Susan Hayes, Branden R. Nelson, Brian Buckingham and Thomas A. Reh- Notch signaling regulates regeneration in the avian retina

8/3/2019 Susan Hayes, Branden R. Nelson, Brian Buckingham and Thomas A. Reh- Notch signaling regulates regeneration in

1/19

Notch signaling regulates regeneration in the avian retina

Susan Hayesa, Branden R. Nelsona, Brian Buckinghamb, and Thomas A. Reha

aDepartment of Biological Structure, 357420 Health Science Center, University of Washington, School of

Medicine, Seattle, WA 98195, USA, Phone: (206) 543-8043, Fax: (206) 543-1524, e-mail:

[email protected]

bMedical Student Training Program, Box 357470, University of Washington, School of Medicine, Seattle,

WA 98195, USA

Abstract

The chicken retina is capable of limited regeneration. In response to injury, some Mller glia

proliferate and de-differentiate into progenitor cells. However most of these progenitors fail to

differentiate into neurons. The Notch pathway is upregulated during retinal regeneration in both fish

and amphibians. Since the Notch signaling pathway maintains cells in a progenitor state duringdevelopment, we hypothesized that a persistently active Notch pathway might prevent a more

successful regeneration in the chick retina. We found Notch signaling components are upregulated

in the proliferating progenitors. We also found that blocking the Notch pathway while Mller glia

are de-differentiating into progenitor cells, prohibits regeneration; conversely, blocking the Notch

pathway after the progenitors have been generated from the Mller glia, caused a significant increase

in the percentage new neurons. Thus, Notch signaling appears to play two distinct roles during retinal

regeneration. Initially, Notch activity is necessary for the de-differentiation/proliferation of Mller

glia, while later it inhibits the differentiation of the newly generated progenitor cells.

Keywords

retina; regeneration; Notch; Mller glia

INTRODUCTION

In response to damage, Mller glia in the chick and fish retina can re-enter the cell cycle,

express progenitor genes and regenerate neurons (Fischer, 2005; Fischer et al., 2002; Fischer

and Reh, 2001; Fischer and Reh, 2002; Fischer and Reh, 2003; Raymond et al., 2006; Yurco

and Cameron, 2005). In the fish retina, the Mller glial derived progenitors go on to

successfully regenerate nearly all the damaged retina (Raymond et al., 2006; Yurco and

Cameron, 2005). However, regeneration in the bird is much less successful, and the majority

of the progenitor cells derived from Mller glial cell divisions remain undifferentiated (Fischer

and Reh, 2001), expressing the markers of progenitor cells, rather than differentiating as either

Mller glia or neurons.

The failure of the majority of progenitors to differentiate into neurons in the regenerating chick

retina suggests that some factors expressed in the regenerating retina may limit neuronal

differentiation in these cells. A potential candidate for this block in differentiation is the Notch

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers

we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting

proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could

affect the content, and all legal disclaimers that apply to the journal pertain.

NIH Public AccessAuthor ManuscriptDev Biol. Author manuscript; available in PMC 2008 June 1.

Published in final edited form as:

Dev Biol. 2007 December 1; 312(1): 300311.

NIH-PAAu

thorManuscript

NIH-PAAuthorManuscript

NIH-PAAuthorM

anuscript


2/19

pathway. During retinal development, the Notch signaling pathway maintains progenitor cells

in an undifferentiated state; constitutive activation of the Notch pathway prevents cells from

differentiating as neurons, and instead they either differentiate into Mller glia, or remain in a

progenitor state (Bao and Cepko, 1997; Dorsky et al., 1997; Henrique et al., 1997; Jadhav et

al., 2006). The Notch receptor is activated by the ligands, Delta (Dll1-4) or Serrate 1,2 (known

as Jagged 1,2 in mammals). Binding of the Notch receptor to its ligand induces two proteolytic

cleavages of Notch. The second cleavage, mediated by a -secretase, cleaves the intracellular

domain (ICD), allowing it to translocate to the nucleus where it can activate one or moredownstream target genes of the hairy/enhancer of split family (Hes) (Bray, 2006). Hes genes

inhibit expression of proneural genes (Chen et al., 1997; Sriuranpong et al., 2002), preventing

neuronal differentiation. Inhibition of Notch signaling by a dominant-negative Dll1 or the -

secretase inhibitor, DAPT, in developing retina promotes neuronal differentiation (Henrique

et al., 1997; Nelson et al., 2006; Nelson et al., 2007).

Recent studies have implicated the Notch signaling pathway in retinal regeneration. A study

in fish retina has shown that after injury, Notch and some of the associated pathway components

are expressed in the Mller glia, which are proliferating and de-differentiating into progenitor

cells (Raymond et al., 2006; Sullivan et al., 1997). Since the Notch signaling pathway is known

to maintain the progenitor state in developing retina, we hypothesized that the Notch pathway

might be persistently active during regeneration in the chick retina and thus prevent more

successful regeneration. To explore this possibility, we analyzed Notch pathway componentsfollowing neurotoxic damage and used a small molecule inhibitor of the Notch pathway,

DAPT, to test for a requirement for Notch at various times during the regeneration process.

In this study, we find that Notch activity has two distinct roles in retinal regeneration. After

neurotoxic damage, Notch signaling components are upregulated in the proliferating Mller

glia. Activation of the Notch pathway is necessary for the de-differentiation process; inhibiting

the Notch pathway soon after neurotoxic damage reduces the percent of Mller glia that re-

express progenitor genes and reduces the overall proliferative response. However, later in the

regeneration process we find that Notch activity prevents more successful regeneration:

inhibiting Notch signaling after the Mller cells have already de-differentiated causes a

significant increase in the extent of neuronal differentiation.

