Upload
others
View
5
Download
0
Embed Size (px)
Citation preview
JPET #180364
Synergistic Suppression of Prostatic Cancer Cells by Co-expression of both
Mdm2-siRNA and Wide-type P53 Gene in vitro and in vivo
Kun Ji, Bo Wang, Yue-ting Shao, Ling Zhang, Ya-nan Liu, Chen Shao, Xiao-jie Li, Xin Li,
Jia-di Hu, Xue-jian Zhao, De-qi Xu, Yang Li, Lu Cai
Department of Pathophysiology, Prostate Diseases Prevention and Treatment Research Center,
Norman Bethune College of Medicine, Jilin University, Changchun, P. R. China (K.J., B.W.,
Y.S., L.Z., Y.L., C.S., X.L., X.L., X.Z., Y.L.); Department of Pathophysiology, College of
Basic Medicine, Shenyang Medical College, Shenyang, P. R. China (K.J.); Department of
Pathology, Inner Mongolia Forestry General Hospital, Yakeshi, Inner Mongolia Autonomous
Region, P. R. China (B.W.); Department of Pediatrics and Radiation Oncology, the University
of Louisville, Louisville, KY, USA (B.W., L.C.); Department of Oncology and Diagnostic
Sciences, University of Maryland Dental School, Baltimore, MD, USA (J.H.); Laboratory of
Enteric and Sexually Transmitted Diseases, Center for Biologics Evaluation and Research,
Food and Drug Administration, Bethesda, Maryland, USA (D.X.)
JPET Fast Forward. Published on March 28, 2011 as DOI:10.1124/jpet.111.180364
Copyright 2011 by the American Society for Pharmacology and Experimental Therapeutics.
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on March 28, 2011 as DOI: 10.1124/jpet.111.180364
at ASPE
T Journals on A
pril 10, 2019jpet.aspetjournals.org
Dow
nloaded from
JPET #180364
2
Running title: Synergistic suppression of prostate cancer by mdm2-siRNA/p53
Address correspondence to: Dr. Yang Li. Department of Pathophysiology, Prostate Diseases
Prevention and Treatment Research Center, Norman Bethune College of Medicine, Jilin
University, Changchun 130021 China or Dr. De-Qi Xu, MD 20892, USA. Phone:
+86-431-85619485. E-mail: [email protected]
The number of text pages, number of tables, figures, and references
Text pages: 35
Tables: 1
Figures: 8
References: 40
The number of words
Abstract: 249
Introduction: 740
Discussion: 1,311
ABBREVIATIONS: MDM2, Murine double minute 2; wt p53, wild-type p53; mt p53,
mutated-type p53; PI, propidium iodide; PBS, phosphate-buffered saline; MTT, 3-(4,
5-dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide; GFP, green fluorescent
protein; AI, apoptotic index.
Section options: Chemotherapy, Antibiotics, and Gene Therapy
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on March 28, 2011 as DOI: 10.1124/jpet.111.180364
at ASPE
T Journals on A
pril 10, 2019jpet.aspetjournals.org
Dow
nloaded from
JPET #180364
3
ABSTRACT
The objective was to evaluate the cell growth and death effects in human prostate cancer cells
by inhibiting Murine Double Minute 2 (MDM2) expression with overexpressing wild-type
(wt) p53 gene. Prostate PC-3 tumor cells were transfected with a plasmid containing either
mdm2-siRNA (Si-mdm2), wt p53 gene (Pp53) alone or both (Pmp53) using lipofectamine in
vitro and attenuated Salmonella in vivo. Cell growth, apoptosis, and the expression of related
genes and proteins were examined in vitro and in vivo by flow cytometry and Western
blotting assays. We demonstrated that human prostate tumors had the increased expressions of
MDM2 and mutant p53 proteins. Transfection of the PC-3 cells with Pmp53 plasmid in vitro
offered a significant inhibition of cell growth and an increase in apoptotic cell death compared
to the Si-mdm2 or Pp53 group. These effects were associated with up-regulation of p21 and
down-regulation of HIF-1α expression in Pmp53 transfected cells. To validate the in vitro
findings, the nude mice implanted with PC-3 cells were treated with attenuated salmonella
carrying the plasmids, which showed that Pmp53 plasmid significantly inhibited the tumor
growth rate in vivo compared to Si-mdm2 or Pp53 plasmid alone. Tumor tissues from the
mice treated with Pmp53 plasmid showed an increased expression of p21 and decreased
expression of HIF-1α proteins, with an increased apoptotic effect. These results suggest that
knockdown of mdm2 expression by its specific siRNA with an overexpression of wt p53 gene
offers a synergistic inhibition of prostate cancer cell growth in vitro and in vivo.
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on March 28, 2011 as DOI: 10.1124/jpet.111.180364
at ASPE
T Journals on A
pril 10, 2019jpet.aspetjournals.org
Dow
nloaded from
JPET #180364
4
Introduction
Prostate cancer is the most common cancer in men (Kamangar et al., 2006), and an
efficient therapy for this cancer remains an urgent need. Cell growth and death are usually
determined by a balance between oncogenes and tumor-suppressor genes. P53 plays an
essential regulatory role in the development and homeostasis of cells and tissues (Vousden
and Lane, 2007). P53 inactivation caused by its negative regulators such as Murine Double
Minute 2 (MDM2) contributes to the development of a large number of human cancers.
MDM2 is an E3 ubiquitin ligase that directly binds to the p53 for its ubiquitylation (Tao and
Levine, 1999). Tumors with over-expression of MDM2 were resistant to p53 gene therapy
(Wiman, 2006). Reportedly prostate tumors with MDM2 knockdown were sensitive to
radiation therapy both in vitro and in vivo (Mu et al., 2004a, 2004b, 2008; Stoyanova et al.,
2007). Therefore, the anti-tumor strategy to interfere with the p53–MDM2 feedback loop
holds a promise to reinstate the p53 tumor suppressing pathway (Wade and Wahl, 2009).
Several agents such as Nutlin-3a that disrupts MDM2-p53 interaction inhibit the growth
of certain tumors, but are less effective in the other tumors (Patton et al., 2006; Wade et al.,
2006). In addition, these agents also lack selectivity for the tumor cells. Therefore, gene
therapy selectively targeting to the tumor cells with little effect to normal tissue is an
interesting and urgent tool to improve the therapeutic efficacy (Lee et al., 2004). For instance,
gastric cancer cell lines carrying wt p53 gene were infected with adenovirus expressing
RPL23 (Ad-RPL23) to stabilize wt p53 by inhibiting MDM2-mediated p53 degradation. The
adenovirus delivery of RPL23 significantly inhibited the proliferation of gastric cancer cells
with wt p53 (Zhang et al., 2010).
In the above study, the successful restoration of p53 function needs the presence of
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on March 28, 2011 as DOI: 10.1124/jpet.111.180364
at ASPE
T Journals on A
pril 10, 2019jpet.aspetjournals.org
Dow
nloaded from
JPET #180364
5
endogenous wt p53 in the tumors. However, inactivation of p53 activity often occurs in the
tumors due to its deletions, mutations, protein destruction or protein sequestration (Bernal et
al., 2010). Thus, reinstatement of wt p53 function in the tumors with mutated (mt)
endogenous p53 is specially daunting (Bernal et al., 2010). A few studies have explored for
the forced expression of wt p53 gene with MDM2 negative regulator genes such as FHIT
(Nishizaki et al., 2004) or FUS1 (Deng et al., 2007) to negatively inhibit MDM2 that in turn
up-regulates the exogenous wt p53 function in the cancer cells. However, expression of single
MDM2 negative regulator either FHIT or FUS1 to down-regulate MDM2’s p53 suppression
may be not ideal since which of these MDM2 negative regulators is the most effective in
suppressing MDM2 function and whether these MDM2 negative regulators have other
functions except for suppressing MDM2 function remains uncertain. Therefore, to directly
down-regulate MDM2 by its specific siRNA in the tumors cells with a forced-expression of
exogenous wt p53 may be a better approach.
