46
http://bejerano.stanford.edu 1 Tales from the Dark Side of Your Genome Dept. of Developmental Biology Dept. of Computer Science Stanford University Gill Bejerano

Tales from the Dark Side of Your Genome - Stanford …bejerano.stanford.edu/talks/BejeranoTIEOct07.pdfgenes (17 of which show clear evidence of alt-splicing inc. EIF2C1, DDX, BCL11A,

  • Upload
    others

  • View
    0

  • Download
    0

Embed Size (px)

Citation preview

Page 1: Tales from the Dark Side of Your Genome - Stanford …bejerano.stanford.edu/talks/BejeranoTIEOct07.pdfgenes (17 of which show clear evidence of alt-splicing inc. EIF2C1, DDX, BCL11A,

http://bejerano.stanford.edu 1

Tales from the Dark Side of Your Genome

Dept. of Developmental BiologyDept. of Computer Science

Stanford University

Gill Bejerano

Page 2: Tales from the Dark Side of Your Genome - Stanford …bejerano.stanford.edu/talks/BejeranoTIEOct07.pdfgenes (17 of which show clear evidence of alt-splicing inc. EIF2C1, DDX, BCL11A,

http://bejerano.stanford.edu 2

Biology has become a quantitative science

strings

circuits

time series

Page 3: Tales from the Dark Side of Your Genome - Stanford …bejerano.stanford.edu/talks/BejeranoTIEOct07.pdfgenes (17 of which show clear evidence of alt-splicing inc. EIF2C1, DDX, BCL11A,

http://bejerano.stanford.edu 3

Biology has also become a meeting place

For PhysicistsMathematiciansEngineersBiologistsComputer Scientistsand more…

Page 4: Tales from the Dark Side of Your Genome - Stanford …bejerano.stanford.edu/talks/BejeranoTIEOct07.pdfgenes (17 of which show clear evidence of alt-splicing inc. EIF2C1, DDX, BCL11A,

http://bejerano.stanford.edu 4

AYBABTU

Page 5: Tales from the Dark Side of Your Genome - Stanford …bejerano.stanford.edu/talks/BejeranoTIEOct07.pdfgenes (17 of which show clear evidence of alt-splicing inc. EIF2C1, DDX, BCL11A,

http://bejerano.stanford.edu 5

Genomics in a nutshell

Page 6: Tales from the Dark Side of Your Genome - Stanford …bejerano.stanford.edu/talks/BejeranoTIEOct07.pdfgenes (17 of which show clear evidence of alt-splicing inc. EIF2C1, DDX, BCL11A,

http://bejerano.stanford.edu 6

DNA: Functional and Non-FunctionalDNA = linear molecule that carries instructions for making living organisms ~ long string(s) over a small alphabet

Alphabet of four {A,C,G,T} Strings of length 104-1011

...ACGTACGACTGACTAGCATCGACTACGACTAGCAC...

genetic instructions:

how to...when to...where to...

“junk”

DNA “junk”

DNA

Page 7: Tales from the Dark Side of Your Genome - Stanford …bejerano.stanford.edu/talks/BejeranoTIEOct07.pdfgenes (17 of which show clear evidence of alt-splicing inc. EIF2C1, DDX, BCL11A,

http://bejerano.stanford.edu 7

One Cell, One Genome, One ReplicationEvery cell holds a copy of all its DNA = its genome.The genome is replicated every cell division.The human body is made of ~1014

cells.All originate from a single cell through repeated cell divisions.

cell

genome =all DNA

chicken ≈

1014

copies

(DNA) of egg (DNA)

chicken

egg egg

egg

celldivision

DNAstring

Page 8: Tales from the Dark Side of Your Genome - Stanford …bejerano.stanford.edu/talks/BejeranoTIEOct07.pdfgenes (17 of which show clear evidence of alt-splicing inc. EIF2C1, DDX, BCL11A,

http://bejerano.stanford.edu 8

Genes = How to make Proteins

gene

DNA

cell“the workhorses of every living cell”

Page 9: Tales from the Dark Side of Your Genome - Stanford …bejerano.stanford.edu/talks/BejeranoTIEOct07.pdfgenes (17 of which show clear evidence of alt-splicing inc. EIF2C1, DDX, BCL11A,

http://bejerano.stanford.edu 9

...ACGTACGACTGACTAGCATCGACTACGA........TCTGACTAGCATCGACTACGA...

