Supporting InformationFujii et al. 10.1073/pnas.1208651109SI Materials and MethodsHuman Biopsies and Animal Samples. Biopsy samples of humangastric mucosa with intestinal metaplasia were collected frompatients who underwent routine upper endoscopy. Humanstomach tissues without intestinal metaplasia were obtained frompatients who underwent upper endoscopy or gastrectomy. Cdx1-transgenic mice have been described previously (1). The stomachof Cdx1-transgenic mice (6 mo old, male) and control C57BL/6Jmice (6 mo old, male) were used.

Cell Culture and Transfection. Cells were transfected with plasmidsusing FuGene HD (Roche Applied Science) or Lipofectamine2000 reagent (Invitrogen) according to the manufacturer’s in-structions. MKN28 and AGS human gastric carcinoma cells werecultured in Roswell Park Memorial Institute (RPMI) 1640 me-dium containing 10% (vol/vol) FBS. GES-1 nontransformedhuman gastric epithelial cells were cultured in DMEM contain-ing 10% (vol/vol) FBS. MKN28-derived transfectant clones werecultured in RPMI 1640 medium supplement with 10% (vol/vol)FBS and 1 μg/mL doxycycline (Dox) (Clontech Laboratories).MKN28 (tet-off) cells, which are able to regulate the expressionof a target gene using the Tet-Off system (Clontech Laborato-ries), were established by transfecting pTet-Off (Clontech Lab-oratories) into MKN28 cells, and transfected cells were selectedby 0.5 mg/mL G418 (Clontech Laboratories). MKN28-A2 andMKN28-B5 cells, which inducibly express Flag-tagged CDX1 byremoval of Dox, were established by transfecting pTRE2hyg/Flag-CDX1 into MKN28 (tet-off) cells, and transfected cells wereselected by 0.1 mg/mL hygromycin (Sigma). MKN28-derived A2-KD/SK and B5-KD/SK cells, in which expression of both SALL4and KLF5 was suppressed by stable expression of specific shorthairpin RNAs (shRNAs), were established by cotransfectingpSUPER-shSALL4/2 and pSUPER-shKLF5/2 (see Plasmidsbelow for details) into MKN28-A2 and MKN28-B5 cells, re-spectively. MKN28-derived A2-KD/C and B5-KD/C cells, whichstably express the control luciferase-specific shRNA, were es-tablished by transfecting pSUPER-shLuc into MKN28-A2 andMKN28-B5 cells, respectively. Cells transfected with shRNAconstructs were selected by 1 μg/mL puromycin (Sigma).

Plasmids. A cDNA encoding human CDX1 was provided by JuanLucio Iovanna (Centre deRecherche INSERM,Marseille, France).Flag-tag sequence was introduced into the 5′ end of CDX1, and thefragment encoding Flag-CDX1 was inserted into pcDNA3 mam-malian expression vector (Invitrogen) or pTRE2hyg vector (Clon-tech Laboratories). Using genomic DNA extracted from AGS cells,SALL4 upstream region between −2115 and +44 from the tran-scription start site (TSS) was amplified by PCR with the forwardprimer, 5′-CTTAGAAACTGACCACCAGCTCAG-3′ and thereverse primer with an HindIII site (underlined), 5′-CCCAAGC-TTAGAGCCGCAGTTATTTGCCCTCTC-3′. The PCR productwas subcloned into upstream of luciferase gene of pGL3-basicvector (Promega) to make pGL3-SALL4(−2115). A series of de-letion constructs of the cloned SALL4 upstream region in pGL3vector were produced by using restriction enzyme digestion. Re-sulting plasmids containing EcoRI–HindIII (−1666 to +44), NcoI–HindIII (−938 to+44), and SacI–HindIII (−642 to+44) fragmentswere named pGL3-SALL4(−1666), pGL3-SALL4(−938), andpGL3-SALL4(−642), respectively. pGL3-SALL4(−1305), a pGL3-derived vector containing the region between −1305 and +44 ofSALL4 was made by PCR using the forward primer 5′-CTGCA-CAGTCCCTTACAATGAAGTAAATGC-3′ and the described

