81
1 Lee Hood Institute for Systems Biology, Seattle National Conference of Pharmacetical Organizations 1-10-15 Systems Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare Predictive, Preventive, Personalized and Participatory

Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine

  • Upload
    others

  • View
    5

  • Download
    0

Embed Size (px)

Citation preview

Page 1: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine

1

Lee HoodInstitute for Systems Biology, Seattle

National Conference of PharmaceticalOrganizations

1-10-15

Systems Medicine and Proactive P4 Medicine: Catalyzing a Revolution

in Healthcare

Predictive, Preventive, Personalized and Participatory

Page 2: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine

2

Take home lessons

• Systems medicine is key to dealing with the complexities of disease leading to new strategies and technologies for diagnostics and therapeutics

• Systems medicine has reach a tipping point and is enabling a medicine that is predictive, preventive, personalized and participatory (P4 medicine)—that is very different from contemporary medicine

• P4 medicine can transforming healthcare through the initiation of a Framingham-like, longitudinal, digital-age study of 100,000 well people for which we are seeking Congressional support

Page 3: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine

3

The grand challenge for biology and medicine is deciphering biological complexity

Page 4: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine

4

6 Blind Men and an Elephant

Page 5: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine

5

Paradigm Changes Drive Radical Changes in Science

Page 6: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine

6

I Participated in Five Paradigm Changes in Biology over 45 YearsLeading to Systems Medicine and P4 Medicine

• Brought engineering to biology– Developed 6 instruments that led to high-throughput biology: big data in

biology (1970 - present)• The Human Genome Project

– Invented enabling technology, advocate, participant, applying genomics to P4 medicine (1990-2003)—complete parts list human genes

• Cross-disciplinary biology– Created 1st cross-disciplinary department: enabled technology development

to be driven by biology (1992-2000)• Systems biology

– Created 1st systems biology institute: deciphering the complexities of biology and disease (2000 – present)

• Systems medicine / emergence of proactive P4 medicine– Early advocate and pioneer of a P4 medicine that will transforming healthcare

(2001 – present)– Pioneered systems driven technologies and strategies for P4– 100,000 person wellness project (2013—present)

Page 7: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine

7

Big data is one essence of systems medicine: Soon each individual will be surrounded by a virtual cloud of billions of multi-scale data points—big data

Transactional

11010100010101010110101010100100

0

Phenome

Na143 K 3.7 BP 110/70 

HCT32 BUN 12.9 Pulse 110 PLT150  WBC  92

GCGTAGATGCGTAGGCATGCATGCCATTATAGCTT

CCA

Genome

Proteome

arg‐his‐pro‐gly‐leu‐ser‐thr‐ala‐trp‐tyr‐val‐met‐phe‐

Transcriptome

UUAGUGAUGCGUCUAGGCAUGCAUGCC

Epigenome

110101000101010101101010101001000101101010001

Single Cell

11010100010101010110101010100100

iPS Cells

11010100010101010110101010100100

Social Media

110101000101010101101010101001000101101010001

TeleHealth

110101000101010101101010101001000101101010001

Page 8: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine

8

Systems Medicine Systems biology andd isease-perturbed network of networks

• Integration of patient data will reveal biological networks that specify health and are altered in disease

• Understanding differences in normal and disease-perturbed networks will provide fundamental insights into disease mechanisms

• These insights are essential for developing more effective diagnostic and therapeutic approaches

Page 9: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine

9

Why is the Institute for Systems Biology (ISB) uniquely positioned to transform systems medicine and catalyze a revolution in healthcare?

Page 10: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine

10

Evolution of the Vision for Systems Medicine (and P4 Medicine) 2001 - Present• By 2005, the vision of Systems Medicine/P4 medicine had

been clearly articulated by ISB– Key question: How to bring P4 to the healthcare system?

• In 2008, ISB formed a 5 year $100M strategic partnership with Luxembourg – Developed about 10 new systems-driven technologies and

strategies– Placed P4 medicine at a tipping point for transforming the

practice of healthcare

• In 2013, ISB first proposed the P4 pilot project to study 100,000 well people– Bringing the power of P4 medicine to the contemporary

healthcare system

Page 11: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine

11

Three systems-driven strategies supported by Luxembourg

Page 12: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine

12

Dynamic network approaches to prion-induced neurodegeneration in mice

Page 13: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine

13

Global and Subtractive Brain Transcriptome Analysis—Differentially Expressed Genes (DEGs)

Uninfected brain

Prion infected brain 

Inoculate w/ Prions

Time‐course array analysis:subtrative analyses to DEGs

Mouse Genome array:45,000 probe sets

~22,000 mouse genes.

