Supporting Information

Rumpho et al. 10.1073/pnas.0804968105SI MethodsSea Slug and Algal Culturing. Sea slug egg masses were cultured inPetri dishes containing sterile autoclaved artificial sea water(Instant Ocean) and incubated under room conditions of tem-perature and lighting. Veliger larvae emerged from egg massesafter 5–7 days and were fed aliquots of Rhodomonas salina orIsochrysis galbana. Within 16–22 days, the veligers started todevelop pigmented striations on their shells; at this point,filaments of V. litorea were provided to induce metamorphosis.Cultures were supplemented with additional V. litorea on a dailybasis to promote growth and establishment of the symbioticassociation.

ptDNA Sequencing. ABI 3100 automated sequencers (AppliedBiosystems) at the University of Maine Sequencing Facility andthe Institute for Plant Genomics and Biotechnology, TexasA&M University, were used to sequence the ptDNA fragments.Sequences were assembled with Sequencher version 4.0, andgenes were identified using DNA and protein sequences sub-mitted to BLAST and Genetic Computer Group (www.accelry-s.com/products/gcg/). The map was constructed using Canvasversion 6.0.

Primer Design and PCR Amplification of psbO. Conserved regions ofseveral heterokont and red alga psbO sequences were alignedusing Clustal X (1) to design primers, including Karenia brevis(GenBank AY116667), Isochrysis galbana (GenBankAY116669), Heterocapsa triquetra (GenBank AY116668), Het-erosigma akashiwo (GenBank AY191862), Phaeodactylum tricor-nutum (GenBank AY191862), and Cyanidium caldarium (2).The resulting primers, psbO R and psbO L2, amplified an internalregion of the V. litorea psbO gene. A list of all primers used canbe found in Table S2. PCR conditions included 1 � enzymereaction buffer, 1.5 mM MgCl2, 0.2 mM dNTP mix (Invitrogen),primers (0.5 �M each), 1 to 10 ng of DNA, and 2.5 U of platinumTaq polymerase (Invitrogen). Cycle conditions were 94°C for 2min, 25 cycles of 94°C for 30 sec, 58.7°C for 30 sec, and 72°C for1 min, with a final elongation step at 72°C for 10 min. Productswere separated using a 1% agarose gel in 1 � Tris borate EDTAbuffer (TBE) and visualized by staining with ethidium bromide.

5�- and 3�-RACE. The complete V. litorea psbO transcript wasobtained by RACE using the GeneRacer Kit (Invitrogen) andoligo d(T) and random hexamer priming. Amplification of the 5�end was performed with the following primary primer sets: psbORev1 and GeneRacer 5� primer and psbO For1 and GeneRacer3� primer (Invitrogen). The full-length V. litorea psbO sequencewas used to generate homologous primers (psbO L5 and R8),which amplified a larger (�963-bp) psbO fragment. A list of allprimers used can be found in Table S2.

Northern Blotting. The procedures for Northern Max (formalde-hyde-based system for Northern blots; Ambion) were followedfor Northern blot analysis of the psbO transcripts using 4 �g ofDNAse-treated total RNA for each sample. RNA MillenniumSize Markers (Ambion) were run in an adjacent gel lane toestimate transcript size. RNA was transferred to Hybond-n �nylon membranes (Amersham Biosciences) using the NytranSuPerCharge Turboblotter (Schleicher & Schuell) and theNorthern Max 20 � SSC transfer buffer, and was UV cross-linked. The psbO probe was prepared using the Rediprime II

random prime labeling system (Amersham Biosciences) and[32P] dCTP (50 �Ci). Prehybridization was performed withULTRAhyb (Ambion) preheated to 42°C for 1 to 2 h beforehybridizing overnight at 42°C. Following hybridization, the mem-brane was washed with 2 � SSC/0.1% SDS for 5 min at roomtemperature, followed by two washes in 0.1 � SSC, 0.1% SDS for15 min at 42°C. The blot was exposed to x-ray film (Image Plus;Diagnostic Imaging, Inc.) at �80°C for 5 days before manualdevelopment.

