Page 1

Supplementary Note: Detailed information

Natural variation in a homolog of Antirrhinum CENTRORADIALIS contributed to spring

growth habit and environmental adaptation in cultivated barley

Jordi Comadran1*

, Benjamin Kilian2*

, Joanne Russell1, Luke Ramsay

1, Nils Stein

2, Martin

Ganal3, Paul Shaw

1, Micha Bayer

1, William Thomas

1, David Marshall

1, Pete Hedley

1,

Alessandro Tondelli4, Nicola Pecchioni

5, Enrico Francia

5, Viktor Korzun

6, Alexander

Walther7and Robbie Waugh

1**

The Supplementary information has been arranged into the following sections.

1. Supplementary note ……………………………………………………………...(page 3)

1.1.Development of the 9K iSelect platform ……………………………………(page 3)

1.2.Determination of marker order by linkage mapping Morex x Barke derived

RILs……………………………………………………………………………(page 6)

1.3.Divergent selection and known loci............................................................... (page 7)

1.4.QTL mapping of flowering time in the Nure x Tremois (NT) population...(page 8)

1.5.Expression analysis of HvCEN in Nure and Tremois................................. (page 10)

1.6.Diversity analysis........................................................................................... (page 11)

2. Supplementary Figures ...................................................................................... (page 15)

Supplementary Figure 1: Multi-environment QTL scan of the time to flowering.

Supplementary Figure 2: Expression of barley HvCEN and VRN-H1 genes (HvBM5A).

Supplementary Figure 3: MJ network derived from resequenced DNA haplotypes and

conservation of synteny searches in sequenced model grass genomes among Triticeae

species.

Supplementary Figure 4: Pleiotropic effects of MAT-C mutant alleles on (a) height (in

millimetres) and (b) grains per ear.

Supplementary Figure 5: GIS-based topographic maps of Ala-135 and Pro-135

containing haplotypes.

3. Supplementary Tables......................................................................................... (page 20)

Supplementary Table 1. Read numbers and read lengths for all samples used.

Supplementary Table 2. GigaBayes parameter values used in the primary SNP

detection run.

Supplementary Table 3. Breakdown of failure categories.

Supplementary Table 4. Numbers of SNPs during the incremental filtering procedure.

Supplementary Table 5. Validation rates for the Illumina read mappings.

Supplementary Table 6: Barley 9K iSelect marker platform (Separate Excel File).

Supplementary Table 7: Germplasm used for Divergent selection.

Page 2

Supplementary Table 8 Regions under strong divergent selection.

Supplementary Table 9 Analyses of variance for Days to Heading (DtH), Grain yield

(Yield) and Thousand grain weight (Tgw) traits

Supplementary Table 10: Characterisation of putative mat-c mutants

Supplementary Table 11: Geo-referenced wild, landrace and cultivated lines (Separate

Excel File)

Supplementary Table 12: Haplotypes observed in germplasm surveyed......(page X)

Supplementary Table 13 Nucleic state at alignment position 531 (P135A: Pro-135/Ala-

135) for Triticeae species ......(page X)

Page 3

1. Supplementary note:

1.1. Development of the 9K iSelect platform

Barley material and RNA extraction

Seeds were germinated from each of 10 barley varieties (Barke, Betzes, Bowman, Derkado,

Intro, Morex, Optic, Quench, Sergeant and Tocada) on filter paper moistened with sterile

water in petri dishes. Following 4 days incubation in the dark at 20oC, developing radicle (c.

10-20 mm) and embryo tissues were dissected and flash frozen in liquid nitrogen. Total RNA

was extracted from c. 200 mg mixed tissue from each genotype using 2 ml TriReagent

(Sigma) as recommended, with two additional phenol-chloroform purification steps. RNAs

were quality checked using the RNA 6000 Nano kit as instructed on a 2100 Bioanalyzer

(Agilent), with all RNA samples having an RNA Integrity Number (RIN) >8.

Transcriptome sequencing

Total RNA samples were submitted to The Sir Henry Wellcome Functional Genomics

Facility, University of Glasgow, for RNA-seq processing using standard recommended

Illumina GAII procedures. For each sample, one lane of Single-End 54 nt or 76 nt RNA-seq

was performed, generating between c. 6M and 27M reads respectively (Supplementary Table

1).

Read preparation

The raw Illumina reads were obtained in two separate sequencing runs carried out more than

a year apart, and as a result reads obtained in the earlier run were significantly shorter (54 nt)

than those from the latter run (76 nt) as Illumina read lengths continue to increase

significantly. All raw reads were quality trimmed to a quality score (phred equivalent) of 20

or greater. This removes stretches of sequence from either read end where the base qualities

are consistently below the threshold. Read numbers and read lengths are detailed in

Supplementary Table 1. This step significantly reduces the risk of obtaining false positives

during SNP discovery.

Read mapping

The trimmed reads were mapped to the Harvest 35 unigene sequences (http://www.harvest-

web.org/hweb/bin/wc.dll?hwebProcess~hmain~&versid=5) using the Mosaik read mapping

tool (http://bioinformatics.bc.edu/marthlab/Mosaik) using a separate run for each sample.

Due to the varying length of the trimmed reads a mismatch percentage was used (2%

mismatches allowed). The mapping was carried out using the “-m unique” parameter setting

which causes reads to be discarded that could be mapped to more than one location in the

reference sequence. The SNP sequences from BOPA 1 and 2 (Close et al. 2009) were also

mapped to the Harvest35 unigenes using the same parameters.

The Illumina reads mapped to 41,484 out of a total of 50,938 unigenes (81.4%). 112,721,213

out of a total of 191,210,425 reads were mapped successfully to the reference sequences

(58.9%). 2,079 of the BOPA manifest sequences mapped to unigenes in the Harvest 35

assembly, which represents only 67.6% of the total of 3,072 BOPA manifests. The shortfall is

Page 4

likely due to the fact that the BOPA SNPs were designed using a previous version of the

Harvest assembly (Harvest 21).

All the individual mappings were then merged using the MosaikMerge utility, and the

resulting file was used for SNP discovery as well as for generating sam and bam files.

SNP discovery

The initial round of SNP discovery was carried out using the GigaBayes tool

(http://bioinformatics.bc.edu/marthlab/GigaBayes). The parameter values used for this are

listed in Supplementary Table 2. A deliberately relaxed set of parameters was used which

captures a wide range of putative SNPs but also detects a large number of false positives.

This was followed by a second round of filtering with custom written code because there is

significant variation of read coverage between and within unigenes (due to the nature of the

transcriptome data), and therefore a simple filter based on absolute numbers such as that used

by GigaBayes is inadequate for eliminating a sufficient number of false positives.

We then extracted SNP manifest sequences from the full set of SNPs from the GigaBayes run

(n = 240,119), which contained IUPAC ambiguity codes for any neighbouring SNPs in the

extracted flanking regions. These were submitted to the Illumina Assay Design Tool (ADT)

in order to assess the suitability of the SNPs for the assay.

Out of the total of 240,119 SNPs submitted, 92,063 passed the ADT run and out of these

76,831 had a final design score of >= 0.6 (Illumina‟s recommended threshold for high-

confidence design). A large number of SNPs failed (n = 148,056, 61.6% of the total), mostly

because of the presence of other SNPs in the flanking regions (Supplementary Table 3). This

is likely a consequence of the full, unfiltered set containing numerous false positives.

SNP filtering

The initial set of SNPs discovered by the GigaBayes tool was then filtered further

(Supplementary Table 4). First, all SNPs with a final design score of less than 0.6 were

removed, leaving 76,831 of 240,119. Then, all SNPs on unigenes that contained BOPA SNPs

were removed to maximize the unigene coverage of the whole SNP set.

This left 64,474 SNPs which were then filtered further to remove SNPs containing reads from

apparently heterozygous samples. The samples used were assumed to come from completely

homozygous individuals, so any observed heterozygosity should be attributable to one or

more of the following:

Mismapped regions where two different overlapping sets of reads have been mapped,

one of which has been assigned to the wrong location

Cases where misassembly seems to have taken place due to the Harvest 35 unigene

itself having been misassembled (chimaerism)

Cases where there are very few reads of the minor allele of the sample, suggesting

read errors

To separate “genuine” heterozygotes from those caused by read errors we extracted for each

SNP a statistic which we refer to as the “heterozygosity index” here. This is the maximum

Page 5

value observed in any one sample x SNP combination (within a SNP) of the proportion of its

minor allele count relative to its total allele count. This has the effect of removing SNPs

featuring heterozygote samples where the allele proportion indicates misassembly, whilst

retaining SNPs with homozygous samples only, as well as SNPs where sample

heterozygosity is due to a small proportion of presumed read errors. The value used for this

was 0.01 (1%) or less, which is approximately the same as the published error rate for

Illumina sequencing.

A combination of sorting and filtering was then used to obtain the final shortlist of SNPs.

This consisted of the following steps:

1. Filter by the number of samples which had the genotype of the minor allele at the

SNP location, using a cutoff of >=2.

2. Sort the data by unigene name (ascending), then, in descending order, by minimum

number - out of all samples in a SNP - of reads that were counted towards the actual

genotype of the sample, i.e. in homozygous samples the major (and only) allele count

and in heterozygous samples the minor allele count (here referred to as “minimum

read replication”)

3. Remove duplicates so that only a single SNP remains per unigene. This left 7,905

SNPs.

4. Sort the remaining SNPs again, first by the number of reads that were counted

towards the actual genotype of the sample as above (descending), then by the minor

allele frequency (descending). This puts the most robust SNPs topmost.

5. Select the top SNPs from this list.

This approach is a compromise between sample diversity in a SNP and robustness of support

for the SNP, with sample diversity being given a relatively greater weight.

The 5,010 topmost SNPS were selected from this final sorted list for inclusion on the chip. In

addition, a set of 2,832 SNPs used for the existing BOPA (Barley Oligo Pooled Assay) on the

Illumina Golden Gate genotyping platform was included together with 22 SNPs from

resequencing studies, giving a total of 7,864 SNP assays on the chip.

Validation of Illumina mappings

Mappings were initially inspected visually using the Tablet assembly viewer (Milne et al

2010). To ascertain the validity of the Illumina read mappings the SNP discovery was based

on, custom written code was used to compare genotype calls extracted from the Illumina read

mappings at the BOPA SNP positions with existing genotype data for the same samples

obtained with the Illumina Golden Gate genotyping assay.

To harmonize the SNP filtering protocol and the validation procedure the code was

parameterized with two of the critical parameters also used in filtering – the heterozygosity

index and the minimum read replication (see above). When the code was executed with

values of 0.01 and 1 for these parameters, respectively, validation rates were in the region of

approx. 93-95% (Supplementary Table 5). When the minimum read replication value was

Page 6

increased to 2 and 3, the average validation rates increase to approx. 97% and 98%,

respectively.

It appears that the incorrectly called instances of SNP x sample combinations are mainly due

to heterozygotes that have not been filtered out (because the cutoff of 1% cannot complete

filter out all instances of heterozygotes caused by read errors), and to a lesser extent cases

where read coverage is low.

All markers, including their locations according to the Morex x Barke map are included in the

„Supplementary Table 6‟.

References

Close T, Bhat P, Lonardi S, Wu Y, Rostoks N, Ramsay L, Druka A, Stein N, Svensson J,

Wanamaker S, Bozdag S, Roose M, Moscou M, Chao S, Varshney R, Szucs P, Sato K, Hayes

P, Matthews D, Kleinhofs A, Muehlbauer G, DeYoung J, Marshall D, Madishetty K, Fenton

R, Condamine P, Graner A, Waugh R (2009) Development and implementation of high-

throughput SNP genotyping in barley. BMC Genomics 10:582

Milne, I., Bayer, M., Cardle, L., Shaw, P., Stephen, G., Wright, F. and Marshall, D. 2010.

Tablet - next generation sequence assembly visualization. Bioinformatics 26(3), 401-402.

1.2.Determination of marker order by linkage mapping Morex X Barke derived RILs

A large population of 2407 F8 recombinant inbred lines (RILs) was constructed by single

seed descent from a cross between the cultivars Morex and Barke. A random subset of 367

RILs was taken and DNA was isolated from each RI line by standard procedures and

genotyped using the barley 9K iSelect (7864 SNPs) chip as described in the materials and

methods. Allele scores extracted directly from the Illumina GenomeStudio software were

checked manually and monomorphic and questionable data removed. This left a total of

3973 high quality and robust co-dominant SNP markers that were polymorphic in the

population. Seven individual lines were dropped from further analysis due to quality

concerns leaving a mapping population of 360 RILs. Out of 1,430,280 markers scored,

26,535 (1.43%) were considered heterozygous. These were almost entirely within maintained

tracts of heterozygosity/heterogeneity that were present in 299 (83%) of the RILs sampled.