RNAfrom brain

homogenate

Prion strains:• RML• 301V   

Mouse strains: C57BL/6J FVB/NCr BL6.I FVB/B4053    

C57BL/6J‐RML:   12 time points 

FVB/NCr‐RML:      11 time points 

BL6.I‐301V:            9 time points

FVB/B4053‐RML:  8 time points

‐300 DEGs encode the prion neurodegenerative response

Page 14: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine

14

Neuropathology Identifies 4 Major Disease-Perturbed Networks for Prion DiseasePrP replication/accumulation Microglia/astrocyte

activation

Synaptic degeneration

Normal Infected

Nerve cell death

Page 15: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine

15

Prionaccumulation

GlialActivation

SynapticDegeneration

Neuronal Cell Death

Cholesteroltransport

Sphingolipidsynthesis

Lysosomeproteolysis

ReactiveAstrocytesLeukocyte

extravasation

Na+channelsCargo

transport

Caspases

*Arachidonatemetab./Ca+ sig.

Clinical Signs

Sequential Disease-Perturbation of the Four Major Networks of Prion Disease

0 wk 18~20 wk 22 wk7 wk

Page 16: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine

16

10 Disease-Perturbed Dynamical Networks in Prion Disease Explain Virtually all of the Pathophysiology of

the Disease in Mice

Page 17: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine

17

A systems-driven network approach to glioblastoma in humans and mouse models—developing a network approach to the identification of new drug targets

Page 18: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine

18

A computational approach to cancer drug target identification through network analysis

BALIGA, Aitchison, Hood LABs

Halobacterium

Yeast peroxisome biogenesis

Host‐pathogen interactions

Cancer

Page 19: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine

19

Strategy--Glioblastoma• Mine omics and clinical data to generate disease-perturbed network

signatures to:– Stratify disease into different subtypes

• Discover how networks are disease-perturbed within each patient to predict (identify) unique sets of druggable targets

• Use network architecture of druggable targets to prioritize drug combinations that are most likely to work on a given patient

• Use patient tumor-derived differentiated stem cells to perform high throughput screening to:– generate dose response-curves for individual drugs – perform combinatorial drug screens on network-predicted

phenotypes

Page 20: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine

20

Possible outcomes for computational approaches to cancerMethodology to reverse engineer disease-perturbed network dynamics directly from patient cohort data

– Biomarkers:• Stratify Disease• Analyze Individual Patients for Unique Features• Predict Clinical Outcomes• Predict Drug Responsiveness

– Rational Drug Discovery:• Identification of New Drug Targets• Drug Repurposing for New Indications• Combinatorial Drug Formulations

Page 21: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine

21

Making blood a window into health and disease

Page 22: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine

22

Dynamics of prion-induced neurodegeneration in mice as seen through the blood with brain-specific blood proteins