Genome Walking. Algal and sea slug egg genomic DNA wasisolated using DNAzol extra strength (Molecular ResearchCenter, Inc.). The egg DNA was further purified on a CsClgradient to remove inhibiting mucopolysaccharides (3). AllDNA (2.5 �g) was restriction digested with 80 U of MscI, PvuII,or SspI overnight at 37°C; precipitated; and concentrated to 50ng/�l in deionized H2O. Genome walking was performed fol-lowing the method detailed in Clontech’s Genome Walking Kit.Briefly, 0.2 �g of restriction-digested DNA, 47.5 pmol modifiedadapter (T � N mixed 1:1), and 3 U of T4 DNA ligase weremixed and incubated at 16°C overnight. Adapter-ligated DNAwas precipitated and used in sequential inverse PCR reactions.Gene-specific primers and adapter primers (Table S2) were usedin four sequential nested amplifications starting with PsbO GW3�-3. Amplified products were band isolated using the QiagenGel Extraction Kit and cloned into pGEM-TEZ vector (Pro-mega), plated on LB agar plates containing 50 �g ml�1 Amp, andgrown overnight at 37°C. Inserts were amplified with Sp6 and T7primers and analyzed by gel electrophoresis. Amplified product(5 �l) was mixed with 2 �l of ExoSap-IT (USB Corp.) to removeresidual dNTP and primers and was incubated for 15 min at 37°Cbefore inactivating at 80°C for 15 min. Samples were sequencedby the University of Maine DNA Sequencing Facility.

Cloning and Sequence Analysis. Unless stated otherwise, the TOPOTA Cloning Kit for Sequencing (Invitrogen) was used to cloneDNA fragments excised from 1% agarose gel slices by S.N.A.P.(Invitrogen) column centrifugation. Plasmids were isolated usingthe Qiaprep Miniprep Spin Kit (Qiagen), and inserts weresequenced in both directions by the University of Maine DNASequencing Facility. A minimum of two totally independentPCR reactions and cloning events and three to six differentplasmids were sequenced for all PCR products reported here.Consensus nucleotide sequences [manually identified after align-ing with ClustalX (1)] and translated amino acid sequences wereused to search the GenBank database (www.ncbi.nlm.nih.gov/BLAST/).

Phylogenetic Analysis of psbO (MSP). The psbO phylogeny wasconstructed using maximum parsimony in PAUP 4.0b10 (4). Max-imum parsimony heuristic searches included 1,000 replications ofRANDOM addition and tree bisection-reconnection. Sets ofequally parsimonious trees were summarized using strict consensus.Bootstrapping (5) was implemented in PAUP using 1,000 replicatesof heuristic searches with SIMPLE addition sequence and treebisection-reconnection. Sources for the sequences used are asfollows: green lineage: Spinacia oleracea (S00415), Oryza sativa(NP�001043134), Chlamydomonas reinhardtii (CAA32053), Volvoxcarteri (AAD55562), Bigelowiella natans (AAP79149), and Euglenagracilis (BAA03529); red lineage: Karenia brevis (AAM77464),Isochrysis galbana (AAM77466), Heterocapsa triquerta

Rumpho et al. www.pnas.org/cgi/content/short/0804968105 1 of 13

(AAM77465), Guillardia theta (ABD51936), Porphyra yezoensis(AAW33888), Cyanidioschyzon merolae (BAD36767), Phaeodacty-lum tricornutum (AAO43192), Thalassiosira pseudonana (thaps1/scaffold�39:162585–163984 from genome.jgi-psf.org/), Heterosigmaakashiwo (AAN11311), and Vaucheria litorea (DQ514337); mol-lusc: Elysia chlorotica (EU621882); glaucophyta: Cyanophora para-doxa (CAH04962); and prokaryotes: Nostoc punctiforme PCC73102 (ZP�00111456), Trichodesmium erythraeum (YP�723422),Thermosynechococcus elongatus BP-1 (BAC07996), Crocosphaerawatsonii WH 8501 (ZP00515383), Cyanothece sp. ATCC 51142(AAF13997), Synechococcus sp. WH 8102 (CAE06818), andGloeobacter violaceus PCC 7421 (BAC91632).