Mapping was performed with three different software packages. These were JoinMap 4.0

(Kyazma B.V., Wageningen, Netherlands), Map Manager QTXb20 (Manly et al., 2001,

www.mapmanager.org) and MapChart 2.2 (Plant Research International BV, Wageningen,

Netherlands). Initially, the genotyping data were transformed into a mapping data format

(“ABH”, A = genotype parent 1, B = genotype parent 2, H = heterozygous). JoinMap 4.0

(Van Ooijen, 2006) was employed for the linkage mapping, for verification of the segregation

patterns, the formation of linkage groups and the preliminary position of the markers on the

chromosomes with the default grouping settings and the mapping algorithm ML (maximum

likelihood). The final map position of the markers as well as the genetic distances between

Page 7

the markers were subsequently optimized manually with respect to the number of crossovers

(as low as possible) and the length of the linkage group (as short as possible) using the ABH

mapping data file in Excel and MapManager QTX (settings: linkage evaluation RIX, search

linkage criterion P=0.05, map function Kosambi, cross type line cross). Ultimately this

allowed all 3973 markers to be located to each of the seven barley chromosomes (411 on 1H,

700 on 2H, 596 on 3H, 346 on 4H, 802 on 5H, 558 on 6H and 560 on 7H). The genetic map

totalled 990.5 cM with the very distal end of 4HL being monomorphic presumably due to

past selection in both parental lines for spring habit at the VRN-H2 vernalization locus

(Dubcovsky et al, 2005). The mean distance between pairs of genetic markers was 0.249 cM

though there remain a small number of intervals >5 cM relating to regions of higher

recombination rate or identity by state. The final map was drawn using MapChart 2.2 (R.E.

Voorrips, 2002). The mapped markers and their locations are indicated in the iSelect marker

assay file given in Supplementary Table 6 and downloadable from

http://bioinf.hutton.ac.uk/waugh/iselect.

References

Dubcovsky, J, Chen, C, Yan, L. (2005) Molecular characterization of the allelic variation at

the VRN-H2 vernalization locus in barley. Molecular Breeding 15:395-407.

Manly KF, Cudmore Jr RH, Meer JM (2001) Map Manager QTX, cross platform software for

genetic mapping. Mamm Genome 12: 930-932

Van Ooijen, J.W. (2006). JoinMap 4

, Software for the calculation of genetic linkage maps in

experimental populations. Kyazma B.V., Wageningen, Netherlands

Voorrips, R.E. (2002). MapChart: Software for the graphical presentation of linkage maps

and QTLs. The Journal of Heredity 93: 77-78

1.3.Divergent selection and known loci.

SNP markers with ФPT values higher than 0.9 (ФPT 10

> 0.35) delimited 9 genomic regions

with strong putative divergent selection footprints. Manual examination revealed that

alternative alleles at these regions are close to fixation in the divergent germplasm pools.

Known loci were assigned to 6 of the 9 genomic regions (see Supplementary Table 8) where

the causative gene is known or very strong gene candidates have been cited in the literature.

The genes known as DENSO (sdw-1) and PPD-H2 have not been cloned in barley but the

regions containing these genes have been shown to contribute to differences in flowering

time between spring and winter barley genepools. The top SNP in the DENSO region (ФPT =

0.938) is 1.13 cM (MxB map) from the strong candidate gene Ga20ox for sdw-1 (41 / 24

gene models in rice / Brachypodium respectively). In the case of PPD-H2 5 SNPs in

complete LD with ФPT values of 0.986 delimitate a region of 2.77 cM encompassing 56 rice

genes (from LOC_Os05g44100 to LOC_Os05g44760). The candidate gene for PPD-H2

Page 8

(OsFTL10, LOC_Os05g44180) is 5 / 3 gene models away in rice / Brachypodium

respectively from the closest amongst the top SNPs.

In the case of frost resistance locus FR-2, the top SNP with ФPT value of 0.947 hits

OSU_HvCBF4A. CBF (C-repeat/DRE-Binding Factor) genes has been shown to induce the

expression of some cold-regulated genes, increase freezing tolerance and play a major role in

winter hardiness in cereals. OSU_HvCBF4A is a SNP in one of a cluster of CBF genes and

may not be the causal gene - but it is linked to functional structural changes in the CBF

cluster.

For VRN-H2, flanking SNPs (ФPT > 0.9) are 51/42 and 34/38 gene models away in rice /

Brachypodium respectively and for VRN-H1 the top flanking SNPs (ФPT > 0.9) are 119/100

and 87/36 gene models away in rice / Brachypodium respectively. Large linkage blocks

around these two regions that are maintained by high LD (especially around VRN-H1) have

already been described in the literature (von Zitzewitz et al. 2011). For the latter two

examples, we are conscious that there may be some ascertainment issues in the marker

platform as the majority of SNPs were derived from the spring gene pool (only one winter

genotype was included in selecting 6000 of the 9000 SNPs).

ФPT values around PPD-H1 and VRN-H3 did not reach the threshold of ФPT > 0.9. VRN-H3

is close to fixation in the spring germplasm cluster (MAF = 0.07) but still segregates in the

winter germplasm (MAF = 0.41). Fixation of VRN-H3 in the spring cluster caused a local

moderate increase of the Fst values in the region. The top SNP "i_SCRI_RS_172761" (ФPT =

0.46) is located 21 / 22 gene models away in rice / Brachypodium respectively from VRN-H3.

In relation to PPD-H1, a moderately high ФPT value for SNP "i_SCRI_RS_153798" (ФPT

>0.8), 0.99 cM from HvPRR7, provides evidence of an ongoing selection sweep in the region.

Physical distance could not be inferred as the SNP "i_SCRI_RS_153798" is not in a

conserved syntenic position in rice or Brachypodium. The SNP allele fixed in the spring

germplasm pool is segregating at relatively low frequency in the winter germplasm pool

(MAF = 0.18).

Reference

von Zitzewitz, J., A. Cuesta-Marcos, F. Condon, A. J. Castro, S. Chao et al. 2011 The

genetics of winterhardiness in barley: perspectives from genomw-wide association mapping.

The Plant Genome 4: 76-91.

1.4.QTL mapping of flowering time in the Nure x Tremois (NT) population

The "NT" Doubled Haploid (DH) population was derived by anther culture from the F1 of

the cross between the winter, two-rowed Italian variety Nure - [(„Fior 40‟ x „Alpha‟2) x

„Baraka‟] - and the spring, two-rowed French malting cultivar Tremois - [(„Dram‟ x

„Aramir‟) x „Berar‟]. One hundred and eighteen DH lines have been genotyped with 542

markers (396 DArT) in order to build a genetic linkage map with an average resolution of one

Page 9

marker every 2.8 cM (Tondelli et al., unpublished; Aghnoum et al., 2010). Replicated field

trials were conducted in 13 environments of six countries around the Mediterranean basin for

two harvest seasons, with different sowing dates ranging from the beginning of November

(autumn sowing) to the end of December (winter sowing), till march 21 (spring sowing)

(Francia et al., 2011). Time to flowering, grain yield and other phenological and yield

component traits were recorded. Phenotypic data were analyzed in GenStat version 14 (Payne

2009) in order to generate both Best Linear Unbiased Estimates (BLUEs) for each NT line,

and for multi-environment QTL analyses through Composite Interval Mapping (CIM).

The most significant time to flowering QTL was detected in the centromeric region of

chromosome 2H, BIN_07.2 , in a genomic region that corresponds to EPS2. The QTL

position for EPS2 (Supplementary Figure 1) is based on the P135A polymorphism within

HvCEN, that cosegregates with BOPA 12_30265, a marker showing strong divergent

selection in winter vs. spring barleys. HvCEN was resequenced in all individuals of the Nure

x Tremois population and the polymorphism leading to P135A was the most highly

associated marker in QTL analysis. The QTL thus explains precisely how much of the total

phenotypic variation is accounted for by HvCEN alleles at this locus. Regression analyses

considering marker alleles at four main loci involved in barley phenology and segregating in

the NT population (PPD-H2 on chromosome 1H, EPS2 on 2H, VRN-H2 on 4H and VRN-H1

on 5H) revealed that EPS2 explains 66% of the genotypic component of heading date across

the 13 environments (Supplementary Table 9). The Nure allele at HvCEN conferred early

maturity in 12 out of 13 environments, under different photoperiod and temperature regimes,

with an average effect on flowering of - 4.7 days. The same allele was pleiotropically

associated with grain yield in 5 environments, with an average effect of + 0.26 t ha-1, and to

thousand grain weight in 9 environments (average effect of + 3.8 grams). EPS2 accounted for

30% and 64% of the genetic variation for yield and thousand grain weight, respectively

(SupplementaryTable 9). This dataset confirmed that in environments characterized by

terminal drought the best adapted genotypes in the Nure x Tremois population were those

capable of fine tuning their life cycle, by advancing time to flowering in order to set seed and

increase seed weight in a wetter period.

In addition to the Nure x Tremois population, in 2011 we similarly examined the pleiotropic

effects of 10 of the mutant mat-c alleles on both height and grains per ear (Supplementary

Figure 4). Plants were planted in a randomized complete block design with ten replicates and

grown under natural long-day conditions in Dundee, Scotland. Data for each line are based on

the average values of the five main tillers of the plant (SupplementaryTable 10).

References:

Aghnoum R, Marcel TC, Johrde A, Pecchioni N, Schweizer P, Niks RE (2010) Basal host

resistance of barley to powdery mildew: connecting quantitative trait loci and candidate

genes. Mol Plant-Microbe Interact 23:91–102

Francia E, Tondelli A, Rizza F, Badeck FW, Li Destri O, Akar T, Grando S, Al-Yassin A,

Benbelkacem A, Thomas WTB, van Eeuwijk F, Romagosa I, Stanca AM, Pecchioni N (2011)

Page 10

Determinants of barley grain yield in a wide range of Mediterranean environments. Field

Crop Res 120:169–178

Payne R W (2009). "GenStat". Wiley Interdisciplinary Reviews: Computational Statistics 1

(2): 255–258

1.5.Expression analysis of HvCEN in Nure and Tremois

Nure and Tremois plants were grown in a Sanyo Gallenkamp SGC970 growth chamber under

different controlled conditions: Long Day (16h light, 20°C / 8h dark, 18°C), or Short Day (8h

light, 20°C / 16h dark, 18°C), with or without vernalization (4 week at 3°C day, 1°C night, in

short or long day as above). Vernalization was performed in SD but also in LD because most

of the sampling points fell into this period. In fact, for each experimental condition, tissues

were collected at the first leaf stage (fls), followed by 4 samplings –at 10, 20, 30 and 50 days.

For the vernalized experiments, last sampling was performed after returning plants to

20°C/18°C. Since microdissection of apex was not possible for very young plants, at each

time point 3 plants were pooled from each genotype, by sampling 2 cm of tissue surrounding

the meristematic apex. Two independent replicates of the whole experiment were performed.

For quantitative RT-PCR analysis, total RNA was extracted using TRI reagent® (Ambion)

and three μg of total RNA of each sample were reverse transcribed using oligo (dT)18-primer

with M-MLV Reverse Transcription Reagents (Promega) according to manufacturer‟s

instructions. The cDNAs were quantified using Qubit™ fluorometer (Invitrogen), diluted and

used for qPCR amplifications with gene specific primers. qRT-PCR analyses were performed

on 7300 Real-Time PCR System (Applied Biosystems) with the SYBR® Green PCR Master

Mix (Applied Biosystems), in three technical replications. The barley housekeeping reference

gene Actin was chosen for normalization of the cDNA, by amplifying it with the primer

combination described by Yan et al. (2006). Primer combinations for the target genes HvCEN

(F: 5‟-tttggaagggaggtggtgag-3‟; R: 5‟-gaagtagacggcagcgacagand-3‟) and HvBM5A (i.e. VRN-

H1) (F: 5‟-aactgaaggcgaaggttgaga-3‟; R: 5‟-tgcataagttggttcttcctgg-3‟; Yan et al., 2006) were

chosen in order to amplify fragments of comparable sizes, with one of the primer being

designed on an exon-intron junction, to avoid amplification from residual genomic DNA.

Expression values for the target genes are reported with respect to the expression of the

housekeeping gene Actin (Supplementary Figure 2). As expected, HvBM5A, the gene

promoting the transition of the apex from the vegetative to the reproductive stage, gradually

increased its expression in the winter genotype Nure under both inductive vernalization and

short day conditions. HvBM5A was constitutively expressed in the spring genotype Tremois.

On the other hand, HvCEN is neither induced nor repressed in any condition during the time

window examined, but its expression is always higher in Tremois than in Nure. Based on

these results, HvCEN is not influenced by the photoperiod and vernalization conditions used,

allowing us to hypothesize that it plays a role in maintenance of the vegetative state.

Page 11

Reference:

Yan L, Fu D, Li C, Blechl A, Tranquilli G, Bonafede M, Sanchez A, Valarik M, Yasuda S,

Dubcovsky J (2006) The wheat and barley vernalization gene VRN3 is an orthologue of FT.

