesof RPMI 1640 and Eagle’s Hank’s amino acids (Biofluids, Rockville, MD)supplemented with 10% FCS, 53 1025 M 2-ME, 4 mM glutamine, andantibiotics, at 37°C in a 5% CO2 humidified incubator. The A.E7 T cellclone was expanded as previously described (6). In general, the cells werestimulated with Ag for 48 h and then expanded in 10 U/ml of IL-2, ap-proximately every 3 wk. The T cells were not utilized in experiments forat least 12 days after expansion to allow them to rest down.

Anergy induction

Anergy was induced as previously described (13). Briefly, 1003 106 cellswere incubated overnight in T 162-cm2 tissue culture flasks that had beenprecoated with 10mg/ml of anti-TCR Ab (anti-TCR-b Ab H57-597) (20).The cells were then harvested using a cell scraper, washed, and rested fora minimum of 5 days in fresh medium that did not contain IL-2. Prolifer-ation to Ag was performed by incubating 203 103 cells with 5003 103

splenocytes (irradiated with 3000 rad) from B10.A mice as APCs withvarying doses of PCC, in 0.2 ml of complete medium in 96-well plates. Thecultures were pulsed with [3H]thymidine at 48 h and harvested at 64 h.Exogenous rIL-2 (R&D Systems, Minneapolis, MN) was added to a trip-licate of each sample in the absence of Ag as a positive control for func-tional viability. The cells were tested for their ability to produce IL-2 byincubating 5003 103 cells in anti-TCR-coated 24-well plates (Costar,Cambridge, MA) with 1/5000 dilution of ascitic fluid containing anti-CD28mAb 37.51 (a gift of Dr. J. Allison, University of California, Berkeley, CA)in a total volume of 0.5 ml (21). Supernatant fluid was collected after 16 h,and IL-2 activity was determined by measuring proliferation of the IL-2-dependent CTLL cell line (American Type Culture Collection, Manassas,VA), as previously described (13).

Preparation of nuclear extracts

Nuclear extracts from EL-4 cells and the A.E7 T cell clone were preparedby modification of the procedure of Dignam et al. (22). The cells were firstincubated on ice for 15 min with 10 mM HEPES, pH 8, 10 mM KCL, 0.1mM EDTA, 0.1 mM EGTA, 3.3mg/ml aprotinin, 10mg/ml leupeptin, 2.5mM 4-(2-aminoethyl)-benzenesulfonylfluoride hydrochloride, and 1 mMDTT. Next, an equal volume of the same solution with 2% Triton-X wasadded, and the cells were mixed for 15 s and spun in a microcentrifuge at10,000 rpm for 30 s. The supernatant fluid was discarded and the nuclearpellet was resuspended in a solution containing 20 mM HEPES, 0.4 MNaCl, 1 mM EDTA, 1 mM EGTA, protease inhibitors, and 1 mM DTT.The final concentration of the nuclear extract was adjusted to 4003 103

cells/ml for the EL-4 extracts and 13 106 cells/ml for the A.E7 extracts.The resuspended nuclear pellet was incubated rocking for 30 min at 4°Cand then was spun at 12,000 rpm in a microcentrifuge to remove insolublematerial. The extracts were frozen at270°C until they were assayed.

Electrophoretic mobility shift assays

EMSA were conducted using 4% polyacrylamide gels, as previously de-scribed, with some modifications (13). Nuclear extracts (1–3ml) were in-cubated with 30,000 cpm of32P end-labeled, double-stranded oligonucle-otide probe (10–50 pg) with 0.1–1mg of poly(dG)zpoly(dC) (Sigma, St.Louis, MO) in 4.5 mM Tris, 32.5 mM KCl, 2 mM DTT, 1 mM EDTA, 10%glycerol, 0.03% Nonidet P-40, and 100mg/ml BSA at 4°C for 30 min. Gelelectrophoresis was then run at 4°C. Where noted, poly(dIz dC) was usedin place of poly(dG)zpoly(dC) as the nonspecific competitor. It was foundthat the dose of poly(dIz dC) and poly(dG)zpoly(dC) needed for optimalbinding varied between preparations. Thus, each new batch was titrated foroptimal results. In some assays, recombinant proteins were utilized inEMSA. Where indicated, 0.01–1 protein footprint units (optimum bindingwas batch dependent) of recombinant c-Jun (Promega, Madison, WI; cat-alogue E3061) were added to the binding reaction, while 25 ng of rCREM(Santa Cruz Biotechnology, Santa Cruz, CA; catalogue sc-4005) was used.The dsDNA probes of the2180 site utilized were the following: SLD-2,AATCCATTCAGTCAGTGTATGGGGGT; LD, AATCCATTCAGTCAGTGTATGGGGGGTTTAAA; LDM-1, AATCCATTCttgCAGTGTATGGGGGTTTAAA; and SLD-12, CCATTCAGTCAGTGTATGGGGGT.

Additionally, dsDNA probes of the following sequences were used forcold competition analysis: NF-IL-2a, GAAAATATGTGTAATATGTAAAACATCGT (15); TRE proximal (2150 AP-1 site), GAAATTCCAGAGAGTCATCAGAAGA (15); NF-AT, TCGACCAAAGAGGAAAATTTGTTTCATACAGAG (15); consensus AP-1, CGCTTGATGAGTCAGCCGGAA (Promega; E3201); consensus octamer (Oct), TGTCGAATGCAAATCACTAGAA (Santa Cruz Biotechnology; sc-2506); con-sensus EGR, GGATCCAGCGGGGGCGAGCGGGGGCGA (Santa CruzBiotechnology; sc-2530); and consensus CREB, AGAGATTGCCTGACGTCAGAGAGCTAG. (Santa Cruz Biotechnology; sc-2504).

EMSA analysis

All blots were developed by the STORM PhosphorImager (Molecular Dy-namics, Sunnyvale, CA). All comparisons concerning band density weremade for each individual gel, as there was great variation in backgroundbetween gels. Quantification of each of the bands was determined by thePhosphorImager using a fixed area and by using the object average pro-gram (Imagequant; Molecular Dynamics) for determining the background.In this way, the background was determined for each individual lane andsubtracted from the band density to account for interlane backgroundvariation.