In addition, the transfection approaches (adenovirus and nanoparticle), used in the above
studies (Deng et al., 2007; Nishizaki et al., 2004), are also not tumor cell selective. Reportedly
salmonella would infect and preferentially accumulate within the tumor xenograft in vivo,
with a tumor/normal tissue ratio of approximately 1,000:1 (Pawelek et al., 1997). Attenuated
salmonella Typhimurium Ty21a (S. Typhi Ty21a) is a facultative anaerobic bacterium and
capable of replicating preferentially in tumor cells and has been explored for developing
therapeutic proteins to tumors (Cryz et al., 1993; Kimura et al., 2010).
In the present study, therefore, we have made plasmids either containing mdm2-siRNA
or human wt p53 (Pmp53) alone or containing both. The effects on the tumor cell growth and
apoptotic death by transfection with Pmp53 in the prostate cancer cells in vitro and in vivo
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on March 28, 2011 as DOI: 10.1124/jpet.111.180364
at ASPE
T Journals on A
pril 10, 2019jpet.aspetjournals.org
Dow
nloaded from
JPET #180364
6
were compared with that by transfection with either mdm2-siRNA or wt p53 alone. The
unique features of the present study included (1) that we have co-transfected, for the first time,
mdm2-siRNA to directly down-regulate MDM2 expression with human wt p53 gene in the
prostate cancer cells in vitro and in vivo; (2) for the in vivo study, we have used, for the first
time, S. Typhi Ty21a to carry various plasmids predominantly transfected into prostate tumor
xenografts in a nude tumor-bearing mouse model. This application of the S. Typhi Ty2la
bacteria carrying plasmid containing both mdm2-siRNA and wt p53 will ensure the
transfected cells to express wt p53 with efficient inactivation of its negative regulator MDM2
expression no matter the tumor cells with or without the presence of wt p53.
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on March 28, 2011 as DOI: 10.1124/jpet.111.180364
at ASPE
T Journals on A
pril 10, 2019jpet.aspetjournals.org
Dow
nloaded from
JPET #180364
7
Materials and Methods
Construction of a Plasmid Vector Capable of Co-expressing mdm2 siRNA and wt
p53. By a method used in our previous studies (Zhang et al., 2007), we constructed a series
of expression plasmids that contain siRNA specific to mdm2 and/or wt p53 expression
element. The pcDNA3.1-p53 (Pp53) plasmid containing wt p53 coding region was generated
as described before (Shao et al., 2010). A siRNA with the sequence of
GACACTTATACTATGAAAG (Genbank accession number NM002392) was selected for
specifically targeting to the fragment corresponding nucleotides 152 to 171 of MDM2 mRNA.
The oligonucleotide contains a sense strand of 19 nucleotides followed by a short spacer (loop
sequence: TTCAAGAGA), an antisense strand and a five Ts terminator. A scrambled siRNA
was used as a negative control. Double-stranded DNA oligonucleotides were cloned into
pGCsilencerU6/ Neo/GFP, which also expresses a green fluorescent protein (GFP) gene (Jikai
Chemical, Inc., Zhejiang, China), to generate plasmids Si-mdm2 and Si-scramble. A 585bp
fragment, containing Si-mdm2 under the control of the U6 promoter was PCR amplified from
the plasmid Si-mdm2 using the following primers: forward =
5'-GCAGATCTTGCTTCGCGATGTACGGGCC-3'; reverse =
5'-GCAGATCTTGCTTCGCGATGTACGGGCC-3'. The underlined nucleotides in these
primers correspond to the BglII and NruI restriction sites, respectively. This fragment was
sub-cloned into the BglII and NruI sites of the Pp53 vector to generate the plasmid
pcDNA3.1- p53/U6 Si-mdm2, which can express both mdm2-siRNA and p53 protein from
the same plasmid and was designated as Psi-mdm2-p53 (shortly, Pmp53). All recombinant
plasmids were verified by sequencing (Shenggong Bioengineering, Shanghai, China).
Human Prostate Tissues. We obtained 10 samples of normal prostate tissues from
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on March 28, 2011 as DOI: 10.1124/jpet.111.180364
at ASPE
T Journals on A
pril 10, 2019jpet.aspetjournals.org
Dow
nloaded from
JPET #180364
8
nontumor areas of prostatectomy specimens, and 19 samples of cancer tissues from radical
prostatectomy specimens of patients with organ-confined tumor without previous therapy.
Both prostate normal and tumor tissues (Gleason score=9) were collected from Inner
Mongolia Forestry General Hospital (Yakeshi, China) and Prostate Disease Prevention and
Treatment Research Center (Jilin University, China), with the informed consent of the patients
under an institutionally approved protocol.
Cell Culture and Transfection. PC-3 cells were cultured in IMDM medium
supplemented with 10% fetal bovine serum (FBS), penicillin-streptomycin, and L-glutamine,
as described previously (Mu et al., 2005). Cells were transfected with various plasmids using
the Lipofectamine TM 2000 reagent (Invitrogen, Carlsbad, CA, USA) and 1% FBS for
various times before analysis of mRNA and protein levels, apoptosis, and cell proliferation. In
combination treatments, plasmids-transfected cells were incubated for an additional 48-72 h
before measurement.
Cell Proliferation Assay. Approximately 6×103 PC-3 cells per well were transfected
with the plasmids of interest, and cell growth was evaluated after 48 and 72 h using the
4,5-dimethylthiazol-2-yl-2,5-diphenyltetrazolium bromide (MTT) assay following the
instruction provided by the Kit.
Reverse Transcription-PCR. For RT-PCR analysis at 48 h after transfection, cells were
collected and total RNA was extracted using the Trizol Reagent (Invitrogen, Carlsbad, CA,
USA). Approximately, 5 μg of total RNA (purified after DNAse I treatment) from each
sample was converted to complementary DNA using a commercially available RT-PCR kit
(Promega, Madison, WI, USA). The resultant complementary DNAs were used in PCR
reactions with the gene-specific primers of interest (Table 1), and the optimal conditions of
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on March 28, 2011 as DOI: 10.1124/jpet.111.180364
at ASPE
T Journals on A
pril 10, 2019jpet.aspetjournals.org
Dow
nloaded from
JPET #180364
9
PCR reaction, including cycles, annealing times and primer concentrations for each gene were
obtained by performing series of pre-experiments (Data not shown). The PCR products at the
optimal conditions for each gene of interest were separated by agarose gel electrophoresis and
visualized by ethidium bromide staining.
Flow Cytometry. PC-3 cells were incubated with plasmids for 48, 72 h, harvested and
counted, and 1 × 106 cells were resuspended in 100 μl phosphate-buffered saline (PBS). Then,
5 μl of propidium iodide (PI, Beckman, USA) was added, incubated for 30 min at room
temperature in dark. Then the cells were subjected to flow cytometry to measure the apoptosis
rate (%) with a Beckman Coulter Epics-XL-MCL cytometer (California, USA).
Xenograft Models. The models of PC-3 xenografts were established using athymic
nude male mice (nu/nu; 6–8 weeks) that were acquired from the Institute of Zoology, Chinese
Academy of Sciences, Beijing and used in accordance with an Animal Care and Use protocol
approved by Jilin University. Cultured cells were washed with and resuspended in serum-free
media. The suspension (5 × 106 cells in 150 μl per mouse) was inoculated subcutaneously into
the right flank of nude mice. The sizes of tumors in these mice were measured starting from
10 days after cell injection until 21 days using calipers. These tumor-bearing mice were then
randomly divided into five groups (6 mice per group): (1) mock transfection with PBS buffer
as the normal control; (2) scrambled siRNA-vector alone (Si-scramble) as the vector control;
(3) pcDNA3.1-p53 (Pp53) as wt p53 transfection alone; (4) U6-mdm2 (Si-mdm2) as mdm2
siRNA transfection alone; (5) pcDNA3.1-p53/U6 Si-mdm2 (PSi-mdm2-p53, Pmp53) as the
combined transfection. Mice in each of these groups were inoculated bacteria with different
plasmids (108 cfu/50 µl) per mouse via intratumoral injection by using a syringe fitted with a
27-gauge needle. At 4 days after treatment, tumors were measured using calipers every 4 days
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on March 28, 2011 as DOI: 10.1124/jpet.111.180364
at ASPE
T Journals on A
pril 10, 2019jpet.aspetjournals.org
Dow
nloaded from
JPET #180364
10
for 32 days and the data were plotted using Kaplan-Meier method to analyze the tumor
growth curves. In addition, the tumor xenografts were also measured for the wet weight and
size when mice were sacrificed.