DNA Replication is ImperfectMedium Scale: substrings are duplicated, deleted, invertedLarge Scale: whole DNA strings are duplicated, deleted

...ACGTACGACTGACTAGCATCGACTACGA...

...ACGTACGACTGACTAGCATCGACTACGA........TCTGACTAGCATCGACTACGA...

functionaljunk

functionalfunctional

functional’’functional’

substringduplication

functionaldivergence

So...More Genes...More Complexity!...Right?

Page 10: Tales from the Dark Side of Your Genome - Stanford …bejerano.stanford.edu/talks/BejeranoTIEOct07.pdfgenes (17 of which show clear evidence of alt-splicing inc. EIF2C1, DDX, BCL11A,

http://bejerano.stanford.edu 10

1. Gene number does not correlate with Complexity

Gene families are important. Many are surprisingly old.But -

flyworm

humanweed

fishrice

# genes

103

cells1014

cells pre-genomic era:“100,000 genes tothe human genome”

Page 11: Tales from the Dark Side of Your Genome - Stanford …bejerano.stanford.edu/talks/BejeranoTIEOct07.pdfgenes (17 of which show clear evidence of alt-splicing inc. EIF2C1, DDX, BCL11A,

http://bejerano.stanford.edu 11

DNA Replication is Imperfect (contd)

Small Scale: single letters are substituted, erased, added

...ACGTACGACTGACTAGCATCGACTACGA...

chicken

egg ...ACGTACGACTGACTAGCATCGACTACGA...

functionaljunk

TT CAT

“anythinggoes”

many changesare not tolerated

chicken

thus, sequence conservation over generations implies function!

Page 12: Tales from the Dark Side of Your Genome - Stanford …bejerano.stanford.edu/talks/BejeranoTIEOct07.pdfgenes (17 of which show clear evidence of alt-splicing inc. EIF2C1, DDX, BCL11A,

http://bejerano.stanford.edu 12

Sequence Conservation implies Function

(but which function/s?...)

human

mouse

mammalianancestor

...CTTTGCGA-TGAGTAGCATCTACTATTT...

...ACGTGGGACTGACTA-CATCGACTACGA...

functional region!

Comparative Genomics of Distantly related species:

Page 13: Tales from the Dark Side of Your Genome - Stanford …bejerano.stanford.edu/talks/BejeranoTIEOct07.pdfgenes (17 of which show clear evidence of alt-splicing inc. EIF2C1, DDX, BCL11A,

http://bejerano.stanford.edu 13

HumanGenome:

3*109

letters

2. Human Genome full of Conserved Non-Coding Elements

[Science 2004 Breakthrough of the Year, 5th

runner up]

1.5%known

function >50%junk

3x more functional DNA than known!

compare to other species

>5% human genome functional

~106 substrings do not code for protein

What do they do then?

Page 14: Tales from the Dark Side of Your Genome - Stanford …bejerano.stanford.edu/talks/BejeranoTIEOct07.pdfgenes (17 of which show clear evidence of alt-splicing inc. EIF2C1, DDX, BCL11A,

http://bejerano.stanford.edu 14

Gene regulation = when/where to make protein

gene (how to)control region

(when & where)

DNA

effective region~103 letters

recognition site~10

letters/protein

Unicellular

Page 15: Tales from the Dark Side of Your Genome - Stanford …bejerano.stanford.edu/talks/BejeranoTIEOct07.pdfgenes (17 of which show clear evidence of alt-splicing inc. EIF2C1, DDX, BCL11A,

http://bejerano.stanford.edu 15

Vertebrate Gene Regulation

gene (how to)control region

(when & where)

DNA

effective region ~106 letters!!!