Supershift analysis and immunodepletion

Nuclear extracts were preincubated with 1mg of the indicated Abs for 30min before the addition of the labeled probe. The following Abs wereobtained from Santa Cruz Biotechnology: antiactivating transcription fac-tor-2 (ATF-2) (sc-6233x), broadly reactive anti-c-Jun (sc-044x), specificanti-c-Jun (sc-045x), broadly reactive anti-CREB-1 (sc186x), specific anti-CREB-1 (specific sc-240x), anti-CREM (sc-440x), anti-Oct-1 (sc-232x),anti-Oct-2 (sc-233x), and anti-c-Rel (sc-272x). For immunodepletions, 30ml of protein A/G beads (Santa Cruz Biotechnology) were preincubatedwith 10 mg of Ab for 1 h, while rocking at 4°C. The beads were washedthree times with PBS and then incubated for 2 h with 12ml of extract and48 ml of H20, while rocking at 4°C. The beads were spun down, and 10mlof the supernatant fluid was assayed by EMSA.

Western blot analysis

Nuclear extracts utilized in EMSA were subjected to 10% polyacrylamidegel electrophoresis, transferred to nitrocellulose, and blotted with the fol-lowing Abs: Anti-CREM (sc-440x, 1mg/ml), anti-CREB (sc-186x, 1mg/ml), and anti-phospho-CREB (1mg/ml; Upstate Biotechnology, LakePlacid, NY). The secondary Ab consisted of an alkaline phosphatase-la-beled anti-rabbit (Sigma), and the blot was developed with Vistra ECFsubstrate (Amersham, Arlington Heights, IL) using the blue fluorescencemode of the STORM PhosphorImager.

Site-directed mutagenesis and transfections

Reporter assays were performed using a luciferase reporter gene (pGL-2;Promega) driven by 353 bp of the 59IL-2 promoter. Specific mutationswere made using the Quick-Change site-directed mutagenesis kit (Strat-agene, La Jolla, CA). The following primers were used to generate themutations: M-1, 59-CCGACCAAGAGGGATTTCACCTAAATCCATCCATTCTTGCAGTGTATGG-39 (forward), 59-CCATACACTGACTGAACAGAACAGATTTAGGTGAAATCCCTCTTGGTC-39 (reverse); M-6, 59-GAGGGATTTCACCTAAATCCATTCAGTGCGTGTATGGGGGGTTTAAAG-39 (for-ward), 59-CTTTAAACCCCCATACACGCACTGAATGGATTTAGGTGAAA

6632 CREB/CREM IN T CELL ANERGY

by guest on March 18, 2018

http://ww

w.jim

munol.org/

Dow

nloaded from

TCCCTC-39 (reverse); M-12, 59-CCATACACTGCAAGAATGGATTTAGGTGAAATCCCTCTTGGTCGG-39 (forward), 59-GACCAAGAGGGATTTCACCTAAATCTGTTCAGTCAGTGTATGG-39 (reverse). The fidelity of the muta-tions was checked by sequencing on an ABI 377 automated sequencer.

Transfections were performed using plasmid-coated gold particles anda gene gun (Bio-Rad, Richmond, CA), as previously described, with somemodification (23). Briefly, anti-CD44-coated 35-mm dishes were layeredwith 10 million A.E7 cells. The gold beads were coated with 10mg ofDNA. To eliminate the variation in transfection efficiency between trans-fections, each condition was derived by pooling cells from multiple trans-fections. Cotransfection with SV40-driven Renella luciferase (Promega)revealed that both normal A.E7 and anergic A.E7 cells could be transfectedwith equal efficiency; however, the presence of the second plasmid ap-peared to affect the activity of the mutated reporter plasmids (data notshown). Therefore, in all of the experiments shown, the cells were trans-fected with only one reporter construct. The cells were stimulated over-night in six-well plates (10 million cells/well) that had been previouslycoated with anti-TCR Ab (H57, 10mg/ml). Luciferase activity was deter-mined using a luciferase reporter kit (Promega) and a femtomaster FB-12luminometer (Zylux, Maryville, TN). Data were evaluated for statisticalsignificance by a Student’st test.

ResultsMultiple protein complexes can bind to the2180 site

In light of our functional data defining the2180 site as a target ofnegative transcriptional regulation in anergy, our initial goal was todetermine what, if any, transcription factors bind to this region ofthe IL-2 promoter. To this end, we first performed a series ofexperiments using nuclear extracts from the immortal T cell lym-phoma EL-4, which provided us with an abundant source of nu-clear extracts. As seen in Fig. 1A (lane 1), once EMSA conditionswere optimized, we were able to observe the binding of four pro-tein-DNA complexes at this site. Of note, when the EMSA wereperformed with poly(dIz dC) as the nonspecific DNA in the bind-ing buffer, the formation of these bands was inhibited (data notshown). Poly(dIz dC) is known to inhibit the binding of transcrip-tion factors that bind to the minor groove of DNA. We hypothesizethat this is the reason that Jain et al. (16) were unable to demon-strate binding at this site.

Identification of bands I, II, and III

A series of cold competition assays was performed as a screeningmethod to gain insight into which proteins were involved in theformation of each of the four protein-DNA complexes. Nuclearextracts were prepared from unstimulated EL-4 cells and run in anEMSA with the labeled SLD-2 probe in the presence and absenceof various unlabeled probes as cold competitors. As seen in Fig.1A, all four bands are competed by excess (503) cold SLD-2 (lane2), but not by an excess of an unlabeled irrelevant (EGR) dsDNAprobe (lane 5). An unlabeled probe with the consensus metallo-thionein AP-1 sequence completely eliminates bands I, II, and IV

FIGURE 1. Bands I, II, and III contain CREB and AP-1 family memberproteins.A, EMSA was performed using unstimulated EL-4 extracts andthe labeled probe SLD-2 in the absence (lane 1) and the presence (lanes2–5) of a 503 unlabeled dsDNA probe as a competitor.Lane 2has theunlabeled self probe,lane 3the unlabeled consensus AP-1 probe,lane 4theunlabeled consensus CREB probe, andlane 5 the unlabeled consensusEGR probe.B, EMSA was performed using unstimulated EL-4 extractsand the labeled probe SLD-2 in the absence (lane 1) and presence (lanes2–5) of 1 mg of various Abs.Lane 2has anti-ATF-2 (p, denotes super-shifted band),lane 3 has anti-c-Jun (pp, denotes supershifted band), andlane 4 has anti-CREB-1.C, EMSA was performed using unstimulated

EL-4 extracts and labeled LD probe in the absence (lane 1) and presence(lanes 2–5) of a 1003 unlabeled dsDNA probe as a competitor.Lane 2hasthe unlabeled self probe,lane 3 has the unlabeled LDM-1 probe(TTCAGTC3TTCttgCA), lane 4has the unlabeled NF-IL-2a probe,lane5 has the unlabeled NF-AT probe,lane 6has the unlabeled consensus AP-1probe, andlane 7has the unlabeled consensus Oct probe.D, EMSA wasperformed using unstimulated EL-4 extracts that had been immunodepletedof various transcription factors and assayed with labeled LD probe. Ex-tracts were incubated in the cold with protein A/G beads that had beenpreincubated with Abs. The beads were spun down and the supernatantfluid was used in the shift assay.Lane 1 was preincubated with beadswithout Ab (mock),lane 2 was depleted of ATF-2,lane 3 was depletedwith a broadly reactive Jun Ab,lane 4was depleted of Jun B,lane 5wasdepleted of Oct -1 and Oct-2, andlane 6was depleted of CREB-1.