To ensure the tumor-preferable distribution of the bacteria, an additional pilot study was
performed before the above animal experiment. Tissue samples from the tumor, liver, lung,
spleen, heart and kidney of three tumor-bearing mice treated with bacteria carrying
Si-scramble at day 1 (24 h), 2, 3, 5, and day 10 after bacteria treatment were used for bacterial
distribution analysis. Tissues were weighed and then 100 mg of each tissue in 3 ml of PBS
were excised, minced, and homogenized. Then the homogenized tissues were plated onto
Luria-Bertani agar containing ampicillin (100 mg/ml) in triplicate, 24 h later bacterium
colony count was evaluated as the colony-forming unit (CFU).
Immunohistochemic Staining. Each paraffin-embedded tissue section at 4 μm in
thickness was deparaffinized, hydrated, and incubated in 3% H2O2 and microwaved for 10
min to block endogenous peroxidase activity. After formalin fixation and paraffin embedding,
the tissue sections were incubated with the primary antibodies [anti-mt-p53, wt-p53,
anti-mdm2 antibodies, from Santa Cruz Biotech Inc. (Santa Cruz, CA, USA), or anti-PCNA
anti-body, from Beijing Biosynthesis Biotechnology Co. LTD (Beijing, China)] for 60 min,
washed with PBS, and then were incubated with the biotinylated secondary antibody. Finally
the sections were stained with 3, 3'-diaminobenzidine (DAB) and counterstained with
hematoxylin. Serum blocking solution in place of the primary antibody was used as a negative
control. Stained tissues were screened independently by two investigators and classified
according to staining intensity (-or+). We considered the tissue to be positive (+) if the
staining intensity was moderate to strong in>10% of cells examined. Weakly stained (<10%
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on March 28, 2011 as DOI: 10.1124/jpet.111.180364
at ASPE
T Journals on A
pril 10, 2019jpet.aspetjournals.org
Dow
nloaded from
JPET #180364
11
of total cells examined) or non-immunoreactive cells were considered negative (-). Positive
or negative reaction was determined after counting cells in five random high-power fields of
each sample.
Western Blot Analysis. The protein levels of MDM2, wt p53, p21 (Cyclin-dependent
kinase inhibitor 1A), cdk4, cyclin-D1, hypophosphorylated retinoblastoma (pRb), E2F1,
hypoxia-inducible factor 1alpha (HIF-1α) and β-actin in cultured cells and xenografts were
analyzed by Western blotting as described previously (Zhang et al., 2008). The monoclonal
antibodies against MDM2, wt p53, p21, pRb, cyclin-D1, and HIF-1α were obtained from
Oncogene Research Products (Boston, MA, USA). Anti-E2F1 monoclonal antibody was
purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA). Anti-β-actin monoclonal
antibody was obtained from Sigma (St Louis, MO, USA).
TUNEL Staining of Apoptotic Cells. The tissue sections of xenografts from the nude
mice were dewaxed and hydrated, and then were subjected to TUNEL staining following the
instruction provided by TUNEL kit (Promega, Madison, WI, USA). Four fields (400 x) were
randomly chosen and analyzed, the apoptotic index (AI) was defined as follows: AI (%) = 100
× apoptotic cells/total tumor cells.
Transmission Electron Microscopy. Tissue blocks (~1 mm3) were fixed in 2.5%
glutaraldehyde (in 0.1 M sodium cacodylate, pH 7.4) for 2 h and stained by 1% OsO4 at 4 °C
for 2 h and 0.9% OsO4 and 0.3% K4Fe (CN)6 at 4 °C for 2 h. Sections in 80 nm thick were
deposited on carbon and Formvar-coated, 200-mesh, nickel grids (Electron Microscopy
Sciences, MA,USA) and were stained with 3% uranyl acetate and Reynolds lead citrate for
visualization under a 120 kV JEM-1200EX transmission electron microscope.
Statistical Analysis. For in vitro study, three separate experiments were done. For in
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on March 28, 2011 as DOI: 10.1124/jpet.111.180364
at ASPE
T Journals on A
pril 10, 2019jpet.aspetjournals.org
Dow
nloaded from
JPET #180364
12
vivo study, six animals were included. Data are expressed as the mean ± SD. One-way
ANOVA was used to determine if differences exist and if so, a post hoc Tukey’s test was used
for the difference analysis between groups, with Origin 7.5 laboratory data analysis and
graphing software. Statistical significance was considered at p < 0.05.
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on March 28, 2011 as DOI: 10.1124/jpet.111.180364
at ASPE
T Journals on A
pril 10, 2019jpet.aspetjournals.org
Dow
nloaded from
JPET #180364
13
Results
MDM2 and mt p53 are Over-expressed in Primary Human Prostate Cancers.
Immunohistochemical analysis of the mt p53 and MDM2 protein expression in human
prostate tissues (Fig. 1A) showed that MDM2 expression mainly localized in the nucleus in
the prostate tumors and was detectable in 68.4% of the primary prostate cancers (13/19) while
mt p53 protein was detected in 52.6% of the primary prostate cancers (10/19). Semi-
quantitative analysis of each protein, as described in the Materials and Methods, was
presented in Fig. 1B. This study confirms the increased expression of mt p53 and MDM2
proteins in the human prostate cancer tissues compared to normal prostate tissues.
Effect on the Gene and Protein Expressions of MDM2 and wt p53 in Human PC-3
Prostate Cancer Cells by Transfection with both mdm2 siRNA and wt 53. The expression
of mdm2 and wt p53 genes and proteins in the PC-3 cells transfected with different plasmids
(illustration of the constructions of these plasmids are shown in Fig. 2A) was examined by
RT-PCR and Western blot analysis, respectively. As expected, the mdm2-mRNA and protein
expressions were significantly decreased in the PC-3 cells transfected with Si-mdm2 and
Pmp53 compared to the cells transfected with mock and Si-scramble (Fig. 2B, C). In contrast,
the wt p53 mRNA and protein expressions were significantly increased in the PC-3 cells
transfected with Pp53 and Pmp53 and slightly increased in the PC-3 cells transfected with
Si-mdm2 compared to the cells transfected with mock and Si-scramble (Fig. 2B,C). The
results suggest the effectiveness of the transfected plasmids on the target genes.
Effects on the Cell Proliferation and Apoptotic Death by Co-expression of
mdm2-siRNA and wt p53 Gene in the Prostate Cancer Cells. The potential effects on cell
proliferation and death by treatment with Pmp53 were compared to those with Pp53 and
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on March 28, 2011 as DOI: 10.1124/jpet.111.180364
at ASPE
T Journals on A
pril 10, 2019jpet.aspetjournals.org
Dow
nloaded from
JPET #180364
14
Si-mdm2 by two assays: MTT and apoptotic cell death. MTT assay showed that treatments
with Pp53, Si-mdm2 and Pmp53 resulted in a significant inhibition of the PC-3 cell
proliferation at both 24 and 72 h after transfection, with a maximal inhibition by Pmp53
treatment (Fig. 3A).
For apoptotic cell death, flow cytometry (FCM) was employed to detect the fluorescent
intensity after tumor cells were double-stained with Annexin V and PI at 72 h transfection.
Representative raw FCM data are shown in Fig. 3B, in which the early (Annexin V positive
only) and the late (Annexin V and PI both positive) apoptotic cells are distributed in the Q4
and Q2 regions, respectively, and necrotic cells (PI positive only) are in the Q1 region. It is
noted that there was a few necrotic cells and there was also no significant difference for the
incidence of necrotic cells among the groups. Compared to necrotic cells, there was a
significantly increased portion of apoptotic cells among the tumors cells of each group.
Quantitative analysis based in FCM showed that the apoptotic death was significantly
increased in the cells transfected with Pp53 or Si-mdm2 plasmid compared to the cells
transfected with mock or Si-scramble, but was the most evident in the cells treated with
Pmp53 plasmid among the all groups (Fig. 3B, C).