Page 23: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine

23

APLP1,SNAP25,LGI1,NACM1, CLSTN2

KINESIN,MAP1B,SYT3,CT

NND1

CAMKII,PCLO,GRIA4,GLUR3,NSF,ANK2,ENO2,DOCK3

,SCG3,

L1CAM,CTF1, ARF3,ANK3, 

MAP3K12,CTNNA2,KIF3A,GFAP,CNTN1,ENC1

, CRMP2, SYNAPSIN1

NEUROMODULIN,HUC,CAMKIIA,RIN,SYNAPSIN1,RGS4,PEA15,RASGRF1,NR1

GNAO1, GNA13, GABBR1, GLUR1,GRI

A1

MAP1A,SPTBN, 

SPTBN4,FOXG1,EPHA5,N

CAM2, ELAVL3

TAU,MAP2, CAMKII, EPHA5, 

UCHL1,NCAM1

RGS4,PEA15,CAMKII,RASGRF1,

NR1

Synaptic vesicle transport

Calcium mediated signaling

Synaptic Transmission

Neurogenesis

Cell surface receptor signaling

GPCR signaling

Cellular differentiation

Anatomical structure 

development

Nerve growth factor signaling

200 Brain-Specific Blood Proteins Reflect Key Networks

Page 24: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine

2424

Targeted MS Proteomics:  Human Selective Reaction Monitoring (SRM)Atlas

ISB has developed SRM/MRM assays for most of the known 20,333  

human proteins

Analyze 100‐200 proteins quantitatively in 1 hour

Heavy isotope peptides forQ3 analyses allow precise 

quantification

Page 25: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine

25

15 Brain-Specific Blood Proteins Reflect the Early Detection and Progression of Prion Disease-Perturbed Networks

Prionaccumulation

GlialActivation

SynapticDegeneration

Neuronal Cell Death

Cholesteroltransport

Sphingolipidsynthesis

Lysosomeproteolysis

ReactiveAstrocytesLeukocyte

extravasation

Na+channelsCargo

transport

Caspases

*Arachidonatemetab./Ca+ sig.

Apod* Scg3*

Cntn2* Ttc3*

Gria3*Gfap*L1cam*

Mapt*Snap25*Myo5a*Kif5a*

Gria1*Bcas1*

Grin1*Prkar1b*

Clinical Signs0 wk 18~20 wk 22 wk

* indicates brain-specific blood proteins

Page 26: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine

26

Organ-specific blood proteins allow one to study the dynamics of human biological processes

• Development• Physiology• Aging• Wellness• Disease dynamics (diagnostics)• Drug toxicity (liver)• Multi-organ responses to disease

(Alzheimer’s)

Page 27: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine

27

A second blood diagnostics approach: a systems approach to blood diagnostic for identifying benign lung nodules in human lung cancer

Integrated Diagnostics—Paul Kearney, Xiao-jun Li, etc.

X. Li et.al. Science Translation Medicine: 5, 207, 2013

Page 28: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine

28

Indeterminate Pulmonary Nodules

Integrated Diagnostics

Is this cancer?

~3 million cases annually in the USA

Patrick Nana‐Sinkham, MD   Ohio State University 

Page 29: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine

29

Lung Nodules Found by CT Scan in USA

PET Scan Needle Aspiration Bronchoscopic Biopsy

Repeat CT studies

Surgery for nodule removal

(Ost DE and Gould MK. Decision Making in the Patient with Pulmonary Nodules. Am. J. Respir. Crit. Care Med. October 6, 2011 as doi:10.1164/rccm.201104‐0679C)

Cancer Risk

lower                                                     intermediate                                                   higher

Watchful waiting for 2 

years

Look for cancer

surgery threshold“watchful waiting” threshold

~0.8 – 2.0 cm

3 million cases/yr 600,000 in “dilemma zone”

Page 30: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine

30

Systems Approach to Distinguishing Benign from Malignant Lung Cancer Nodules (with Integrated Diagnostics)

• 371 SRM assays for lung cancer tissue/190 detectable in the blood– Differentially secreted (normal vs. neoplastic)– Differentially shed from cell surface (normal vs. neoplastic)– Candidates captured from the literature

• Discovery samples—analyze all 190 detectable proteins– 72 cancer vs. 72 benign/from four sites

• Discovery algorithm for “cooperative” proteins– Select the 32 (out of 190) best proteins for distinguishing nodules– A million random panels of 10 of 32 best proteins were scored– Identified 13 proteins that were highly “cooperative”—generally in most

effective panels• Validation study—13-protein panel

– 52 cancer vs. 52 benign/from 4 old sites plus 1 new site• InDi commercialize the panel of 13 blood proteins in Q4 2013• Published in X. Li et.al. Science Translation Medicine: 5, 207, 2013

Red indicates systems approaches

Page 31: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine

31

Lung cancer blood biomarker panel

• Rule out for surgery about 40% of the benign nodules with 90% specificity—prevent 1/3rd of unnecessary surgeries

• Save the healthcare system in US about $3.5 billion per year

• Bring “peace of mind” to many patients• Panel is independent of 3 classical criteria

for lung cancer—age, smoking history and size of lung nodule

Page 32: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine

32

Three Lung Cancer Networks Monitored: 12/13 biomarkers map to these networks

Page 33: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine

33

Performance of biomarker panels on 66 PTSD samples (36negatives and 30 positives) #

Characteristics Panel of 8 (train)

Panel of 8 (Cross-

validation)

Panel of 2 plasma only

(train)

Panel of 2 plasma only

(Cross-validation)