MATERIALS AND METHODS

Animals

The use of animals in this study was in accordance with the guidelines established by the

University of Washington, IACUC, and the National Institute of Health. Newly hatched

leghorn or hyline brown chickens (Gallus gallus domesticus) were obtained from H&M

Highline International (Seattle, WA).

Quantitative Polymerase Chain Reaction Analysis

Quantative polymerase chain reaction (QPCR) was performed as described (Dorsky et al.,

1997; Nelson et al., 2006; Nelson et al., 2007). Intraocular injections of NMDA or saline were

given to P1 chicks. Animals were sacrificed and eyes were dissected at the indicated time

points. Three pairs of eyes were used per time point. The eyes were bisected, separating theperipheral half from the central half. The central retina halves were frozen, homogenized, and

cells were lysed with Trizol (Invitrogen). Genomic DNA was digested by DNAse (Invitrogen)

and RNA was purified using an RNEasy column (Qiagen). cDNA was generated by oligo-dT

primed reverse transcription reaction with Superscript II reverse transcriptase (Invitrogen); an

RT-minus control was included for each sample. Quantative PCR was performed using an

Opticon DNA Engine (Bio-Rad). The cDNAs were normalized to GAPDH levels. The

Hayes et al. Page 2

Dev Biol. Author manuscript; available in PMC 2008 June 1.

NIH-PAA

uthorManuscript


NIH-PAAuthor

Manuscript


3/19

following primer sets were used: cGAPDH forward 5 CAT CCA AGG AGT GAG CCA AG,

reverse 5 TGG AGG AAG AAA TTG GAG GA; cPCNA forward 5

GATGTGGAGCAGCTT GGA AT, reverse 5 CCAATGTGGCTGAGGTCTCT, Cash1

forward 5 AGGGAACCACGTTTATGCAG, reverse 5 TTATACAGGGCCTGGTGAGC,

Notch1 forward 5 TTCCCAGCACAGCTATTCCT; reverse 5

CCCACTGGGTCTCACTTGAA; cHes-5 forward 5 CCAGAGACACCAACCCAACT,

reverse 5 CAGAGCTTCTTTGAGGCACC : cHes1 forward 5

GAAGTCCTCCAAACCCATCA, reverse 5 AGGTGCTTCACCGTCATCTC cHey-2forward 5 TCTCCTTCACCAGCACCTTC, reverse 5 GGCTGGATGAGGCTGACAC;

cHey-1 forward 5 CGACTCGTGTCTCACCTCAA, reverse 5

GTGAGGGTGATGTCCAAAGG; cDeltex2 forward 5CAATGAGAAGGGCAGAAAGG,

reverse 5 GGTGGATCTCATTCCACACC; cDNER forward 5

TCAGTGGACACGGGATTAGA, reverse 5 CATCAACAAACAACTCAAACCA; cDelta1

forward 5 CACTGACAACCCTGATGGTG, reverse 5 TGGCACTGGCATATGTAGGA;

cDll4 forward 5 CAAATTGCCGATTCTGTCCT, reverse 5

TGCTGTCGATGCTTGGTAAGA; cFoxN4 forward 5 GCTGCCATTCATAGGAGCAT,

reverse 5CTGGGTCTGGATCTGGTGAT; cSox2 forward 5

AGGCTATGGGATGATGCAAG, reverse 5 GTAGGTAGGCGATCCGTTCA; cPEA3

forward 5 ACCTGTGCAGATTCACCTC, reverse 5 GTACGGGACAGGCACTTCTC; and

cGeminin forward 5 TGCATTATTTGACCAGCATGA, reverse 5

TGTTTCTTGGTTGGATTCGTC.

In Situ Hybridization

In situ hybridization was essentially performed as described (Bermingham-McDonogh et al.,

2006; Nelson et al., 2006). Posthatch eyes were dissected in HBSS; the lens and vitreous humor

were removed. Sections from stage 25 embryonic heads were also stained in parallel, to serve

as controls for the probes. In situ probes were synthesized by in vitro transcription reaction.

The DNA template was digested with DNAse and the probe was precipitated with ethanol. The

probe was resuspended in 0.25% SDS in TE buffer. Notch1 plasmid used to make probe came

from D. Henrique (Henrique et al., 1997) and Hes5 plasmid was described in (Nelson et al.,

2006).

Intraocular InjectionsThe left eye was injected with 20 uL of 0.1 M NMDA. The right eye was injected with 20 L

0.9% saline. For immunohistochemistry and in situ studies, both eyes were injected with 20

L 0.1 10 mg/mL BrdU. Where indicated, eyes were injected twice (4 hours between

injections) with 2.5 uL DMSO or 10 mM DAPT (Sigma). (DAPT (N-[N-(3,5-

difluorophenacetyl)-L-alanyl]-S-phenylgly cine t-butyl ester)).

Immunohistochemistry

A standard immunohistochemical staining protocol was performed as described (Fischer and

Reh, 2000). Antibodies used included: rat anti-BrdU (1:100, Accurate), mouse anti-Hu (1:100,

Monoclonal Antibody Facility, University of Oregon), rabbit anti-Calretinin (1:1000, J.H.

Rogers, University of Cambridge), mouse anti-Vimentin (1:50, DSHB), mouse anti-Islet (1:20,

DSHB), rabbit anti-Pax6 (1:500, Covance), mouse anti-Visinin (1:2000, DSHB) and goat anti-Sox2 (1:1000, Santa Cruz). When rat anti-BrdU antibody was used, slides were treated with a

100Kunitz/mL DNAse (Sigma). Alexa-488 and Alexa-568 secondary antibodies (Invitrogen)

used at 1:500. Alexa-350 (Invitrogen) secondary antibodies were used at 1:80. Apoptotic cells

were detected using terminal deoxynucleotidyl transferase (TdT) (Promega) to transfer Alexa

Fluor 546-14-dUTP (Molecular Probes) to strand breaks of cleaved DNA.