Effects of Co-expression mdm2-siRNA and wt p53 Gene on the Expression of
CDK4, Cyclin-D1 and HIF-1α Genes in the Prostate Cancer Cells. To explore the possible
mechanisms underlying the induction of PC-3 cell death by co-expression of mdm2-siRNA
and wt p53 gene, gene and protein expressions of p21, CDK4, cyclin-D1 and HIF-1α were
examined with RT-PCR (Fig. 4A) and Western blot (Fig. 4B) assays. It is shown that p21
mRNA and protein levels were low in mock and Si-scramble group, but significantly
increased in the cells transfected with Pp53 or Pmp53 plasmid (Fig. 4 A, B). In contrast,
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on March 28, 2011 as DOI: 10.1124/jpet.111.180364
at ASPE
T Journals on A
pril 10, 2019jpet.aspetjournals.org
Dow
nloaded from
JPET #180364
15
expressions of CDK4, cyclin-D1 and HIF-1α were significantly evident in the cells treated
with either mock or Si-scramble, but significantly decreased in the cells treated with Pp53,
Si-mdm2 and Pmp53 plasmids (Fig. 4).
Preferable Transfection of the S. Typhi Ty21a Carrying Plasmids into Xenograft
PC-3 Tumors and Efficient Expressions of MDM2 and wt p53 Proteins. The models of
PC-3 xenografts were established as described in the Materials and Methods. Athymic nude
male mice (nu/nu; 6–8 weeks) were implanted with PC-3 tumor cell suspension at 5 × 106
cells in 150 μl per mouse at the upper back of the mice. The sizes of tumors were measured
daily starting from 10 days after cell implantation. At 21 days of post-implantation, the
tumor-bearing mice were inoculated with bacteria carrying the specific plasmid for each
group via intratumorally injection with 108 cfu/50 µl per mouse.
To ensure the S. Typhi Ty21a carrying these plasmids preferentially localized in the
tumor tissue, we have monitored the kinetics of bacterium distribution in the xenograft tumor
and different organs of the tumor-bearing mice with bacterium injection at specified
post-injection times (Fig. 5A). At 24 h (1 day) after injection, bacteria could be found in the
tumors and organs (Data not shown). The bacteria were significantly increased in the tumors
and decreased in the liver and other tissues at 3 days after administration (Fig. 5A). At 10
days after bacterium injection, the bacterium accumulation was observed predominantly in the
tumor tissue, very less in the liver (Fig. 5A), and undetectable in other organs (Data not
shown). Quantitative analysis of the bacteria by CFU, as described in the Materials and
Methods and presented in Fig. 5B, C, confirms the predominantly distribution of these
bacteria in the tumor tissue.
To determine if the transfected plasmids were efficiently expressed in tumor cells, the
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on March 28, 2011 as DOI: 10.1124/jpet.111.180364
at ASPE
T Journals on A
pril 10, 2019jpet.aspetjournals.org
Dow
nloaded from
JPET #180364
16
expressions of MDM2 and wt p53 proteins were examined by Western blotting. As shown in
Fig. 6A, MDM2 expression was significantly low in the tumors of mice treated with Si-mdm2
and Pmp53, but not changed in the tumors of mice treated with Pp53, as compared to that in
the tumors of mice treated with Si-scramble or mock. This result suggests that the successful
transfection of bacteria with mdm2-siRNA in vivo efficiently suppress mdm2 expression.
Expression of wt p53 was increased significantly in the tumors of mice treated with Pmp53
and Pp53 and only slightly in the tumors of mice treated with Si-mdm2, as compared to that
in the tumors of mice treated with Si-scramble or mock (Fig. 6A). This confirms the
successful transfection of the bacteria with wt p53 gene to efficiently express the wt p53
protein. Furthermore, immunohistochemical staining for MDM2 and wt p53 was
representatively provided in Fig. 6B, which confirmed that the expression of MDM2 was
decreased and expression of wt p53 was increased in the tumor cells treated with Pmp53
compared to the tumors cells treated with Si-scramble.
Suppression of the Prostate Tumor Xenograft Growth by Co-expression of Mdm2-
siRNA and wt p53. The potential therapeutic effect on the prostate xenograft growth was
examined in the tumor-bearing mice treated with the bacteria carrying plasmid containing
both mdm2-siRNA and wt p53 gene (Fig. 7). Dynamic tumor growth that was monitored from
the 4th day until the 32nd day after bacteria treatment (Fig. 7A) showed that sizes of the tumor
xenografts in the mice treated with mock or Si-scramble increased slowly from day 4 to day
16 and quickly from day 16 until day 32, while tumor xenografts in the mice treated with
Pmp53 grew very slowly thorough the whole period, and also significantly smaller than those
in the mice treated with either Pp53 or Si-mdm2. When tumor-bearing mice treated with
different plasmids were sacrificed, tumor xenografts were removed for measuring tumor sizes
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on March 28, 2011 as DOI: 10.1124/jpet.111.180364
at ASPE
T Journals on A
pril 10, 2019jpet.aspetjournals.org
Dow
nloaded from
JPET #180364
17
and weights. Fig. 7B showed that the individual tumor xenografts from the mice treated with
Pmp53 plasmid were significantly smaller than those from mice treated with Si-scramble. Fig.
7C showed that tumor weights were significantly decreased in the tumor-bearing mice treated
with Pp53, Si-mdm2 or Pmp53, compared to the mice treated with mock or Si-scramble
plasmid. However, the inhibitory effect on tumor growth was more evident in the mice treated
with Pmp53 than that in the mice treated with either Pp53 or Si-mdm2 alone (Fig. 7A, C).
Effects of Co-expression of mdm2-siRNA and wt p53 on Tumor Cell Death and
Expression of the p53-MDM2 Downstream Signaling Targets in the Prostate Tumor
Xenografts. Histological examination with H&E staining revealed a few focal areas of
necrosis cells along with tissue disorganization in Pp53, Si-mdm2 and Pmp53 treatment
groups (Fig. 8A). With TUNEL staining (Fig. 8B) apoptotic cells around the necrotic area
were observed. The apoptotic cells showed chromatin condensation, chromatin crescent, and
nucleus fragmentation, under the examination with transmission electron microscope (Fig.
8C). Although the incidence of apoptotic cells was increased in the tumor tissues from all the
mice treated with Pp53, Si-mdm2 and Pmp53, the most highest incidence of the apoptotic
cells was seen in the tumors from the mice treated with Pmp53 (Fig. 8B, C).
Tumor cell proliferation was also analyzed by immunohistochemical staining for PCNA
that acts a marker for cells in early G1 phase and S phase of the cell cycle. Treatment with
Pmp53 plasmid caused the maximal inhibition of cell proliferation since there were
significantly decreased numbers of PCNA positive cells compared to other groups (Fig. 8D).
To determine the potential mechanism of tumor growth inhibition in vivo, p21 protein
expression was examined by Western blotting assay (Fig. 8E), p21 protein expression was
very low in the Si-scramble group but significantly increased in the groups treated with Pp53
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on March 28, 2011 as DOI: 10.1124/jpet.111.180364
at ASPE
T Journals on A
pril 10, 2019jpet.aspetjournals.org
Dow
nloaded from
JPET #180364
18
and Pmp53. In contrast, the protein expressions of E2F-1, pRb, and HIF-1α were significantly
decreased in the groups treated with Pp53, Si-mdm2, and Pmp53 groups compared to the
Si-scramble treated group (Fig. 8E).
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on March 28, 2011 as DOI: 10.1124/jpet.111.180364
at ASPE
T Journals on A
pril 10, 2019jpet.aspetjournals.org
Dow
nloaded from
JPET #180364
19
Discussion
Widespread use of prostate-specific antigen (PSA) and digital rectal examination
screenings has led to earlier diagnosis, but there remains lack of a significantly efficient
therapeutic approach (Derweesh et al., 2004). Gene therapy remains to be considered as a
potential to providing an efficient therapeutic approach (Freytag et al., 2007).
From human prostate cancer samples, we demonstrated significant increases in mt p53
and MDM2 expressions compared to the normal prostate tissues (Fig. 1). These results
indicated that increased expressions of MDM2 and mt p53 may play important roles in the
formation of prostate cancer. The tumor suppressor p53 is a powerful anti-tumor molecule
that is often inactivated by over-expression of its negative mediators. Down-regulation of p53
results in the prevention of p53-mediated apoptosis and cell cycle arrest (Momand et al.,
1992). MDM2 inhibits p53 transcriptional activity, favors its nuclear export and stimulates its
degradation. Therefore, inhibiting the p53–MDM2 interaction is a promising approach for
activating p53 in the tumor cells with the presence of endogenous wt p53 (Chene, 2003;
Gottifredi and Prives, 2001).