reverse primer. A plasmid containing the KLF5 upstream regionwas provided by Ichiro Manabe and Ryozo Nagai (The Universityof Tokyo, Tokyo, Japan). Luciferase reporter plasmids for KLF5were made by inserting the XbaI–NcoI fragment (−1908 to +328)of KLF5 into pGL3-basic vector. A series of deletion constructs forthe cloned KLF5 upstream region in pGL3 vector were producedby the use of the Deletion Kit for Kilo Sequencing (TaKaRa),according to the manufacturer’s instructions. Resulting plasmidscontaining the KLF5 regions −1659/+328, −1214/+328, −985/+328, and −696/+328 were denoted pGL3-KLF5(−1659), pGL3-KLF5(−1214), pGL3-KLF5(−985), and pGL3-KLF5(−696), re-spectively. Expression plasmids for SALL4-, KLF5-, and luciferase-specific shRNAs were made by introducing each of the followingtarget sequences into pSUPER vector (OligoEngine):

shSALL4/1: 5′-AGGTTCACTACATGACACACG-3′shSALL4/2: 5′-CAACATCCCTTCTGCCACC-3′shKLF5/1: 5′-GTATCTGACACCTCAGCTTCC-3shKLF5/2: 5′-GTCCAGATAGACAAGCAGAGA-3′shLuc: 5′-CTTACGCTGAGTACTTCGA-3′.

Antibodies. Anti-Flag monoclonal antibody (M2) (Sigma) wasused as a primary antibody for chromatin immunoprecipitation,immunoblotting, and immunofluorescence staining. Anti-SALL4polyclonal antibody (ab29112) (Abcam) and anti-BTEB2 (anti-KLF5) polyclonal antibody (A-16) (Santa Cruz Biotechnology)were used as primary antibodies for immunoblotting and im-munofluorescence staining. Anti-actin polyclonal antibody (C-11), anti-NFκB p65/RelA polyclonal antibody (H-286), anti-Sp1polyclonal antibody (PEP 2) (Santa Cruz Biotechnology), anti-CagA monoclonal antibody (Austral Biologicals), and anti-phospho–NF-κB p65 (Ser536) polyclonal antibody (93H1) (CellSignaling) were used as primary antibodies for immunoblotting.Anti-MUC2 monoclonal antibody (Ccp58), anti–GLP-1 poly-clonal antibody (C-17) (Santa Cruz Biotechnology), and anti-LYZ polyclonal antibody (Dako) were used as a primary anti-body for immunofluorescence staining. Normal mouse IgG waspurchased from Santa Cruz Biotechnology.

Helicobacter pylori Infection. H. pylori NCTC11637 strain and itsisogenic mutant ΔcagA have been reported previously (2). GES-1cells were infected with H. pylori at a multiplicity of infection of100 in DMEM supplemented with 10% (vol/vol) FBS. Afterinfection with H. pylori for 24 h, cells were resuspended in PBS/0.1% saponin (Sigma), which lyses mammalian cells but notbacterial cells. The protein extracts were then subjected to im-munoblotting, as described (3).

Expression Microarray Analysis. Expression microarray analysiswas performed using GeneChip Human Genome U133 Plus 2.0Array (Affymetrix), as described (4). Using TRIzol Reagent(Invitrogen) according to the manufacturer’s instructions, totalRNAs were extracted from MKN28-A2 and MKN28 (tet-off)cells cultured with or without Dox for 24 h. The experimentalprocedures for GeneChip were performed according to the Af-fymetrix GeneChip expression analysis technical manual. Briefly,total RNA was used to synthesize biotin-labeled cRNA, whichwas then hybridized to the array. After washing, the arrays werestained with streptavidin-phycoerythrin and analyzed on an Af-fymetrix scanner to collect the image data. Microarray Suitesoftware 5.0 (Affymetrix) was used to calculate the average dif-ference (AD) for each gene probe set, which was shown as the

Fujii et al. www.pnas.org/cgi/content/short/1208651109 1 of 6

gene expression intensity value. The AD values were normalizedfor each array so that the average of all AD values was 100. Agene was determined to be an “increased gene” if its expressionlevel was increased by more than or equal to twofold with thechange P value less than 0.002 and the detection P value lessthan 0.04. A gene was determined to be a “decreased gene” if itsexpression level was decreased to below half with the change Pvalue more than 0.998 and the detection P value less than 0.04.