Hayes et al. Page 3


NIH-PAA

uthorManuscript


NIH-PAAuthor

Manuscript


4/19

Counts on Flatmounts

Retinas were flatmounted, fixed and immunolabelled for BrdU. Confocal slice images of retina

flatmounts were taken on a Zeiss confocal microscope. ImageJ (Rasband, 1997-2006)

including extended depths of field plug-in (Forster et al., 2004) were used to flatten image

stacks, threshold and count BrdU positive nuclei per area across the complete retinal depths.

A one tailed Mann-Whitney test was used to determine significance of changes in BrdU

incorporation between control DMSO and DAPT injected eyes; p < 0.05 was considered

significant.

RESULTS

The Notch signaling pathway is upregulated during chicken retinal regeneration

As noted above, in response to toxins, such as NMDA, some chicken Mller glia cells

proliferate and express genes normally only expressed in embryonic progenitors, and

approximately 10% of these progenitor cells go on to differentiate into new neurons. To

determine whether Notch pathway genes are involved in the regenerative process, we used Q-

PCR to measure changes in expression of Notch signaling components following NMDA

treatment in the posthatch chick retina. The left eyes of P1 chicks were injected with NMDA,

while the right eyes were injected with saline and served as controls. We define P1 as the day

the chicken hatched. NMDA and control retinal mRNA was harvested from P2, P3, P4 and P8chickens. To confirm that the NMDA injection elicited a regenerative response, we measured

changes in proliferating cell nuclear antigen (PCNA) and four additional neural progenitor-

specific genes: geminin, Cash1, Pea3 and FoxN4 (Del Bene et al., 2004; Jasoni et al., 1994;

Li et al., 2004; McCabe et al., 2006). We also analyzed expression of Sox2, which is known

to be in progenitor cells, but is also expressed in Muller glia (Taranova et al., 2006). These

genes were all up-regulated in the first few days after NMDA induced damage. Cash1 is

normally only expressed in progenitor cells, but was previously shown to be re-expressed in

the regenerating retina (Fischer and Reh, 2001). We confirmed that Cash1 increased after

damage and was maximally expressed at P4 (Fig. 1H). We found the greatest change in PCNA

occurred at P4, which coincides with what was previously determined (Fischer and Reh,

2003) to be the peak of proliferative response (Fig. 1D, Sup Fig. 1). These data show that

NMDA induces a pattern of gene expression at least partly similar to that observed during

normal embryonic development.

The Notch pathway is critical for normal embryonic development (see Introduction), and so

we investigated whether the genes in this pathway were also up-regulated in the NMDA

damaged retina. We carried out a time course for Notch1 and Hes5 (a critical downstream

target of the Notch ICD), and found that both genes reached a peak in expression at P4 (Fig.

1F, 1G). At this same time point, we also analyzed other components of this pathway. We

found that other members of the Hes and Hey family of Notch target genes, Hes1, Hey2 and

Hey1, were not significantly different in the NMDA treated retinas as compared with the saline

treated retinas. We also tested for changes in Deltex, and the Notch ligands: DNER, Dll1, and

Dll4, but did not see significant changes in their expression (data not shown). These results

show that at least some components of the Notch pathway are up-regulated following NMDA

induced retinal damage.

Components of the Notch pathway are expressed in the regenerating cells

We used in situ hybridization, to determine which cells up-regulate Notch1 and Hes5 during

retinal regeneration. The probes were tested in embryonic retina to ensure they gave specific

labeling similar to that which has been previously reported (Fischer and Reh, 2001; Henrique

et al., 1997; Nelson et al., 2006) (Sup Fig.2). We also performed in situ hybridization with the

corresponding sense probes; the sense probe gave a background staining, but not the distinctive

Hayes et al. Page 4


NIH-PAA

uthorManuscript


NIH-PAAuthor

Manuscript


5/19

staining pattern seen with the anti-sense probe (Sup Fig. 2). In normal posthatch chick eyes

(saline-injected), Notch1 was expressed in a small cluster of cells at the ciliary marginal zone

(CMZ) (Fig. 2A), similar to that reported in other non-mammalian vertebrates (Perron et al.,

1998). In addition, faint Notch staining was observed in the center of the inner nuclear layer

(INL; Fig. 2B). The position of the Notch1 positive cells, in the middle of the INL, suggested

that they might be Mller glia. Previous studies have described Notch1 expression in mouse

Mller glia (Furukawa et al., 2000). To confirm that Notch positive cells were Mller glia, we

labeled the sections with an antibody to vimentin, a Mller glial marker, following in situhybridization. Although the expression levels of Notch mRNA were very low, we found that

some of the Notch positive cells were also vimentin positive (Fig. 2C-F, arrow).

After NMDA treatment, the in situ hybridization for Notch1 mRNA showed an overall increase

in the intensity of labeling (Fig. 2F,G). Co-labeling the in situ hybridizations with antibodies

to BrdU and vimentin allowed us to determine whether the Notch expressing cells were Mller

glia and/or their progeny. All of the BrdU labeled cells were also labeled with vimentin,

confirming previous reports (Fischer and Reh, 2001); in addition, most, if not all, of the Notch1

expressing cells were also labeled with vimentin (Fig. 2G-J, arrow). However, we found

examples of cells that expressed Notch1 (Fig. 2G-J. asterisk), but did not label with BrdU,

suggesting either that our BrdU pulse was not sufficient to label all of the Mller glial-derived

progenitors, or alternatively that Mller glia can up-regulate Notch1 without re-entering the

cell cycle.