6633The Journal of Immunology

by guest on March 18, 2018

http://ww

w.jim

munol.org/

Dow

nloaded from

and decreases band III (lane 3). This suggests that all four bandscontain proteins that have some affinity for the consensus AP-1binding site. Additionally, both bands I and II were completelyeliminated by an unlabeled consensus CREB probe (lane 4) andband III was diminished to a much lesser degree. This result raisedthe possibility that CREB family member proteins might be bind-ing to this site. Interestingly, both the cold consensus AP-1 andconsensus CREB probes failed to completely inhibit band III. Thismay indicate that this protein-DNA complex has higher affinity forthe native AP-1-like sequence contained in the SLD-2 probe thanthe consensus sequences contained in the cold competitors.

In light of the cold competition data, supershift analyses wereperformed utilizing Abs against various CREB and AP-1 familymembers. Fig. 1Bdemonstrates that anti-ATF-2 Abs completelysupershift band I while having no effect on bands II and III (lane2). Anti-c-Jun also supershifts band I to some extent (lane 3),suggesting that band I contains at least an ATF-2/c-Jun het-erodimer. Anti-CREB-1 (lane 4), anti-ATF-1, and anti-JunB (datanot shown) had no effect on this band. Band II, on the other hand,is completely eliminated by an anti-CREB-1 Ab (lane 4). Thissuggests that band II contains CREB-1, although this particular Abalso cross-reacts with other CREB family members. Anti-ATF-1Ab (data not shown) and anti-ATF-2 (lane 2) did not supershiftthis band. Thus, although band II was competed by both cold con-sensus cAMP response element and AP-1 DNA probes, the super-shift data suggest that this complex consists of CREB family mem-bers. Such a finding is not without precedence. Masquilier et al.(24) have demonstrated the ability of CREB and CREM to bind toAP-1 binding sites and in fact inhibit AP-1-mediated transcriptionat these sites. Finally, in spite of the cold competition data dem-onstrating that unlabeled AP-1 and CREB probes could partiallycold compete band III (Fig. 1A), none of the Abs supershiftedthis band.

To identify the proteins that comprise band III, we screenedmultiple dsDNA consensus probes in cold competition EMSA us-ing a labeled LD probe (this probe enhances the binding of bandIII). A representative experiment is shown in Fig. 1C. As seen inlane 2, band III is reduced by the presence of excess unlabeled selfprobe. The specificity of the protein-DNA interaction is demon-strated by the fact that the band is not competed by the unlabeledmutated probe LDM-1 (lane 3). Band III is partially inhibited bythe presence of unlabeled NF-IL-2a (lane 4). This latter sequence,an element of the proximal IL-2 promoter, has been shown to bindNF-AT, AP-1, and Oct proteins (15). An unlabeled consensusNF-AT double-stranded probe did not cold compete (lane 5); how-

ever, consensus AP-1 and Oct sequences did partially inhibit bind-ing (lanes 6and7). These data suggest a possible role for AP-1and Oct proteins in the formation of band III. Anti-Oct-1 and anti-Oct-2 Abs, as well as anti-Jun B Abs sometimes resulted in thepartial inhibition of band III formation (data not shown). Further-more, band III formation was repeatedly reduced by immunodeple-tion of the extracts with anti-JunB and anti-Oct Abs. Fig. 1Dshows a representative experiment of this immunodepletion. Ex-tracts depleted with an anti-pan Jun Ab (lane 3), anti-Jun B (lane4), or anti-Oct 1 and anti-Oct 2 (lane 5) showed decreased forma-tion of band III. The specificity of the immunodepletion is dem-onstrated by the fact that the depletion of multiple other factorsincluding ATF-2 (lane 2) and CREB-1 (lane 6), shown to play arole in bands I and II, had no effect on band III. Of note, multipleanti-Fos antisera failed to supershift or immunodeplete band III(data not shown).

Thus, these data and the cold competition experiments suggestthat Jun and Oct proteins participate in the formation of band III.However, the inability to completely eliminate band III may indi-cate that other proteins also bind at this site. The binding of Oct,CREB, or AP-1 family member proteins to a region of a promoterthat does not contain consensus sequences for their binding hasprecedent in several promoters, including the proximal IFN-g pro-moter (25). Furthermore, Sterling and Bresnick have identified anegative regulatory element of the liver-specific CYP1A1 pro-moter that shares partial homology with the2180 site and bindsOct proteins (26).

Nuclear extracts from anergic T cell clones

Having utilized nuclear extracts from the T cell lymphoma EL-4 tocharacterize three protein-DNA complexes that can bind to the2180 site, we next wanted to determine which, if any, of thesecomplexes might be involved in anergy. A.E7 is a PCC-specificTh1-type murine T cell clone maintained in our laboratory. Whenthese cells are stimulated overnight with signal 1 alone, in the formof plate-bound anti-TCR Abs, then washed and rested, such cellsare hyporesponsive to subsequent full rechallenge with anti-TCRand anti-CD28 (signal 11 2). As seen in Fig. 2A, the anergic A.E7cells show a marked decrease in their ability to proliferate to PCC.They proliferate, however, as well as nonanergic cells to exoge-nous IL-2 (see legend). Even more striking is their inability toproduce IL-2 under optimal stimulatory conditions (Fig. 2B).

Initial experiments were designed to examine binding to the2180 site by components of nuclear extracts derived from T cellsimmediately following anergy induction. As shown in Fig. 3A,

FIGURE 2. Anergic T cells fail to proliferate andproduce IL-2 upon rechallenge.A, A.E7 cells wereanergized, rested for 5 days, and then assayed for Ag-specific proliferation, as described inMaterials andMethods. Note that both the anergized cells and thenonanergized cells responded equally well to exoge-nous IL-2 (60,922 cpm vs 59,570 cpm, respectively).B, A.E7 T cells were anergized (AN), rested 5 days,and then stimulated overnight with plate-bound anti-TCR and anti-CD28. Supernatant fluid was collectedfrom stimulated and unstimulated cultures and testedfor IL-2 production, as described inMaterials andMethods.