Proc Natl Acad Sci USA 103:19581–19586

1.6.Diversity analysis

Allele mining

The plant material used in this study is listed in Supplementary Table 11. Details on

accession names, their HvCEN haplotypes, taxonomic designations, status, growth habit, row

type and collection sites of 1143 re-sequenced accessions are given. We studied 215 wild

barleys (H. vulgare subsp. spontaneum) from the whole natural distribution range (17

countries), 108 wild barley accessions from recent collection trips were considered together

with 107 wild barley accessions obtained from genebanks; 184 barley landraces (H. vulgare

subsp. vulgare; 44 countries), 739 barley cultivars (51 countries, including 346 lines also

included in the „divergent selection‟ panel) and five H. vulgare agriocrithon accessions. We

defined the growth habit for wild barley based on phenotypic information gathered in 2007,

2009 and 2010 (not shown). The term “winter habit” refers to autumn-sown vernalization-

depended/responsive genotypes while “spring” types are not vernalization-responsive.

Extraction of genomic DNA, generation of PCR primers and PCR amplification

Genomic DNA was isolated from silica-dried single leaves of each line with the Qiagen

DNeasy Plant Mini Kit (Qiagen, Hilden, Germany), according to the manufacturers

instructions. The Primer3 online software (primer3_www.cgi v 0.2, Whitehead Institute for

Biomedical Research, Cambridge, UK) (Rozen and Skaletsky 2000) was used to design

primers. Oligonucleotides were purchased from Eurofins MWG Operon, Ebersberg,

Germany. We used a single primer pair that covers the last 3 exons and 2 introns for the

diversity analysis: CENbL1 (forward): GATCCATACCTGAGGGAGCA and CEN1bR2

(reverse): TGATGCAAACAATCAGCCAT. Total amplified fragment size was 689 bp. This

region covered three SNPs that distinguish Nure (winter) from Tremois (spring), including

that leading to the P135A amino acid change. The spring allele has one non‐synonymous

change in the coding region & two SNPs in the introns.

Page 12

DNA amplifications were performed in a 25 µl volume. The reaction mix contained about

100 ng of genomic DNA:

n=1 (µl)

5*buffer 5

0,1mM dNTP's 3

CENbL1 0,5

CEN1bR2 0,5

H2O 13,875

Promega GoTaq 0,125

DNA 2

The reactions were incubated in a SensoQuest labcycler with the following cycling

conditions:

95°C 3 min

95°C 30 sec

65°C 30sec 7 cycles ( -1°C/cycle)

72°C 1 min

95°C 30 sec

57°C 30 sec 32 cycles

72°C 1 min

72°C 10 min

12°C forever

PCR products were separated by agarose gels.

Purification and sequencing of PCR products

PCR products from 1143 accessions were purified by NucleoFast 96 PCR plates (Macherey-

Nagel, Düren, Germany; add to each sample 150 µl water, set the samples on a NucleoFast

96 PCR Plate, use the vacuum station until the membrane is dry, add to each well 12 µl

water, shake for 15 min at room temperature) and were sequenced directly on both strands on

an Applied Biosystems (Weiterstadt, Germany) ABI Prism 3730xL sequencer using BigDye

terminators (4µl sample + 1µl primer 5µmol).

SNP-detection

DNA sequences were processed with AB DNA Sequencing Analysis Software 5.2 and later

manually edited by Bio-Edit version 7.0.9.0 (Hall 1999). Sequence alignments were

generated with ClustalW, and the allelic haplotypes were defined by DNASP 5.10.01

(Librado and Rozas 2009). All singletons have been confirmed afterwards by additional three

independent amplifications and sequencing. One heterozygous sequence was excluded from

the analysis. Of the sequenced 689 bp fragment, 657 bp were considered for the multiple

alignment. 14 SNPs have been detected that defined 13 haploytpes (Supplementary Table 12)

Page 13

Median-Joining Networks

Median-Joining (MJ) Networks (Bandelt et al. 1999) were constructed with the software

programs DNA Alignment 1.3.1.1, Network 4.6.1.0 and Network publisher 1.3.0.0 (Fluxus

Technology Ltd., Clare, Suffolk, UK). Nine haplotypes were found in wild barley, seven in

landraces and six in cultivars. Six haplotypes are unique for wild barley whereas four are

unique for domesticated barley (unique for cultivars: -; unique for landraces: 1). Three major

haplotypes are shared between wild, landraces and cultivars. Four major haplotypes exist in

wild barley in nature (Figure 4 main text).

Haplotype distribution maps

ArcGIS 10 software from ESRI was used to draw the topographic maps. The GTOPO30

global digital elevation dataset developed by USGS was used as a basemap

(http://eros.usgs.gov/#/Find_Data/Products_and_Data_Available/gtopo30_info). The original

30-arc-second resolution (~1km) was aggregated to a coarser 10-km resolution, which is

sufficient for global scale mapping purposes still showing main topographical features. GPS

coordinates for collected and genebank materials are given in Supplementary Table 11. For

accessions obtained from genebank, where the precise collection site is unknown, the capital

state of the source country was arbitrarily chosen as collection site. European elite cultivars

were considered and arbitrarily plotted at the capital state of the source country were this

variety was released. The number of individuals collected at every location was counted and

is indicated using circles of different size. The unweighted geographical mean of the sample

locations was calculated and marked with a black cross in each map.

Natural distribution of Ala-135 and Pro-135 containing haplotypes

In order to address the biology behind the P135A change, we have plotted all accessions

harbouring Ala-135 and Pro-135 haplotypes, respectively – together into one GIS-based

distribution map each (Supplementary Figure 5). It is evident that the „Tremois G, Ala-135‟

allele (730 accessions; wild, landraces and cultivars) = the „spring‟ allele, predominates in

domesticated barley north of the Mediterranean Basin. This „spring‟ allele confers an

advantage in cool seasons because it is later flowering – allowing more time for grain fill and

ripening under optimal well-watered conditions.

The „Nure C, Pro-135)‟ allele (together 413 accessions) = the „winter‟ allele, predominates

e.g. in landraces originating south of the Mediterranean Sea (Morocco, Algeria, Libya,

Egypt) or from the Arabian Peninsula (Yemen, Oman). Here under hot, dry summer

conditions, the „winter‟ allele confers an advantage because it accelerates development and

thereby provides a mechanism to escape early season terminal drought.

Page 14

Phylogenetic analysis of HvCEN

We selected early, mid and late flowering individuals of thirteen additional Triticeae species

based on phenotypic information gathered in 2010 and 2011 (not shown). DNA isolated from

101 single seed from Hordeum, Triticum and Aegilops individuals were resequenced at

HvCEN (multiple sequence alignment length: 614 bp) – 23 individuals of T. urartu (wheat

genome A donor); 14x Ae. speltoides (wheat genome B donor); 7x Ae. tauschii (wheat

genome D donor); 7x Ae. bicornis; 3x Ae. longissima; 4x Ae. sharonensis; 2x Ae. searsii; 3x

Ae. markgrafii; 3x Ae. umbellulata and 33x T. boeoticum; 1x H. murinum ssp. glaucum; 1x

H. californicum and 1x H. cordobense. Conservation of synteny searches were performed for

rye and wheat genomes. We found that Pro-135 is ancient at alignment position 531 (P135A)

and Ala-135 derived only in the H. vulgare lineage from haplotype IX which we only found

in wild barley. Two haplotype clades have been detected in the H. vulgare lineage. Clade 1

consists of major haplotype II (Nure), and haplotypes IV, VI and XI, whereas Clade 2

consists of haplotypes IX, X, XIII, major haplotype III (Tremois), VIII, V, XII, major

haplotype I (Bowman) and VII.

References

Bandelt H-J, Forster P, Röhl A (1999) Median-joining networks for inferring intraspecific

phylogenies. Mol Biol Evol 16:37–48

Hall TA (1999) BioEdit: a user-friendly biological sequence alignment editor and analysis

program for Windows 95/98/NT. Nucleic Acids Symp Ser. 41:95–98

Huson DH, Bryant D (2006) Application of phylogenetic networks in evolutionary studies.

Mol Biol Evol 23:254–267

Librado P and Rozas J (2009) DnaSP v5: A software for comprehensive analysis of DNA

polymorphism data. Bioinformatics 25:1451-1452

Rozen S, Skaletsky H (2000) Primer3 on the WWW for general users and for biologist

programmers. Methods Mol Biol 132:365-386

Page 15

2. Supplementary Figures:

Supplementary Figure 1: Multi-environment QTL scan of the time to flowering trait

measured in the Nure X Tremois DH population.

Supplementary Figure 1: Multi-environment QTL scan of the time to flowering trait

measured in the Nure X Tremois DH population. A genetic linkage map of chromosome 2H

from the NT population, showing the position of HvCEN and HvPPD-H1. Distances are in

Kosambi cM.

Page 16

Supplementary Figure 2: Expression of barley HvCEN and VRN-H1 genes (HvBM5A).

Supplementary Figure 2: Expression of barley HvCEN and VRN-H1 genes (HvBM5A).

Experiments were carried out in the winter cultivar Nure and the spring cultivar Tremois,

grown under different photoperiod and vernalization conditions: a) Long Days, not

Vernalized; b) Long Days, Vernalized; c) Short Days, not Vernalized; d) Short Days,

Vernalized. Each mRNA was quantified relative to Actin mRNA. Data were standardized over

two independent experiments (means ± SE). The numbers at the bottom indicate the number

of days after the complete emergence of the first leaf.

Page 17

Supplementary Figure 3: MJ network derived from resequenced DNA haplotypes and

conservation of synteny searches in sequenced model grass genomes among Triticeae

species.

Supplementary Figure 3: MJ network derived from resequenced DNA haplotypes and

conservation of synteny searches in sequenced model grass genomes among Triticeae

species. Thirty-four haplotypes were found (every haplotype has been considered only one

time, thus one haplotype can be shared between several individuals and species). The

distance in nucleotide substitutions between haplotypes is indicated by numbers. Two clades

of haplotypes within the Hordeum vulgare lineage were found. Haplotypes highlighted in

green are Ala containing haplotypes at position 531 (P135A) (Supplementary Table 11). All

other haplotypes harbor Pro at this position. The 13 haplotypes within the H. vulgare lineage

are indicated by Roman numerals as in Figure 4 in the main text and Supplementary Table

11. Hor-mur-glau – Hordeum murinum subsp. glaucum, Hor-cordob – H. cordobensis, Hor-

calif – H. californicum, AES-A – Triticum aestivum genome A, BOE – T. boeoticum, LOG –

Aegilops longissima, MAR – Ae. markgrafii, MON – T. monococcum, SEA – Ae. searsii,

SHA – Ae. sharonensis, SPE – Ae. speltoides, TAU – Ae. tauschii, UMB – Ae. umbellulata

and URA – T. urartu. Genbank accession numbers of resequenced DNA haplotypes are

JX855806-JX855826 (http://www.ncbi.nlm.nih.gov/genbank).

Page 18

Supplementary Figure 4: Pleiotropic effects of MAT-C mutant alleles on (a) height (in

millimetres) and (b) grains per ear.

Supplementary Figure 4: Pleiotropic effects of MAT-C mutant alleles on (a) height (in

millimetres) and (b) grains per ear. Data presented are from the two wild types and the ten

mutant lines and are shown as means +/- s.e.m.

500600700800900

100011001200

he

igh

t (m

m)

05

1015202530

grai

ns

pe

r e

ar

a

b

Page 19

Supplementary Figure 5: GIS-based topographic maps of Ala-135 and Pro-135

containing haplotypes.

Supplementary Figure 5: GIS-based topographic maps of Ala-135 and Pro-135 containing

haplotypes. a) All wild and domesticated barley accessions harboring the ‘Tremois G, Ala-

135), spring allele’ (haplotypes I, III, V, VII, VIII, XII) were plotted together. b) All

accessions harboring the ‘Nure C, Pro-135, winter allele’ (haplotypes I II, IV, VI, IX, X, XI,

XIII) were plotted together. See Figure 4 and Supplementary Table 12i for more details. The

number of individuals collected at each particular site is indicated by the key at upper left.

The geographical mean is indicated by a black cross.

Page 20

3. Supplementary Tables:

Supplementary Table 1: Read numbers and read lengths for all samples used.

sample read numbers

untrimmed

read numbers

trimmed

mean trimmed read

length

Barke 25,663,186 25,538,142 72

Betzes 22,204,022 22,118,902 72.5

Bowman 7,257,869 7,251,430 48.8

Derkado 5,932,230 5,930,692 39.8

Intro 6,066,180 6,064,803 40.4

Morex 26,664,480 26,292,853 68.9

Optic 23,252,182 23,164,817 71.5

Quench 26,946,706 26,795,748 69.8

Sergeant 24,480,462 24,288,466 72.1

Tocada 23,868,881 23,764,572 72.2

Total 192,336,198 191,210,425 62.8

Page 21

Supplementary Table 2: GigaBayes parameter values used in the primary SNP

detection run.

--CRL 6 minimum read coverage = 6

--CAL 3 minimum number of instances of an allele required = 3

--PSL 0.5 minimum likelihood of SNP being genuine = 0.5

Page 22

Supplementary Table 3: Breakdown of failure categories and counts of SNPs returned

by the Illumina Assay Design Tool (ADT), out of a total of 240,119 raw SNPs submitted.