We looked to see if the Notch target gene, Hes5, was also expressed in a similar pattern. In the

CMZ of normal eyes, there was a small cluster of Hes5 expressing cells (Fig. 3A), similar to

those that express Notch1 (Fig. 2A). We could not detect Hes5 staining in the central region

of the normal (saline injected) retina (Fig. 3B). The inability to detect Hes5 staining was not

due to a problem with the probe, as the same probe on embryonic control slides detected robust

Hes5 expression (Sup Fig. 2). In the NMDA treated eye, scattered cells in the INL expressed

Hes5 (Fig. 3C). We found that nearly all of the Hes5 expressing cells were also labeled with

BrdU and vimentin (Fig. 3D-G). We did however find a few examples of cells that expressed

Hes5 (Fig. 3 D-G, asterisk), but did not label with BrdU, suggesting again that either our BrdU

pulse was not sufficient to label all of the Mller glial-derived progenitors, or alternatively that

Mller glia can up-regulate Hes5 without re-entering the cell cycle. These data are consistent

with the QPCR results, demonstrating that some of the proliferating cells in NMDA treatedretinas up-regulate Notch1 and Hes5. The function of these two genes during normal retinal

development and their expression during regeneration in fish suggests that this same molecular

pathway is re-utilized during retinal regeneration in birds.

Notch Signaling is Necessary for Regeneration

The up-regulation of Notch signaling components correlates with the proliferation and

transition of Mller glia into progenitor cells. To determine whether the Notch pathway is

necessary for the proliferation and/or transition of Mller glia to progenitor cells, we blocked

the Notch pathway using a small molecule inhibitor of-secretase, DAPT, as outlined in Fig.

4A. Application of DAPT, is a well-established method for inhibiting the Notch pathway.

Previous studies have shown that DAPT and inhibitory mutations in the Notch pathway have

the same effect on development (Geling et al., 2002;Micchelli et al., 2003;Nelson et al.,2006;Nelson et al., 2007).

We injected eyes with NMDA at P1, DAPT or DMSO (vehicle control) at P2 and BrdU at P3.

We found that injection of DAPT significantly inhibited the Hes5 up-regulation caused by the

NMDA injection (Sup Fig3A). We predicted that if Notch signaling is necessary for Mller

glial de-differentiation, we would see a decrease in the number of BrdU labeled cells. We

quantified the amount of BrdU staining in flatmount retinas from chickens sacrificed at P8

Hayes et al. Page 5


NIH-PAA

uthorManuscript


NIH-PAAuthor

Manuscript


6/19

(compare 4B and 4C), there was a significant decrease in proliferation in the DAPT treated

retinas (about 65% less, p < 0.019, Fig. 4D). The decline in BrdU labeled cells in the DAPT

treated retina was consistent with the hypothesis that Notch activity is necessary for the

transition of Mller glia to proliferating progenitor cells; however, it is possible that DAPT

prevented the NMDA-induced damage. To test for this alternative explanation of the result,

we labeled the DMSO and DAPT treated retinas with an apoptotic marker. We found NMDA

induced apoptotic cells in both treated and control retinas, indicating that the difference in

BrdU incorporation was not due to a lack of apoptosis induced by the NMDA in the DAPTtreated retinas (Sup Fig.3B-C).

To determine if DAPT treatment was inhibiting the dedifferentiation process, we performed a

similar experiment and counted the percentage of proliferating cells that also stained with a

progenitor marker. We predicted that if Notch signaling is necessary for the de-differentiation

of Muller glia into progenitors, fewer cells would co-stain for BrdU and a progenitor marker

following DAPT treatment. In the NMDA treated posthatch chick retina, the progenitor cells

express Pax6 (Fischer and Reh, 2001). We treated chicks with NMDA at P1, DAPT or DMSO

(vehicle control) at P2, BrdU at P3 and sacrificed the animals 4 hours after the BrdU pulse.

We sacrificed the animals at this early time-point because most of the de-differentiation occurs

2-3 days after NMDA injection and therefore most of the BrdU positive cells are the new

progenitors (Fischer and Reh, 2001). If Notch signaling is necessary for de-differentiation,

fewer cells would co-stain for Pax6 and BrdU in the DAPT treated retinas. We found about a25% decrease in the number of BrdU/Pax6 double-labeled cells (de-differentiating Mller glia)

in the DAPT treated retinas compared to DMSO treated retinas (p < 0.0364, Fig. 4E-I). These

data support the conclusion that inhibition of the Notch pathway early in the regeneration

process inhibits the de-differentiation of Mller glia into retinal progenitors.

Downregulation of Notch Signaling Enhances Retinal Regeneration

The data from the early treatment with DAPT indicates that activation of the Notch pathway

may be necessary for Mller cells to de-differentiate, and become neurons. However, previous

studies have also found that once the Mller glia de-differentiate into progenitor cells, only a

small percentage of the cells go on to differentiate into neurons, while most of the cells remain

in an undifferentiated state. Our time-course data (Fig. 1) shows that the expression of Notch

signaling components persists until at least P8. Thus, we hypothesized that the maintained

activation of Notch in these cells may prevent more of the progeny of the Mller glia from

differentiating into neurons. To test this hypothesis, we injected eyes with NMDA at P1, BrdU

at P3, and DAPT or DMSO (vehicle control) at P4, and sacrificed the animals at P8 (Fig 5A).