mtDNA Sequencing. After 3 months in culture in the absence ofany algae, the sea slugs produced eggs and these were used forDNA extraction. Universal primers (6, 7) were used to amplifyfragments of the mitochondrial rrnL and cox1 regions, and cobprimers were designed based on published mollusc sequences(ref. 8; Table S3). Standard PCR mixtures contained 10 mMTris-HCl, 50 mM KCl, 1.5 mM MgCl2, 0.5 �M each primer,template DNA (30–40 ng), and Taq Polymerase (1 U; NewEngland Biolabs) in a final volume of 50 �l. They were subjectedto an initial denaturation cycle at 94°C for 2 min; 25 cycles at94°C for 30 sec; annealing at 42°C for rrnL, 51°C for cob, and48°C for cox1, each for 30 sec; and then extension at 72°C for 1min. All PCR products were separated in a 1% agarose gel, andfragments were isolated using the QIAquick Gel Extraction Kit(Qiagen). Fragments were ligated using the pGEM-T EasyVector system (Promega) and transformed into NEB (NewEngland Biolabs) 5� competent cells. Three to five colonies ofeach cloned PCR product were selected, and the cloned frag-ments were sequenced using T7 and SP6 universal primers.Following identification of primers that yielded known mito-chondrial products from sea slug egg DNA, combinations ofthese primers (Table S3) were used to generate longer productsto amplify the entire circular mtDNA. The mitochondrial geneorder of the mollusc Roboastra europaea was used as a guide (10).Two cox1 primers were used with two cob primers in fourdifferent combinations of separate PCR reactions. These reac-

tions yielded two products of approximately 7,000bp each. Thelong PCR products were directly sequenced by primer walking.The two cob primers were also used in combination with the tworrnL primers, and the resulting fragments were directly se-quenced following gel extraction. The remainder of the genomewas obtained in the same manner using a combination of tworrnL and cox1 primers (see Table S3). For long PCR reactions,the Phusion High-Fidelity PCR Kit (New England Biolabs) wasused and PCR mixtures were subjected to an initial denaturationat 98°C for 30 sec, 35 cycles of denaturation at 98°C for 20 sec,annealing for 20 sec, and extension at 72°C for 5 min. Theannealing temperature was adjusted in accordance with themelting temperature (Tm) of the primer pairs. The resultingfragments were extracted from an agarose gel as describedpreviously and sequenced by primer walking on both strands.

The gene for ATPase8 was annotated by alignment with otheropisthobranch ATPase8 genes, including Aplysia californica(NC�005827), Roboastra europaea (NC�004321), and Pupa stri-gosa (AB028237), using CLUSTAL X (1). Two trnS genes thatwere not identified by tRNA-SE Scan or DOGMA programswere identified by their ability to form characteristic secondarystructures. Both nucleotide and amino acid sequence alignmentswere used to define the start and stop codons for each gene.

Analysis of the mtDNA for HGT. The E. chlorotica mitochondrialnucleotide windows (500 nt each) were analyzed by compiling adatabase of 1,429 RefSeq (11) complete mtDNAs (animals,heterokonts, green plants and algae, red algae, alveolates, andfungi) for homologous segments to each of the windows usingWashington University (WU)-BLAST. Each window was thenaligned along with its homologues using MUSCLE (12); inferredmaximum likelihood topologies were then determined usingPhyML (13). In the case of translated ORFs, a database wasassembled of 24,722 RefSeq (11) proteins from the mitochondriaof 24 species spanning animals (including molluscs), het-erokonts, green plants and algae, fungi, alveolates and slimemolds, and six bacteria. Then, each ORF was analyzed bysearching for homologues, aligning, and inferring trees (using thesame set of tools as for the nucleotide windows, adjusting theparameters appropriately for amino acid sequences).

1. Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG (1997) The ClustalXwindows interface: Flexible strategies for multiple sequence alignment aided byquality analysis tools. Nucleic Acids Res 24:4876–4882.

2. Tohri A, et al. (2002) Comparison of the structure of the extrinsic 33 kDa protein fromdifferent organisms. Plant Cell Physiol 43:429–439.

3. Rumpho ME, Mujer CV, Andrews DL, Manhart JR, Pierce SK (1994) Extraction of DNAfrom mucilaginous tissues of a sea slug (Elysia chlorotica). BioTechniques 17:1097–1101.

