1

Supplementary Figures

Fig. S1. Electron density of malonic acid observed in the active site pocket of CURS1. Each panel is a wall-eye stereo view. Malonic acids with chain A (A), chain B

(B), chain C (C), and chain D (D) are shown. Superimposition of them is also shown

(E). Malonic acids observed in chain A, chain B, chain C, and chain D are depicted by

green, light blue, magenta, and light yellow sticks, respectively (E). The sulfur atom of

the catalytic Cys-164 (shown in yellow) is located at the left side of these malonic acids.

The simulated annealing composite omit map was built by using CNS (26).

2

Fig. S2. pH dependence of the curcuminoid formation catalyzed by CURS1. The

standard reaction mixture contained 100 mM potassium phosphate buffer (pH 6.0–9.0), 100 µM feruloyl-CoA, 100 µM 5-(4-hydroxy-3-methoxy- phenyl)-3-oxo-4-pentenoic

acid, and 0.2 µg of the recombinant CURS1 protein (wild-type or H303Q mutant) in a total volume of 100 µL. After preincubation of the reaction mixture without substrates

at 37°C for 2 min, reaction was started by adding both starter and extender substrates. The reaction was incubated for 5 min and quenched by adding 20 µL of 6 M HCl. The

reaction mixture was extracted with ethylacetate and the organic layer was evaporated to dryness. The residual materials were dissolved in 40 µL dimethylsulfoxide and

analyzed using a high-performance liquid chromatography (HPLC) system (Waters,

Massachusetts, USA) equipped with a Docosil-B reverse-phase HPLC column (4.6×250

mm; Senshu Scientific). The samples were eluted with linear acetonitrile gradient

(10–100% in 30 min) in water containing 0.1% trifluoroacetic acid at a flow rate of 1.0

mL/min.

3

Fig. S3. Benzalacetone formation by the decarboxylation of β-keto acid by CURS1.

The standard reaction mixture contained 100 mM potassium phosphate buffer (pH 7.5), 100 µM 3-oxo-5-phenyl-4-pentenoic acid, and the recombinant CURS1 protein (4.0 µg,

native and boiled) in a total volume of 100 µL. The reaction was continued at 37°C for

1 h and quenched by putting the sample on ice. The reaction mixture was extracted with

chilled ethylacetate and the organic solvent was evaporated to dryness. The residual

materials were dissolved in methanol and analyzed using an HPLC system (Waters)

equipped with a Docosil-B reverse phase HPLC column (4.6×250 mm; Senshu

Scientific). The samples were eluted with linear acetonitrile gradient (5–5% in 5 min,

5–40% in 35 min, 40–80% in 5 min) in water containing 25 mM CH3COONH4 at a flow rate of 1.0 mL/min. The relative amounts of β-keto acid that remained (A) and

benzalacetone produced (B) were estimated by integrating their peaks. Absorbance units

at 330 nm were used for the detection. When the boiled enzyme was used, a larger amount of β-keto acid remained in the reaction buffer (A) and a smaller amount of

benzalacetone was produced (B), compared with the result when the native enzyme was used. Benzalacetone formation was observed even when the β-keto acid was incubated

with the denatured CURS1, because the β-keto acid is non-enzymatically

decarboxylated at room temperature.

4

Fig S4. Generation of a covalent bond between CURS1 and feruloyl-CoA. Recombinant CURS1 protein (20 µg) was incubated with feruloyl-CoA (500 µM) in

100 mM potassium phosphate buffer (pH 8.0) in a total volume of 50 µL at 37°C for 1 h.

The reaction mixture was directly analyzed using an HPLC system (Waters) equipped

with a Protein-R reverse-phase HPLC column (4.6×250 mm) (Nacalai Tesque, Kyoto,

Japan) and eluted with a linear acetonitrile gradient (2–2% in 5 min, 2–40% in 5 min,

40–60% in 30 min) in water containing 0.1% trifluoroacetic acid at a flow rate of 1.0

mL/min. The UV chromatogram (A) and UV spectra of peaks a (B) and b (C) are

shown. Peak b was generated only when CURS1 was incubated with feruloyl-CoA. The

UV spectrum of peak b is highly similar to that of the recombinant CURS1 protein

(peak a), but it possesses another absorbance peak at 350 nm derived from the feruloyl

moiety. Proteins included in peaks a and b were confirmed to be the recombinant

CURS1 protein by sodium dodecyl sulfate-polyacrylamide gel electrophoresis.