The eyes were analyzed by immunohistochemistry for neuronal markers (Hu, calretinin, and

islet) and BrdU. Since normally at this stage, all the retinal cells are postmitotic, we used BrdU

to label the newly generated retinal neurons.

DAPT treatment at P4, led to an increase in the number of newly generated neurons (Fig. 5).

Cells labeled with BrdU and several neuronal markers (Hu (ganglion and amacrine cells),

calretinin (ganglion, amacrine, horizontal cells), islet (ganglion, amacrine, bipolar cells) and

visinin (cone photoreceptors)) were more commonly observed in the DAPT treated retinas

compared to retinas from the group that received DMSO. There were roughly 3.5x more new

Hu (Fig. 5B), 2x more new calretinin (Fig. 5C) and 4.7x more islet (Fig. 5D) labeled neuronsin the DAPT treated retinas than in the DMSO treated retinas. The number of visinin and BrdU

labeled cells was extremely rare (Fig. 5E). Out of seven DMSO treated retinas, we found one

retina that had one new visinin cell. Out of eight DAPT treated retinas, we found three retinas

that had new visinin cells. The occurrence of new visinin cells was too rare to reach statistical

significance. The overall number of BrdU labeled cells was similar between the DAPT treated

group and the DMSO control (Sup. Fig 4). Quantification of the number of cells that were

Hayes et al. Page 6


NIH-PAA

uthorManuscript


NIH-PAAuthor

Manuscript


7/19

double-labeled with BrdU and the various neural markers is shown in Fig. 5E. We also looked

for any cells that coexpress the neural marker, Hu, and the Muller glia marker, CRALBP, to

determine whether the Muller glia undergo an abnormal plasticity. Out of 2,429 Hu positive

cells, in 7 NMDA treated birds (4 DAPT treated and 3DMSO treated) we did not find any cells

that coexpressed Hu and CRALBP (Sup. Fig 5).

These results indicate that inactivation of the Notch pathway led to an increase in the neural

differentiation of the Mller glial-derived progenitors. We analyzed the DAPT treated retinasto determine whether there was a concomitant decrease in the number of Mller-glial derived

progenitors, when compared to the DMSO-treated control retinas. We identified these de-

differentiated progenitor cells as cells that were triple labeled for BrdU, Sox2 and Pax6. Sox2

labels Mller glia and progenitors (Ellis et al., 2004). Therefore one would predict that de-

differentiated Mller glia would co-express Sox2 and Pax6. We found a significant decline in

the number of progenitor cells in the DAPT treated retinas compared to the DMSO treated

retinas (about 45% less, p < 0.0317, Fig. 6), consistent with the hypothesis that Notch signaling

maintains the progenitors from differentiating in the toxin treated retina.

The inhibition of Notch with DAPT thus leads to a shift in the BrdU labeled population from

a progenitor state to neuronal differentiation. To determine whether the new neurons persist in

the retina, we analyzed some birds after survival periods of up to two weeks following the

NMDA treatment (Sup. Fig 4). We found that most of the new neurons do not survive afterone week. Two weeks after the NMDA treatment there was a significant decrease in the total

number of BrdU labeled cells in both the DMSO and DAPT treated retinas. However among

the remaining BrdU labeled cells, we found that a significantly higher percentage co-labeled

with BrdU and Hu in the DAPT treated retinas as compared to the DMSO treated retinas (about

1.97-times more BrdU and Hu labeled cells in DAPT compared to DMSO, p < 0.05). Thus,

although most of the newly generated neurons do not persist, the effects of DAPT treatment

are still present two weeks after the NMDA-induced damage.

DISCUSSION

The chick retina is capable of limited regeneration following neurotoxic damage. In this study,

we have investigated the role of Notch in the regulation of regeneration in the posthatch chick

retina. We find that 1.) components of the Notch pathway are up-regulated in Mller glia afterretinal damage; 2.) this up-regulation of Notch is important for the de-differentiation process,

since inhibition of Notch signaling soon after damage leads to a reduction in the number of

progenitors produced by the Mller cells; and 3.) sustained Notch activity limits the process

of regeneration, since inhibition of Notch signaling late in the process leads to an increase in

the number of new neurons produced by the Mller glial-derived progenitors. Taken together,

our results implicate Notch signaling at two key steps in the process of regeneration in the

retina, as outlined in Figure 7.

Previous studies have shown that Notch pathway components are expressed in adult

mammalian brain regions that retain neurogenic and regenerative capability, such as the

subventricular zone, dentate gyrus, and the rostral migratory stream (Stump et al., 2002). In

addition, in lower vertebrates, Notch and related components of the pathway are expressed in

the neurogenic zone of the mature retina, the ciliary marginal zone (Perron et al., 1998;Raymond et al., 2006). The most peripheral region of the chicken retina also contains a CMZ

(Fischer and Reh, 2000), similar to that of cold-blooded vertebrates, and the results of our study

show that Notch1 and Hes5 are localized to this zone in the posthatch chick retina.

Our results also show that Mller glia normally express a low level of Notch1, and that this

gene is rapidly up-regulated following damage, reaching a peak three days after the toxin

Hayes et al. Page 7


NIH-PAA

uthorManuscript


NIH-PAAuthor

Manuscript


8/19

treatment, correlating with the peak of progenitor proliferation. During retinal regeneration,

we were also able to detect expression of Hes5, a key downstream Notch effector, in the

responsive Mller cells. These data are consistent with recent findings in other parts of the

nervous system that show an increase in Notch signaling following damage. For example,

following a cortical stab wound, the Notch pathway is activated in the subventricular zone

(Givogri et al., 2006). In addition, Raymond et al have reported an increase in Notch expression

in the regenerating zebrafish retina (Raymond et al., 2006). The Notch pathway was also

recently shown to play a role in retinal regeneration in newt. The newt regenerates its retinafrom the pigment epithelium. The pigment epithelium must first dedifferentiate into retinal

progenitor cells, which go on to generate a new retina, and the de-differentiation process is

accompanied by an increase in Notch expression (Nakamura and Chiba, 2006). It is interesting

that regenerating newt and chick retinas, which have a very different source of regeneration,

both require Notch during the regeneration process; this provides further evidence that the

Notch pathway regulates differentiation of the progenitor cells, regardless of their source.