4. Swofford DL, et al. (2001) Bias in phylogenetic estimation and its relevance to thechoice between parsimony and likelihood methods. Syst Biol 50:525–539.

5. Felsenstein J (1985) Confidence limits on phylogenies: an approach using the boot-strap. Evolution 39:783–791.

6. Palumbi S, et al. (1991) The Simple Fool’s Guide to PCR (Department of Zoology,University of Hawaii, Honolulu).

7. Folmer O, Black M, Hoeh R, Lutz R, Vrijenhoek R (1994) DNA primers for amplificationof mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates.Mol Mar Biol Biotechol 3:294–299.

8. Merritt TJS, et al. (1998) Universal cytochrome b primers facilitate intraspecific studiesin molluscan taxa. Mol Mar Biol Biotechnol 3:7–11.

10. Grande C, Templado J, Cervera L, Zardoya R (2002) The complete mitochondrialgenome of the nudibranch Roboastra europaea (Mollusca: Gastropoda) supports themonophyly of opisthobranchs. Mol Biol Evol 19:1672–1685.

11. Pruitt KD, Tatusova T, Maglott DR (2007) NCBI reference sequences (RefSeq): A curatednon-redundant sequence database of genomes, transcripts and proteins. Nucleic AcidsRes 35:D61–D65.

12. Edgar RC (2004) MUSCLE: A multiple sequence alignment method with reduced timeand space complexity. BMC Bioinformatics 5:113.

13. Guindon S, Gascuel O (2003) A simple, fast, and accurate algorithm to estimate largephylogenies by maximum likelihood. Syst Biol 52:696–704.

Rumpho et al. www.pnas.org/cgi/content/short/0804968105 2 of 13

Fig. S1. Schematic illustrating the evolutionary origin of secondary plastids in V. litorea and tertiary plastids in E. chlorotica. The drawing highlights the redalgal secondary endosymbiotic origin of V. litorea. Four membranes surround the algal plastids as a result of the two endosymbiotic events, with the outermostmembrane being continuous with the nuclear envelope. The bottom panel with two sea slug digestive epithelial cells illustrates that only two membranes, thetypical plastid double envelope, are typically seen around the plastids in the sea slug. The plastids are colored red in the drawing to reflect the red algal origin.

Rumpho et al. www.pnas.org/cgi/content/short/0804968105 3 of 13

Fig. S2. Nucleic acid sequence comparison of psbO from V. litorea cDNA and genomic DNA, E. chlorotica DNA, and E. chlorotica egg DNA. An initial 452-bpfragment was obtained from V. litorea by RT-PCR, and the complete cDNA for psbO was obtained by 5� and 3� RACE. This sequence was used to design primersthat amplified a �963-bp fragment from DNA or cDNA of both organisms. The psbO gene does not contain an intron. The black dots identify identical base pairsin all four sequences beginning with the start codon, and the dashes indicate that the sequence is not available for comparison. Base pair numbering is accordingto the V. litorea cDNA sequence.

Rumpho et al. www.pnas.org/cgi/content/short/0804968105 4 of 13

Fig. S3. Maximum parsimony tree based on amino acid sequences of 25 psbO-encoded MSPs. Strict consensus of nine trees (1,530 steps, consistency index �0.650, retention index � 0.576) using maximum parsimony in PAUP 4.0b10 (1, 2). Numbers are shown above branches for all boot strap values �90. Weightedbranches are indicative of branches with boot strap support values �70. For a complete list of sources, see SI Methods.

Rumpho et al. www.pnas.org/cgi/content/short/0804968105 5 of 13

Fig. S4. Nucleic acid sequence comparison of the psbO 3� flanking region of V. litorea and E. chlorotica DNA. Genome walking using a nested gene-specificprimer with an adapter-specific primer yielded 3� psbO flanking sequence data from both V. litorea and E. chlorotica. The sequences were identical for the first81bp corresponding to the 3� end of the psbO gene and ending with the stop codon (bold text). This sequence was followed by the highly diverged sequencecorresponding to the 3� untranslated flanking region in each organism.