Error explanation # failed

106;101 Degenerate nucleotide(s) in assay design region;Flanking sequence is

too short

2,536

360 Low score warning 637

106 Degenerate nucleotide(s) in assay design region 144,429

103 Top/Bot strand cannot be determined 454

total failed 148,056

Page 23

Supplementary Table 4. Numbers of SNPs during the incremental filtering procedure.

SNP set # SNPs

unfiltered (after GigaBayes) 240,119

after removal of SNPs with final design score

of less than 0.6

76,831

after removal of unigenes containing BOPA

SNPs

64,474

after filtering for heterozygosity 31,616

Page 24

Supplementary Table 5: Validation rates for the Illumina read mappings by sample,

compared to existing benchmark genotype data from the Illumina Golden Gate

genotyping assay (values of 0.01 and 1 for heterozygosity index and the minimum read

replication respectively).

Sample Incorrec

tly

called

Correctly

called

SNP not

present

No

NGS

data

No

benchmark

data

Tota

l

%

correctly

called

Betzes 115 1776 1020 132 29 3072 93.92

Bowman 72 1390 1020 338 252 3072 95.08

Intro 40 699 1020 541 772 3072 94.59

Morex 24 573 1020 306 1149 3072 95.98

Optic 47 884 1020 125 996 3072 94.95

Sergeant 129 1782 1020 123 18 3072 93.25

Tocada 119 1795 1020 117 21 3072 93.78

Derkado 75 1433 1020 532 12 3072 95.03

Barke 103 1842 1020 93 14 3072 94.70

Quench 64 870 1020 107 1011 3072 93.15

Page 25

Supplementary Table 7: Germplasm used for Divergent selection

Serial number

JHI iSelect

lines

Accession name Taxonomy Genetic cluster Divergent

pools

Included in the

1143 set

1 ACAPELLA Hordeum vulgare elite spring 2r S-2R

2 ACROBAT Hordeum vulgare elite spring 2r S-2R

3 ADONIS Hordeum vulgare elite spring 2r S-2R +

4 AGENDA Hordeum vulgare elite spring 2r S-2R +

5 AKITA Hordeum vulgare elite spring 2r S-2R

6 ALABAMA Hordeum vulgare admixted excluded +

7 ALLIOT-2 Hordeum vulgare elite spring 2r S-2R

8 ALUMINIUM Hordeum vulgare elite spring 2r S-2R +

9 AMOURETTE Hordeum vulgare elite spring 2r S-2R

10 ANACONDA Hordeum vulgare elite spring 2r S-2R

11 ANAIS Hordeum vulgare admixted excluded

12 ANNABELL Hordeum vulgare elite spring 2r S-2R +

13 APPALOOSA Hordeum vulgare elite spring 2r S-2R +

14 ARAMIR Hordeum vulgare admixted excluded +

15 ARDILA Hordeum vulgare elite spring 2r S-2R

16 ASB 04-18 Hordeum vulgare elite spring 2r S-2R +

17 ASPEN Hordeum vulgare elite spring 2r S-2R +

18 ASTORIA Hordeum vulgare elite spring 2r S-2R

19 ATEM Hordeum vulgare admixted excluded +

20 ATHENA Hordeum vulgare admixted excluded

21 AVEC Hordeum vulgare elite spring 2r S-2R +

22 AZURE Hordeum vulgare elite spring 2r S-2R

23 B83-12-21-5 Hordeum vulgare admixted excluded

24 BEATRIX Hordeum vulgare elite spring 2r S-2R +

25 BEKA Hordeum vulgare admixted excluded

26 BERAC Hordeum vulgare admixted excluded +

27 BERWICK Hordeum vulgare elite spring 2r S-2R +

28 BETZES Hordeum vulgare admixted excluded

29 BLENHEIM Hordeum vulgare admixted excluded

30 BRAEMAR-2 Hordeum vulgare elite spring 2r S-2R

31 BRAHMS Hordeum vulgare elite spring 2r S-2R +

32 BRAZIL-2 Hordeum vulgare elite spring 2r S-2R

33 BREWSTER Hordeum vulgare elite spring 2r S-2R

34 BRISE Hordeum vulgare elite spring 2r S-2R

35 BERYLLIUM Hordeum vulgare elite spring 2r S-2R +

36 CALICO Hordeum vulgare elite spring 2r S-2R +

37 CAMARGUE Hordeum vulgare old spring 2r excluded +

38 CAMPALA Hordeum vulgare elite spring 2r S-2R +

39 CANASTA Hordeum vulgare elite spring 2r S-2R +

40 CATALINA Hordeum vulgare elite spring 2r S-2R

41 CECILIA Hordeum vulgare admixted excluded

42 CELEBRA Hordeum vulgare admixted excluded +

43 CENTURION Hordeum vulgare elite spring 2r S-2R +

44 CENTURY Hordeum vulgare elite spring 2r S-2R +

45 CHALICE Hordeum vulgare elite spring 2r S-2R +

46 CHARIOT Hordeum vulgare elite spring 2r S-2R +

Page 26

47 CHARM Hordeum vulgare elite spring 2r S-2R

48 CHASER Hordeum vulgare elite spring 2r S-2R +

49 CHEVALLIER-

TYSTOFTE

Hordeum vulgare admixted excluded

50 CHIEFTAIN Hordeum vulgare elite spring 2r S-2R +

51 CHIME Hordeum vulgare elite spring 2r S-2R +

52 CINDY Hordeum vulgare admixted excluded

53 CLARITY Hordeum vulgare admixted excluded +

54 CLASS Hordeum vulgare elite spring 2r S-2R +

55 COLADA Hordeum vulgare elite spring 2r S-2R +

56 COOPER-2 Hordeum vulgare elite spring 2r S-2R

57 CORK Hordeum vulgare elite spring 2r S-2R +

58 COUNTY Hordeum vulgare elite spring 2r S-2R

59 CPBT B76 Hordeum vulgare elite spring 2r S-2R +

60 CPBT B80 Hordeum vulgare elite spring 2r S-2R +

61 CRIBBAGE Hordeum vulgare admixted excluded

62 CRUSADER Hordeum vulgare elite spring 2r S-2R

63 DALLAS Hordeum vulgare elite spring 2r S-2R +

64 DECANTER Hordeum vulgare elite spring 2r S-2R +

65 DELIBES Hordeum vulgare elite spring 2r S-2R

66 DERKADO Hordeum vulgare elite spring 2r S-2R

67 DEW Hordeum vulgare elite spring 2r S-2R +

68 DRAUGHT Hordeum vulgare elite spring 2r S-2R +

69 DRAY Hordeum vulgare elite spring 2r S-2R +

70 DRUM Hordeum vulgare elite spring 2r S-2R

71 DOYEN Hordeum vulgare elite spring 2r S-2R +

72 EXTRACT Hordeum vulgare elite spring 2r S-2R

73 FAIRYTALE Hordeum vulgare elite spring 2r S-2R +

74 FELICIE Hordeum vulgare admixted excluded

75 FELTWELL Hordeum vulgare elite spring 2r S-2R +

76 FERMENT Hordeum vulgare elite spring 2r S-2R +

77 FONTANA Hordeum vulgare elite spring 2r S-2R +

78 FOXTROT Hordeum vulgare elite spring 2r S-2R +

79 FRACTAL Hordeum vulgare admixted excluded

80 FRANKLIN Hordeum vulgare admixted excluded

81 GEORGIE Hordeum vulgare admixted excluded +

82 GLEN Hordeum vulgare admixted excluded

83 GLOBAL Hordeum vulgare elite spring 2r S-2R +

84 GOLDIE Hordeum vulgare admixted excluded +

85 GRANTA Hordeum vulgare elite spring 2r S-2R +

86 GRAPHIC Hordeum vulgare admixted excluded

87 GUNDEL Hordeum vulgare admixted excluded

88 HANKA-2 Hordeum vulgare elite spring 2r S-2R

89 HARRIOT Hordeum vulgare elite spring 2r S-2R +

90 HART Hordeum vulgare admixted excluded

91 HEATHER Hordeum vulgare admixted excluded +

92 HENLEY Hordeum vulgare elite spring 2r S-2R +

93 HENNI Hordeum vulgare admixted excluded

94 HERON Hordeum vulgare admixted excluded

95 HOPPER Hordeum vulgare elite spring 2r S-2R +

96 HORIZON Hordeum vulgare elite spring 2r S-2R +

97 HOST Hordeum vulgare elite spring 2r S-2R +

98 HYDRA Hordeum vulgare elite spring 2r S-2R +

99 INDOLA Hordeum vulgare elite spring 2r S-2R +

100 ISABELLA Hordeum vulgare elite spring 2r S-2R +

Page 27

101 JIVE Hordeum vulgare admixted excluded

102 JUNO Hordeum vulgare admixted excluded

103 KARAT Hordeum vulgare winter 2r W-2R

104 KASSIMA Hordeum vulgare elite spring 2r S-2R +

105 KLAXON Hordeum vulgare admixted excluded +

106 KYM Hordeum vulgare admixted excluded +

107 LANDLORD Hordeum vulgare elite spring 2r S-2R +

108 LINA Hordeum vulgare admixted excluded

109 LINDEN Hordeum vulgare elite spring 2r S-2R +

110 LITHIUM Hordeum vulgare elite spring 2r S-2R +

111 LIVET Hordeum vulgare elite spring 2r S-2R

112 LOGAN Hordeum vulgare admixted excluded

113 MACARENA Hordeum vulgare elite spring 2r S-2R +

114 MACAW Hordeum vulgare elite spring 2r S-2R +

115 MADRAS Hordeum vulgare elite spring 2r S-2R +

116 MANDOLIN-1418 Hordeum vulgare admixted excluded +

117 MAYPOLE Hordeum vulgare elite spring 2r S-2R +

118 MELITTA Hordeum vulgare elite spring 2r S-2R +

119 MELTAN Hordeum vulgare admixted excluded +

120 MIKADO Hordeum vulgare admixted excluded +

121 MINSTREL Hordeum vulgare elite spring 2r S-2R

122 MONIKA Hordeum vulgare elite spring 2r S-2R +

123 NATASHA Hordeum vulgare elite spring 2r S-2R +

124 NERUDA Hordeum vulgare elite spring 2r S-2R +

125 NIMBUS Hordeum vulgare elite spring 2r S-2R