Although it has been shown previously that Mller glia retain stem cell-like properties and are

the source of regenerated retinal neurons in fish and posthatch chickens (Fischer et al., 2002;

Fischer and Reh, 2001; Fischer and Reh, 2002; Fischer and Reh, 2003; Raymond et al.,

2006), the mechanisms by which Mller glia de-differentiate into neurogenic progenitors is

not understood. Our results show that Notch signaling is necessary for the de-differentiation

and proliferation of Mller glia, since blocking Notch results in reduction of both proliferationand progenitor gene expression. A recent study in an ischemically injured rat brain, also

suggests that Notch signaling may be necessary for progenitor activation after trauma. In this

study, administering the ligand, Dll4, activated Notch signaling; as a result, there were more

newly generated precursor cells and the rats had improved motor skills (Androutsellis-

Theotokis et al., 2006). Attempts to stimulate regeneration from the mammalian retina have

shown the response to toxin damage is even more limited than that of the posthatch chick

(Ooto et al., 2004), however, recent evidence indicates that activation of the Wnt pathway

stimulates proliferation of Mller glia and promotes their de-differentiation into retinal

progenitors (Osakada et al., 2007). While it is not known whether Notch signaling is involved

in the de-differentiation of mammalian Mller glia, and/or their production of new neurons,

another study in the rodent retina has implicated Notch signaling in the response of the

mammalian retina to damage. A FACS sorted side population that possesses some

progenitor-like qualities can be isolated from the toxin-treated rat retina. When the Notchsignaling pathway was inhibited at the same time as the damage was induced, the pool of side

population cells was lost (Das et al., 2006).

In previous studies of regeneration in the chick retina, it was noted that a majority of the Mller

glial-derived progenitors do not differentiate into neurons, but rather remain as undifferentiated

progenitors (Fischer and Reh, 2001). We tested whether a persistent activation of the Notch

pathway may be preventing these progenitors from completing the regenerative process. Our

data are consistent with this hypothesis, since experimentally inhibiting the pathway by

treatment with DAPT causes an increase in the percentage of these progenitors that differentiate

into neurons. This result begs the question as to which ligands might be activating the Notch

receptor in the damaged retina. While we found that Notch1 and Hes5 were upregulated during

regeneration, we did not see a significant up-regulation of either the canonical or non-canonical

Notch ligands: DNER, Dll1, and Dll4. Nevertheless, we could detect expression of theseligands by QPCR, and so it is possible that one or more of them may be activating the Notch

receptor, but that the overall expression levels of these ligands do not change after damage.

The Notch pathway has also been implicated in regeneration of other non-retinal tissues, such

as the pancreas (Su et al., 2006), bone marrow (Han et al., 2000; Han et al., 2006), skin (Adolphe

and Wainwright, 2005), muscle (Luo et al., 2005, Carey et al, 2007) and cochlea (Bermingham-

Hayes et al. Page 8


NIH-PAA

uthorManuscript


NIH-PAAuthor

Manuscript


9/19

McDonogh and Rubel, 2003; Stone and Rubel, 1999) and thus some of the mechanisms for

regeneration are likely to be conserved across tissue types and species. When muscle cells are

stressed, for example through exercise, new muscles cells are generated. The source of this

regeneration is an intrinsic stem population, called satellite cells. During this myogenesis, there

is increased expression of several Notch signaling components. Coincidently, it was found that

older muscles cells, which have less regenerative capabilities, express lower levels of Notch

signaling molecules than younger muscles. Interestingly, if older muscles underwent resistance

training, the expression levels of Notch signaling components between age groups wereindistinguishable (Carey et al., 2007). Thus Notch signaling is necessary for the expansion of

the satellite cell population, however later in myogenesis, the Notch pathway is downregulated

as the newly differentiated muscle cells emerge. One theme that appears to be emerging in the

study of Notch signaling during regeneration, regardless of the tissue type, is that there is a

need for tight spatial and temporal regulation of Notch signaling.

In summary, there is an increasing body of data that supports the importance of Notch signaling

during regeneration. In most of the these cases, Notch signaling functions to maintain stem cell

properties in progenitor/stem cell populations while restricting differentiation. We have shown

that Notch signaling is transiently upregulated during retinal regeneration in the chick, and that

Notch signaling plays a biphasic role during the regeneration. Initially, Notch is necessary for

dedifferentiation of Mller glia into progenitor cells, but later in the process the activation of

Notch limits successful regeneration in these animals. It is possible that a similar limit occursin the mammalian retina, and manipulation of the Notch pathway may be critical to promote

retinal repair in mammals.

Supplementary Material

Refer to Web version on PubMed Central for supplementary material.

Acknowledgements

We would like to thank Paige Etter, Samuel Reh and Christa Younkins for the assistance with sectioning, Toshinori

Hayashi and Byron Hartman for advice on in situ protocol and all the members of the Reh lab, especially Mike Karl

and Deepak Lamba, for their constructive comments. This work was supported by NRSA postdoctoral fellowship F32

EY016636 to S.H. and NIH grant EY13475 to T.A. R.