Rumpho et al. www.pnas.org/cgi/content/short/0804968105 6 of 13

Fig. S5. Distribution of E. chlorotica G � C content over the sliding window of 500 nucleotides with overlaps of 200 nucleotides. The values were found to beuniformly distributed across the windows with a linear trend described by the model y � 0.0026x � 36.25. The average G � C content of the mtDNA of E. chloroticawas 36.19%.

Rumpho et al. www.pnas.org/cgi/content/short/0804968105 7 of 13

Fig. S6. Maximum likelihood phylogenetic tree of cytochrome b. The tree was inferred using PhyML (13) with 100 bootstrap replicates.

Rumpho et al. www.pnas.org/cgi/content/short/0804968105 8 of 13

Movie S1 (MOV)

Movie S1. Young sea slug sucking plastids out of Vaucheria litorea filaments. A juvenile sea slug is observed feeding on filaments of the heterokont algaV. litorea. There is an obligate requirement at this stage for plastid acquisition for continued development to the adult stage. This is fulfilled by juvenilespuncturing the siphonaceous filaments and sucking out the cellular contents. Only the plastids are retained by the sea slug in cells lining the digestive epithelium.

Rumpho et al. www.pnas.org/cgi/content/short/0804968105 9 of 13

Movie S2 (MOV)

Movie S2. Mature “solar-powered” sea slug Elysia chlorotica. An adult sea slug is observed feeding on the heterokont alga V. litorea. Algal chloroplasts areretained in the digestive epithelium in an endosymbiotic association yielding an emerald green “solar-powered” sea slug. The sea slug can sustain itself for itsentire life-span of about 10 months photoautotrophically requiring only light and air as a source of carbon dioxide. Adult animals range from about 1.5 to amaximum of 6 cm in length.

Rumpho et al. www.pnas.org/cgi/content/short/0804968105 10 of 13

Table S1. Complete listing of Vaucheria litorea chloroplast genes by category

Protein-encoding genes 139Photosynthesis

Photosystem I 10 psaA, psaB, psaC, psaD*, psaE, psaF, psaI, psaJ, psaL,psaM

Photosystem II 18 psbA, psbB, psbC, psbD, psbE, psbF, psbH, psbI, psbJ,psbK, psbL, psbN, psbT, psbV, psbX, psbY, psbZ, psb28

Chlorophyll biosynthesis 4 chlB‡, chlI, chlL‡, chlN‡

Cytochrome 9 petA, petB, petD, petF, petG, petJ§, petL, petM, petNATP synthase 8 atpA, atpB, atpD, atpE, atpF, atpG, atpH, atpIRubisco 3 rbcL, rbcS, cfxQ

Transcription/translation/replication

RNA polymerase 4 rpoA, rpoB, rpoC1, rpoC2Translation factors 2 tufA, tsf¶

Replication helicase 1 dnaBRibosomal proteins

Small subunits 18 rps1§, rps2, rps3, rps4, rps5, rps7, rps8, rps9, rps10, rps11,rps12, rps13, rps14, rps16, rps17, rps18, rps19, rps20

Large subunits 27 rpl1, rpl2, rpl3, rpl4, rpl5, rpl6, rpl9‡, rpl11, rpl12, rpl13,rpl14, rpl16, rpl18, rpl19, rpl20, rpl21†, rpl22, rpl23,rpl24, rpl27, rpl29, rpl31, rpl32, rpl33, rpl34, rpl35,rpl36

Miscellaneous proteinsMaintenance 4 clpC, dnaK, ftsH, groELTransport 5 secA, secY, sufB, sufC, tatCAmino acid biosynthesis 2 ilvB§, ilvH§

Other proteins 8 acpP�, acsF§, ccsA, ccs1, ftrC§, ycf17 (hlip§), thiG, thiSConserved ORFs 14 ycf3, ycf4, ycf12, ycf19‡, ycf33, ycf36§, ycf37‡, ycf39,

ycf41, ycf42, ycf54§, ycf60‡, ycf65†§, ycf66†

Unidentified ORFs 2RNA-encoding genes 35

Ribosomal RNAs 6 (3�2) rrl, rrs, rrfTransfer RNAs 29 trnA(ugc)X2, trnC(gca), trnD(guc), trnE(uuc), trnF(gaa),

trnfM(cau), trnG(gcc), trnG(ucc), trnH(gug), trnI(cau),trnI(gau)X2, trnK(uuu), trnL(uaa)**, trnL(uag),trnM(cau), trnN(guu), trnP(ugg), trnQ(uug), trnR(acg),trnR(ccg), trnR(ucu), trnS(gcu), trnS(uga), trnT(ugu),trnV(uac), trnW(cca), trnY(gua)

*Genes not found in Streptophyta or Chlorophyta chloroplast genomes are bold; those found in Chlorophyta but not embryophytes (land plants) aresingle-underlined.