Sensitivity 0.97 0.90 0.83 0.79

Specificity 0.92 0.81 0.91 0.86

Accuracy 0.94 0.85 0.87 0.82Panel of 8: one blood protein, five circulating miRNAs and two PBMC miRNAs#66 out of 140 samples have results for all the measurements

ROC curve of a training result based on the panel of 8

Posttraumatic stress disorder—quantitative blood biomarkers for a neuropsychiatric disease—discovery phase

1. Panel was build based on the results from 46 measurements (1 protein +45 miRNAs) over 140 samples, 66 samples have results from all the measurements

2. Cross‐validation was performed by leave‐one‐out approach. 

3. Adding different measurements on the panel improves the performance of the diagnostic model

Page 34: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine

34

How Blood Biomarker Panels for Detecting Disease-Perturbed Networks Are Effective

• Distinguish normal individuals from diseased individuals

• Early diagnosis• Follow progression• Follow response to therapy• Follow the reoccurrence of disease• Reveal disease-perturbed networks which suggest

mechanisms of disease and candidate drug targets• Stratification of disease into different subgroups for

impedance match against effective drugs—and proper prognosis

Page 35: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine

35

Systems Medicine Is at a Tipping Point and Is Transforming Healthcare through Systems-Driven Strategies and Technologies

• Providing fundamental insights into the early dynamics of disease and disease-perturbed networks—using orthologous animal models

• Family genome sequencing -- identifying disease genes• Transforming blood into a window to distinguish health

from disease with a systems approach to blood diagnostics• Stratifying diseases into their distinct subtypes for an

impedance match against proper drugs• Using disease-perturbed networks to identify new drug

target candidates and repurpose old drugs.• Pioneering peptide protein-capture agents that will replace

monoclonal antibodies over the next 10 years.• Large-scale, longitudinal studies for the digital age—a

dynamical understanding of wellness and disease– Longitudinal clinical trials for preterm birth, wellness, and Lyme Disease

Page 36: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine

36

The Emergence of P4 MedicinePredictive, Preventive, Personalize, Participatory

Converging Megatrends Driving the transformation of healthcare for patients

Systems Biology & Systems Medicine

Consumer‐Driven Social Networks

P4 MEDICINE

Digital RevolutionBig Data

Page 37: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine

37

P4 Medicine vs. Contemporary Medicine• Proactive• Focus on Individual• Focus on Wellness• Generate, mine and integrate individual patient dynamical

data clouds– Produce predictive and actionable models of wellness /

disease• Clinical trials -- large patient populations analyzed at single

individual level (not population averages!) – Generate quantized stratification of patient populations and

create the predictive medicine of the future. N=1 experiments

Patient-driven social networks are a key to driving the acceptance of P4 medicine

Page 38: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine

38

Conceptual Themes of P4 Medicine

Disease DemystifiedWellness Quantified

P4 MedicinePredictivePreventivePersonalizedParticipatory

Wellness Industry Disease Industry

Page 39: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine

39

Understanding Wellness is KeyDeveloped World

If the trend of the last 10 years of increases in life

expectancy continue, more than half of all children

born today in developed countries can expect to

celebrate their 100th birthday.

Christensen, Ageing Populations: The Challenges Ahead, Lancet , 2009

Page 40: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine

40

A Framingham-like digital-age study of wellness in 100,000 (100K Project) patients longitudinally -- 20-30 years

2014 P4 Pilot ProjectHundred Person Wellness Project(March 2014)  

Page 41: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine

41

Assays / Measurements

Gut Microbiome 3xContinual self‐tracking & lifestyle monitoring

Whole Genome Sequencing Detailed lab tests 3x(blood, urine, saliva)

Database of actionable possibilities that will grow exponentially over time

Page 42: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine

42

Health: What do we really want to understand from 100,000 well patients?

Wellness

Time

Wellness

Disease transition

Page 43: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine

43

The Wellness Well

• Information will bring individuals from minimal to maximum wellness

• The dimensions of the wellness well are unique for each individual: presumably determined genetically

Minimum

Maximum

Page 44: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine

44

Health: What do we really want to understand from 100,000 well patients?