References

Adolphe C, Wainwright B. Pathways to improving skin regeneration. Expert Rev Mol Med 2005;7:1

14. [PubMed: 16179092]

Androutsellis-Theotokis A, Leker RR, Soldner F, Hoeppner DJ, Ravin R, Poser SW, Rueger MA, Bae

SK, Kittappa R, McKay RD. Notch signalling regulates stem cell numbers in vitro and in vivo. Nature

2006;442:8236. [PubMed: 16799564]

Bao ZZ, Cepko CL. The expression and function of Notch pathway genes in the developing rat eye. J

Neurosci 1997;17:142534. [PubMed: 9006984]

Bermingham-McDonogh O, Oesterle EC, Stone JS, Hume CR, Huynh HM, Hayashi T. Expression of

Prox1 during mouse cochlear development. J Comp Neurol 2006;496:17286. [PubMed: 16538679]

Bermingham-McDonogh O, Rubel EW. Hair cell regeneration: winging our way towards a sound future.

Curr Opin Neurobiol 2003;13:11926. [PubMed: 12593990]

Bray SJ. Notch signalling: a simple pathway becomes complex. Nat Rev Mol Cell Biol 2006;7:67889.

[PubMed: 16921404]

Carey KA, Farnfield MM, Tarquinio SD, Cameron-Smith D. Impaired expression of Notch signaling

genes in aged human skeletal muscle. J Gerontol A Biol Sci Med Sci 2007;62:917. [PubMed:

17301032]

Chen H, Thiagalingam A, Chopra H, Borges MW, Feder JN, Nelkin BD, Baylin SB, Ball DW.

Conservation of the Drosophila lateral inhibition pathway in human lung cancer: a hairy-related protein

Hayes et al. Page 9


NIH-PAA

uthorManuscript


NIH-PAAuthor

Manuscript


10/19

(HES-1) directly represses achaete-scute homolog-1 expression. Proc Natl Acad Sci U S A

1997;94:535560. [PubMed: 9144241]

Das AV, Mallya KB, Zhao X, Ahmad F, Bhattacharya S, Thoreson WB, Hegde GV, Ahmad I. Neural

stem cell properties of Muller glia in the mammalian retina: regulation by Notch and Wnt signaling.

Dev Biol 2006;299:283302. [PubMed: 16949068]

Del Bene F, Tessmar-Raible K, Wittbrodt J. Direct interaction of geminin and Six3 in eye development.

Nature 2004;427:7459. [PubMed: 14973488]

Dorsky RI, Chang WS, Rapaport DH, Harris WA. Regulation of neuronal diversity in the Xenopus retinaby Delta signalling. Nature 1997;385:6770. [PubMed: 8985247]

Ellis P, Fagan BM, Magness ST, Hutton S, Taranova O, Hayashi S, McMahon A, Rao M, Pevny L. SOX2,

a persistent marker for multipotential neural stem cells derived from embryonic stem cells, the

embryo or the adult. Dev Neurosci 2004;26:14865. [PubMed: 15711057]

Fischer AJ. Neural regeneration in the chick retina. Prog Retin Eye Res 2005;24:16182. [PubMed:

15610972]

Fischer AJ, McGuire CR, Dierks BD, Reh TA. Insulin and fibroblast growth factor 2 activate a neurogenic

program in Muller glia of the chicken retina. J Neurosci 2002;22:938798. [PubMed: 12417664]

Fischer AJ, Reh TA. Identification of a proliferating marginal zone of retinal progenitors in postnatal

chickens. Dev Biol 2000;220:197210. [PubMed: 10753510]

Fischer AJ, Reh TA. Muller glia are a potential source of neural regeneration in the postnatal chicken

retina. Nat Neurosci 2001;4:24752. [PubMed: 11224540]

Fischer AJ, Reh TA. Exogenous growth factors stimulate the regeneration of ganglion cells in the chickenretina. Dev Biol 2002;251:36779. [PubMed: 12435364]

Fischer AJ, Reh TA. Potential of Muller glia to become neurogenic retinal progenitor cells. Glia

2003;43:706. [PubMed: 12761869]

Forster B, Van De Ville D, Berent J, Sage D, Unser M. Complex wavelets for extended depth-of-field:

a new method for the fusion of multichannel microscopy images. Microsc Res Tech 2004;65:3342.

[PubMed: 15570586]

Furukawa T, Mukherjee S, Bao ZZ, Morrow EM, Cepko CL. rax, Hes1, and notch1 promote the formation

of Muller glia by postnatal retinal progenitor cells. Neuron 2000;26:38394. [PubMed: 10839357]

Geling A, Steiner H, Willem M, Bally-Cuif L, Haass C. A gamma-secretase inhibitor blocks Notch

signaling in vivo and causes a severe neurogenic phenotype in zebrafish. EMBO Rep 2002;3:688

94. [PubMed: 12101103]

Givogri MI, de Planell M, Galbiati F, Superchi D, Gritti A, Vescovi A, de Vellis J, Bongarzone ER. Notch

signaling in astrocytes and neuroblasts of the adult subventricular zone in health and after corticalinjury. Dev Neurosci 2006;28:8191. [PubMed: 16508306]

Han W, Ye Q, Moore MA. A soluble form of human Delta-like-1 inhibits differentiation of hematopoietic

progenitor cells. Blood 2000;95:161625. [PubMed: 10688816]

Han W, Yu Y, Liu XY. Local signals in stem cell-based bone marrow regeneration. Cell Res

2006;16:18995. [PubMed: 16474433]

Henrique D, Hirsinger E, Adam J, Le Roux I, Pourquie O, Ish-Horowicz D, Lewis J. Maintenance of

neuroepithelial progenitor cells by Delta-Notch signalling in the embryonic chick retina. Curr Biol

1997;7:66170. [PubMed: 9285721]

Jadhav AP, Cho SH, Cepko CL. Notch activity permits retinal cells to progress through multiple

progenitor states and acquire a stem cell property. Proc Natl Acad Sci U S A 2006;103:189989003.