However, p53 is also frequently inactivated by mutations or deletions in cancer cells.
Isaacs et al. reported for the first time of p53 gene mutations in prostate cancer cells, and other
studies also confirmed the high incidence of mt p53 in prostate cancer (Hainaut and Hollstein,
2000; Isaacs et al., 1991). The results from our own observation that about 52.6 % of human
prostate cancers showed the presence of mt p53 (Fig. 1 B) also supports these previous studies.
Under such condition, only inactivation of MDM2 would not be able to restore p53 function.
To solve this issue, forced expression of both FHIT and wt p53 by adenoviral vector in
non-small cell lung carcinoma (NSCLC) cells was found to result in a synergistic inhibition of
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on March 28, 2011 as DOI: 10.1124/jpet.111.180364
at ASPE
T Journals on A
pril 10, 2019jpet.aspetjournals.org
Dow
nloaded from
JPET #180364
20
the tumor cell proliferation in vitro and growth in nude mice (Nishizaki et al., 2004). This is
because FHIT can inactivate MDM2 and interrupt the association of MDM2 with p53, leading
to p53 stabilization. A similar study reported that co-expression of FUS1 and p53 by
nanoparticle-mediated gene transfer significantly and synergistically inhibited NSCLC cell
growth and induced apoptosis (Deng et al., 2007). They found that the observed synergistic
tumor suppression by FUS1 and p53 concurred with the FUS1-mediated down-regulation of
MDM2 expression. Although these findings showed that combinational expressions of a gene
to inhibit MDM2 function with exogenous wt p53 gene in the tumor cells with mt p53 may be a
gene therapeutic strategy, it maybe not ideal since which of these MDM2 negative regulators
is the most effective in suppressing MDM2 function and whether these MDM2 negative
regulators have other functions except for suppressing MDM2 function remains uncertain.
The novel finding in the present study thus is that we have demonstrated, for the first
time, that the plasmid containing both mdm2-siRNA to directly down-regulate mdm2
expression and function, and wt p53 gene can synergistically inhibit the growth of the prostate
tumor cells in vitro and in vivo. MTT assay and flow cytometric analysis of apoptotic cells
showed the maximal inhibition of PC-3 cell growth and induction of apoptotic cell death in
the cells transfected with both mdm2-siRNA and wt p53 (Pmp53 group) compared to the
group treated with either mdm2-siRNA or wt p53 alone (Fig. 3). Treatment of PC-3
tumor-bearing mice with Pmp53 plasmid also provided a maximal inhibition of the tumor
xenograft growth, shown by the smallest tumor volume and weight among the five groups
(Fig. 6). Both in vitro and in vivo studies clearly showed the advantage of transfection of the
cells or xenografts in the tumor-bearing mice with the plasmid containing both mdm2-siRNA
and wt p53. Under this case, forced-expression of wt p53 can be optimally expressed with
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on March 28, 2011 as DOI: 10.1124/jpet.111.180364
at ASPE
T Journals on A
pril 10, 2019jpet.aspetjournals.org
Dow
nloaded from
JPET #180364
21
efficient inactivation of mdm2 by its siRNA (Fig. 6).
In addition, MDM2 is known to interact with other regulatory proteins, such as pRb
(Xiao et al., 1995) and E2F-1 (Martin et al., 1995) independent of p53. In the present study,
we investigated the expression levels of these genes and proteins, such as p21, CDK4,
cyclinD1, HIF-1α, pRb and E2F-1. We demonstrated that treatment with Pmp53 plasmid
increased the expression of p21 and inhibited E2F-1, pRb, HIF-1α expression in certain extent
(Fig. 4, 8).
Cell cycle arrest takes place when there is a block in cell-cycle division. It is known that
p53 arrests the cell cycle by stimulating the expression of p21 that blocks DNA replication by
inhibiting PCNA activity and also mediates growth arrest by inhibiting the action of G1
cyclin-dependent kinases (CDKs). Inhibition of CDKs results in an inhibition of both G1-to-S
and G2-to-mitosis transitions by causing hypophosphorylation of Rb and preventing the
release of E2F (Zheng et al., 2006). Studies by Hsieh et al. and Kowalik et al. Separately
confirmed that overexpression of MDM2 limited the native E2F-1’s ability to induce
p53-dependent apoptosis (Hsieh et al., 1997; Kowalik et al., 1998). We also showed that
restoration of wt p53 function resulted in up-regulation of p21, which may be responsible for
the down-regulation of its other downstream genes such as pRb and E2F-1 expression (Fig.
8E).
Yamakuchi et al. showed that p53 is able to inhibit HIF-1 by inducing microRNA-107,
leading to a suppression of tumor angiogenesis and tumor growth (Yamakuchi et al., 2010).
The transcription factor HIF-1 is composed of the subunits HIF-1α and HIF-1β, which are
basic helix-loop-helix DNA binding proteins. The HIF-1α subunit is overexpressed in a
variety of human cancers. To confirm this finding, we also demonstrated the inhibitory
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on March 28, 2011 as DOI: 10.1124/jpet.111.180364
at ASPE
T Journals on A
pril 10, 2019jpet.aspetjournals.org
Dow
nloaded from
JPET #180364
22
expression of HIF-1α by up-regulation of p53 in the prostate tumor cells in vitro (Fig. 3) and
in vivo (Fig. 8). Based on the above information, therefore, we assumed that the
synergistically inhibitive effects of co-expression of mdm2-siRNA and wt p53 on prostate
tumor cells observed in the present study is most likely through two facts: (1) inhibition of
HIF-1α activity by up-regulation of wt p53 expression would impair hypoxic signaling,
resulting in an inhibition of tumor growth, angiogenesis, and vessel maturation (Stoeltzing et
al., 2004); (2) Up-regulation of wt p53 in the tumor tissues enhances the spontaneous
apoptotic cell death (Deng et al., 2007).
Most human and rodent solid tumors contain a substantial fraction of cells that are
hypoxic. Tumor hypoxia occurs because of the stochastic and slow development of the
vasculature during tumor growth. S. Typhi Ty21a have an excellent safe profile (Thamm et al.,
2005), a propensity homing to tumors (Clairmont et al., 2000). In the present study, the
strategy is that when the S. Typhi Ty21a carrying the plasmids of interest were infected the
tumor cells, the tissues with overexpression of HIF-1α is in favor of the growth of these
bacteria and expression of the genes of interest to develop therapeutic action. It should be
mentioned that although we have ensured the tumor-specific and efficient transfection of the
bacteria containing target genes by intratumoral injection of these bacteria, it does not means
that we have to intratumorally give it since a few studies have reported the effectiveness when
it was given by intravenously (Zhang et al., 2007; Zhao et al., 2005).
In summary, in the present study, we demonstrated that human prostate tumors exhibited
increased expressions of MDM2 and mutant p53 proteins. Transfection of the PC-3 cells with
both mdm2-siRNA and wt 53 in vitro and in vivo significantly increased the tumor cell growth
and increased apoptotic cell death compared to knockdown of mdm2 or forced expression of
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on March 28, 2011 as DOI: 10.1124/jpet.111.180364
at ASPE
T Journals on A
pril 10, 2019jpet.aspetjournals.org
Dow
nloaded from
JPET #180364
23
wt p53 alone. These effects were associated with up-regulating p21 and down-regulating
HIF-1α expression. These results suggest that knockdown of mdm2 expression by its specific
siRNA with an overexpression of wt p53 gene offers a synergistic inhibition of prostate
cancer cell growth in vitro and in vivo. This strategy offered a significantly synergistic
inhibition of the tumor cell growth and is the better than use of the plasmid containing either
mdm2-siRNA or wt p53 alone.
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on March 28, 2011 as DOI: 10.1124/jpet.111.180364
at ASPE
T Journals on A
pril 10, 2019jpet.aspetjournals.org
Dow
nloaded from
JPET #180364
24
Acknowledge:
We are grateful to Dr. Yi Tan for his assistance of the figure preparation and Mrs. Shuqin
Pan for her assistance of pathological technology.