126 NOMAD Hordeum vulgare admixted excluded

127 NOVELLO Hordeum vulgare elite spring 2r S-2R +

128 NSL 95-1257 Hordeum vulgare elite spring 2r S-2R +

129 NSL 97-4552 Hordeum vulgare elite spring 2r S-2R +

130 NSL 98-5065 Hordeum vulgare elite spring 2r S-2R +

131 NSL 99-5363 Hordeum vulgare elite spring 2r S-2R +

132 ONYX Hordeum vulgare admixted excluded +

133 OPTIC Hordeum vulgare elite spring 2r S-2R +

134 PARAMOUNT Hordeum vulgare elite spring 2r S-2R +

135 PENTHOUSE Hordeum vulgare elite spring 2r S-2R

136 PEWTER Hordeum vulgare elite spring 2r S-2R +

137 PITCHER Hordeum vulgare elite spring 2r S-2R +

138 POKER Hordeum vulgare elite spring 2r S-2R +

139 POLYGENA Hordeum vulgare elite spring 2r S-2R +

140 PONGO Hordeum vulgare admixted excluded

141 POTTER Hordeum vulgare admixted excluded +

142 POWER Hordeum vulgare elite spring 2r S-2R +

143 PRAGUE Hordeum vulgare elite spring 2r S-2R +

144 PRESTIGE Hordeum vulgare elite spring 2r S-2R +

145 PRIMERA Hordeum vulgare admixted excluded

146 PRISMA Hordeum vulgare elite spring 2r S-2R +

147 PUBLICAN Hordeum vulgare elite spring 2r S-2R +

148 QUARTET Hordeum vulgare elite spring 2r S-2R +

149 QUENCH Hordeum vulgare elite spring 2r S-2R +

150 RAGTIME Hordeum vulgare admixted excluded

151 RAINBOW Hordeum vulgare elite spring 2r S-2R +

152 RAKAIA Hordeum vulgare elite spring 2r S-2R +

153 RANGOON Hordeum vulgare elite spring 2r S-2R +

154 REBECCA Hordeum vulgare admixted excluded

155 REGGAE Hordeum vulgare admixted excluded +

Page 28

156 RENATA Hordeum vulgare old spring 2r excluded +

157 RIA Hordeum vulgare elite spring 2r S-2R +

158 RIVET-PERTH Hordeum vulgare elite spring 2r S-2R

159 RUMMY Hordeum vulgare elite spring 2r S-2R +

160 SABEL Hordeum vulgare elite spring 2r S-2R +

161 SACHA Hordeum vulgare elite spring 2r S-2R +

162 SALOON Hordeum vulgare elite spring 2r S-2R +

163 SCANDIUM Hordeum vulgare elite spring 2r S-2R +

164 SCARLETT Hordeum vulgare admixted excluded +

165 SEBASTIAN Hordeum vulgare elite spring 2r S-2R +

166 SHAKIRA Hordeum vulgare elite spring 2r S-2R +

167 SILICON Hordeum vulgare elite spring 2r S-2R +

168 SKAGEN Hordeum vulgare elite spring 2r S-2R +

169 SKITTLE Hordeum vulgare elite spring 2r S-2R +

170 SPEY Hordeum vulgare elite spring 2r S-2R +

171 SPIKE Hordeum vulgare elite spring 2r S-2R +

172 SPIRAL Hordeum vulgare admixted excluded

173 SPIRE Hordeum vulgare elite spring 2r S-2R +

174 SPLASH Hordeum vulgare elite spring 2r S-2R +

175 STARLIGHT Hordeum vulgare elite spring 2r S-2R +

176 STATIC Hordeum vulgare elite spring 2r S-2R +

177 SW 2808 Hordeum vulgare elite spring 2r S-2R +

178 SW MACSENA Hordeum vulgare elite spring 2r S-2R +

179 SW SCANIA Hordeum vulgare admixted excluded +

180 SW STELLA Hordeum vulgare elite spring 2r S-2R +

181 TABORA Hordeum vulgare elite spring 2r S-2R +

182 TANKARD Hordeum vulgare elite spring 2r S-2R +

183 TAPHOUSE Hordeum vulgare elite spring 2r S-2R +

184 TARDUS Hordeum vulgare elite spring 2r S-2R +

185 TARTAN Hordeum vulgare elite spring 2r S-2R +

186 TAVERN Hordeum vulgare elite spring 2r S-2R +

187 THISTLE Hordeum vulgare elite spring 2r S-2R

188 THRIFT Hordeum vulgare admixted excluded

189 TIMORI Hordeum vulgare admixted excluded

190 TIPPLE Hordeum vulgare elite spring 2r S-2R +

191 TOBY Hordeum vulgare elite spring 2r S-2R +

192 TOCADA Hordeum vulgare elite spring 2r S-2R +

193 TODDY Hordeum vulgare elite spring 2r S-2R +

194 TOKEN Hordeum vulgare elite spring 2r S-2R +

195 TORUP Hordeum vulgare admixted excluded +

196 TOUCAN Hordeum vulgare elite spring 2r S-2R +

197 TRINIDAD Hordeum vulgare elite spring 2r S-2R

198 TRINITY Hordeum vulgare elite spring 2r S-2R +

199 TRIUMPH Hordeum vulgare elite spring 2r S-2R +

200 TROON Hordeum vulgare elite spring 2r S-2R

201 TROSA Hordeum vulgare elite spring 2r S-2R +

202 TUCSON Hordeum vulgare elite spring 2r S-2R +

203 TURNBERRY Hordeum vulgare elite spring 2r S-2R +

204 TYNE Hordeum vulgare admixted excluded

205 URSA Hordeum vulgare elite spring 2r S-2R +

206 VEGAS Hordeum vulgare elite spring 2r S-2R +

207 VELVET Hordeum vulgare elite spring 2r S-2R +

208 VILLA Hordeum vulgare admixted excluded

209 VISKOSA Hordeum vulgare elite spring 2r S-2R +

210 VIVENDI Hordeum vulgare elite spring 2r S-2R +

Page 29

211 VORTEX Hordeum vulgare elite spring 2r S-2R

212 WAGGON Hordeum vulgare elite spring 2r S-2R +

213 WEITOR Hordeum vulgare admixted excluded

214 WESTMINSTER Hordeum vulgare elite spring 2r S-2R +

215 WICKET Hordeum vulgare elite spring 2r S-2R +

216 WIDRE Hordeum vulgare admixted excluded

217 WIKINGETT Hordeum vulgare elite spring 2r S-2R +

218 WREN Hordeum vulgare admixted excluded +

219 Z91-103-21 Hordeum vulgare elite spring 2r S-2R +

220 CAJA Hordeum vulgare old spring 2r excluded

221 AAPO Hordeum vulgare old spring 2r excluded

222 ABACUS Hordeum vulgare admixted excluded

223 ABAVA Hordeum vulgare old spring 2r excluded

224 AKCENT Hordeum vulgare elite spring 2r S-2R

225 ALEXIS Hordeum vulgare elite spring 2r S-2R

226 ALIS Hordeum vulgare elite spring 2r S-2R

227 ALLIOT Hordeum vulgare elite spring 2r S-2R

228 ALVA Hordeum vulgare old spring 2r excluded

229 AMETYST Hordeum vulgare admixted excluded

230 ANLA Hordeum vulgare old spring 2r excluded

231 ANNI Hordeum vulgare admixted excluded

232 ANSIS Hordeum vulgare admixted excluded

233 APEX Hordeum vulgare admixted excluded

234 ARMELLE Hordeum vulgare admixted excluded

235 ARVO Hordeum vulgare old spring 2r excluded

236 ATHOS Hordeum vulgare admixted excluded

237 ATLAS Hordeum vulgare admixted excluded

238 ATRIBUT Hordeum vulgare elite spring 2r S-2R

239 AURIGA Hordeum vulgare elite spring 2r S-2R

240 BALDER Hordeum vulgare old spring 2r excluded

241 BALDER_J Hordeum vulgare old spring 2r excluded

242 BALGA Hordeum vulgare admixted excluded

243 BARABAS Hordeum vulgare elite spring 2r S-2R

244 BARKE Hordeum vulgare elite spring 2r S-2R

245 BARONESSE Hordeum vulgare admixted excluded

246 BERENICE Hordeum vulgare admixted excluded

247 BINDER Hordeum vulgare old spring 2r excluded

248 BIRGITTA Hordeum vulgare admixted excluded

249 BIRKA Hordeum vulgare old spring 2r excluded

250 BONUS Hordeum vulgare old spring 2r excluded

251 BRAEMAR Hordeum vulgare elite spring 2r S-2R +

252 BRAZIL Hordeum vulgare elite spring 2r S-2R +

253 BRITTA Hordeum vulgare old spring 2r excluded

254 CABARET Hordeum vulgare elite spring 2r S-2R

255 CALGARY Hordeum vulgare admixted excluded

256 CAMEO Hordeum vulgare admixted excluded

257 CAMINANT Hordeum vulgare elite spring 2r S-2R

258 CAMIR Hordeum vulgare admixted excluded

259 CARLSBERG Hordeum vulgare old spring 2r excluded

260 CARVILLA Hordeum vulgare old spring 2r excluded

261 CELLAR Hordeum vulgare elite spring 2r S-2R +

262 CEYLON Hordeum vulgare elite spring 2r S-2R

263 CHAMANT Hordeum vulgare elite spring 2r S-2R

264 CHERI Hordeum vulgare elite spring 2r S-2R

265 CICERO Hordeum vulgare elite spring 2r S-2R

Page 30

266 CILLA Hordeum vulgare old spring 2r excluded

267 CLARET Hordeum vulgare admixted excluded

268 CLAUDE Hordeum vulgare elite spring 2r S-2R

269 CLEOPATRA Hordeum vulgare admixted excluded

270 COOPER Hordeum vulgare elite spring 2r S-2R +

271 CORGI Hordeum vulgare elite spring 2r S-2R

272 CRISTALIA Hordeum vulgare elite spring 2r S-2R

273 CROYDON Hordeum vulgare admixted excluded

274 DANDY Hordeum vulgare admixted excluded

275 DANUTA Hordeum vulgare elite spring 2r S-2R

276 DEBA_ABED Hordeum vulgare old spring 2r excluded

277 DELTA Hordeum vulgare old spring 2r excluded

278 DIALOG Hordeum vulgare admixted excluded

279 DIAMANT Hordeum vulgare admixted excluded

280 DIGERSANO_(NAKE

D)