6634 CREB/CREM IN T CELL ANERGY

by guest on March 18, 2018

http://ww

w.jim

munol.org/

Dow

nloaded from

EMSA was performed on nuclear extracts obtained from A.E7cells that were mock stimulated or stimulated with anti-TCR for16 h to induce anergy.Lane 1shows the binding pattern of EL-4nuclear extracts for comparison. The EL-4 extracts in this partic-ular experiment using the probe SLD-2 demonstrate prominentband I and band III binding and minimal band II binding. In con-trast, extracts from resting A.E7 cells demonstrate slight binding ofall three complexes (lane 2). Interestingly, the extract from theA.E7 cells stimulated to induce anergy shows increased bindingonly of band II (lane 3). The Jun containing band III, which is soprominent in the extracts from the immortalized EL-4 cells, isbarely detectable in the extracts from the T cell clones. The fourth,faster migrating band seen with the EL-4 extracts is also present inthe A.E7 extracts and was unaffected by the activation status of thecell (data not shown). Thus, under the stimulatory conditions thatlead to the induction of anergy, the level of binding of band II (the

CREB complex) appears to be selectively up-regulated in the A.E7T cell clones.

Next, we examined nuclear extracts from fully rested and stim-ulated anergic cells. A.E7 cells were anergized by stimulation withanti-TCR overnight, and the cells were then washed and rested for5 days. These are the same cells that were tested functionally foranergy in Fig. 2. Nuclear extracts were made from the restinganergic cells and their nonanergic counterparts as well as anergicand nonanergic cells that had been stimulated for just 3 h withanti-TCR and anti-CD28. As seen in Fig. 3A, there is enhancedbinding of band II in the extract from the resting anergic T cellscompared with their nonanergic counterpart (20.9 vs 7.7 arbitraryunits, respectively, by PhosphorImager analysis). In both the non-anergic and anergic extracts, stimulation up-regulated band II:lanes 4and5, 7.7–17.5, andlanes 6and7, 20.9–35.6, respectively.Note that all numbers were derived by subtracting the backgroundfrom each lane to account for the interlane background differences.The faint band I in the resting anergic extracts and the small in-crease in band III in the stimulated anergic extracts were not al-ways observed in other experiments (Fig. 3B). In contrast, the in-creased formation of band II using extracts from anergic cellscompared with extracts from nonanergic cells was always ob-served, although the magnitude of the increase was variable.Among multiple experiments (.10), band II binding from the an-ergic extracts was anywhere from 1.5–6-fold increased comparedwith the extracts from the nonanergic cells.

From the experiments utilizing the EL-4 nuclear extracts, wedetermined that band II contained CREB family member proteins.To determine whether this was also the case for the anergic ex-tracts, as well as to use more specific Abs to further characterizethis band, a supershift experiment was conducted using nuclearextracts from stimulated anergic cells (Fig. 3B). In this experiment,once again the most prominent (only) complex observed is band II.This band is eliminated with the broadly reactive CREB antiserum(lane 2). Furthermore, band II is supershifted by a CREB-1-spe-cific antiserum (lane 3), as well as by a CREM-specific antiserum(lane 4). No effect was seen with an anti-ATF-1 antiserum (lane5). These data suggest that band II contains a CREB/CREM het-erodimer. CREM, which is known to form heterodimers withCREB, has a very similar DNA binding domain as that of CREB;however, most of the CREM isoforms lack a transactivating do-main, and thus, CREB-CREM heterodimers and CREM-CREMhomodimers have been shown to be inhibitors of transcription(27). Thus, band II, the complex whose binding is up-regulated in

FIGURE 3. Band II binding is up-regulated in anergy.A, EMSA wasperformed using the labeled probe SLD-2, which demonstrates the bindingof all three bands.Lane 1, Resting EL-4 nuclear extracts;lane 2, restingA.E7 nuclear extracts;lane 3, extracts from A.E7 cells stimulated for 16 hwith anti-TCR. In a second experiment, nuclear extracts were preparedfrom resting A.E7 T cells and anergic A.E7 T cells, as well as from anergicand nonanergic cells stimulated for 3 h with anti-TCR and anti-CD28. Notethat these extracts were prepared from the same aliquot of cells utilized inthe functional studies in Fig. 2,A and B. EMSA was performed usinglabeled SLD-2 with extracts from:lane 4, resting A.E7 cells;lane 5, stim-ulated A.E7 cells;lane 6, resting anergic A.E7 cells; andlane 7, stimulatedanergic A.E7 cells.B, Band II consists of a CREB/CREM heterodimer.EMSA was performed using nuclear extracts from stimulated anergic A.E7cells, a labeled SLD-2 probe, and various anti-CREB family member Absfor supershift analysis.Lane 1, no Ab; lane 2, broadly reactive anti-CREB-1;lane 3, anti-CREB-1 (p, denotes supershifted band);lane 4, anti-CREM (pp, denotes supershifted bands); andlane 5, anti- ATF-1. In ex-periments not presented, the supershifted band (p) was shown not to beband I (ATF-2/c-Jun).

FIGURE 4. The levels of CREB and CREM are not increased in anergy.EMSA was performed using nuclear extracts from A.E7 cells mock stim-ulated (denoted, M) or stimulated overnight with plate-bound anti-TCR toinduce anergy (denoted, A).A, EMSA of the nuclear extracts using labeledSLD-2 probe.B, Western blot analysis of the same nuclear extracts. Notethat the anti-CREB and anti-phospho-CREB Abs cross-react with CREM(lower band).

6635The Journal of Immunology

by guest on March 18, 2018

http://ww

w.jim

munol.org/

Dow

nloaded from

the anergic state, consists of transcription factors known to partic-ipate in the inhibition of transcription.

To determine whether the increased binding of CREB/CREM atthe 2180 site in anergy was due to an increase in the amount ofCREB and CREM found in the extracts derived from the anergiccells, A.E7 cells were either mock stimulated (denoted: M), orstimulated with plate-bound anti-TCR for 16 h to induce anergy(denoted: A), and nuclear extracts were obtained. As seen in Fig.4A, there is an increase in band II in the extracts derived from theanergic cells. Western blot analysis of the same nuclear extracts(Fig. 4B) does not reveal any differences in total CREM or CREB.The lower band in the CREB and phospho-CREB blots is CREM,as both Abs cross-react with CREM. There is a slight increase,however, in the levels of phosphorylated CREB and CREM (upperand lower bands, respectively). Thus, it does not appear that thedifferences in binding of CREB and CREM to the2180 site aredue to quantitative differences in their expression, but rather maybe due to qualitative differences such as their phosphorylationstatus.