Chromatin Immunoprecipitation (ChIP). MKN28-A2 cells were cul-tured in the absence of Dox for 24 h. AGS and GES-1 cellstransiently transfected with a Flag-CDX1 vector were cultured for24 h. Cells were subjected to fix with 1% formaldehyde for 10 minat room temperature with swirling. Glycine was added to a finalconcentration of 0.2 M and the incubation was continued for anadditional 5 min. Cells were then washed twice with ice-cold PBS,harvested by scraping, pelleted, and resuspended in SDS lysisbuffer [10 mM Tris·HCl (pH 8.0), 150 mM NaCl, 1% SDS, 1 mMEDTA]. Samples were sonicated with Branson Sonifier 450 for 5cycles of 1 min (60% duty, output control 1) with an interval of1 min. Then, samples were centrifuged at 13,000 × g for 10 min at4 °C and diluted fivefold in ChIP dilution buffer [20 mMTris·HCl (pH 8.0), 150 mM NaCl, 1 mM EDTA, 1% Triton X-100, and protease inhibitors]. After removal of a control aliquot(input DNA), samples were incubated at 4 °C overnight withprotein G sepharose beads that had been incubated overnightwith anti-Flag antibody or normal mouse IgG, and then washedtwice with ChIP dilution buffer, once with wash buffer 1 [20 mMTris·HCl (pH 8.0), 500 mM NaCl, 2 mM EDTA, 1% Triton X-100, 0.1% SDS, 1 mM phenylmethylsulfonyl fluoride], once withwash buffer 2 [10 mM Tris·HCl (pH 8.0), 1 mM EDTA, 0.25 MLiCl, 0.5% Na-Deoxycholate, 0.5% Nonidet P-40, 1 mM phe-nylmethylsulfonyl fluoride], and three times with TE buffer (pH8.0). After being washed, the immunoprecipitated samples wereeluted from the beads by heating for 30 min at 65 °C in elutionbuffer [50 mM Tris·HCl (pH 8.0), 10 mM EDTA, 1% SDS]. Thecross-links were then reversed by incubation with Proteinase Kfor 2 h at 42 °C followed by heating at 65 °C overnight. The DNAsamples were further purified by phenol-chloroform extractionand ethanol precipitation.

ChIP-Chip Analysis. ChIP-chip analysis was performed usingGeneChip Human Promoter 1.0R Array (Affymetrix), as de-scribed (4). ChIP and control input DNA samples prepared fromMKN28-A2 cells with Flag-CDX1 induction for 24 h were am-plified by two cycle in vitro transcription (IVT) method. The firstcycle of IVT was performed as described previously (5). Theamplified RNA was converted into single-strand cDNA withRandom Primers (Invitrogen), annealed with T7 primer followedby second-strand cDNAs synthesis, and then samples amplifiedagain by IVT using the T7 Megascript kit (Ambion) according tothe manufacture’s instructions. A second amplified RNA wasconverted into double-strand cDNA with Random Primers,fragmented with DNase I, and end labeled with biotin-11–ddATP as described previously (6). ChIP and control inputsamples were hybridized on the separate array according to themanufacture’s instructions. After scanning and data extraction,enrichment values (ChIP/control input DNA) were calculatedwith the algorithm, Model-based Analysis of Tiling-arrays (MAT),as described previously (7). A P value cutoff of 1e-3 was used. Agene was determined to be a “bound gene” if CDX1 bound to thegenome sequence between −10 kb and +2.5 kb from the TSS orwithin first intron of its gene.

Reverse Transcription. Total RNAs were extracted using TRIzolReagent (Invitrogen). cDNAs were generated by SuperScript II

reverse transcriptase (Invitrogen) with Random Primers (Invi-trogen) according to the manufacturer’s instructions.