Hordeum vulgare admixted excluded

281 DINA Hordeum vulgare admixted excluded

282 DOMEN Hordeum vulgare admixted excluded

283 DOUBLET Hordeum vulgare admixted excluded

284 DRAKE Hordeum vulgare admixted excluded

285 DROST Hordeum vulgare old spring 2r excluded

286 EGMONT Hordeum vulgare admixted excluded

287 ELANTRA Hordeum vulgare admixted excluded

288 ELO Hordeum vulgare admixted excluded

289 EMIR Hordeum vulgare old spring 2r excluded

290 ESME Hordeum vulgare admixted excluded

291 EUNOVA Hordeum vulgare admixted excluded

292 FAMIN Hordeum vulgare elite spring 2r S-2R

293 FAVORIT Hordeum vulgare admixted excluded

294 FELICITAS Hordeum vulgare elite spring 2r S-2R

295 FORMULA Hordeum vulgare admixted excluded

296 FORUM Hordeum vulgare admixted excluded

297 FREJA Hordeum vulgare admixted excluded

298 GALAN Hordeum vulgare elite spring 2r S-2R

299 GANT Hordeum vulgare admixted excluded

300 GATE Hordeum vulgare elite spring 2r S-2R

301 GERKRA Hordeum vulgare old spring 2r excluded

302 GITANE Hordeum vulgare admixted excluded

303 GIZMO Hordeum vulgare elite spring 2r S-2R

304 GOLDEN_PROMISE Hordeum vulgare old spring 2r excluded

305 GOLF Hordeum vulgare admixted excluded

306 GORM Hordeum vulgare old spring 2r excluded

307 GULL Hordeum vulgare old spring 2r excluded

308 Unknown 4 Hordeum vulgare admixted excluded +

309 HANA Hordeum vulgare admixted excluded

310 HANKA Hordeum vulgare elite spring 2r S-2R +

311 HANNA_(W273368) Hordeum vulgare old spring 2r excluded

312 HASSAN Hordeum vulgare old spring 2r excluded

313 HELLAS Hordeum vulgare old spring 2r excluded

314 HELMI Hordeum vulgare admixted excluded

315 HERIS Hordeum vulgare admixted excluded

316 HYDROGEN Hordeum vulgare elite spring 2r S-2R

317 IDA Hordeum vulgare old spring 2r excluded

318 IDUMEJA Hordeum vulgare admixted excluded

319 IMBER Hordeum vulgare old spring 2r excluded

Page 31

320 IMIDIS Hordeum vulgare elite spring 2r S-2R

321 IMPALA Hordeum vulgare old spring 2r excluded

322 IMULA Hordeum vulgare admixted excluded

323 INARI Hordeum vulgare admixted excluded

324 INGRID Hordeum vulgare old spring 2r excluded

325 ISARIA Hordeum vulgare admixted excluded

326 JAREK Hordeum vulgare admixted excluded

327 DASIO Hordeum vulgare admixted excluded

328 KARAT-2 Hordeum vulgare admixted excluded

329 KARRI Hordeum vulgare old spring 2r excluded

330 KENIA Hordeum vulgare old spring 2r excluded

331 KEOPS Hordeum vulgare elite spring 2r S-2R

332 KORAL Hordeum vulgare admixted excluded

333 KRISTAPS Hordeum vulgare admixted excluded

334 KRONA Hordeum vulgare admixted excluded

335 KRYSTAL Hordeum vulgare admixted excluded

336 LADIK Hordeum vulgare elite spring 2r S-2R

337 LATVIJAS_VIETEJIE Hordeum vulgare admixted excluded

338 LEENI Hordeum vulgare elite spring 2r S-2R

339 LENTA Hordeum vulgare old spring 2r excluded

340 LINGA Hordeum vulgare old spring 2r excluded

341 LUD Hordeum vulgare admixted excluded

342 LUX Hordeum vulgare elite spring 2r S-2R

343 LYSIBA Hordeum vulgare admixted excluded

344 LYSIMAX Hordeum vulgare admixted excluded

345 MAJA Hordeum vulgare old spring 2r excluded

346 MALA Hordeum vulgare old spring 2r excluded

347 MALVA Hordeum vulgare admixted excluded

348 MARESI Hordeum vulgare elite spring 2r S-2R

349 MARIS_MINK Hordeum vulgare admixted excluded

350 MARS Hordeum vulgare admixted excluded

351 MARTHE Hordeum vulgare elite spring 2r S-2R

352 MAURITIA Hordeum vulgare elite spring 2r S-2R

353 DUCHESS Hordeum vulgare winter 2r W-2R

354 MELTAN-2 Hordeum vulgare admixted excluded

355 MENTOR Hordeum vulgare admixted excluded

356 MIDAS Hordeum vulgare admixted excluded

357 NATHALIE Hordeum vulgare elite spring 2r S-2R

358 NEMEX Hordeum vulgare old spring 2r excluded

359 NORDAL Hordeum vulgare old spring 2r excluded

360 NOVUM Hordeum vulgare admixted excluded

361 ODESSA Hordeum vulgare admixted excluded

362 OKOS Hordeum vulgare admixted excluded

363 ORBIT Hordeum vulgare admixted excluded

364 ORZA Hordeum vulgare admixted excluded

365 OTIS Hordeum vulgare admixted excluded

366 OTTO Hordeum vulgare admixted excluded

367 PALLAS Hordeum vulgare old spring 2r excluded

368 PALOMA Hordeum vulgare elite spring 2r S-2R

369 PASADENA Hordeum vulgare elite spring 2r S-2R

370 PERUN Hordeum vulgare admixted excluded

371 PRIEKULU_60 Hordeum vulgare old spring 2r excluded

372 PRIMUS Hordeum vulgare admixted excluded

373 PROCTOR Hordeum vulgare old spring 2r excluded

374 PROSA Hordeum vulgare admixted excluded

Page 32

375 PUBLICAN-2 Hordeum vulgare elite spring 2r S-2R

376 QUARTZ Hordeum vulgare admixted excluded

377 QUENCH-2 Hordeum vulgare elite spring 2r S-2R

378 RAPID Hordeum vulgare admixted excluded

379 RASA Hordeum vulgare admixted excluded

380 RIKA Hordeum vulgare old spring 2r excluded

381 RIVIERA Hordeum vulgare admixted excluded

382 ROLAND Hordeum vulgare old spring 2r excluded

383 ROMI Hordeum vulgare old spring 2r excluded

384 ROXANA Hordeum vulgare elite spring 2r S-2R

385 RUBIN Hordeum vulgare elite spring 2r S-2R

386 RUJA Hordeum vulgare admixted excluded

387 RUPAL Hordeum vulgare old spring 2r excluded

388 SAANA Hordeum vulgare admixted excluded

389 SAFIR Hordeum vulgare admixted excluded

390 SALKA Hordeum vulgare old spring 2r excluded

391 SALVE Hordeum vulgare admixted excluded

392 SCARLETT-2 Hordeum vulgare admixted excluded

393 SENAT Hordeum vulgare old spring 2r excluded

394 SENCIS Hordeum vulgare admixted excluded

395 SIMBA Hordeum vulgare admixted excluded

396 SIMON Hordeum vulgare old spring 2r excluded

397 SMILLA Hordeum vulgare elite spring 2r S-2R

398 SPARTAN Hordeum vulgare admixted excluded

399 STATIC-2 Hordeum vulgare elite spring 2r S-2R

400 STEFFI Hordeum vulgare admixted excluded

401 STEINA Hordeum vulgare admixted excluded

402 STELLA Hordeum vulgare spring 6r excluded

403 STENDES Hordeum vulgare old spring 2r excluded

404 SULTAN Hordeum vulgare old spring 2r excluded

405 TARM92 Hordeum vulgare admixted excluded

406 TERNO Hordeum vulgare admixted excluded

407 THURINGIA Hordeum vulgare admixted excluded

408 TREMOIS Hordeum vulgare admixted excluded +

409 TRIUMPH-2 Hordeum vulgare elite spring 2r S-2R

410 TYRA Hordeum vulgare old spring 2r excluded

411 UNION Hordeum vulgare admixted excluded

412 URSEL Hordeum vulgare admixted excluded

413 VADA Hordeum vulgare admixted excluded

414 VALTICKY Hordeum vulgare admixted excluded

415 VANKKURI Hordeum vulgare old spring 2r excluded

416 VEGA Hordeum vulgare old spring 2r excluded

417 VIIVI Hordeum vulgare admixted excluded

418 VOLLA Hordeum vulgare admixted excluded

419 WELAM Hordeum vulgare old spring 2r excluded

420 WING Hordeum vulgare old spring 2r excluded

421 WISA Hordeum vulgare admixted excluded

422 ZENIT Hordeum vulgare admixted excluded

423 ZEPHYR Hordeum vulgare admixted excluded

424 HARRY Hordeum vulgare old spring 2r excluded

425 MONTANA Hordeum vulgare old spring 2r excluded

426 12337 ZH Hordeum vulgare winter 2r W-2R +

427 201157 A Hordeum vulgare elite spring 2r S-2R +

428 410/3E Hordeum vulgare winter 2r W-2R +

429 961374 Hordeum vulgare winter 2r W-2R +

Page 33

430 AC 97-H2406-10 Hordeum vulgare winter 2r W-2R +

431 AC 99-077-2 Hordeum vulgare winter 2r W-2R +

432 ACTRICE Hordeum vulgare winter 2r W-2R +

433 ACCRUE Hordeum vulgare winter 2r W-2R +

434 ANGORA Hordeum vulgare winter 2r W-2R +

435 ANTELOPE Hordeum vulgare winter 2r W-2R +

436 ANTIGUA Hordeum vulgare winter 2r W-2R +

437 ANTONIA Hordeum vulgare winter 2r W-2R

438 ANVIL Hordeum vulgare winter 2r W-2R +

439 ARCHIMEDES Hordeum vulgare winter 2r W-2R +

440 ARTIST Hordeum vulgare winter 2r W-2R +

441 AVENUE Hordeum vulgare winter 2r W-2R +

442 AYANA Hordeum vulgare admixted excluded +

443 ALPHA Hordeum vulgare winter 6r excluded +

444 BARCELONA Hordeum vulgare winter 2r W-2R +

445 BATON Hordeum vulgare winter 2r W-2R +

446 BECKET Hordeum vulgare winter 2r W-2R +

447 BISTRO Hordeum vulgare winter 2r W-2R +

448 BLYTHE Hordeum vulgare winter 2r W-2R +

449 BOREALE Hordeum vulgare winter 2r W-2R +

450 BREEZE Hordeum vulgare winter 2r W-2R +

451 BRONZE Hordeum vulgare winter 2r W-2R +

452 CALCUTTA Hordeum vulgare winter 2r W-2R +

453 CALLIOPE Hordeum vulgare winter 2r W-2R

454 CAMION Hordeum vulgare winter 2r W-2R +

455 CAMPANILE Hordeum vulgare winter 2r W-2R +

456 CAMPION Hordeum vulgare winter 2r W-2R +

457 CANDY Hordeum vulgare winter 2r W-2R +

458 CANNOCK Hordeum vulgare winter 2r W-2R +

459 CAPTION Hordeum vulgare winter 2r W-2R +

460 CASSATA Hordeum vulgare winter 2r W-2R

461 CATHAY Hordeum vulgare winter 2r W-2R +

462 CEBECO 02215-05 Hordeum vulgare winter 2r W-2R +

463 CEDAR Hordeum vulgare winter 2r W-2R +

464 CELEBRITY Hordeum vulgare winter 2r W-2R +

465 CELLINA Hordeum vulgare admixted excluded +

466 CELSIUS Hordeum vulgare winter 2r W-2R +

467 CHAMOMILE Hordeum vulgare winter 2r W-2R +

468 CHARLESTON Hordeum vulgare winter 2r W-2R +

469 CHESTNUT Hordeum vulgare winter 2r W-2R +

470 CHICANE Hordeum vulgare admixted excluded +

471 CHINTZ Hordeum vulgare winter 2r W-2R +

472 CHORD Hordeum vulgare winter 2r W-2R +

473 CINNAMON Hordeum vulgare winter 2r W-2R +

474 CLARINE Hordeum vulgare winter 2r W-2R +

475 COBALT Hordeum vulgare winter 2r W-2R +

476 CONCEPT Hordeum vulgare winter 2r W-2R +

477 CONNOISSEUR Hordeum vulgare winter 2r W-2R +

478 CORIOLIS Hordeum vulgare winter 2r W-2R +

479 CPBT B20 Hordeum vulgare winter 2r W-2R +

480 CPBT B66 Hordeum vulgare winter 2r W-2R +

481 CPBT-B75 Hordeum vulgare elite spring 2r S-2R

482 CPBT B78 Hordeum vulgare winter 2r W-2R +

483 CREDO Hordeum vulgare winter 2r W-2R +

484 CRESCENDO Hordeum vulgare winter 2r W-2R +

Page 34

485 TAMISE Hordeum vulgare elite spring 2r S-2R +

486 CWB 5663-1 Hordeum vulgare winter 2r W-2R +

487 CWB 97-6 Hordeum vulgare admixted excluded +

488 CYNTHIA Hordeum vulgare winter 2r W-2R +

489 CYPRESS Hordeum vulgare winter 2r W-2R +

490 CARSTEN-2-ROW Hordeum vulgare admixted excluded

491 DIAMOND Hordeum vulgare admixted excluded +

492 DIGBY Hordeum vulgare admixted excluded +

493 DOLPHIN Hordeum vulgare winter 2r W-2R +

494 DRUID Hordeum vulgare winter 2r W-2R +

495 EAGLE Hordeum vulgare winter 2r W-2R

496 ELECTRON Hordeum vulgare admixted excluded +

497 EMERAUDE Hordeum vulgare admixted excluded +

498 FAHRENHEIT Hordeum vulgare winter 2r W-2R +

499 FANFARE Hordeum vulgare winter 2r W-2R +

500 FARADAY Hordeum vulgare winter 2r W-2R +

501 FIGHTER Hordeum vulgare admixted excluded +

502 FIREFLY Hordeum vulgare winter 2r W-2R +

503 FLUTE Hordeum vulgare winter 2r W-2R +

504 FROLIC Hordeum vulgare admixted excluded +

505 GAZELLE Hordeum vulgare winter 2r W-2R +

506 GLINT Hordeum vulgare winter 2r W-2R +

507 GOLDMINE Hordeum vulgare winter 2r W-2R +

508 GOLDRUSH Hordeum vulgare winter 2r W-2R +

509 GYPSY Hordeum vulgare admixted excluded +

510 HAKA Hordeum vulgare winter 2r W-2R +

511 HALIFAX Hordeum vulgare winter 2r W-2R +

512 HANNA Hordeum vulgare admixted excluded +

513 HARLAND Hordeum vulgare winter 2r W-2R +

514 HARUNA-NIJO Hordeum vulgare admixted excluded

515 HELIGAN Hordeum vulgare winter 2r W-2R +

516 HERMIA Hordeum vulgare winter 2r W-2R +