Differential binding properties of the CREB/CREM and Jun-Jun/Oct complexes

To determine whether we could further dissect the binding prop-erties of each of the protein complexes and in so doing define theirrole in either promoting or inhibiting transcription, we used theSLD-12 probe as a backbone (it is the minimal probe able to bindall three complexes). By using a series of deletion mutants, we haddetermined that the CREB/CREM complex appeared to bind the2180 site and the region immediately 59 of this site, while the Jun-Jun/Oct complex appeared to bind to the2180 site and the regionimmediately 39 of this site (data not shown). Based on these data,mutations were made to try to selectively inhibit the binding of theCREB/CREM complex or the Jun-Jun/Oct complex. M-6 is a 2-bpmutation of the last 2 bases of the 39 end of the2180 site. Likewise,a 2-bp mutation (M-12) was made in the CCA sequence immediately59 of the 2180 site. The consequences of these mutations on thebinding of each of the complexes are depicted in Fig. 5. InA, usingextracts from stimulated anergic A.E7 cells, we see that the M-6 mu-tation results in enhancement of both band I and band II, while theM-12 mutation leads to a diminution of both of these bands. In ad-dition, band III, barely detectable using the wild-type probe, is moreprominent when band II is inhibited by the M-12 mutation. UsingEL-4 extracts, we see the same pattern of binding for each of themutations (B). Note that whereas there is very little band II whenusing the EL-4 extracts with the WT probe (B, lane 1), when the M-6mutation is present, not only does this result in a decrease in thedominant band III, but it also results in a dramatic up-regulation ofband II binding (B, lane 2). This suggests that the lack of substantialband II binding observed for the EL-4 extracts is not secondary to adeficiency in CREB and CREM proteins, but rather the ability of theJun-Jun/Oct complex to outcompete the CREB/CREM complex forbinding to the central part of the2180 site.

Consistent with these data are the effects of these mutations on thebinding of recombinant proteins. As seen in Fig. 5C, the M-6 muta-tion has no effect on recombinant CREM binding, but the M-12 mu-tation results in a decrease in CREM binding. On the other hand (asseen in Fig. 5D), the M-6 mutation results in the diminution of re-combinant Jun binding, while the M-12 mutation actually results in anincrease in Jun binding. Note that we have observed that both therecombinant CREM and c-Jun proteins appear as doublets. The exactnature of these two bands is unclear, but may be due to degradation ofthe bacterially produced protein.

To further demonstrate the differential binding properties of therecombinant CREB and Jun, we performed cold competition ex-periments using the mutated probes. As seen in Fig. 5E, the bind-ing of recombinant CREM to labeled SLD-12 is nearly completelycompeted away by 100X unlabeled SLD-12 M-6 (which containsthe 39 mutation). In contrast, the addition of 100X unlabeledSLD-12 M-12 (which contains the 59 mutation) was less effectivein competing with the labeled SLD-12 probe. Alternatively (Fig.5F), recombinant Jun is preferentially cold competed by SLD-12M-12 and less so by the SLD-12 M-6. Taken together, the bindingdata presented in Fig. 5 support the notion that CREM and band IIrely upon the 59region of the2180 site for binding, while Jun andband III rely upon the 39 region of the2180 site for binding.

Correlating protein-DNA binding with function

Although we have been able to demonstrate the binding of fourprotein-DNA complexes to the2180 site, only the formation ofthe CREB/CREM complex appears to be up-regulated in nuclearextracts from anergic T cells. This provided circumstantial evi-dence that the CREB/CREM complex was involved in promotinganergy. We wanted to address this hypothesis functionally. Based

FIGURE 5. Differential binding properties of the CREB/CREM and theJun-Jun/Oct complexes. EMSA was performed utilizing the core probeSLD-12 (lane 1), the same probe with a mutation in the 39 region of the2180 site, SLD-12 M-6 (lane 2), or a mutation 59 of the 2180 site, andSLD-12 M-12 (lane 3).A was run using stimulated anergic A.E7 extracts,B with EL-4 extracts, whileC, E andD, F contained recombinant CREM(25 ng) and c-Jun (0.01 protein footprint units), respectively. For the re-combinant proteins, 10 ng of poly(dG) poly(dC) and 10 ng of poly(dI dC)were added to the CREM and c-Jun-binding reactions, respectively. ForEand F, recombinant CREM and Jun, respectively, were incubated withlabeled SLD-12 and 1003 of either unlabeled SLD-12 M-6 or SLD-12 M-12.

6636 CREB/CREM IN T CELL ANERGY

by guest on March 18, 2018

http://ww

w.jim

munol.org/

Dow

nloaded from

on our binding data, we would predict that the M-12 mutation thatdisrupts the binding of CREB/CREM would also impair the abilityof a reporter construct to be affected by anergy. Conversely, be-cause inhibiting the binding of the Jun-Jun/Oct complex did notimpair CREB/CREM binding, we would predict that the M-6 mu-

tation would not inhibit an anergic effect. To this end, luciferasereporter constructs driven by the 59 353 bp of the IL-2 promoterwere made containing the M-1, M-6, and M-12 mutations. Theseconstructs were examined in transient transfection assays using agene gun that facilitated the transfection of our nonimmortalizedA.E7 T cell clones. A.E7 or anergic A.E7 cells were transfectedwith each of the plasmids and stimulated overnight in anti-TCR-coated six-well plates. Preliminary experiments using the gene gundetermined that overnight stimulation was optimal, and that theluciferase activity of unstimulated transfected A.E7 cells was typ-ically less than 200 relative light units/s (data not shown).

Fig. 6A depicts the luciferase activity of a representative exper-iment, while Fig. 6Bdepicts the fold difference between the aner-gic and nonanergic cells for this experiment. This pattern of inhi-bition is representative of multiple experiments, as seen in Fig. 6C,in which the data are presented as the geometric mean fold differ-ences between luciferase values from the nonanergic and anergiccells. As seen in Fig. 6A, the constructs that contained mutations inthe2180 site demonstrate decreased luciferase activity in nonan-ergic cells when compared with the WT constructs. This is con-sistent with the data of Jain et al. (16), who observed 2–4-folddecreases in reporter activity by mutating the2180 site.