Authorship Contributions:
Participated in research design: Kun Ji, Yue-ting Shao, Xue-jian Zhao, De-Qi Xu, Yang Li
and Lu Cai
Conducted experiments: Kun Ji, Bo Wang, Ya-nan Liu, Chen Shao, Xiao-jie Li and Xin Li
Contributed new reagents or analytic tools: Kun Ji, Bo Wang, Yue-ting Shao, Ling Zhang and
Jia-di Hu
Performed data analysis: Kun Ji, Bo Wang, De-Qi Xu and Yang Li
Wrote or contributed to the writing of the manuscript: Kun Ji, Bo Wang, Ling Zhang, De-Qi
Xu, Yang Li and Lu Cai
Others: Kun Ji, Yue-ting Shao and Yang Li acquired funding for the research.
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on March 28, 2011 as DOI: 10.1124/jpet.111.180364
at ASPE
T Journals on A
pril 10, 2019jpet.aspetjournals.org
Dow
nloaded from
JPET #180364
25
References
Bernal F, Wade M, Godes M, Davis T N, Whitehead D G, Kung A L, Wahl G M and Walensky
L D (2010) A Stapled p53 Helix Overcomes HDMX-Mediated Suppression of p53.
Cancer Cell 18: 411-422.
Chene P (2003) Inhibiting the p53-MDM2 interaction: an important target for cancer therapy.
Nat Rev Cancer 3: 102-109.
Clairmont C, Lee K C, Pike J, Ittensohn M, Low K B, Pawelek J, Bermudes D, Brecher S M,
Margitich D, Turnier J, Li Z, Luo X, King I and Zheng L M (2000) Biodistribution and
genetic stability of the novel antitumor agent VNP20009, a genetically modified strain of
Salmonella typhimurium. J Infect Dis 181: 1996-2002.
Cryz S J, Jr., Vanprapar N, Thisyakorn U, Olanratmanee T, Losonsky G, Levine M M and
Chearskul S (1993) Safety and immunogenicity of Salmonella typhi Ty21a vaccine in
young Thai children. Infect Immun 61: 1149-1151.
Deng W G, Kawashima H, Wu G, Jayachandran G, Xu K, Minna J D, Roth J A and Ji L (2007)
Synergistic tumor suppression by coexpression of FUS1 and p53 is associated with
down-regulation of murine double minute-2 and activation of the apoptotic
protease-activating factor 1-dependent apoptotic pathway in human non-small cell lung
cancer cells. Cancer Res 67: 709-717.
Derweesh I H, Kupelian P A, Zippe C, Levin H S, Brainard J, Magi-Galluzzi C, Myles J,
Reuther A M and Klein E A (2004) Continuing trends in pathological stage migration in
radical prostatectomy specimens. Urol Oncol 22: 300-306.
Freytag S O, Stricker H, Peabody J, Pegg J, Paielli D, Movsas B, Barton K N, Brown S L, Lu
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on March 28, 2011 as DOI: 10.1124/jpet.111.180364
at ASPE
T Journals on A
pril 10, 2019jpet.aspetjournals.org
Dow
nloaded from
JPET #180364
26
M and Kim J H (2007) Five-year follow-up of trial of replication-competent
adenovirus-mediated suicide gene therapy for treatment of prostate cancer. Mol Ther 15:
636-642.
Gottifredi V and Prives C (2001) Molecular biology. Getting p53 out of the nucleus. Science
292: 1851-1852.
Hainaut P and Hollstein M (2000) p53 and human cancer: the first ten thousand mutations.
Adv Cancer Res 77: 81-137.
Hsieh J K, Fredersdorf S, Kouzarides T, Martin K and Lu X (1997) E2F1-induced apoptosis
requires DNA binding but not transactivation and is inhibited by the retinoblastoma
protein through direct interaction. Genes Dev 11: 1840-1852.
Isaacs W B, Carter B S and Ewing C M (1991) Wild-type p53 suppresses growth of human
prostate cancer cells containing mutant p53 alleles. Cancer Res 51: 4716-4720.
Kamangar F, Dores G M and Anderson W F (2006) Patterns of cancer incidence, mortality,
and prevalence across five continents: defining priorities to reduce cancer disparities in
different geographic regions of the world. J Clin Oncol 24: 2137-2150.
Kimura H, Zhang L, Zhao M, Hayashi K, Tsuchiya H, Tomita K, Bouvet M, Wessels J and
Hoffman R M (2010) Targeted therapy of spinal cord glioma with a genetically modified
Salmonella typhimurium. Cell Prolif 43: 41-48.
Kowalik T F, DeGregori J, Leone G, Jakoi L and Nevins J R (1998) E2F1-specific induction
of apoptosis and p53 accumulation, which is blocked by Mdm2. Cell Growth Differ 9:
113-118.
Lee C H, Wu C L and Shiau A L (2004) Endostatin gene therapy delivered by Salmonella
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on March 28, 2011 as DOI: 10.1124/jpet.111.180364
at ASPE
T Journals on A
pril 10, 2019jpet.aspetjournals.org
Dow
nloaded from
JPET #180364
27
choleraesuis in murine tumor models. J Gene Med 6: 1382-1393.
Martin K, Trouche D, Hagemeier C, Sorensen T S, La Thangue N B and Kouzarides T (1995)
Stimulation of E2F1/DP1 transcriptional activity by MDM2 oncoprotein. Nature 375:
691-694.
Momand J, Zambetti G P, Olson D C, George D and Levine A J (1992) The mdm-2 oncogene
product forms a complex with the p53 protein and inhibits p53-mediated transactivation.
Cell 69: 1237-1245.
Mu Z, Hachem P, Agrawal S and Pollack A (2004a) Antisense MDM2 oligonucleotides
restore the apoptotic response of prostate cancer cells to androgen deprivation. Prostate 60:
187-196.
Mu Z, Hachem P, Agrawal S and Pollack A (2004b) Antisense MDM2 sensitizes prostate
cancer cells to androgen deprivation, radiation, and the combination. Int J Radiat Oncol
Biol Phys 58: 336-343.
Mu Z, Hachem P, Hensley H, Stoyanova R, Kwon H W, Hanlon A L, Agrawal S and Pollack
A (2008) Antisense MDM2 enhances the response of androgen insensitive human prostate
cancer cells to androgen deprivation in vitro and in vivo. Prostate 68: 599-609.
Mu Z, Hachem P and Pollack A (2005) Antisense Bcl-2 sensitizes prostate cancer cells to
radiation. Prostate 65: 331-340.
Nishizaki M, Sasaki J, Fang B, Atkinson E N, Minna J D, Roth J A and Ji L (2004)
Synergistic tumor suppression by coexpression of FHIT and p53 coincides with
FHIT-mediated MDM2 inactivation and p53 stabilization in human non-small cell lung
cancer cells. Cancer Res 64: 5745-5752.
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on March 28, 2011 as DOI: 10.1124/jpet.111.180364
at ASPE
T Journals on A
pril 10, 2019jpet.aspetjournals.org
Dow
nloaded from
JPET #180364
28
Patton J T, Mayo L D, Singhi A D, Gudkov A V, Stark G R and Jackson M W (2006) Levels of
HdmX expression dictate the sensitivity of normal and transformed cells to Nutlin-3.
Cancer Res 66: 3169-3176.
Pawelek J M, Low K B and Bermudes D (1997) Tumor-targeted Salmonella as a novel
anticancer vector. Cancer Res 57: 4537-4544.
Shao Y, Liu Y, Shao C, Hu J, Li X, Li F, Zhang L, Zhao D, Sun L, Zhao X, Kopecko D J,
Kalvakolanu D V, Li Y and Xu D Q (2010) Enhanced tumor suppression in vitro and in
vivo by co-expression of survivin-specific siRNA and wild-type p53 protein. Cancer Gene
Ther 17: 844-854.
Stoeltzing O, McCarty M F, Wey J S, Fan F, Liu W, Belcheva A, Bucana C D, Semenza G L
and Ellis L M (2004) Role of hypoxia-inducible factor 1alpha in gastric cancer cell growth,
angiogenesis, and vessel maturation. J Natl Cancer Inst 96: 946-956.
Stoyanova R, Hachem P, Hensley H, Khor L Y, Mu Z, Hammond M E, Agrawal S and Pollack
A (2007) Antisense-MDM2 sensitizes LNCaP prostate cancer cells to androgen
deprivation, radiation, and the combination in vivo. Int J Radiat Oncol Biol Phys 68:
1151-1160.