(~103 letters)

Multicellular

Page 16: Tales from the Dark Side of Your Genome - Stanford …bejerano.stanford.edu/talks/BejeranoTIEOct07.pdfgenes (17 of which show clear evidence of alt-splicing inc. EIF2C1, DDX, BCL11A,

http://bejerano.stanford.edu 16

3. Most Non-Coding Elements are likely cis-regulatory

9Mb

“IRX1 is a member of the Iroquois homeobox

gene family. Members of this family appear to play multiple rolesduring pattern formation of vertebrate embryos.”

gene deserts

regulatory jungles

Page 17: Tales from the Dark Side of Your Genome - Stanford …bejerano.stanford.edu/talks/BejeranoTIEOct07.pdfgenes (17 of which show clear evidence of alt-splicing inc. EIF2C1, DDX, BCL11A,

http://bejerano.stanford.edu 17

The Writing on the Wall…gene deserts

regulatory jungles

25,000

1,000,000

Page 18: Tales from the Dark Side of Your Genome - Stanford …bejerano.stanford.edu/talks/BejeranoTIEOct07.pdfgenes (17 of which show clear evidence of alt-splicing inc. EIF2C1, DDX, BCL11A,

http://bejerano.stanford.edu 18

DNA Conservation levels

[Bejerano et al., Science 2004]

Conserved elements between human and mouse are on average 85% identical. [mouse consortium, 2002]

Page 19: Tales from the Dark Side of Your Genome - Stanford …bejerano.stanford.edu/talks/BejeranoTIEOct07.pdfgenes (17 of which show clear evidence of alt-splicing inc. EIF2C1, DDX, BCL11A,

http://bejerano.stanford.edu 19

Ultraconserved Elements

[Bejerano et al., Science 2004]

fish

Page 20: Tales from the Dark Side of Your Genome - Stanford …bejerano.stanford.edu/talks/BejeranoTIEOct07.pdfgenes (17 of which show clear evidence of alt-splicing inc. EIF2C1, DDX, BCL11A,

http://bejerano.stanford.edu 20

Ultraconserved ElementsHundreds of long substrings identical between human-birds

they must have rejected many different changes.But... all functions we understand in our genome are encoded using redundant codes.

E.g. Protein Coding Genes:DNA –

108

letters over alphabet of 4.

Protein –

102

letters over alphabet of 20.

Coding: 3 DNA letters → 1 Protein letter.

*****

[Bejerano et al., Science 2004]

Page 21: Tales from the Dark Side of Your Genome - Stanford …bejerano.stanford.edu/talks/BejeranoTIEOct07.pdfgenes (17 of which show clear evidence of alt-splicing inc. EIF2C1, DDX, BCL11A,

http://bejerano.stanford.edu 21

No known function requires this much conservation

CDS ncRNA TFBS

*****

seq.

?

Page 22: Tales from the Dark Side of Your Genome - Stanford …bejerano.stanford.edu/talks/BejeranoTIEOct07.pdfgenes (17 of which show clear evidence of alt-splicing inc. EIF2C1, DDX, BCL11A,

http://bejerano.stanford.edu 22

What do they do?

Page 23: Tales from the Dark Side of Your Genome - Stanford …bejerano.stanford.edu/talks/BejeranoTIEOct07.pdfgenes (17 of which show clear evidence of alt-splicing inc. EIF2C1, DDX, BCL11A,

http://bejerano.stanford.edu 23

Genomic Distribution of Ultraconserved Elements

•exonic•non•possibly

Page 24: Tales from the Dark Side of Your Genome - Stanford …bejerano.stanford.edu/talks/BejeranoTIEOct07.pdfgenes (17 of which show clear evidence of alt-splicing inc. EIF2C1, DDX, BCL11A,

http://bejerano.stanford.edu 24

Annotation by Association

Measure Correlation between genomic regions and annotation

genome

heterogeneous body of knowledge Testable Hypothesis

dd

d

Page 25: Tales from the Dark Side of Your Genome - Stanford …bejerano.stanford.edu/talks/BejeranoTIEOct07.pdfgenes (17 of which show clear evidence of alt-splicing inc. EIF2C1, DDX, BCL11A,

http://bejerano.stanford.edu 25

Ultras are Functional

Back in 2004 we hypothesized:

481 ultraconserved

elements

exonic

subset –post transcriptional regulation

[Ni et al., Genes Dev.; Lareau

et al., Nature, 2007]

“nonexonic”

subset –transcriptional regulators

[Pennacchio

et al., Nature, 2006]