Wellness

Time

Wellness

Disease transition

Page 45: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine

45

Actionable Traits, Coaches and Positive Reinforcement

• Actionable possibilities from individual data types

• Actionable possibilities from integrated data types

• Coaches with MD advisors– Bringing actionable opportunities to each individual– Nourish relationship based accountability for participants

• Positive reinforcement / immediate gratification– Individuals can see improvement within a three-month period

(from one blood draw or other sample to the next)

Page 46: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine

46

Scaling Up RapidlyISB 100KWELLNESS PROJECT

10K

1K

Page 47: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine

47

Nature, Feb 2014

107 Individuals

Page 48: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine

48

Hundred Person Wellness Project Tests Blood, Urine, Saliva, Stool

1. Blood• Whole genome sequence – 50x coverage• Comprehensive clinical chemistries focusing on

nutrition, inflammation and metabolic function • Metabolomics targeting 600 metabolites—15% from gut microbiome• Organ-specific proteins for heart, brain and liver• 96 well ELIZA panels for inflammation and cardiovascular disease

2. Urine• Amino acid profile • Oxidative stress – lipid peroxidases

3. Saliva• Adrenal stress markers – cortisol and DHEA

4. Stool• 16S bacterial variable region 4 ribosomal RNA

Page 49: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine

49

Hundred Person Wellness Project Tests Personal Health and Self-Tracking

1. Personal Health Status• Personal health history• Familial health history• Personality assessments

2. Self-Tracking• Activity (Fitbit)• Sleep (Fitbit)• Weight• Blood Pressure (Omron)• Heart Rate (Omron)

Page 50: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine

50

Knowledgebase—graph database

• There are currently 227,979 nodes in the graph database, and 2,375,362 edges—connecting genes, environment and actionable possibilities

• What information being incorporated into our analytics pipeline?– Database of human phenotypes (OMIM)– Database of human clinical variants (ClinVar, ACMG)– Database of GWAS studies / traits (GWAS Catalog)– Database of actionable genetic variants (ISB

resource)– Database of human metabolites (HMDB)– Database of pharmacogenomics (PharmGKB)– Literature for actionable variants

Page 51: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine

51

Preliminary stories about actionable possibilities for the 107 Pioneers

Page 52: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine

52

Actionable possibilities from single data types

Page 53: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine

53

Baseline Blood Results

Cardiovascular

59% 

Inflammation68%

NutrientAbnormalities

91%

Diabetes Risk54%

Baseline Health (Blood Draw #1)Prevalence of Actionable Results in Pioneer 100 Labs

High rate of actionable lab results impacting various physiological systems, even in this supposedly healthy cohort

Page 54: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine

54

Actionable possibilities: toxic metals

• High mercury from tuna• High lead

Page 55: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine

5555

Only change between blood draw #1 and blood draw #2:

• 8 weeks of having salmon sushi vs. tuna sushi (3x a week)

Participant Action: Reducing Toxicity

Page 56: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine

56

Searching for novel correlations: lead vs. age

Page 57: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine

57

Actionable possibilities from two or more integrated data types

Page 58: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine

58

Vitamin D deficiency

• Vitamin D—90/108 Pioneers are low– Six genetic variants from 3 genes block

Vitamin D absorption– Risks associated with low Vitamin D

• Ricketts—improper bone mineralization• Increased risk of death from cardiovascular

disease• Cognitive impairment in older adults• Severe asthma in children• Cancer

Page 59: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine

59

Presence of risk alleles in vitamin D binding proteins is negatively correlated with vitamin D levels

28.75

31.64

35.7136.25

41.07

43.85

25.00

30.00

35.00

40.00

45.00

50.00

Vitamin D vs. risk alleles in GC, DHCR7, CYP2R1Round1 Round2

Wang, TJ et al. Common genetic determinants of vitamin D insufficiency: a genome-wide association study. Lancet 2010. 376(9736): 180-8.

4 or 5 risk alleles8 participants

3 risk alleles15 participants

1 or 2 risk alleles15 participants

25‐OH D Co

ncentration (ng/mL)

Page 60: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine

60

Vitamin D is significantly increased across our participants

Round 1

Roun

d 2

μR1 = 33.6 ng/mLμR2 = 44.0 ng/mLpsignedrank = 1.45E‐9

Vitamin D

0

10

20

30

40

50

60

70

80

90

100

0 10 20 30 40 50 60 70 80 90 100

Vitamin D was the most significantly changed metabolite out of 189 for which data are available. 