Tao W and Levine A J (1999) Nucleocytoplasmic shuttling of oncoprotein Hdm2 is required
for Hdm2-mediated degradation of p53. Proc Natl Acad Sci U S A 96: 3077-3080.
Thamm D H, Kurzman I D, King I, Li Z, Sznol M, Dubielzig R R, Vail D M and MacEwen E
G (2005) Systemic administration of an attenuated, tumor-targeting Salmonella
typhimurium to dogs with spontaneous neoplasia: phase I evaluation. Clin Cancer Res 11:
4827-4834.
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on March 28, 2011 as DOI: 10.1124/jpet.111.180364
at ASPE
T Journals on A
pril 10, 2019jpet.aspetjournals.org
Dow
nloaded from
JPET #180364
29
Vousden K H and Lane D P (2007) p53 in health and disease. Nat Rev Mol Cell Biol 8:
275-283.
Wade M and Wahl G M (2009) Targeting Mdm2 and Mdmx in cancer therapy: better living
through medicinal chemistry? Mol Cancer Res 7: 1-11.
Wade M, Wong E T, Tang M, Stommel J M and Wahl G M (2006) Hdmx modulates the
outcome of p53 activation in human tumor cells. J Biol Chem 281: 33036-33044.
Wiman K G (2006) Strategies for therapeutic targeting of the p53 pathway in cancer. Cell
Death Differ 13: 921-926.
Xiao Z X, Chen J, Levine A J, Modjtahedi N, Xing J, Sellers W R and Livingston D M (1995)
Interaction between the retinoblastoma protein and the oncoprotein MDM2. Nature 375:
694-698.
Yamakuchi M, Lotterman C D, Bao C, Hruban R H, Karim B, Mendell J T, Huso D and
Lowenstein C J (2010) P53-induced microRNA-107 inhibits HIF-1 and tumor
angiogenesis. Proc Natl Acad Sci U S A 107: 6334-6339.
Zhang L, Gao L, Li Y, Lin G, Shao Y, Ji K, Yu H, Hu J, Kalvakolanu D V, Kopecko D J, Zhao
X and Xu D Q (2008) Effects of plasmid-based Stat3-specific short hairpin RNA and
GRIM-19 on PC-3M tumor cell growth. Clin Cancer Res 14: 559-568.
Zhang L, Gao L, Zhao L, Guo B, Ji K, Tian Y, Wang J, Yu H, Hu J, Kalvakolanu D V,
Kopecko D J, Zhao X and Xu D Q (2007) Intratumoral delivery and suppression of
prostate tumor growth by attenuated Salmonella enterica serovar typhimurium carrying
plasmid-based small interfering RNAs. Cancer Res 67: 5859-5864.
Zhang Y, Shi Y, Li X, Du W, Luo G, Gou Y, Wang X, Guo X, Liu J, Ding J, Wu K and Fan D
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on March 28, 2011 as DOI: 10.1124/jpet.111.180364
at ASPE
T Journals on A
pril 10, 2019jpet.aspetjournals.org
Dow
nloaded from
JPET #180364
30
(2010) Inhibition of the p53-MDM2 interaction by adenovirus delivery of ribosomal
protein L23 stabilizes p53 and induces cell cycle arrest and apoptosis in gastric cancer. J
Gene Med 12: 147-156.
Zhao M, Yang M, Li X M, Jiang P, Baranov E, Li S, Xu M, Penman S and Hoffman R M
(2005) Tumor-targeting bacterial therapy with amino acid auxotrophs of GFP-expressing
Salmonella typhimurium. Proc Natl Acad Sci U S A 102: 755-760.
Zheng Q H, Ma L W, Zhu W G, Zhang Z Y and Tong T J (2006) p21Waf1/Cip1 plays a critical
role in modulating senescence through changes of DNA methylation. J Cell Biochem 98:
1230-1248.
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on March 28, 2011 as DOI: 10.1124/jpet.111.180364
at ASPE
T Journals on A
pril 10, 2019jpet.aspetjournals.org
Dow
nloaded from
JPET #180364
31
Footnotes:
This work was supported by Research Fund for the Doctoral Program of Higher Education of
China [Grants 20070183012] and Scientific and technological development plan project in
Jilin Province [Grants 200705360].
K.J. and B.W. contributed equally to this work.
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on March 28, 2011 as DOI: 10.1124/jpet.111.180364
at ASPE
T Journals on A
pril 10, 2019jpet.aspetjournals.org
Dow
nloaded from
JPET #180364
32
FIGURE LEGENDS
Fig. 1. Expression of Mdm2 and mt p53 in human prostate tissues. Human benign and
cancer tissue (Gleason score 9) sections were immunostained with antibodies against
MDM2 and mt p53, respectively (A, ×200). Semi-quantitative analysis for the
expression percent of positive staining based on the methods described in the
Materials and Methods are provided (B).
Fig. 2. Expression of Mdm2 and wt p53 in PC-3 cells transfected with various plasmids.
Constructions of various plasmids are illustrated (A). Expression of mdm2 and wt
p53 at mRNA (B) and protein (C) levels were examined with RT-PCR and Western
blotting assays, respectively. Data shown were means ± SD of three separate
experiments. ap<0.05 vs mock or Si-scramble group; bp<0.05 vs Pp53 group; cp<0.05
vs Si-mdm2 group.
Fig. 3. Effects of transfection with various plasmids on cell growth. (A) Growth
inhibitory effects were evaluated with MTT assays for the PC-3 cells transfected with
different plasmids, and the data were presented as the ratio to control (mock). Data
shown were means ± SD of three separate experiments. ap<0.05 vs mock or
Si-scramble group; bp<0.05 vs Pp53 group; cp<0.05 vs Si-mdm2 group. (B) The raw
data of flow cytometry with Annexin V and PI staining for detecting cell death are
representatively shown from each group. Q1: necrotic cells; Q2: late apoptotic cells;
Q3: normal cells; Q4: early apoptotic cells. (C) The average data of flow cytometry
are presented for the results at 72 h after treatment. ap<0.05 vs Si-scramble group;
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on March 28, 2011 as DOI: 10.1124/jpet.111.180364
at ASPE
T Journals on A
pril 10, 2019jpet.aspetjournals.org
Dow
nloaded from
JPET #180364
33
bp<0.05 vs Pp53 group; cp<0.05 vs Si-mdm2 group.
Fig. 4. Effects of transfection with various plasmids on the expression of cell
cycle-related protein in the PC-3 cells. Gene and protein expressions of p21, CDK4,
cyclin-D1, and HIF-1α were examined with RT-PCR (A) and Western blotting assays
(B), respectively. ap<0.05 vs mock or Si-scramble group; bp<0.05 vs Pp53 group;
cp<0.05 vs Si-mdm2 group.
Fig. 5. Assessment of tumor-preferable distribution of the bacteria. Tissue samples from
the tumor xenografts, liver, lung, spleen, heart and kidney of three tumor-bearing
mice treated with bacteria carrying Si-scramble at different times after bacteria
treatment were used for bacterial distribution analysis. Tissue (100 mg) either from
tumors or each organ was in 3 ml of PBS and homogenized well, and the
homogenized tissue was plated onto Luria-Bertani agar. Representative images of the
plates planted with different tissues at 3 day (72 h) and 10 day (10d) after bacterial
injection are given in panel A. T: tumor xenograft; Li: liver; Lu: lung; S: spleen; H:
heart; K: kidney. Panels B and C are the quantitative analysis of the bacterium counts
by CFU/g tissue at day 3 (B) and day (C) after bacterial injection. ap<0.05 vs any one
of the other groups.
Fig. 6. Protein expression of Mdm2 and wt p53 in the PC3 tumor xenografts treated
with various plasmids. Western blotting analysis (A) and immunohistochemical
staining (B, x 200) were performed for MDM2 and wt p53 protein expressions in the
PC-3 tumor xenografts from the tumor-bearing mice treated with different plasmids
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on March 28, 2011 as DOI: 10.1124/jpet.111.180364
at ASPE
T Journals on A
pril 10, 2019jpet.aspetjournals.org
Dow
nloaded from
JPET #180364
34
at the termination of the study. ap<0.05 vs mock or Si-scramble group; bp<0.05 vs
Pp53 group; cp<0.05 vs Si-mdm2 group.