Semiquantitative PCR Analysis. cDNA or ChIP DNA samples wereanalyzed by PCR using TaKaRa Ex Taq followed by agarose gelelectrophoresis. GAPDH (human) or Hprt1 (mice) was used asan internal control. Primers are shown in Table S2.

Quantitative PCR Analysis. cDNA samples were analyzed by PCRusing SYBR Premix Ex Taq (Perfect Real Time) (TaKaRa). Datawere acquired using StepOnePlus Real-Time PCR System(Applied Biosystems). Amplification data were quantified by thestandard curve method. In all quantitative PCR analysis,GAPDH(human) or Hprt1 (mice) was used to normalize input. Primersare shown in Table S2.

Immunoblotting. Cells were harvested and lysed at 24 h after in-duction or transfection in Lysis buffer T [50 mM Tris·HCl (pH7.5), 100 mM NaCl, 5 mM EDTA, 1% Triton X-100, 10% (vol/vol) glycerol, 2 mM Na3VO4, 10 mM NaF, 10 mM β-glycer-ophosphate, 10 μg/mL aprotinin, 10 μg/mL leupeptin, 10 μg/mLtrypsin inhibitor and 2 mM phenylmethylsulfonyl fluoride]. Totalcell lysates were subjected to SDS/PAGE. Proteins were trans-ferred to polyvinylidene difluoride membrane filter (Millipore).The membrane filters were incubated with primary antibodiesand then treated with antirabbit IgG or antimouse IgG (GEHealthcare) or antigoat IgG (Santa Cruz Biotechnology) HRP-conjugated secondary antibodies. Proteins were visualized usingWestern blot chemiluminescence reagent (Perkin-Elmer LifeScience). ACTIN was used as a protein-loading control.

Immunofluorescence Staining. Cells were seeded into an eight-wellchamber slide (Lab-Tek), and were cultured for the indicatedtime periods after induction or transfection. Cells were fixed withMildform 10N (Wako) for 15 min and then permeabilized with0.25% Triton X-100 for 10 min. The fixed samples were thentreated with primary antibodies and were visualized with AlexaFluor-conjugated secondary antibodies (Invitrogen). Nuclei werevisualized by 4′,6-diamidino-2-phenyl-indole dihydrochloriden-hydrate (DAPI) staining. Images were acquired using confocalmicroscope systems (Fluoview, Olympus; TCS-SPE, Leica).

Luciferase Reporter Assay. Cells transiently transfected with thereporter plasmids together with a Flag-CDX1 or control vectorwere cultured for 12 h. Luciferase activities were measured usingthe dual luciferase reporter assay system (Promega) according tothe manufacturer’s instructions. Luciferase activity was normal-ized by the pRL-TK luciferase activity.

Distribution of Binding Sites. Distribution of CDX1-binding siteswas identified using the program, Cis-Regulatory Element An-notation System (CEAS) (http://ceas.cbi.pku.edu.cn/index.html)(8). CDX1 binding positions identified by ChIP-chip were liftedto National Center for Biotechnology Information 36 (NCBI36)coordinates using the program Lift Genome Annotations (http://genome.ucsc.edu/cgi-bin/hgLiftOver) and were then inputted.

De Novo Motif Search. In vivo CDX1 binding motifs were identifiedusing the program, Motif Discovery Scan (MDscan) (http://ai.stanford.edu/∼xsliu/MDscan/) (9). The identified sequences ofthe 166 CDX1-target genes by ChIP-chip analysis were arrangedaccording to the P value in the ChIP-chip analysis and were theninputted. Human 5000bp upstream was selected as backgroundmodel. Motif width was set to 7, number of top sequences was setto 9, and number of candidate motifs for the rest of the sequenceswas set to 20. Representative matrix data were shown using theprogram, WebLogo (http://weblogo.berkeley.edu/) (10).

Fujii et al. www.pnas.org/cgi/content/short/1208651109 2 of 6

1. Mutoh H, et al. (2004) Cdx1 induced intestinal metaplasia in the transgenic mousestomach: Comparative study with Cdx2 transgenic mice. Gut 53(10):1416–1423.