5

Fig. S5. Extender substrate specificity of CURS1. The standard reaction mixture contained 100 µM feruloyl-CoA, 100 µM extender substrate

(dihydrocinnamoyldiketide-NAC, 3-oxooctanoyl-NAC, 3-oxopalmitoyl-NAC,

acetoacetyl-CoA, acetoacetic acid, or 3-oxovaleric acid), 100 mM potassium phosphate buffer (pH 8.0), and the recombinant CURS1 protein (4.0 µg) in a total volume of 100

µL. Reactions were incubated at 37ºC for 1 h. The reaction was quenched by adding 20

µL of 6 M HCl and extracted with ethylacetate. The organic layer was evaporated to

dryness and the residual materials were dissolved in dimethylsulfoxide for LC-MS/MS

analysis. LC-APCIMS analysis was performed using the Esquire HCT system (Bruker

Daltonics, Bremen, Germany) equipped with a Pegasil-B C4 reversed-phase HPLC

column (4.6×250 mm; Senshu Scientific, Tokyo, Japan) and eluted with a linear

acetonitrile gradient (10–100% in 45 min) in water containing 0.1% acetic acid at a flow

rate of 1.0 mL/min.

6

Fig. S6. Location of the β-keto acid in the modeling structure of CURS1 that binds to the β-keto acid and a feruloyl moiety. The β-keto acid is indicated by magenta

sticks. The malonic acid that was actually observed in the crystal structure of CURS1

(chain A) is depicted by green sticks.

7

Supplementary Tables Table S1. Data collection statistics.

Data collection CURS1 WT CURS1 G211F

Space group P21 21 21 P212121

Unit cell dimension

a 77.21 76.7

b 115.75 116.36

c 221.27 221.24

α 90 90

β 90 90

γ 90 90

resolution (Å) 20-2.32 (2.36-2.32) Å 20-2.50 (2.56-2.50)

wavelength 1.0 Å 1.0 Å

I/σI 8.35 (2.59) 19.40 (4.65)

Redundancy 2.91 (2.93) 13.81 (2.42)

Completeness 99.8 98.2 (97.9)

Rsym (%) 9.8 (42.1) 12.6 (83.3)

Refinement

resolution (Å) 20-2.32 20-2.5

number of reflections 82,095 64650

Rwork/Rfree 18.6/23.5 19.2/24.7

Number of atoms

protein 12153 12160

solvent 890 335

Average B value

protein 27.9 37.3

solvent 37.8 43.7

r. m. s. deviations

bond length (Å) 0.011 0.014

bond angles (˚) 1.287 1.45

8

Table S2. Primer used for the construction of CURS1 mutants. The bold face letters

indicate the mutation generated. Primer name Sequence of primer

CURS1A211F_F TTCCAGGCCGGCTTCGGCGACGG

CURS1A211F_R CGCGAGCGCCTCGAAGTCGCC

CURS1A211W_F TGGCAGGCCGGCTTCGGCGACGG

CURS1A211W_R CGCGAGCGCCTCGAAGTCGCC

CURS1H336A_F GCCCCGGGCAACTGGGCCATCATT

CURS1H336A_R CGCCACCCAGAAGACGTCGTTC

CURS1H336Q_F CAACCGGGCAACTGGGCCATCATT

CURS1C164S_F CCCACATGGGCGCCGCCATGC

CURS1C164S_R AGGCCTGGCTGTAGATCATG

Supplementary Reference 26. Brunger, A. T, Adams, P. D., Clore, G. M., DeLano, W. L., Gros, P,

Grosse-Kunstleve, R. W., Jiang, J. S., Kuszewski, J., Nilges, M., Pannu, N. S.,

Read, R. J., Rice, L. M., Simonson, T., Warren, G. L. (1998) Acta Crystallogr. D Biol. Crystallogr. 54, 905-921.