517 HONEY Hordeum vulgare winter 2r W-2R +

518 HOUSTON Hordeum vulgare winter 2r W-2R +

519 HURRICANE Hordeum vulgare winter 2r W-2R +

520 Beauty Hordeum vulgare winter 2r W-2R +

521 IGRI Hordeum vulgare winter 2r W-2R +

522 IMOGEN Hordeum vulgare admixted excluded +

523 INTRO Hordeum vulgare winter 2r W-2R +

524 JESSICA Hordeum vulgare winter 2r W-2R +

525 JET Hordeum vulgare winter 2r W-2R +

526 JEWEL Hordeum vulgare winter 2r W-2R +

527 JONATHAN Hordeum vulgare winter 2r W-2R +

528 KARISMA Hordeum vulgare admixted excluded +

529 KESTREL Hordeum vulgare winter 2r W-2R +

530 KINGSTON Hordeum vulgare winter 2r W-2R +

531 KITE Hordeum vulgare winter 2r W-2R +

532 LABEA Hordeum vulgare winter 2r W-2R +

533 LAMBADA Hordeum vulgare winter 2r W-2R +

534 LARK Hordeum vulgare winter 2r W-2R +

535 LAUREL Hordeum vulgare winter 2r W-2R +

536 LOUISE Hordeum vulgare winter 2r W-2R

537 LP1124-8-98 Hordeum vulgare elite spring 2r S-2R

538 MADRIGAL Hordeum vulgare winter 2r W-2R +

539 MAGNOLIA Hordeum vulgare winter 2r W-2R

Page 35

540 MAHOGANY Hordeum vulgare admixted excluded

541 MALWINTA Hordeum vulgare winter 2r W-2R +

542 MARINER Hordeum vulgare winter 2r W-2R +

543 MARITEM Hordeum vulgare winter 2r W-2R +

544 MASAI Hordeum vulgare winter 2r W-2R +

545 MASQUERADE Hordeum vulgare winter 2r W-2R +

546 MEAD Hordeum vulgare winter 2r W-2R +

547 MEDOC Hordeum vulgare winter 2r W-2R +

548 MELANIE Hordeum vulgare winter 2r W-2R +

549 MELUSINE Hordeum vulgare admixted excluded +

550 MERODE Hordeum vulgare winter 2r W-2R +

551 MHHX011 Hordeum vulgare winter 2r W-2R +

552 MILENA Hordeum vulgare winter 2r W-2R

553 MILLENA Hordeum vulgare admixted excluded

554 MOLLY Hordeum vulgare winter 2r W-2R +

555 MONTAGE Hordeum vulgare winter 2r W-2R +

556 MOONSHINE Hordeum vulgare winter 2r W-2R +

557 MORTIMER Hordeum vulgare winter 2r W-2R +

558 MUSETTE Hordeum vulgare winter 2r W-2R +

559 MYSTIQUE Hordeum vulgare winter 2r W-2R +

560 NECTARIA Hordeum vulgare winter 2r W-2R +

561 NOCTURNE Hordeum vulgare winter 2r W-2R +

562 INGMAR Hordeum vulgare elite spring 2r S-2R +

563 FLAMINA Hordeum vulgare winter 2r W-2R +

564 Belgravia Hordeum vulgare elite spring 2r S-2R +

565 NSL 97-6002 Hordeum vulgare winter 2r W-2R +

566 OPAL Hordeum vulgare winter 2r W-2R +

567 OUTLOOK Hordeum vulgare winter 2r W-2R

568 OXBRIDGE Hordeum vulgare elite spring 2r S-2R

569 PARASOL Hordeum vulgare admixted excluded +

570 PASTORAL Hordeum vulgare winter 2r W-2R +

571 PEARL Hordeum vulgare winter 2r W-2R +

572 PEDIGREE Hordeum vulgare winter 2r W-2R +

573 PERIDOT Hordeum vulgare winter 2r W-2R +

574 PILOT Hordeum vulgare admixted excluded +

575 PIPPA Hordeum vulgare admixted excluded

576 PORTRAIT Hordeum vulgare winter 2r W-2R +

577 POSAUNE Hordeum vulgare winter 2r W-2R

578 PRELUDE Hordeum vulgare winter 2r W-2R +

579 PUFFIN Hordeum vulgare winter 2r W-2R +

580 PUNCH Hordeum vulgare winter 2r W-2R +

581 PIONEER Hordeum vulgare admixted excluded

582 PIPKIN Hordeum vulgare admixted excluded

583 RATTLE Hordeum vulgare winter 2r W-2R +

584 RAVEL Hordeum vulgare winter 2r W-2R +

585 REGINA Hordeum vulgare old spring 2r excluded

586 RETRIEVER Hordeum vulgare winter 2r W-2R

587 RHYTHM Hordeum vulgare winter 2r W-2R +

588 RICARDA Hordeum vulgare admixted excluded +

589 RIFLE Hordeum vulgare winter 2r W-2R +

590 SAFFRON Hordeum vulgare winter 2r W-2R +

591 SAPPHIRE Hordeum vulgare admixted excluded +

592 SCYLLA Hordeum vulgare winter 2r W-2R +

593 SELECTION Hordeum vulgare winter 2r W-2R +

594 SERGEANT Hordeum vulgare admixted excluded

Page 36

595 SEVILLA Hordeum vulgare winter 2r W-2R

596 SILVERSTONE Hordeum vulgare winter 2r W-2R +

597 SOMBRERO Hordeum vulgare winter 2r W-2R +

598 SONIC Hordeum vulgare winter 2r W-2R +

599 SONJA Hordeum vulgare winter 2r W-2R

600 SPECTRUM Hordeum vulgare winter 2r W-2R

601 SPICE Hordeum vulgare winter 2r W-2R +

602 SPINNER Hordeum vulgare winter 2r W-2R +

603 SPIRIT Hordeum vulgare winter 2r W-2R

604 STEEPLE Hordeum vulgare winter 2r W-2R

605 SUMO Hordeum vulgare winter 2r W-2R +

606 SUNRISE Hordeum vulgare winter 2r W-2R +

607 SW 165 Hordeum vulgare winter 2r W-2R +

608 SW ALISON Hordeum vulgare winter 2r W-2R +

609 SW FARRIER Hordeum vulgare winter 2r W-2R +

610 SW HILLARY Hordeum vulgare winter 2r W-2R +

611 SW NORMA Hordeum vulgare winter 2r W-2R +

612 SW-SIENNA Hordeum vulgare admixted excluded

613 SWALLOW Hordeum vulgare winter 2r W-2R +

614 SWIFT Hordeum vulgare winter 2r W-2R

615 TABETHA Hordeum vulgare winter 2r W-2R +

616 TALLICA Hordeum vulgare winter 2r W-2R +

617 TARGET Hordeum vulgare winter 2r W-2R +

618 TEMPO Hordeum vulgare admixted excluded

619 THALIA Hordeum vulgare winter 2r W-2R +

620 TIFFANY Hordeum vulgare admixted excluded +

621 TIPSTER Hordeum vulgare winter 2r W-2R +

622 TOFFEE Hordeum vulgare winter 2r W-2R +

623 TOKYO Hordeum vulgare admixted excluded +

624 TORRENT Hordeum vulgare admixted excluded +

625 TOSCA Hordeum vulgare winter 2r W-2R +

626 TUCKER Hordeum vulgare winter 2r W-2R +

627 TUDOR Hordeum vulgare admixted excluded +

628 TURINE Hordeum vulgare winter 2r W-2R +

629 TSCHERMAKS Hordeum vulgare admixted excluded

630 VANILLA Hordeum vulgare winter 2r W-2R

631 VILNA Hordeum vulgare winter 2r W-2R

632 VOLLEY Hordeum vulgare winter 2r W-2R +

633 WB 031031 Hordeum vulgare winter 2r W-2R +

634 WEAVER Hordeum vulgare winter 2r W-2R +

635 WHISPER Hordeum vulgare winter 2r W-2R

636 WIGWAM Hordeum vulgare winter 2r W-2R

637 WILLOW Hordeum vulgare winter 2r W-2R +

638 WINNER Hordeum vulgare elite spring 2r S-2R

639 WIZARD Hordeum vulgare winter 2r W-2R +

640 WOMBAT Hordeum vulgare winter 2r W-2R +

641 WINTMALT Hordeum vulgare winter 2r W-2R +

642 ZULU Hordeum vulgare winter 2r W-2R +

643 CLARA Hordeum vulgare winter 2r W-2R

644 FLAGON Hordeum vulgare winter 2r W-2R +

645 KIRA Hordeum vulgare winter 2r W-2R +

646 SCRI-S-0000638 Hordeum vulgare winter 2r W-2R

647 SCRI-S-0000658 Hordeum vulgare winter 2r W-2R

648 SCRI-S-0000687 Hordeum vulgare winter 2r W-2R

649 SCRI-S-0004248 Hordeum vulgare winter 2r W-2R

Page 37

650 SCRI-S-04349 Hordeum vulgare winter 2r W-2R

651 SCRI-S-04351 Hordeum vulgare winter 2r W-2R

652 ACI Hordeum vulgare admixted excluded

653 AQUARELLE Hordeum vulgare winter 2r W-2R

654 PLAISANT Hordeum vulgare winter 6r excluded

655 PLATINE Hordeum vulgare winter 2r W-2R

656 PONENTE Hordeum vulgare winter 6r excluded

657 PRINCESS Hordeum vulgare winter 6r excluded

658 ROBUR Hordeum vulgare winter 6r excluded

659 SAIGON Hordeum vulgare winter 2r W-2R

660 SENTA Hordeum vulgare winter 6r excluded

661 SONJA-2 Hordeum vulgare admixted excluded

662 ARDA Hordeum vulgare winter 2r W-2R

663 SONORA Hordeum vulgare winter 6r excluded

664 SPRITE Hordeum vulgare winter 2r W-2R

665 TAPIR Hordeum vulgare admixted excluded

666 TARGET-2 Hordeum vulgare old spring 2r excluded

667 TEA Hordeum vulgare old spring 2r excluded

668 TIFFANY-2 Hordeum vulgare admixted excluded

669 TORRENT-2 Hordeum vulgare winter 6r excluded

670 TRASIMENO Hordeum vulgare winter 6r excluded

671 TREBBIA Hordeum vulgare old spring 2r excluded

672 TRIA Hordeum vulgare admixted excluded

673 VANESSA Hordeum vulgare old spring 2r excluded

674 VERTICALE Hordeum vulgare winter 2r W-2R

675 VICTORY Hordeum vulgare old spring 2r excluded

676 VOGELSANGER_GO

LD

Hordeum vulgare winter 6r excluded

677 ZACINTO (NAKED) Hordeum vulgare winter 2r W-2R

678 ZOE Hordeum vulgare winter 6r excluded

679 AGNETA Hordeum vulgare spring 6r excluded

680 ARMA Hordeum vulgare winter 6r excluded

681 AKKA_(W_6039) Hordeum vulgare admixted excluded

682 ASSO Hordeum vulgare admixted excluded

683 Unknown 1 Hordeum vulgare admixted excluded +

684 ARRA Hordeum vulgare spring 6r excluded

685 ARTTURI Hordeum vulgare spring 6r excluded

686 ASTRID Hordeum vulgare old spring 2r excluded

687 ASPLUND Hordeum vulgare spring 6r excluded

688 ATHENE Hordeum vulgare winter 6r excluded

689 AYDANHANIM Hordeum vulgare admixted excluded

690 Unknown 2 Hordeum vulgare spring 6r excluded +

691 BOTNIA Hordeum vulgare spring 6r excluded

692 EX178 Hordeum vulgare admixted excluded

693 BALAKI Hordeum vulgare winter 6r excluded

694 BALDA Hordeum vulgare winter 6r excluded

695 CLARA_(W5690) Hordeum vulgare old spring 2r excluded

696 AIACE Hordeum vulgare admixted excluded

697 BARAKA Hordeum vulgare winter 6r excluded

698 DIOMEDE Hordeum vulgare admixted excluded

699 CANORO Hordeum vulgare winter 6r excluded

700 DRUVIS Hordeum vulgare admixted excluded

701 EDDA Hordeum vulgare spring 6r excluded

702 EERO Hordeum vulgare spring 6r excluded

703 CARAT Hordeum vulgare winter 2r W-2R +

Page 38

704 ERKKI Hordeum vulgare spring 6r excluded

705 CAROLA Hordeum vulgare winter 6r excluded

706 FRISIA Hordeum vulgare admixted excluded

707 HANKKIJA_673 Hordeum vulgare spring 6r excluded

708 CHESS Hordeum vulgare admixted excluded

709 HATIF_DE_GRIGNO

N

Hordeum vulgare admixted excluded

710 HERSE Hordeum vulgare spring 6r excluded

711 CLARA-2 Hordeum vulgare winter 2r W-2R

712 JADAR Hordeum vulgare admixted excluded

713 JARLE Hordeum vulgare spring 6r excluded

714 JYVÄ Hordeum vulgare admixted excluded

715 KAJSA Hordeum vulgare spring 6r excluded

716 KILTA Hordeum vulgare spring 6r excluded

717 AIRONE Hordeum vulgare admixted excluded

718 DEA Hordeum vulgare winter 6r excluded

719 DIADEM Hordeum vulgare winter 2r W-2R

720 LISE Hordeum vulgare spring 6r excluded

721 DOLMEN Hordeum vulgare winter 2r W-2R

722 MASKIN Hordeum vulgare spring 6r excluded

723 EX334 Hordeum vulgare old spring 2r excluded

724 TIPPLE-2 Hordeum vulgare elite spring 2r S-2R

725 DUET Hordeum vulgare admixted excluded

726 NIINA Hordeum vulgare spring 6r excluded

727 OLLI Hordeum vulgare admixted excluded

728 DURA Hordeum vulgare winter 6r excluded

729 OTRA Hordeum vulgare spring 6r excluded

730 PAAVO Hordeum vulgare admixted excluded

731 ESTEREL Hordeum vulgare winter 6r excluded

732 POHTO Hordeum vulgare admixted excluded

733 POKKO Hordeum vulgare spring 6r excluded

734 POMO Hordeum vulgare old spring 2r excluded

735 POTRA Hordeum vulgare spring 6r excluded

736 PRIORA_(NAKED) Hordeum vulgare admixted excluded

737 EXPRESS Hordeum vulgare winter 6r excluded

738 ROLFI Hordeum vulgare old spring 2r excluded

739 RONDO_(NAKED) Hordeum vulgare admixted excluded

740 FANFARE-2 Hordeum vulgare winter 2r W-2R

741 ALCE Hordeum vulgare admixted excluded

742 FEDERAL Hordeum vulgare winter 6r excluded

743 SILJA Hordeum vulgare spring 6r excluded

744 SUVI Hordeum vulgare admixted excluded

745 TAMMI Hordeum vulgare spring 6r excluded

746 TEELE Hordeum vulgare spring 6r excluded

747 TEEMU Hordeum vulgare spring 6r excluded

748 FINESSE Hordeum vulgare winter 2r W-2R

749 TELLUS_(W_5897) Hordeum vulgare old spring 2r excluded

750 TIDONE Hordeum vulgare admixted excluded

751 FRANKA Hordeum vulgare winter 6r excluded

752 VAIROGS Hordeum vulgare spring 6r excluded

753 VARDE Hordeum vulgare spring 6r excluded

754 FRIDERICUS Hordeum vulgare winter 6r excluded

755 FROST Hordeum vulgare winter 6r excluded

756 STEPTOE Hordeum vulgare admixted excluded

757 MOREX Hordeum vulgare admixted excluded +