Fig. 7. Inhibition of tumor growth in vivo by treatments with various plasmids. Tumor
growth cures over the 32-day period were made based on the tumor sizes measured
very fourth day for the tumor-bearing mice with different plasmid treatments (A).
Images of tumors from Si-scramble and Pmp53 treatments were collected when these
tumor-bearing mice were sacrificed at the 32nd after treatment (B). Tumor wet
weights were measured when the animals were killed at the 32nd after treatment (C).
ap<0.05 vs mock or Si-scramble group; bp<0.05 vs Pp53 group; cp<0.05 vs Si-mdm2
group.
Fig. 8. Effects of various plasmid treatments on the induction of apoptotic cell death
and the expression of cell cycle arrest-related gene and proteins in the tumor
xenografts. H&E staining (A, x 200), TUNEL fluorescent staining (B, x 200),
electron microscopic analysis (C, x 6000) and immunohistochemical staining for
PCNA (D, x 200) were performed for the tumor cells treated with different plasmids
in tumor-bearing mice. E: Western blotting assay for the protein expressions of P21,
E2F-1, pRb, and HIF-1α in the PC-3 tumor xenografts at the 32nd day after treatments
with different plasmids. ap<0.05 vs mock or Si-scramble group; bp<0.05 vs Pp53
group; cp<0.05 vs Si-mdm2 group.
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on March 28, 2011 as DOI: 10.1124/jpet.111.180364
at ASPE
T Journals on A
pril 10, 2019jpet.aspetjournals.org
Dow
nloaded from
JPET #180364
35
Table 1. Primers and the optimal PCR conditions
Primer Sequence (5’-3’) Product
Size (bp)
Annealing
Temperature
(°C)
No. of
cycles
GAPDH
Sense: 5’-GGGTGATGCTGGTGCTGAGTATGT-3’
Antisense: 5’-AAGAATGGGAGTTGCTGTTGAAGTC-3’
700 57 30
MDM2
Sense: 5’-GAAAGCCAAACTGGAAAACTCA-3’
Antisense: 5’-ACATGTAAAGCAGGCCATAAGA-3’
364 58 30
P53
Sense: 5'-CCTCCTCAGCATCTTATCCG-3'
Antisense: 5'-CACAAACACGCACCTCAAA-3'
259 62 30
P21
Sense: 5'- AGCTCAATGGACTGGAAGGG - 3'
Antisense: 5'-GAGCTGGAAGGTGTTTGGGG - 3'
485 55 35
CDK4
Sense: 5'-CGTGAGGTGGCTTTACTGAG-3'
Antisense: 5'- CTTGATCGTTTCGGCTGG-3
267 58 28
Cyclin-D1
Sense: 5'-TGGATGCTGGAGGTCTGCGAG-3'
Antisense : 5'-GGCTTCGATCTGCTCCTGGC-3'
355 60 28
HIF-1α
Sense: 5'- TGGAGGCGGCGAGAACAT -3'
Antisense: 5' - CTCAGTAGCATCAGCACGAGGG -3'
168 58 20
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on March 28, 2011 as DOI: 10.1124/jpet.111.180364
at ASPE
T Journals on A
pril 10, 2019jpet.aspetjournals.org
Dow
nloaded from
A
B
Normal
Cancer0
20
40
60
Md
m2
exp
ress
ion
per
cen
t 13/19
0/10
Normal
Cancer0
20
40
10/19
mt-
p53
exp
ress
ion
per
cen
t
0/10
Fig.1
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on March 28, 2011 as DOI: 10.1124/jpet.111.180364
at ASPE
T Journals on A
pril 10, 2019jpet.aspetjournals.org
Dow
nloaded from
A
GAPDH
mdm2
wt-p53
β-actin
Wt-p53
Mdm2
B C
U6 Si-scrambleSi-scramble
CMV p53Pp53
U6 Si-mdm2Si-mdm2
U6 Si-mdm2Psi-mdm2-p53 CMV p53
Mdm2 wt-p530.0
0.3
0.6
0.9
1.2a,c
b
a
a,b,c
a,b
Op
tica
l den
sity
(%) mock
Si-scramble Pp53 Si-mdm2 Pmp53
a
Mdm2 wt-p530.0
0.3
0.6
0.9
1.2
a,b,c
b
a
a,b,c
a,b
a
Op
tica
l den
sity
(%) mock
Si-scramble Pp53 Si-mdm2 Pmp53
Fig.2
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on March 28, 2011 as DOI: 10.1124/jpet.111.180364
at ASPE
T Journals on A
pril 10, 2019jpet.aspetjournals.org
Dow
nloaded from
B
A
C
48h 72h0
20
40
60
80
100
a,b,c
aa
a,b,c
aG
row
th r
atio
(%)
mock Si-scramble Pp53 Si-mdm2 Ppmp53a
72h0
10
20
30a,b,c
a
Ap
op
tosi
s ra
te(%
) Si-scram b le P p53 S i-m dm 2 P m p 53
a
.
Fig.3
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on March 28, 2011 as DOI: 10.1124/jpet.111.180364
at ASPE
T Journals on A
pril 10, 2019jpet.aspetjournals.org
Dow
nloaded from
A
Cyclin-D1
β-actin
HIF-1α
p21
CDK4
B
p21
cyclin-D1
cdk4
HIF-1α
GAPDH
p21 cdk4 cyclin-D1 HIF-1a0.0
0.2
0.4
0.6
0.8
a,c
a,b
a
a a a
a,c
a,b
ab
a,c
Op
tica
l den
sity
(%)
mock Si-scramble Pp53 Si-mdm2 Pmp53
a
p21 CDK4 Cyclin-D1 HIF-1a0.0
0.2
0.4
0.6
aa
a
aaaa a
a
a
a
Op
tica
l den
sity
(%) mock
Si-scramble Pp53 Si-mdm2 Pmp53
a
Fig.4
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on March 28, 2011 as DOI: 10.1124/jpet.111.180364
at ASPE
T Journals on A
pril 10, 2019jpet.aspetjournals.org
Dow
nloaded from
T/72h Li/72h Lu/72h S/72h
H/72h K/72h T/10d T/10d
A
B C
Tumor
Liver
050
100150200250300350
CF
U/g
a
Tumor
Liver
Lung
Spleen
Heart
Kidney
0100200300
900950
100010501100
CF
U/g
a
Fig.5
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on March 28, 2011 as DOI: 10.1124/jpet.111.180364
at ASPE
T Journals on A
pril 10, 2019jpet.aspetjournals.org
Dow
nloaded from
A
Mdm2
β-actin
Wt-p53
B
Mdm2 wt-p530.0
0.3
0.6
0.9
a,b,c
a,b
aa,b,c
Opt
ical
den
sity
(%) mock
Si-scramble Pp53 Si-mdm2 Pmp53
a,b
Fig.6
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on March 28, 2011 as DOI: 10.1124/jpet.111.180364
at ASPE
T Journals on A
pril 10, 2019jpet.aspetjournals.org
Dow
nloaded from
A
C
B
Mock
Si-scr
amble
Pp53
Si-mdm
2
Pmp5
30.0
0.3
0.6
0.9
1.2
a,b,c
a
Tu
mo
r w
eig
ht(
g)
a
Fig.7
0 4 8 12 16 20 24 28 32
0
300
600
900
1200
1500
a,b,c
aa
aa,b,c
a
a,b,ca
a
aa
Tu
mo
r vo
lum
e(m
m3 )
Days
mock Si-scramble Pp53 Si-mdm2 Pmp53
a
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on March 28, 2011 as DOI: 10.1124/jpet.111.180364
at ASPE
T Journals on A
pril 10, 2019jpet.aspetjournals.org
Dow
nloaded from
p21 E2F-1 pRb HIF-10.0
0.2
0.4
0.6
0.8
a,c
a
a
a,c
a,b
aa,c
a
a
a,b,c
a,b
a
Op
tica
l den
sity
(%) mock
Si-scramble Pp53 Si-mdm2 Pmp53
a
β-actin
p21
E2F-1
pRb
HIF-1α
E
Fig.8
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on March 28, 2011 as DOI: 10.1124/jpet.111.180364
at ASPE
T Journals on A
pril 10, 2019jpet.aspetjournals.org
Dow
nloaded from