Page 61: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine

61

Common genetic variants—very small disease effects

Page 62: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine

62

Discovery and refinement of frequent genetic variants associated with lipid levels

Global Lipids Genetics Consortium. Discovery and refinement of loci associated with lipid levels. Nat Genet. 2013. 45(11): 1274-83.

• Study examined 188,577 individuals using genome-wide and custom genotyping arrays. – 94,595 in initial discovery set– 93,982 in validation set

• The study associates 72 loci with total cholesterol levels.

Page 63: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine

63

Individuals contain different subsets of variants that affect cholesterol levels

Variantrs68275

Variantrs8572

Variantrs68883

Variantrs099485

Variantrs97693 Variant

rs14445

Variantrs65313

Variantrs111393

Variantrs86837

Variantrs6837

Variantrs583785 Variant

rs68279

Variantrs59583

Variantrs13523

Each individual harbors a subset of the universe ofpossible variants that affect a trait. Although eachvariant alone has only a small effect, the cumulativeeffect of an individual’s variant set can add up tosignificant differences between individuals.

Small increase in overall cholesterol levels

Small decrease in overall cholesterol levels

Page 64: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine

64

Correlating cholesterol levels with 72 single nucleotide variants

The cumulative effect of the individual genetic profile of an individual for cholesterol‐related variants strongly correlates with HDL concentrations, for all participants for which we have genetic data. Reference ranges are shown as red (inappropriately hi), orange, and green (healthy) shadings. 

4000

6000

8000

10000

12000

14000

0 0.2 0.4 0.6 0.8 1 1.2 1.4 1.6

HDL Large Particle Con

centratio

n (nmol/L)

Cumulative genetic effect for each individual (std. dev.)

HDL Large Particle Concentration vs.Individual Genetic Profile

Correlation = 0.56High risk

Low risk

Page 65: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine

65

The multi-genome analysis paradigm

Individual genome

Multi‐genome reference models

2000 genomes Preliminary analysis

High‐quality analysis

Page 66: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine

66

0

20

40

60

80

100

120

140

9.5 10

10.5 11

11.5 12

12.5 13

13.5 14

14.5 15

15.5 16

16.5 17

17.5 18

18.5 19

19.5 20

20.5 21

21.5 22

22.5

Gen

ome Co

unt

Cumulative Odds Ratio

Risk for high cholesterol levels

Cumulative sum for an individual can give an estimate of risk relative to a population of 2000 normal individual genomes

Variantrs099485

Variantrs97693

Variantrs111393

Variantrs6837

Variantrs583785

Variantrs68279

Variantrs14445

Calculate the effects of all common variants within an individual

Estimate the risk for high cholesterol relative to a population.

Below average

Above average

Page 67: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine

67

Major diseases and related GWAS-identified variants

GWAS Trait # of variants

Lung Cancer 31

Obesity 139

COPD 55

Alzheimer’s Disease 230

Asthma 93

Breast Cancer 171

Stroke 21

Hypertension 35

Bipolar Disorder 126

Prostate Cancer 141

Multiple Sclerosis 182

Crohn’s Disease 220

Cholesterol (lipid) Levels 72

We have the capability to associate genetic variation with quantitative traits also being measured in the study.  The NHGRI GWAS catalog provides a rich resource that can be mined for genetic‐phenotype associations.

Page 68: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine

68

Wellness to disease transitions—an example--hemachromatosis

Page 69: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine

69

Hereditary hemochromatosis causes the body to absorb too much iron, which can lead to cancer, heart arrhythmias, and liver cirrhosis. It is one of the most common genetic diseases in Caucasians, and is usually associated with a variant in the HFE gene—about 1/10 Caucasians carry this defect.

Hereditary hemochromatosis is associated with a variant in the HFE gene

Page 70: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine

70

Hereditary hemochromatosis is associated with a rare variant in the HFE gene

Combining genome sequencing with our blood chemistry panel allows us to visualize the effect of this rare variant in only 100 individuals, and infer hemochromatosis in two participants after the first round of blood draws.  Subsequent bloodletting treatment yielded a reduction in iron levels by the second round to healthy levels. Left untreated, this disorder can lead to liver cancer, diabetes, pancreatic disease and heart disease. 