There was a significant decrease in IL-2 promoter-driven lucif-erase activity in the anergic cells transfected with the WT pro-moter, when compared with their nonanergic counterparts (Fig.6C). In contrast, there was no significant difference between theluciferase activity of the anergic and nonanergic cells transfectedwith the construct that contained the M-1 mutation, which inhibitsthe binding of all transcription factors to the2180 site. Similarresults were obtained utilizing reporter constructs containing theM-12 mutation, which impairs the binding of the CREB/CREMcomplex (as well as the ATF-2/c-Jun complex), but leaves theJun-Jun/Oct binding intact. The M-6 mutation, on the other hand,which impairs the binding of the Jun-Jun/Oct complex and favorsthe binding of the CREB/CREM complex, retained the ability to besuppressed under anergic conditions. This pattern of results hasalso been obtained in two experiments using A.E7 cells stablytransfected with WT, M-1, and M-12 reporter constructs (data notshown). Thus, only mutations that impair the binding of theCREB/CREM complex decrease the susceptibility of the reporterconstructs to anergy, supporting a role for this complex in main-taining the anergic state. Because the binding of the ATF-2/c-Juncomplex is also impaired by the M-12 mutation, we cannot rule outa role for this complex as well in anergy.

DiscussionAlthough it is referred to as the distal AP-1 site, the2180 site doesnot share precise homology with the consensus AP-1 sequence(15). Indeed, previously, neither our group nor others have beenable to demonstrate the binding of Jun/Fos heterodimers to thisregion of the IL-2 promoter (12, 16). Furthermore, the functionalrole, if any, that Jun/Fos heterodimers play at this site was unde-fined. The present study not only demonstrates an increase inCREB/CREM binding at this site in extracts derived from anergiccells, but also functionally correlates the binding of the CREB/CREM complex to anergy using mutated IL-2 promoter-drivenreporter constructs. Because there was less of a difference in thereporter activity between the anergic and nonanergic cells trans-fected with the M-1 and M-12 constructs, these data suggest thatthe profound decrease in IL-2 production seen in anergy is notexclusively due to a decrease in activated Jun and Fos production,but also involvescisdominant negative regulation of transcription.

FIGURE 6. Correlation of binding and susceptibility to anergy. A.E7and anergic A.E7 cells were transfected with IL-2-driven luciferase plas-mids that contained the various mutations of the2180 region (M-1, M-6,M-12, or WT). The transfected cells were stimulated overnight with anti-TCR, and luciferase activity was determined.A shows the luciferase ac-tivity for a representaive experiment.B depicts the fold difference in lu-ciferase activity from the experiment inA between the anergic andnonanergic cells. InC, the data are presented as the geometric mean folddifference in activity between the nonanergic and anergic transiently trans-fected cells, taken from multiple experiments (N). The error bars depictthe SEM.

6637The Journal of Immunology

by guest on March 18, 2018

http://ww

w.jim

munol.org/

Dow

nloaded from

The differential binding properties of Jun and CREB family pro-teins to the2180 site present a potential mechanism for regulationat this site. For the proximal IFN-g promoter, Penix et al. (25) haveshown that the binding of ATF-1/CREB can inhibit transcription,while the binding of ATF-2/Jun (which is favored during activa-tion) can enhance transcription. Interestingly, band II often ap-peared as a minor band in extracts from the immortalized, nonan-ergizable EL-4 cells (Fig. 5B). When Jun-Jun/Oct binding wasinhibited by the M-6 mutation, however, the CREM band becameprominent, suggesting that the Jun complex (band III) might beinhibiting CREB/CREM binding.

CREB/CREM protein binding at the2180 site is up-regulatedupon the induction of anergy. This is consistent with the findingsof Feuerstein et al. (28), who were able to demonstrate increasedcAMP response element-binding activity in nuclear extracts de-rived from cells stimulated with anti-CD3. Interestingly, the up-regulation of band II formation was also observed in the nuclearextracts from resting anergic cells. The precise mechanism of thisincreased binding is unclear. Western blot analysis has not re-vealed any differences in the amount of CREB or CREM in anergicvs nonanergic T cells (Fig. 4). It might be that prolonged TCRengagement leads to the modification of the CREB/CREM pro-teins that favor the binding of this complex to the2180 site. Con-sistent with this hypothesis is our finding that CREM and CREBare phosphorylated in anergic cells. Phosphorylation at serine 133,which is detected by the anti-phospho-CREB Ab in Fig. 4, doesnot appear to be involved in CREB or CREM binding to DNA(29). However, it has been shown that in vitro phosphorylation ofCREM t can enhance its affinity for DNA (29), and thus we arecurrently investigating the phosphorylation of CREB and CREMat a number of different sites. Along these lines, ongoing studies inour laboratory have demonstrated the binding of recombinant highmobility group (I) Y (HMG(I) Y) to the2180 site (unpublisheddata). This family of proteins usually binds to A-T-rich regions inthe minor groove of the DNA and can serve to enhance or inhibitthe binding of various transcription factors (30, 31). Preliminarydata suggest that recombinant HMG(I) Y can inhibit recombinantJun binding while stabilizing recombinant CREM binding. It re-mains to be determined whether HMG(I) Y proteins play such arole in anergic T cells.

The potential role of CREB family proteins in inhibiting IL-2production is consistent with the observation that increases incAMP result in decreases in IL-2 production by lymphocytes andthat persistent elevation of cAMP in Th1 clones leads to a hypo-responsive state (32, 33). In this regard, it is of interest that bandII, which is up-regulated in anergic cells, consists of a CREM-containing complex; many of the CREM isoforms lack a transac-tivating domain, and these isoforms have been shown to act asinhibitors of transcription. Similarly, Bodor and Habener havedemonstrated that the inducible cAMP early repressor is able toinhibit transcription of a number of cytokine genes, including IL-2(34). It is of further interest that there is a profound decrease inIL-2 production by T cells derived from mice that express a trans-genic dominant negative CREB under the CD2 promoter (35). Ad-ditionally, others have demonstrated the ability of overexpressionof dominant negative CREB to inhibit IL-2 promoter-driven lucif-erase activity (36). That the overexpression of the dominant neg-ative CREB (that can bind to DNA, but cannot transactivate, andthus behaves like an inhibitory CREM isoform) inhibits IL-2 tran-scription, serves to support our contention that CREM promotesIL-2 repression in anergy. This observation, however, does notprove that CREM binding at the2180 site inhibits IL-2 transcrip-tion, because Butscher et al. (36) have argued that the decrease inIL-2 production is due to the essential role of CREB family mem-

ber binding at the2150 site. If indeed the overexpression of thedominant negative CREB had failed to inhibit IL-2 production, itwould have challenged the veracity of our model. Thus, the dataobtained in various model systems are compatible with the ideathat CREB/CREM family member proteins can negatively regulateIL-2 transcription.