Page 26: Tales from the Dark Side of Your Genome - Stanford …bejerano.stanford.edu/talks/BejeranoTIEOct07.pdfgenes (17 of which show clear evidence of alt-splicing inc. EIF2C1, DDX, BCL11A,

http://bejerano.stanford.edu 26

Repeat made Regulatory Region

Reporter GeneMinimal PromoterConservedElement

in situ

transgenic

Page 27: Tales from the Dark Side of Your Genome - Stanford …bejerano.stanford.edu/talks/BejeranoTIEOct07.pdfgenes (17 of which show clear evidence of alt-splicing inc. EIF2C1, DDX, BCL11A,

http://bejerano.stanford.edu 27

Zoom to uc.351, 225Kb upstream of DACH

ultra conserved

e.de.d

12.512.5

[[NobregaNobrega

et al., 2003]et al., 2003]

Page 28: Tales from the Dark Side of Your Genome - Stanford …bejerano.stanford.edu/talks/BejeranoTIEOct07.pdfgenes (17 of which show clear evidence of alt-splicing inc. EIF2C1, DDX, BCL11A,

http://bejerano.stanford.edu 28

A Vertebrate Innovation?Only 24 ultras can be partially traced back through direct sequence search to Ciona, C. Elegans or

Drosophila.All overlap coding exons from known genes (17 of which show clear evidence of alt-splicing inc. EIF2C1, DDX, BCL11A, EVI1, ZFR, CLK4, HNRPH1, GRIA3).

No intronic element in human was found to be coding in another species, although in some cases EST evidence indicates intron retention, presumably not as CDS.

Interestingly, ribosomal DNA (not part of the draft genomes) also harbors 6 ultraconserved elements in 18S, 28S.

def

defdef

Page 29: Tales from the Dark Side of Your Genome - Stanford …bejerano.stanford.edu/talks/BejeranoTIEOct07.pdfgenes (17 of which show clear evidence of alt-splicing inc. EIF2C1, DDX, BCL11A,

http://bejerano.stanford.edu 29

Similar Phenomena in Flies

[Siepel, Bejerano et al., Genome Research 2005][Glazov, ..., Bejerano, Mattick,

Genome Research 2005]

rich in conserved non-coding

fly-specific ultraconserved elements

Page 30: Tales from the Dark Side of Your Genome - Stanford …bejerano.stanford.edu/talks/BejeranoTIEOct07.pdfgenes (17 of which show clear evidence of alt-splicing inc. EIF2C1, DDX, BCL11A,

http://bejerano.stanford.edu 30

Genomic Distribution of Ultraconserved Elements

•exonic•non•possibly

Page 31: Tales from the Dark Side of Your Genome - Stanford …bejerano.stanford.edu/talks/BejeranoTIEOct07.pdfgenes (17 of which show clear evidence of alt-splicing inc. EIF2C1, DDX, BCL11A,

http://bejerano.stanford.edu 31

Repeats / obile

Elements ("selfish DNA")

HumanGenome:

3*109

letters1.5%

knownfunction >50%

junk

Page 32: Tales from the Dark Side of Your Genome - Stanford …bejerano.stanford.edu/talks/BejeranoTIEOct07.pdfgenes (17 of which show clear evidence of alt-splicing inc. EIF2C1, DDX, BCL11A,

http://bejerano.stanford.edu 32

Cis-reg

& Ultra elements from obile

Elements

[Yass

is a small town in New South Wales, Australia.]

Co-option event, probably due to favorable genomic context

All other copies are destined to decay over time at a neutral rate

[Bejerano et al., Nature 2006]

Page 33: Tales from the Dark Side of Your Genome - Stanford …bejerano.stanford.edu/talks/BejeranoTIEOct07.pdfgenes (17 of which show clear evidence of alt-splicing inc. EIF2C1, DDX, BCL11A,

http://bejerano.stanford.edu 33

Exapted Into Which Cellular Roles?

?

xHuman instances cluster together, found <1Mb from 35 TFs

(P<3*10-6).

No evidence for Transcription (Tx) as small RNAs,no orientation preference in introns, not in antisense Tx.