0

50

100

150

200

250

Zero copies of rare variant (86 individuals)

One copy of rare variant (12 individuals)

Two copies of rare variant (2 individuals)

ng/m

L Iron Levels in 100i Par cipants

First Blood Draw Second Blood Draw

Page 71: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine

71

By examining only one data type, it was determined that 100% of the 107 Pioneers have actionable traits: 

• Hence, virtually every person will have multiple, actionable traits as their data are aggregated and integrated

• These actionable possibilities will change as the environment changes, as reflected by dynamically changing personalized data clouds

Personalized Dynamical Data CloudsGrowing exponentially over time

Page 72: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine

72

Project Leadership• Leroy Hood, PI

• Nathan Price, PhD, Co-PI

• Sean Bell, Business Director

ISB Hundred Person Wellness Project – Team

Data Analytics• Nathan Price, Analytics Lead

• Gustavo Glusman, Genomics

• Andrew Magis, Multi-Omics

Project Management• Sean Bell, Business Director

• Kristin Brogaard, Project Manager

• Sara Mecca, Project Assistant

• Mary Brunkow, Project Coordinator

Medical Advisory Board• Robert Green, M.D.

• Michael Raff, M.D.

• Sarah Speck, M.D.

Communications• Gretchen Sorenson, Consultant

• Hsiao-Ching Chou, Communications

Director

Participant Engagement• Jennifer Lovejoy, VP Clinical Affairs

• Sandi Kaplan, Wellness Coach

• Craig Keebler, M.D., Study Physician

Page 73: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine

73

Most of the 107 Pioneers have learned two important concepts

Page 74: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine

74

Your genome determines your potential but not your destiny. You can control your health.

Page 75: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine

75

The Pioneers Realize that They Must Take Responsibility for their Own Wellness (and Disease)

P4 Medicine puts individuals at the epicenter of their own healthwhich will dramatically reduce the cost of healthcare

Page 76: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine

76

Opportunities

Page 77: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine

77

100K Project: Transforming Healthcare• Identify vast array of actionable possibilities• Analytics to optimize wellness and avoid (reduce) disease for each

individual patient—optimize human potential• Create a data base of wellness measurements to mine for the

“multiparameter wellness metrics”—define fundamental human features of wellness—physiological and psychological

• Generate a data base from individuals that will allow us to follow early disease mechanisms in the transitions from wellness to disease for major diseases—diabetes, cardiovascular, cancer and neurodegeneration—enable early transition back to wellness

• Drive the development of improved old and new assays and analytics—parallelize, miniaturize, increase throughput, reduce cost, point of contact—digitalization through smart phone format

• Database of wellness and disease transitions catalyze innovation for the wellness industry industry

• Bring P4 medicine into the healthcare system– Improving the quality of healthcare– Decreasing the cost of healthcare– Promoting innovation in Healthcare

Page 78: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine

78

P4 medicine and the 100K project: Societal Implications

• Digitalize medicine for the individual patient—Leading to a lowering of healthcare costs and the democratization of healthcare—assays to smart phone.

• Innovation—100K database will create many opportunities for start ups and established healthcare industries.

• Wealth—the Wellness Industry will far exceed the current disease (healthcare) industry in market cap in 10-15 years. We are creating today the companies that will be the Google and Microsoft of the Wellness Industry.

• Competition—Economic advances generally arise from new technologies. Macro and micro inventions. P4 is a macroinvention and will span many microinventions and commercial opportunities.

• Financial crisis from healthcare—key is to have individuals take responsibility for their own health.—enormous savings from individuals becoming responsible for their own healthcare to

• Optimization of human capital—avoid loss of productivity due to absence from illness or presenteeism. Elevate all individuals to their highest level in their “wellness wells”.

Page 79: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine

79

The ISB Wellness Project Is Taking Two Directions

• The 100,000 person wellness project—academic—discovery science—pioneer assays (to the smart phone) and pioneer the integrative and modeling analytics—open data--seek Congressional funding

• The company—Wellness Sciences—consumer directed—may really lead the large-scale adoption of P4 medicine and the democratization of healthcare

Page 80: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine

80

Take home lessons

• Systems medicine is key to dealing with the complexities of disease leading to new strategies and technologies for diagnostics and therapeutics

• Systems medicine has reach a tipping point and is enabling a medicine that is predictive, preventive, personalized and participatory (P4 medicine)—that is very different from contemporary medicine

• P4 medicine can transforming healthcare through the initiation of a Framingham-like, longitudinal, digital-age study of 100,000 well people for which we are seeking Congressional support

Page 81: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine

81