†Gene found in streptophytes but not chlorophytes.‡Gene not found in other published heterokont chloroplast genomes (including Odontella sinensis, Phaeodactylum tricornutum, Thalassiosira pseudonana, andHeterosigma akashiwo).

§Gene found only in Heterosigma akashiwo.¶Gene found only in Phaeodactylum tricornutum.�Gene found in Odontella sinensis, Phaeodactylum tricornutum, and Heterosigma akashiwo but not in Thalassiosira pseudonana.**Gene-containing intron.

Rumpho et al. www.pnas.org/cgi/content/short/0804968105 11 of 13

Table S2. Primers for psbO*

Probe Product size Sequence (5� to 3�)

PCR and RT-PCRpsbO R 452bp RCC DCG KCC YTT SGG RTC MAG GAApsbO L2 ARG GGH WSH GGY YTB GCV AACpsbO L5 963bp GAA GGT CCC ATC TGC TTT GGT CpsbO R8 ATT CGC TCT CAA GCC TTC CAT AG

5� RACEpsbO Rev1 CCA CGT CCT TTG GGG TCA AGGGeneRacer RNA oligo (Invitrogen)

3� RACEpsbO For1 AAG GGA AGN GGT TTG GCC AAC AGOligo d(T) (Invitrogen)

Genome WalkingPsbO GW 3�-1 GGGGAGATTGGAGGAGTCTTTGTTTCGPsbO GW 3�-2 GGAGACACTGATATGGGCTCTAAAGTCCPsbO GW 3�-3 CACCTTGTACGGGATTGACGGCTCTTTCGPsbO GW 3�-4 GAAAGACGGGATTGATTATGCTGCCACTACAdapter Primer 1 GTAATACGACTCACTATAGGGCAdapter Primer 2 ACTATAGGGCACGCGTGGTGenome Walker AdapterT GTAATACGACTCACTATAGGGCACGCGTGGTC

GACGGCCCGGGCTGGTGenome Walker AdapterN (P)ACCAGCCC(L)

*All primers were synthesized by Integrated DNA Technologies, Inc. unless stated otherwise. L, forward primer, R, reverse primer.

Rumpho et al. www.pnas.org/cgi/content/short/0804968105 12 of 13

Table S3. Primer pairs for Elysia chlorotica mitochondrial genome*

Primer Primer sequence Gene amplified

A. Initial primersRrnL (6)† F: GAAAAAAGACGAGAAGACCC rrnL

R: GGGTCTTCTCGTCTTTTTTCCox1 (7) F: GGTCAACAAATCATAAAGATATTGG cox1

R: TAAACTTCAGGGTGACCAAAAAATCACob (8) F: TGTGGRGCNACYGTWATYACTAA cob

R: AANAGGAARTAYCAYTCNGGYTGB. Final primer

combinationsPrimer Primer sequence Regions amplifiedCobp3 TGTGGRGCNACYGTWATYACTAA Part of cob, coxII, ATP8, ATP6, rrnS, nad3, nad4, coxIII, nad2, part of coxICox1f1 GGTCAACAAATCATAAAGATATTGGCobp4 AANAGGAARTAYCAYTCNGGYTG Part of cob, nad4L, nad1, nad5, nad6, part of rrnL16SarL CGCCTGTTTAACAAAAACAT16SbrH CCGGTCTGAACTCAGATCACGT Part of rrnL, part of cox1Cox1f2 TAAACTTCAGGGTGACCAAAAAATCA

*All primers were synthesized by Integrated DNA Technologies, Inc.†Number in parentheses refers to supplementary reference number. F, forward primer, R, reverse primer.

Rumpho et al. www.pnas.org/cgi/content/short/0804968105 13 of 13