Page 34: Tales from the Dark Side of Your Genome - Stanford …bejerano.stanford.edu/talks/BejeranoTIEOct07.pdfgenes (17 of which show clear evidence of alt-splicing inc. EIF2C1, DDX, BCL11A,

http://bejerano.stanford.edu 34

Repeat made Regulatory Region

Reporter GeneMinimal PromoterConservedElement

in situ

transgenic

Page 35: Tales from the Dark Side of Your Genome - Stanford …bejerano.stanford.edu/talks/BejeranoTIEOct07.pdfgenes (17 of which show clear evidence of alt-splicing inc. EIF2C1, DDX, BCL11A,

http://bejerano.stanford.edu 35

Co-option into Different Roles

repeat

proteincoding

gene

regulating

Page 36: Tales from the Dark Side of Your Genome - Stanford …bejerano.stanford.edu/talks/BejeranoTIEOct07.pdfgenes (17 of which show clear evidence of alt-splicing inc. EIF2C1, DDX, BCL11A,

http://bejerano.stanford.edu 36

Relation to Human Disease

[Derti

et al., Nature Genetics, 2006]

SHH LMBR11Mb Limb

Lettice et al. HMG 2003 12: 1725-35

Page 37: Tales from the Dark Side of Your Genome - Stanford …bejerano.stanford.edu/talks/BejeranoTIEOct07.pdfgenes (17 of which show clear evidence of alt-splicing inc. EIF2C1, DDX, BCL11A,

http://bejerano.stanford.edu 37

Ultras are Under Strong Human Selection

Ultra DAF NonSyn

DAF

[Katzman

et al, Science ,2007]

Page 38: Tales from the Dark Side of Your Genome - Stanford …bejerano.stanford.edu/talks/BejeranoTIEOct07.pdfgenes (17 of which show clear evidence of alt-splicing inc. EIF2C1, DDX, BCL11A,

http://bejerano.stanford.edu 38

Ultraconserved Non-coding RNA

[Calin

et al, Cancer Cell, 2007]miRNA

complementarity

About 1/3 of all ultras are expressed.Some are predicted to provide

microRNA

targets.A few are anti-correlated with miRNA

expression levels.A few even act as oncogenes.

Page 39: Tales from the Dark Side of Your Genome - Stanford …bejerano.stanford.edu/talks/BejeranoTIEOct07.pdfgenes (17 of which show clear evidence of alt-splicing inc. EIF2C1, DDX, BCL11A,