2. Higashi H, et al. (2004) Helicobacter pylori CagA induces Ras-independent mor-phogenetic response through SHP-2 recruitment and activation. J Biol Chem 279(17):17205–17216.

3. Murata-Kamiya N, Kikuchi K, Hayashi T, Higashi H, Hatakeyama M (2010) Helicobacterpylori exploits host membrane phosphatidylserine for delivery, localization, and patho-physiological action of the CagA oncoprotein. Cell Host Microbe 7(5):399–411.

4. Kaneshiro K, Tsutsumi S, Tsuji S, Shirahige K, Aburatani H (2007) An integrated mapof p53-binding sites and histone modification in the human ENCODE regions.Genomics 89(2):178–188.

5. Liu CL, Schreiber SL, Bernstein BE (2003) Development and validation of a T7 basedlinear amplification for genomic DNA. BMC Genomics 4(1):19.

6. Kapranov P, et al. (2002) Large-scale transcriptional activity in chromosomes 21 and22. Science 296(5569):916–919.

7. Johnson WE, et al. (2006) Model-based analysis of tiling-arrays for ChIP-chip. Proc NatlAcad Sci USA 103(33):12457–12462.

8. Ji X, Li W, Song J, Wei L, Liu XS (2006) CEAS: cis-regulatory element annotationsystem. Nucleic Acids Res 34(Web Server issue):W551-4.

9. Liu XS, Brutlag DL, Liu JS (2002) An algorithm for finding protein-DNA binding siteswith applications to chromatin-immunoprecipitation microarray experiments. NatBiotechnol 20(8):835–839.

10. Crooks GE, Hon G, Chandonia JM, Brenner SE (2004) WebLogo: A sequence logogenerator. Genome Res 14(6):1188–1190.

Fig. S1. (A) Strategy to identify direct transcriptional targets of CDX1. (B) Distribution of CDX1-binding sites in genomic regions. (C) ChIP-chip signals at theCDH17 and KRT20 loci are shown as positive controls. Red lines represent putative CDX1-binding regions (Upper). ChIP-chip signals at the HBQ1, HBA1, HBA2,and HBM loci are shown as negative controls (Lower). (D) De novo determination of the sequence preferentially recognized by CDX1 in gastric epithelial cells.

Fujii et al. www.pnas.org/cgi/content/short/1208651109 3 of 6

Fig. S2. Sequence alignments of the upstream regions between human SALL4 and mouse Sall4 (Upper) and between human KLF5 and mouse Klf5 (Lower).The numbers indicate the distance from the transcription start site (+1) of human SALL4 or KLF5 gene. Yellow boxes represent CDX-binding core motifs, TTTAT,which are conserved between the human and mouse sequences. Evolutionarily nonconserved CDX-binding core motifs are shown by open boxes.

Fujii et al. www.pnas.org/cgi/content/short/1208651109 4 of 6

Fig. S3. GES-1 cells transfected with the indicated reporter plasmids together with a CDX1 or control vector were subjected to luciferase reporter assay.Schematic diagrams represent SALL4 (Left) or KLF5 (Right) upstream regions. Numbers indicate the distance from the transcription start site (+1) of each gene.Red lines indicate the CDX1-binding regions identified in Fig. 3A and yellow boxes represent putative CDX1-binding sites containing the TTTAT core motif.Error bars, ± SD; n = 3. **P < 0.01.

Fig. S4. (A and B) Anti-LYZ (lysozyme; Paneth cell marker) (A) or anti–GLP-1 (glucagon-like peptide 1; intestinal enteroendocrine cell marker) (B) immuno-fluorescence staining of MKN28-A2 and MKN28-B5 cells with or without CDX1 induction for 5 d. (Scale bars, 10 μm.)

Fig. S5. Effect of CDX1 or SALL4/KLF5 on the expression levels of NF-κB and Sp1. MKN28-derived SALL4/KLF5 double-knockdown (A2-KD/SK) or control-knockdown (A2-KD/C) cells were induced to express CDX1 by depletion of Dox for 24 h. Cell lysates were then prepared and subjected to immunoblotting withthe respective antibodies. The phospho-p65/RelA antibody specifically recognizes the activated form of the NF-κB p65/RelA subunit.