Several investigators have begun to explore the compositeCD28RE-AP-1 (2150) site as a model for the role of coordinatetranscription factor binding in promoting transcription (36–38).Based on the present characterization of protein-DNA binding andour functional data, we propose that perhaps the scope of thiscomposite site might be expanded to include the2180 site. Moreimportantly, we propose that the2180 site might prove to be auseful model for the investigation of the coordinate inhibition oftranscription. The proximity of the2180 site to the CD28RE-AP-1site, the requirement for the2150 site in addition to the2180 siteto manifest an anergic effect (13), and the fact that the proteins thatbind to the two sites are from the same transcription factor familiesis intriguing and lends itself to speculation concerning the mech-anism of transcriptional inhibition. First, the CREB/CREM com-plex may disrupt the efficient formation of a single large IL-2 pro-moter enhanceosome (39). It may be that the interposition ofCREM into the transcription factor complex renders it inactive.Alternatively, the binding of CREB-1/CREM and perhaps evenHMG(I) Y might bend the DNA in such a way that the enhanceo-some cannot be efficiently formed. Second, it might be that CREB/CREM proteins actually form an inhibitory complex. Both CREM/CREM homodimers and CREB/CREM heterodimers have beenshown to antagonize both CREB and AP-1-mediated transcription(40). Indeed, it has been shown that CREM can inhibit AP-1-mediated transcription by outcompeting Jun for binding at con-ventional AP-1-binding sequences (24). In this regard, it might bethat under anergic conditions, the CREB/CREM complex outcom-petes a Jun/Jun-Oct complex.

A third possibility is that the CREB/CREM complex inhibitsIL-2 production at the level of coactivation of transcription. It hasbeen shown that the amount of the coactivators’ CREB-bindingprotein (CBP) and p300 are tightly maintained within the cell (40).Kamei et al. showed that in conjunction with a number of nuclearreceptors, overexpression of CREB protein can inhibit AP-1-me-diated transcription (41). Their proposed mechanism for this re-pression is the ability of the CREB protein to recruit away limitingamounts of coactivator proteins. Similarly, Parry et al. (42) sug-gested that phosphorylated CREB can inhibit NF-kB transcriptionby competing with p65 for limiting amounts of CBP. Along theselines, the binding of CREB/CREM to the2180 site could serve torecruit CBP/p300 into a nonfunctional complex. Alternatively, itmight be that the binding of the CREB/CREM complex at thesesites facilitates the binding of a corepressor molecule. The coac-tivators CBP and p300 both possess histone acetyltransferase ac-tivity, which is believed to play a role in their ability to promotetranscription (43). Recently, it has been shown that corepressormolecules, which possess deacetylase activity, can also be re-cruited into protein-DNA complexes and act to inhibit transcrip-tion (44). Finally, it has recently been shown that p300 and CBPhave distinct, nonoverlapping roles in coactivating transcription(45). It might be that in anergy the formation of the CREB/CREMcomplex favors the recruitment of the wrong coactivator, ulti-mately leading to repression of transcription.

AcknowlegementsWe thank Dr. Kevin Gardner and Dr. Luciano D’Adamio for their helpfulsuggestions, as well as the members of Laboratory of Cellular and Molec-ular Immunology for all of their help and support.

6638 CREB/CREM IN T CELL ANERGY

by guest on March 18, 2018

http://ww

w.jim

munol.org/

Dow

nloaded from

References1. Schwartz, R. H. 1992. Costimulation of T lymphocytes: the role of CD28,

CTLA-4, and B7/BB1 in interleukin-2 production and immunotherapy.Cell 71:1065.

2. Schwartz, R. H. 1997. T cell clonal anergy.Curr. Opin. Immunol. 9:351.3. Schwartz, R. H. 1996. Models of T cell anergy: is there a common molecular

mechanism?J. Exp. Med. 184:1.4. Essery, G., M. Feldmann, and J. R. Lamb. 1988. Interleukin-2 can prevent and

reverse antigen-induced unresponsiveness in cloned human T lymphocytes.Im-munology 64:413.

5. DeSilva, D. R., K. B. Urdahl, and M. K. Jenkins. 1991. Clonal anergy is inducedin vitro by T cell receptor occupancy in the absence of proliferation.J. Immunol.147:3261.

6. Beverly, B., S. M. Kang, M. J. Lenardo, and R. H. Schwartz. 1992. Reversal ofin vitro T cell clonal anergy by IL-2 stimulation.Int. Immunol. 4:661.

7. Mueller, D. L., M. K. Jenkins, and R. H. Schwartz. 1989. An accessory cell-derived costimulatory signal acts independently of protein kinase C activation toallow T cell proliferation and prevent the induction of unresponsiveness.J. Im-munol. 142:2617.

8. Madrenas, J., R. H. Schwartz, and R. N. Germain. 1996. Interleukin 2 production,not the pattern of early T-cell antigen receptor-dependent tyrosine phosphoryla-tion, controls anergy induction by both agonists and partial agonists.Proc. Natl.Acad. Sci. USA 93:9736.

9. Mondino, A., C. D. Whaley, D. R. DeSilva, W. Li, M. K. Jenkins, andD. L. Mueller. 1996. Defective transcription of the IL-2 gene is associated withimpaired expression of c-Fos, FosB, and JunB in anergic T helper 1 cells.J. Im-munol. 157:2048.

10. Li, W., C. D. Whaley, A. Mondino, and D. L. Mueller. 1996. Blocked signaltransduction to the ERK and JNK protein kinases in anergic CD41 T cells.Science 271:1272.

11. Fields, P. E., T. F. Gajewski, and F. W. Fitch. 1996. Blocked Ras activation inanergic CD41 T cells.Science 271:1276.

12. Kang, S. M., B. Beverly, A. C. Tran, K. Brorson, R. H. Schwartz, andM. J. Lenardo. 1992. Transactivation by AP-1 is a molecular target of T cellclonal anergy.Science 257:1134.

13. Kitagawa-Sakakida, S., and R. H. Schwartz. 1996. Multifactorcis-dominant neg-ative regulation of IL-2 gene expression in anergized T cells.J. Immunol. 157:2328.

14. Telander, D. G., E. N. Malvey, and D. L. Mueller. 1999. Evidence for repressionof IL-2 gene activation in anergic T cells.J. Immunol. 162:1460.

15. Serfling, E., A. Avots, and M. Neumann. 1995. The architecture of the interleu-kin-2 promoter: a reflection of T lymphocyte activation.Biochim. Biophys. Acta1263:181.

16. Jain, J., V. E. Valge-Archer, and A. Rao. 1992. Analysis of the AP-1 sites in theIL-2 promoter.J. Immunol. 148:1240.

17. Novak, T. J., P. M. White, and E. V. Rothenberg. 1990. Regulatory anatomy ofthe murine interleukin-2 gene.Nucleic Acids Res. 18:4523.