http://bejerano.stanford.edu 39

GGTGCCAGGGAAAGGGCAGGAGGTGAGTGCTGGGAGGCAGCTGAGGTCAACTTCTTTTGAACTTCCACGTGGTATTTACTCAGAGCAATTGGTGCCAGAGGCTCAGGGCCCTGGAGTATAAAGCAGAATGTCTGCTCTCTGTGCCCAGACGTGAGCAGGTGAGCAGCTGGGGCGAAAGACCTGTTGGAGGCTATGAATGCAATCAAGGTGACAGACAACTGGTGCAATGATGGTAGTGGAAATGGAGGAGAGGGGATTGATTCAAGATGCATTTAGGACCAAGAATCGGGAGCTTGTGAACGTGTGTATGAGTACTGTAGACGGAGTGGGTGTGTCATCAGAGAAGATCTGAGCATTTGGGCTTGCTCTCCTCAGAGGCCCTGCGAGTGGAGTTCAGCTTTTCCTCATGGGGCAAATCTCACTTTCGCTCCAGTTCCTGGGGCTCAGAGTCCCTGGCCCAGATGCCTCTTGCCATCTCATCTTCACCCTGCCTGGCTTCCCTTGCTTGTTCCAGGATTGTTTCATAAAGAGGGATGTGGTTGGTCTTTAACCCTATGAATGCTGGCTGAGGATGCCTGCGGAACCTGTAGTGAAGCTTTCAGGGGCTGCTCGGGTTCTGGCTGGTAGGTGAACACTGTCCATCTTGCCGGCTGGGACACAGTGACTCTGGGTAGTTGTGTAAGAGAGGGGCCCTTGGCAGACAAACAGGTTCTTCTCTGTTGGTGGGCCAGCCAGCAGGTCAGTGGGAAGGTTAAAGGTCATGGGGTTTGGGAGAACTGGGTGAGGAGTTCAGCCCCATCCCCCGTAAAGCTCCTGGGAAGCACTTCTCTACTGGGGCAGCCCCTGATACCAGGGCACTCATTAACCCTCTGGGTGCCAGGGAAAGGGCAGGAGGTGAGTGCTGGGAGGCAGCTGAGGTCAACTTCTTTTGAACTTCCACGTGGTATTTACTCAGAGCAATTGGTGCCAGAGGCTCAGGGCCCTGGAGTATAAAGCAGAATGTCTGCTCTCTGTGCCCAGACGTGAGCAGGTGAGCAGCTGGGGCTGTCTGCTCTCTGTGCCCAGACGTGAGCAGGTGAGCAGCTGGGGCTGTCTGCTCTCTGTGCCCAGACGTGAGCAGGTGAGCAGCTGGGGCTGTCTGCTCTCTGTGCCCAGACGTGAGCAGGTGAGCAGCTGGGGCTGTCTGCTCTCTGTGCCCAGGAAAGACCTGTTGGAGGCTATGAATGCAATCAAGGTGACAGACAACTGGTGCAATGATGGTAGTGGAAATGGAGGAGAGGGGATTGATTCAAGATGCATTTAGGACCAAGAATCGGGAGCTTGTGAACGTGTGTATGAGTACTGTAGACGGAGTGGGTGTGTCATCAGAGAAGATCTGAGCATTTGGGCTTGCTCTCCTCAGAGGCCCTGCGAGTGGAGTTCAGCTTTTCCTCATGGGGCAAATCTCACTTTCGCTCCAGTTCCTGGGGCTCAGAGTCCCTGGCCCAGATGCCTCTTGCCATCTCATCTTCACCCTGCCTGGCTTCCCTTGCTTGTTCCAGGATTGTTTCATAAAGAGGGATGTGGTTGGTCTTTAACCCTATGAATGCTGGCTGAGGATGCCTGCGGAACCTGTAGTGAAGCTTTCAGGGGCTGCTCGGGTTCTGGCTGGTAGGTGAACACTGTCCATCTTGCCGGCTGGGACACAGTGACTCTGGGTAGTTGTGTAAGAGAGGGGCCCTTGGCAGACAAACAGGTTCTTCTCTGTTGGTGGGCCAGCCAGCAGGTCAGTGGGAAGGTTAAAGGTCATGGGGTTTGGGAGAAACTGGGTGAGGAGTTCAGCCCCATCCCCCGTAAAGCTCCTGGGAAGCACTTCTCTACTGGGGCAGCCCCTGATACCAGGGCACTCATTAACCCTCTGGGTGCCAGGGAAAGGGCAGGAGGTGAGTGCTGGGAGGCAGCTGAGGTCAACTTCTTTTGAACTTCCACGTGGTATTTACTCAGAGCAATTGGTGCCAGAGGCTCAGGGCCCTGGAGTATAAAGCAGAATGTCTGCTCTCTGTGCCCAGACGTGAGCAGGTGAGCAGCTGGGGCGAAAGACCTGTTGGAGGCTATGAATGCAATCAAGGTGACAGACAACTGGTGCAATGATGGTAGTGGAAATGGAGGAGAGGGGATTGATTCAAGATGCATTTAGGACCAAGAATCGGGAGCTTGTGAACGTGTGTATGAGTACTGTAGACGGAGTGGGTGTGTCATCAGAGAAGATCTGAGCATTTGGGCTTGCTCTCCTCAGAGGCCCTGCGAGTGGAGTTCAGCTTTTCCTCATGGGGCAAATCTCACTTTCGCTCCAGTTCCTGGGGCTCAGAGTCCCTGGCCCAGATGCCTCTTGCCATCTCATCTTCACCCTGCCTGGCTTCCCTTGCTTGTTCCAGGATTGTTTCATAAAGAGGGATGTGGTTGGTCTTTAACCCTATGAATGCTGGCTGAGGATGCCTGCGGAACCTGTAGTGAAGCTTTCAGGGGCTGCTCGGGTTCTGGCTGGTAGGTGAACACTGTCCATCTTGCCGGCTGGGACACAGTGACTCTGGGTAGTTGTGTAAGAGAGGGGCCCTTGGCAGACAAACAGGTTCTTCTCTGTTGGTGGGCCAGCCAGCAGGTCAGTGGGAAGGTTAAAGGTCATGGGGTTTGGGAGAACTGGGTGAGGAGTTCAGCCCCATCCCCCGTAAAGCTCCTGGGAAGCACTTCTCTACTGGGGCAGCCCCTGATACCAGGGCACTCATTAACCCTCTGGGTGCCAGGGAAAGGGCAGGAGGTGAGTGCTGGGAGGCAGCTGAGGTCAACTTCTTTTGAACTTCCACGTGGTATTTACTCAGAGCAATTGGTGCCAGAGGCTCAGGGCCCTGGAGTATAAAGCAGAATGTCTGCTCTCTGTGCCCAGACGTGAGCAGGTGAGCAGCTGGGGCTGTCTGCTCTCTGTGCCCAGACGTGAGCAGGTGAGCAGCTGGGGCTGTCTGCTCTCTGTGCCCAGACGTGAGCAGGTGAGCAGCTGGGGCTGTCTGCTCTCTGTGCCCAGACGTGAGCAGGTGAGCAGCTGGGGCTGTCTGCTCTCTGTGCCCAG