[PubMed: 17148603]

Jasoni CL, Walker MB, Morris MD, Reh TA. A chicken achaete-scute homolog (CASH-1) is expressed

in a temporally and spatially discrete manner in the developing nervous system. Development1994;120:76983. [PubMed: 7600956]

Li S, Mo Z, Yang X, Price SM, Shen MM, Xiang M. Foxn4 controls the genesis of amacrine and horizontal

cells by retinal progenitors. Neuron 2004;43:795807. [PubMed: 15363391]

Luo D, Renault VM, Rando TA. The regulation of Notch signaling in muscle stem cell activation and

postnatal myogenesis. Semin Cell Dev Biol 2005;16:61222. [PubMed: 16087370]

Hayes et al. Page 10


NIH-PAA

uthorManuscript


NIH-PAAuthor

Manuscript


11/19

McCabe KL, McGuire C, Reh TA. Pea3 expression is regulated by FGF signaling in developing retina.

Dev Dyn 2006;235:32735. [PubMed: 16273524]

Micchelli CA, Esler WP, Kimberly WT, Jack C, Berezovska O, Kornilova A, Hyman BT, Perrimon N,

Wolfe MS. Gamma-secretase/presenilin inhibitors for Alzheimers disease phenocopy Notch

mutations in Drosophila. Faseb J 2003;17:7981. [PubMed: 12424225]

Nakamura K, Chiba C. Evidence for Notch signaling involvement in retinal regeneration of adult newt.

Brain Res. 2006

Nelson BR, Gumuscu B, Hartman BH, Reh TA. Notch activity is downregulated just prior to retinalganglion cell differentiation. Dev Neurosci 2006;28:12841. [PubMed: 16508310]

Nelson BR, Hartman BH, Georgi SA, Lan MS, Reh TA. Transient inactivation of Notch signaling

synchronizes differentiation of neural progenitor cells. Dev Biol. 2007

Ooto S, Akagi T, Kageyama R, Akita J, Mandai M, Honda Y, Takahashi M. Potential for neural

regeneration after neurotoxic injury in the adult mammalian retina. Proc Natl Acad Sci U S A

2004;101:136549. [PubMed: 15353594]

Osakada F, Ooto S, Akagi T, Mandai M, Akaike A, Takahashi M. Wnt signaling promotes regeneration

in the retina of adult mammals. J Neurosci 2007;27:42109. [PubMed: 17428999]

Perron M, Kanekar S, Vetter ML, Harris WA. The genetic sequence of retinal development in the ciliary

margin of the Xenopus eye. Dev Biol 1998;199:185200. [PubMed: 9698439]

Rasband, W. Image J. National Institute of Health; Bethesda: 19972006.

Raymond PA, Barthel LK, Bernardos RL, Perkowski JJ. Molecular characterization of retinal stem cells

and their niches in adult zebrafish. BMC Dev Biol 2006;6:36. [PubMed: 16872490]Sriuranpong V, Borges MW, Strock CL, Nakakura EK, Watkins DN, Blaumueller CM, Nelkin BD, Ball

DW. Notch signaling induces rapid degradation of achaete-scute homolog 1. Mol Cell Biol

2002;22:312939. [PubMed: 11940670]

Stone JS, Rubel EW. Delta1 expression during avian hair cell regeneration. Development 1999;126:961

73. [PubMed: 9927597]

Stump G, Durrer A, Klein AL, Lutolf S, Suter U, Taylor V. Notch1 and its ligands Delta-like and Jagged

are expressed and active in distinct cell populations in the postnatal mouse brain. Mech Dev

2002;114:1539. [PubMed: 12175503]

Su Y, Buchler P, Gazdhar A, Giese N, Reber HA, Hines OJ, Giese T, Buchler MW, Friess H. Pancreatic

regeneration in chronic pancreatitis requires activation of the notch signaling pathway. J Gastrointest

Surg 2006;10:123041. [PubMed: 17114010]discussion 1242

Sullivan SA, Barthel LK, Largent BL, Raymond PA. A goldfish Notch-3 homologue is expressed in

neurogenic regions of embryonic, adult, and regenerating brain and retina. Dev Genet 1997;20:20823. [PubMed: 9216061]

Taranova OV, Magness ST, Fagan BM, Wu Y, Surzenko N, Hutton SR, Pevny LH. SOX2 is a dose-

dependent regulator of retinal neural progenitor competence. Genes Dev 2006;20:1187202.

[PubMed: 16651659]

Yurco P, Cameron DA. Responses of Muller glia to retinal injury in adult zebrafish. Vision Res

2005;45:9911002. [PubMed: 15695184]

Hayes et al. Page 11


NIH-PAA

uthorManuscript


NIH-PAAuthor

Manuscript


12/19

Fig. 1.

QPCR of central retina shows Notch signaling pathway components are upregulated after

NMDA treatment. (A) Geminin (progenitor specific marker) increases after damage. (B) Sox2

increases after damage. (C) Pea3 (progenitor specific marker) increases after damage. (D)

PCNA (a measure of cell proliferation) increases after NMDA damage (P3 p < 0.07, P4 p

Documents

Susan Hayes, Branden R. Nelson, Brian Buckingham and Thomas A. Reh- Notch signaling regulates regeneration in the avian retina