Page 39

758 GERBEL Hordeum vulgare winter 6r excluded

759 GLEAM Hordeum vulgare winter 2r W-2R

760 GLENAN Hordeum vulgare winter 6r excluded

761 GRETE Hordeum vulgare winter 6r excluded

762 ALDEBARAN Hordeum vulgare winter 6r excluded

763 HALCYON Hordeum vulgare admixted excluded

764 HASSO Hordeum vulgare winter 6r excluded

765 HELIGAN-2 Hordeum vulgare winter 2r W-2R

766 HEREFORDIA Hordeum vulgare winter 6r excluded

767 HOPPEL Hordeum vulgare winter 6r excluded

768 ISA Hordeum vulgare winter 6r excluded

769 JAIDOR Hordeum vulgare admixted excluded

770 KASKADE Hordeum vulgare admixted excluded

771 ALFEO Hordeum vulgare winter 2r W-2R

772 KELIBIA Hordeum vulgare winter 2r W-2R

773 KETOS Hordeum vulgare winter 6r excluded

774 LAVERDA Hordeum vulgare winter 6r excluded

775 LEONIE Hordeum vulgare winter 2r W-2R

776 LONNI Hordeum vulgare winter 6r excluded

777 LORENA Hordeum vulgare winter 6r excluded

778 LUDMILLA Hordeum vulgare winter 2r W-2R

779 LUTECE Hordeum vulgare winter 6r excluded

780 ALISEO Hordeum vulgare admixted excluded

781 MALTA Hordeum vulgare admixted excluded

782 MANITOU Hordeum vulgare winter 6r excluded

783 MANOLIA Hordeum vulgare winter 6r excluded

784 MARADO Hordeum vulgare winter 6r excluded

785 MARINKA Hordeum vulgare admixted excluded

786 MARIS OTTER Hordeum vulgare winter 2r W-2R

787 MARIS TROJAN Hordeum vulgare winter 2r W-2R

788 MATTINA Hordeum vulgare winter 6r excluded

789 AMILLIS Hordeum vulgare admixted excluded

790 MIRCO Hordeum vulgare winter 6r excluded

791 MIRRA Hordeum vulgare winter 6r excluded

792 MURCIE Hordeum vulgare winter 2r W-2R

793 MUSCAT Hordeum vulgare winter 6r excluded

794 NAOMIE Hordeum vulgare winter 6r excluded

795 NURE Hordeum vulgare admixted excluded +

796 ONICE Hordeum vulgare admixted excluded

797 OPAL-2 Hordeum vulgare winter 2r W-2R

798 OSIRIS Hordeum vulgare admixted excluded

799 PANDA Hordeum vulgare admixted excluded

800 PASSPORT Hordeum vulgare winter 6r excluded

801 PATRICIA Hordeum vulgare winter 6r excluded

802 PILASTRO Hordeum vulgare admixted excluded

803 PIRATE Hordeum vulgare winter 6r excluded

804 PIRKKA Hordeum vulgare spring 6r excluded

Page 40

Supplementary Table 8: Regions under strong divergent selection (Fst > 0.9).

chromosome

genetic interval in

MxB population

(cM)

Putative

locus

1H 90.29-93.06 PPD-H2*

2H 57.43-62.46 EPS-2

2H 97.38-97.38 ?*

2H 117.99-120.96 ?*

3H 17.35-17.35 ?*

3H 116.36-116.99 DENSO*

4H 107.36-114.94 VRN-H2

5H 95-95 FR-2

5H 121.25-152.36 VRN-H1

* not cloned

Page 41

Supplementary Table 9: Analyses of variance for Days to Heading (DtH), Grain yield

(Yield) and Thousand grain weight (Tgw) traits.

Supplementary Table 9: Analyses of variance for Days to Heading (DtH), Grain yield (Yield)

and Thousand grain weight (Tgw) traits. Genotypic effects are partitioned using marker

alleles at the four main loci regulating barley phenology segregating in the Nure X Tremois

mapping population

Trait Source of variation d.f. Sum of squares R2 Mean squares Variance ratio p -Value -Log(p )

DtH Total 1338 1888858.7

Environment 12 1872542.0 99.14 156045.2 29232.9 <0.001 >>100

Genotype 102 9783.0 0.52 95.9 18.0 <0.001 177.3

Ppd-H2 1 814.7 8.33 814.7 34.3 <0.001 7.6

Eam6 1 6479.5 66.23 6479.5 273.2 <0.001 30.2

Vrn-H2 1 54.7 0.56 54.7 2.3 0.083 1.1

Vrn-H1 1 109.6 1.12 109.6 4.6 0.019 1.7

Residual G 98 2324.6 23.76 23.7 4.4 <0.001 33.7

Residual 1224 6533.7 0.35 5.3

Yield Total 1338 3771.0

Environment 12 3297.7 87.45 274.8 830.7 <0.001 >100

Genotype 102 68.5 1.82 0.7 2.0 <0.001 6.1

Ppd-H2 1 2.7 3.94 2.7 5.9 0.009 2.0

Eam6 1 20.2 29.49 20.2 43.9 <0.001 9.2

Vrn-H2 1 0.5 0.73 0.5 1.1 0.222 0.7

Vrn-H1 1 0.1 0.07 0.1 0.2 0.948 0.0

Residual G 98 45.1 65.84 0.5 1.4 0.127 0.9

Residual 1224 404.9 10.74 0.3

Tgw Total 1025 46017.2

Environment 9 35287.6 76.68 3920.8 720.8 <0.001 >100

Genotype 102 5758.1 12.51 56.5 10.4 <0.001 95.1

Ppd-H2 1 34.2 0.59 34.2 1.7 0.134 0.9

Eam6 1 3681.7 63.94 3681.7 178.8 <0.001 23.8

Vrn-H2 1 14.8 0.26 14.8 0.7 0.328 0.5

Vrn-H1 1 9.6 0.17 9.6 1.8 0.124 0.9

Residual G 98 2017.8 35.04 20.6 3.8 <0.001 24.3

Residual 914 4971.5 10.80 5.4

Page 42

Supplementary Table 10 Characterisation of putative mat-c mutants

We obtained seed for 29 of 31 putative mat-c mutants available in the Nordgen Genebank. For two of these, we had no wild type seed for comparison so they

were not considered further. In 2011 DNA was isolated from germinating seedlings of all 27 remaining accessions. 10 independent accessions were

line Putative MAT-C mutants line idwild type

days to flower (2011)

relative to wild type:

sowing 1/5/2011 s.e.

days to flower (2012)

relative to wild type:

sowing 15/5/2012 s.e.

mutation event: 1978 bp sequenced

including 376 bp upstream (promotor +

enhancer region) and 633 bp downstream comments

WT bonus 73 59

WT foma 73 59

WT kristina No parental seed

WT semira - 58

WT Sv Vg74233 No parental seed

1 mat-c.32 bonus -5.50 0.16 - - non conservative aa change

2 mat-c.93 bonus -3.69 0.63 - - non conservative aa change

3 mat-c.94 bonus -9.11 0.26 -8.30 0.18 splice site

4 mat-c.770 bonus -7.25 0.36 - - alternative transcription start site?

5 mat-c.907 bonus -8.81 0.50 - - non conservative aa change

6 mat-c.913 bonus -4.63 0.42 - - non conservative aa change

7 mat-c.943 bonus -6.25 0.58 - - non conservative aa change

8 mat-c.966 bonus -7.25 0.60 - - non conservative aa change

9 mat-c.400 foma -6.50 0.54 - - non conservative aa change

10 mat-c.1114 foma -8.93 0.61 - - splice site

11 mat-c.16 bonus - - -4.38 0.38 none detected

12 mat-c.19 bonus - - -3.75 0.31 none detected

13 mat-c.758 bonus - - -0.32 0.20 none detected Does not show early flowering phenotype

14 mat-c.760 bonus - - -2.46 0.47 none detected Weak phenotype: flowering < 3 days earlier relative to wild type

15 mat-c.865 bonus - - -2.25 0.87 none detected Weak phenotype: flowering < 3 days earlier relative to wild type

16 mat-c.881 bonus - - -2.08 0.56 ATG 436 bp outside the CDS Weak phenotype: flowering < 3 days earlier relative to wild type

17 mat-c.910 bonus - - 0.25 0.32 none detected Does not show early flowering phenotype

18 mat-c.926 bonus -0.13 0.56 none detected Does not show early flowering phenotype

19 mat-c.101 foma - - -0.03 0.22 none detected Does not show early flowering phenotype

20 mat-c.122 foma - - -0.25 0.44 none detected Distinct phenotype - Short plants and large amount of secondary tillers.

Not early flowering

21 mat-c.1107 foma - - -5.90 0.55 none detected

22 mat-c.1108 foma - - -6.38 0.55 none detected

23 mat-c.1109 foma - - -5.90 0.61 single bp deletion

24 mat-c.1115 foma - - -7.00 0.37 non conservative aa change

25 mat-c.1102 semira - - -7.10 0.61 template didnt amplify from genomic DNA Distinct phenotype. Extreme mutant lines - Shorter than c.94. Very low

internode number per tiller and extremelly short spike.

26 mat-c.1118 semira - - -8.93 0.67 template didnt amplify from genomic DNA Distinct phenotype. Extreme mutant lines - Shorter than c.94. Very low

internode number per tiller and extremelly short spike.

27 mat-c.1120 semira - - -5.80 0.60 template didnt amplify from genomic DNA Distinct phenotype. Extreme mutant lines - Shorter than c.94. Very low

internode number per tiller and extremelly short spike.

28 mat-c.745 Kristina - - - - ND No wild type seed available

29 mat-c.1091 Sv Vg74233 - - - - ND No wild type seed available

30 mat-c.1111 - - - - ND No seed available

31 mat-c.1096 - - - - ND No seed available

Page 43

identified that harboured mutations and these were phenotyped for flowering time. The data for these lines is given in Figure 3b, main text. The remainder

were not considered further in 2011. In 2012 multiple individuals from the 17 accessions not considered in 2011 (plus controls) were subsequently grown for

phenotypic and genotypic analysis. For eleven no mutations were detected. Of these, seven flowered less then 2.5 days earlier than wild type and were not

considered early flowering mutants while four accessions remain classified as early flowering. One accession (mat-c 881) had a mutation downstream of the

coding region but also flowered <2.5 days earlier than WT and was not classified as early flowering. Of the remaining five accessions, two were

heterogeneous for flowering time (mat-c1109 and mat-c1115) (i.e. early flowering clearly segregated in different seed from a single accession).

Resequencing HvCEN in the early flowering individuals identified a 1bp deletion (mat-c 1109) and a non-conservative amino acid change (mat-c 1115) in

these accessions. For the last three accessions (mat-c 1102, 1118 and 1120) we were unable to amplify HvCEN. However amplifications from their parental

line was successful suggesting these lines putatively contained deletions of the entire locus. Interestingly, all three had a distinct morphological phenotype in

addition to being early flowering. Therefore, in summary 15 of the 27 mutants examined contained lesions that were associated with early flowering. 8 of

the 27 flowered within 2.5 days of their parental lines, did not contain mutations and were re-classified as WT for MAT-C. For the remaining 4 of the 27 early

flowering lines we failed to detect any lesions in the resequenced amplicons. Thus we identified lesions in 15 out of 19 early flowering and putative MAT-C

mutants.

Page 44

Supplementary Table 12: Haplotypes observed in germplasm surveyed.

Hap_I CACTATTTGCCCGC

Hap_II ..T.G..AT...C.

Hap_III ..T.G.........

Hap_IV ..T.G..AT.T.C.

Hap_V ..T.G......T..

Hap_VI ..T.G..AT...CT

Hap_VII .........T....

Hap_VIII ..TCG.........

Hap_IX ..T.G.......C.

Hap_X ..T.GC......C.

Hap_XI .GT.G..AT...C.

Hap_XII G.T.G.........

Hap_XIII ..T.G.C.....C.

Supplementary Table 12: Haplotypes observed in germplasm surveyed. SNP positions in the

657bp fragment are: 48 – 50 – 63 – 65 – 93 – 119 – 177 – 229 – 252 – 271 – 390 – 498 –

531 (Pro-135-Ala) – 599. SNPs in coding regions are highlighted in red. The Nure C,

Pro/Tremois G, Ala– SNP (P135A) is highlighted in red and bold. Only this SNP in the

coding region (last exon of HvCEN) led to an amino acid change (P135A). Haplotypes

harboring Pro-135 (CCT) are II, IV, VI, IX, X, XI and XIII. Haplotypes I, III, V, VII, VIII and

XII harbor Ala-135 (GCT).

Page 45

Supplementary Table 13: Nucleotide state at alignment position 531 (P135A: Pro-135

(CCT) /Ala-135 (GCT)) for Triticeae species.

Nure (total seven barley haplotypes) vs. Tremois (total: six barley haplotypes) C -> G

Nure vs. Triticum urartu C -> C

Nure vs. Aegilops speltoides C -> C

Nure vs. Aegilops tauschii C -> C

Nure vs. Aegilops bicornis C -> C

Nure vs. Aegilops longissima C -> C

Nure vs. Aegilops sharonenis C -> C

Nure vs. Aegilops searsii C -> C

Nure vs. Aegilops markgrafii C -> C

Nure vs. Aegilops umbellulata C -> C

Nure vs. Triticum boeoticum C -> C

Nure vs. Triticum monococcum C -> C

Nure vs. Triticum aestivum genome A C -> C

Nure vs. Triticum aestivum genome B C -> C

Nure vs. Triticum aestivum genome D C -> C

Nure vs. Hordeum murinum ssp. glaucum C -> C

Nure vs. Hordeum californicum C -> C

Nure vs. Hordeum cordobense C -> C

Nure vs. Secale cereale C -> C