18. Novak, T. J., D. Chen, and E. V. Rothenberg. 1990. Interleukin-1 synergy withphosphoinositide pathway agonists for induction of interleukin-2 gene expres-sion: molecular basis of costimulation.Mol. Cell. Biol. 10:6325.

19. Hecht, T. T., D. L. Longo, and L. A. Matis. 1983. The relationship betweenimmune interferon production and proliferation in antigen-specific, MHC-re-stricted T cell lines and clones.J. Immunol. 131:1049.

20. Kubo, R. T., W. Born, J. W. Kappler, P. Marrack, and M. Pigeon. 1989. Char-acterization of a monoclonal antibody which detects all murineab T cell recep-tors.J. Immunol. 142:2736.

21. Gross, J. A., T. St. John, and J. P. Allison. 1990. The murine homologue of theT lymphocyte antigen CD28: molecular cloning and cell surface expression.J. Immunol. 144:3201.

22. Dignam, J. D., P. L. Martin, B. S. Shastry, and R. G. Roeder. 1983. Eukaryoticgene transcription with purified components.Methods Enzymol. 101:582.

23. Huang, H., C. Pannetier, J. Hu-Li, and W. E. Paul. 1998. Transient transfectionof primary T helper cells by particle-mediated gene transfer.J. Immunol. Methods215:173.

24. Masquilier, D., and P. Sassone-Corsi. 1992. Transcriptional cross-talk: nuclearfactors CREM and CREB bind to AP-1 sites and inhibit activation by Jun.J. Biol.Chem. 267:22460.

25. Penix, L. A., M. T. Sweetser, W. M. Weaver, J. P. Hoeffler, T. K. Kerppola, andC. B. Wilson. 1996. The proximal regulatory element of the interferon-g pro-moter mediates selective expression in T cells.J. Biol. Chem. 271:31964.

26. Sterling, K., and E. Bresnick. 1996. Oct-1 transcription factor is a negative reg-ulator of rat CYP1A1 expression via an octamer sequence in its negative regu-latory element.Mol. Pharmacol. 49:329.

27. Brindle, P., S. Linke, and M. Montminy. 1993. Protein-kinase-A-dependent ac-tivator in transcription factor CREB reveals new role for CREM repressors.Na-ture 364:821.

28. Feuerstein, N., R. Firestein, N. Aiyar, X. He, D. Murasko, and V. Cristofalo.1996. Late induction of CREB/ATF binding and a concomitant increase in cAMPlevels in T and B lymphocytes stimulated via the antigen receptor.J. Immunol.156:4582.

29. De Groot, R. P., J. den Hertog, J. R. Vandenheede, J. Goris, and P. Sassone-Corsi.1993. Multiple and cooperative phosphorylation events regulate the CREM ac-tivator function.EMBO J. 12:3903.

30. Yie, J., S. Liang, M. Merika, and D. Thanos. 1997. Intra- and intermolecularcooperative binding of high-mobility-group protein I(Y) to theb-interferon pro-moter.Mol. Cell. Biol. 17:3649.

31. Klein-Hessling, S., G. Schneider, A. Heinfling, S. Chuvpilo, and E. Serfling.1996. HMG I(Y) interferes with the DNA binding of NF-AT factors and theinduction of the interleukin 4 promoter in T cells.Proc. Natl. Acad. Sci. USA93:15311.

32. Kammer, G. M. 1988. The adenylate cyclase-cAMP-protein kinase A pathwayand regulation of the immune response.Mol. Today 9:222.

33. Cone, R. E., R. Cochrane, E. G. Lingenheld, and R. B. Clark. 1996. Elevation ofintracellular cyclic AMP induces an anergic-like state in Th1 clones.Cell. Im-munol. 173:246.

34. Bodor, J., and J. F. Habener. 1998. Role of transcriptional repressor ICER incyclic AMP-mediated attenuation of cytokine gene expression in human thymo-cytes.J. Biol. Chem. 273:9544.

35. Barton, K., N. Muthusamy, M. Chanyangam, C. Fischer, C. Clendenin, andJ. M. Leiden. 1996. Defective thymocyte proliferation and IL-2 production intransgenic mice expressing a dominant-negative form of CREB.Nature 379:81.

36. Butscher, W. G., C. Powers, M. Olive, C. Vinson, and K. Gardner. 1998. Coor-dinate transactivation of the interleukin-2 CD28 response element by c-Rel andATF-1/CREB2.J. Biol. Chem. 273:552.

37. McGuire, K. L., and M. Iacobelli. 1997. Involvement of Rel, Fos, and Jun pro-teins in binding activity to the IL-2 promoter CD28 response element/AP-1 se-quence in human T cells.J. Immunol. 159:1319.

38. Shapiro, V. S., K. E. Truitt, J. B. Imboden, and A. Weiss. 1997. CD28 mediatestranscriptional up-regulation of the interleukin-2 (IL-2) promoter through a com-posite element containing the CD28RE and NF-IL-2B AP-1 sites.Mol. Cell. Biol.17:4051.

39. Kim, T. K., and T. Maniatis. 1997. The mechanism of transcriptional synergy ofan in vitro assembled interferon-b enhanceosome.Mol. Cell 1:119.

40. Janknecht, R., and T. Hunter. 1996. Versatile molecular glue.Curr. Biol. 6:951.41. Kamei, Y., L. Xu, T. Heinzel, J. Torchia, R. Kurokawa, B. Gloss, S. C. Lin,

R. A. Heyman, D. W. Rose, C. K. Glass, and M. G. Rosenfeld. 1996. A CBPintegrator complex mediates transcriptional activation and AP-1 inhibition bynuclear receptors.Cell 85:403.

42. Parry, G. C. N., and N. Mackman. 1997. Role of cyclic AMP response element-binding protein in cyclic AMP inhibition of NF-kB-mediated transcription.J. Im-munol. 159:5450.

43. Torchia, J., C. Glass, and M. G. Rosenfeld. 1998. Co-activators and co-repressorsin the integration of transcriptional responses.Curr. Opin. Cell Biol. 10:373.

44. Nagy, L., H. Y. Kao, D. Chakravarti, R. J. Lin, C. A. Hassig, D. E. Ayer,S. L. Schreiber, and R. M. Evans. 1997. Nuclear receptor repression mediated bya complex containing SMRT, mSin3A, and histone deacetylase.Cell 89:373.

45. Kawasaki, H., R. Eckner, T. P. Yao, K. Taira, R. Chiu, D. M. Livingston, andK. K. Yokoyama. 1998. Distinct roles of the co-activators p300 and CBP inretinoic-acid-induced F9-cell differentiation.Nature 393:284.

6639The Journal of Immunology

by guest on March 18, 2018

http://ww

w.jim

munol.org/

Dow

nloaded from