Table S1. Changes in the expression of intestinal-stemness marker genes upon induction of CDX1 in MKN28-A2 cells

Public ID Gene Symbol Change in expression level, log2 ratio Affymetrix ID

Hs.658889 leucine-rich repeat-containing G protein-coupled receptor 5 LGR5 8.3 213880_at5.2 210393_at

Hs.559736 olfactomedin 4 OLFM4 3.1 212768_s_atHs.507755 doublecortin-like kinase 1 DCAMKL1 2.4 229800_at

1.1 205399_atHs.158311 musashi homolog 1 (Drosophila) MSI1 1.0 206333_atHs.496613 BMI1 polycomb ring finger oncogene BMI1 0.4 202265_at

Expression levels of mRNAs were determined by expression microarray analysis. The change in expression level is indicated as log2 ratio of the fold change vs.the expression level of CDX1-uninduced MKN28-A2 cells.

Fujii et al. www.pnas.org/cgi/content/short/1208651109 5 of 6

Table S2. Primers for semiquantitative RT-PCR, RT-qPCR, and ChIP-PCR analyses used in this study

Primer name Forward (5′ to 3′) Reverse (5′ to 3′)

SALL4 TCGTCTGCTAGCGCTCTTCAGATC CGGCGGGCTGAGTTATTGTTCG

KLF5 TAACCCCGATTTGGAGAAAC TGGCTTTTCACCAGTGTGAG

CDX1 GTGGCAGCGGTAAGACTC GTTCACTTTGCGCTCCTTTGC

VIL1 CTTCAAGTGGAGTAACACCAAATCC CTGTTAGCATTGAACACGTCCAC

MUC2 GAGTGCGACTGCTACTGCAC GTGGTAGTTGTCGATGTAAACTCC

MUC5AC CTTCTCAACGTTTGACGGGAAGC CTTGATCACCACCACCGTCTG

GATA6 GACTCCAACTTCCACCTCTTCTAAC GTTCTCGGGATTGGTGCTCTC

FST GTGCCTGCCACCTGAGAAAG CGGCCTCTCCCAACCTTGAAATC

LGR5 CATCCCTAATAAAGCTGGACCTATC GCTCTGTAAGGCATGATTTCCTG

BMI1 TGGCTCTAATGAAGATAGAGG TTCCGATCCAATCTGTTCTG

SI CAACGTGGCTGTGTATGGAG ACCCATGGATGAATAGCGAG

MME CAGCAACTTGGAGACGTTGTGC GCATCCATCCAAGTGAGGTCATC

VIP GCTCCTTGTGCTCCTGACTC TTCATTTGCTCCCTCAAAGG

GAPDH CCTCAACTACATGGTTTACATGTTCC GAAGATGGTGATGGGATTTCCATTG

Mouse Sall4 AAGCAGCACTGCTGCACACG GGCCCCATGAGTCATGTAGTG

Mouse Klf5 CTCTCCCACCTGTCAGATAC CAGGTGAGCTTTTAAGTGAGACG

Mouse Cdx1 GGAAATCAGAGCTGGCTGCCAAT GGCTGTTGCTGCTGCTGTTTC

Mouse Hprt1 CTGGTGAAAAGGACCTCTCG TGAAGTACTCATTATAGTCAAGGGCA

5′-Upstream region of SALL4 CTGCACAGTCCCTTACAATGAAGTAAATGC GATTGTATCATTGACACATGATGCCTGGA

5′-Upstream region of KLF5 GGAAAAGGAGAAAAACCCAGTTTACAGC CCACAGCCTATTCATCACTTCAGAG

Negative control TGTACAAAGCTTGTGCCCAG GTCATACGAAGCCCTTCCAG

Other Supporting Information Files

Dataset S1 (XLS)Dataset S2 (XLS)

Fujii et al. www.pnas.org/cgi/content/short/1208651109 6 of 6