Touch an Ultra And You …?

Page 40: Tales from the Dark Side of Your Genome - Stanford …bejerano.stanford.edu/talks/BejeranoTIEOct07.pdfgenes (17 of which show clear evidence of alt-splicing inc. EIF2C1, DDX, BCL11A,

http://bejerano.stanford.edu 40

Touch an Ultra And You -

DIY

Nadav

Ahituv, Eddy Rubin, LBNL

Page 41: Tales from the Dark Side of Your Genome - Stanford …bejerano.stanford.edu/talks/BejeranoTIEOct07.pdfgenes (17 of which show clear evidence of alt-splicing inc. EIF2C1, DDX, BCL11A,

http://bejerano.stanford.edu 41[Ahituv

et al, 2007]

Complete the Sentence: Ultra KO Mice Are ------

Page 42: Tales from the Dark Side of Your Genome - Stanford …bejerano.stanford.edu/talks/BejeranoTIEOct07.pdfgenes (17 of which show clear evidence of alt-splicing inc. EIF2C1, DDX, BCL11A,

http://bejerano.stanford.edu 4242

Unchangeable but expendible?

Under Strong Selection:

Selection coeff.

Functional:

And expendible??

Under Strong Selection:

Page 43: Tales from the Dark Side of Your Genome - Stanford …bejerano.stanford.edu/talks/BejeranoTIEOct07.pdfgenes (17 of which show clear evidence of alt-splicing inc. EIF2C1, DDX, BCL11A,

http://bejerano.stanford.edu 4343

allneutralfunctional

-

75 50

Primate-Dog Non-Exonic

Rodent-Specific Losses

[International Mouse Genome Sequencing Consortium,Nature, 2002]

Lost in Mouse & Rat(in <1000bp deletions)

ultras~300 fold

more persistent

thanneutral

Page 44: Tales from the Dark Side of Your Genome - Stanford …bejerano.stanford.edu/talks/BejeranoTIEOct07.pdfgenes (17 of which show clear evidence of alt-splicing inc. EIF2C1, DDX, BCL11A,

http://bejerano.stanford.edu 44

What we do understand..Ultraconserved elements exist.They are maintained via strong on-going selection.It is a heterogeneous bunch:Some mediate splicingSome regulate gene expressionSome express ncRNAs(categories are not necessarily mutually exclusive)Knockouts of four regulatory ultras do not lead to severe phenotypes (similar protein cases: Pbx2, Nkx6.2, Gli1)

Page 45: Tales from the Dark Side of Your Genome - Stanford …bejerano.stanford.edu/talks/BejeranoTIEOct07.pdfgenes (17 of which show clear evidence of alt-splicing inc. EIF2C1, DDX, BCL11A,

http://bejerano.stanford.edu 45

What we don’t understand

Their functional density:How did they come to be?What is the selective advantage that lets them persist?

Page 46: Tales from the Dark Side of Your Genome - Stanford …bejerano.stanford.edu/talks/BejeranoTIEOct07.pdfgenes (17 of which show clear evidence of alt-splicing inc. EIF2C1, DDX, BCL11A,

http://bejerano.stanford.edu 46

Kudos

Bejerano Lab:Cory McLeanAbraham BassanShoa

ClarkeEdward ChuongFah

Sathirapongsasuti

UCSC: David Haussler, Craig Lowe, Jim Kent, Sofie

Salama, the lotLBNL: Eddy RubinUCSF: Nadav

Ahituv

Edward Mallinckrodt, Jr

Foundation

http://cs273a.stanford.edu

fall quarterat a classroom

near you..