Originally published 28 September 2018; corrected 13 December 2018

www.sciencemag.org/content/361/6409/eaao4227/suppl/DC1

Supplementary Materials for

Neutrophil extracellular traps produced during inflammation awaken

dormant cancer cells in mice

Jean Albrengues, Mario A. Shields, David Ng, Chun Gwon Park, Alexandra Ambrico,

Morgan E. Poindexter, Priya Upadhyay, Dale L. Uyeminami, Arnaud Pommier, Victoria

Küttner, Emilis Bružas, Laura Maiorino, Carmelita Bautista, Ellese M. Carmona, Phyllis

A. Gimotty, Douglas T. Fearon, Kenneth Chang, Scott K. Lyons, Kent E. Pinkerton,

Lloyd C. Trotman, Michael S. Goldberg, Johannes T.-H. Yeh, Mikala Egeblad*

*Corresponding author. Email: egeblad@cshl.edu

Published 28 September 2018, Science 361, eaao4227 (2018)

DOI: 10.1126/science.aao4227

This PDF file includes:

Materials and Methods

Figs. S1 to S15

Captions for Movies S1 to S8

References

Other Supplementary Material for this manuscript includes the following:

(available at www.sciencemag.org/content/361/6409/eaao4227/suppl/DC1)

Movies S1 to S8

Correction: In the Research Article “Neutrophil extracellular traps produced during

inflammation awaken dormant cancer cells in mice,” figure panels S6C, S6D, S7H, S8D,

and S8E have been replaced. A systematic error in the transfer of raw image files into

image analysis software and subsequently Adobe Illustrator led to errors in the assembly

of figure panels S6C, S6D, S7H, and S8E. In addition, due to human error, an incorrect

part of the gel was used for the condition “C5a” during assembly of fig. S8D. None of

these changes affect the conclusions of the paper.

2

Supplementary Text

Supplementary Materials and Methods

Cell culture

D2.0R and D2.A1 cells were obtained from Dr. Jeffrey Green (National Institutes of Health

[NIH]) and cultured in Dulbecco’s Modified Eagle Medium (DMEM) (#10-013-CV,

Cellgro) supplemented with 10% fetal calf serum (FCS) (#1500-500, Seradigm), 100

units/mL penicillin, and 100 g/mL streptomycin. MCF-7 cells (obtained from Cold Spring

Harbor Laboratory [CSHL] Tissue Culture Facility) were cultured in DMEM

supplemented with 10% FCS, 100 units/mL penicillin, 100 g/mL streptomycin, and 10

nM -estradiol (#E8875, Sigma). Plate-E and 293T cells (obtained from CSHL Tissue

Culture Facility) were cultured in DMEM supplemented with 10% FCS. Cells were tested

repeatedly for mycoplasma over the course of the study, and were never positive.

To generate mCherry- and luciferase-expressing cells, a pGIPz vector containing

cDNA for mCherry and luciferase (Open Biosystems) was used. Lentiviral supernatants

were collected from a 293T packaging cell line transfected with the construct. D2.0R and

MCF-7 cells were infected with the viral supernatants overnight in the presence of 10

μg/mL polybrene (#TR-1003-G, Sigma) and selected with 1 μg/ml puromycin (#sc-

108071, Santa Cruz Biotechnology).

The pBOB-EF1-FastFUCCI-Puro vector was used to express the FUCCI cell cycle

reporter (23). Lentiviral supernatants were collected from 293T packaging cells transfected

with the construct. D2.0R cells were infected with the viral supernatants through a 1.5-hour

spin infection at 1,000 x g at 33 °C, and 72 hours later, were selected with 2 μg/ml

puromycin (#sc-108071, Santa Cruz Biotechnology). Then, the cells were sorted for high-

expressing red and/or green cells.

The pTOL-hCMV-TET3G-Hygro Transactivator vector (CSHL Cancer Center

Functional Genomics and Genetics Shared Resource) was used to express the Tet-On® 3G

doxycycline-dependent transactivator. Lentiviral supernatants were collected from 293T

packaging cells transfected with the construct. D2.0R mCherry-luciferase cells were

infected with the viral supernatants overnight in the presence of 10 μg/mL polybrene and

selected with 750 μg/ml hygromycin B (#10687010, Thermo Fisher Scientific).

Short hairpins (Ultramir, 5th-generation (50)) targeting Integrin , FAK, MLCK, and

YAP, as well as control short hairpins were cloned into the LTR-TRE3Gpro-DsRed-

mir30cassette-PGKpro-Venus-IRES-Neo-sinLTR vector. Lentiviral supernatants were

collected from a 293T packaging cell line transfected with the constructs. D2.0R mCherry-

luciferase Tet-On 3G cells were infected with the viral supernatants overnight in the

presence of 10 μg/mL polybrene (Sigma) and selected with 750 μg/ml geneticin

(#10131035, Thermo Fisher Scientific). In vitro, 1 μg/ml doxycycline (#D9891, Sigma)

was used to induce shRNA expression. The shRNA sequences used to target Integrin ,

FAK, MLCK, and YAP, as well as control short hairpins are listed below.

Integrins 3, 5, 6, 7, 8, 9, v, NE and MMP9 knockdowns were performed by

infecting D2.0R cells with lentivirus using the MISSION shRNA Lentiviral Transduction

system from Sigma and the following RNAi Consortium numbers (TRCNs): 3 TRCN

0000065998 and TRCN 0000066000; 5 TRCN 00000262922 and TRCN 00000262923;

6 TRCN 0000066148 and TRCN 0000066149; 7 TRCN 0000066188 and TRCN

3

0000066192; 8 TRCN 0000066238 and TRCN 0000066240; 9 TRCN 0000066328 and

TRCN 0000066332; v TRCN 0000066590 and TRCN 0000066591; NE TRCN

0000032596 and TRCN 0000453732; MMP9 TRCN 0000031230 and TRCN 0000031233;

non-targeted shRNA control Lentiviral Transduction Particles SHC002V. Lentiviral

transduction was done following the manufacturer’s instructions. Infected cells were

selected with 1 μg/ml puromycin (#sc-108071, Santa Cruz). The shRNAs all had the same

sequence surrounding the 21 specific nucleotides (underlined), as exemplified for the

Renilla Luciferase non-targeting control:

AGATCTTGTTTGAATGAGGCTTCAGTACTTTACAGAATCGTTGCCTGCACATC

TTGGAAACACTTGCTGGGATTACTTCTTCAGGTTAACCCAACAGAAGGCTAA

AGAAGGTATATTGCTGTTGACAGTGAGCGCAGGAATTATAATGCTTATCTAT

AGTGAAGCCACAGATGTATAGATAAGCATTATAATTCCTATGCCTACTGCCTC

GGACTTCAAGGGGCTACTTTAGGAGCAATTATCTTGTTTACTAAAACTGAATA

CCTTGCTATCTCTTTGATACATTTTTACAAAGCTGAATTAAAATGGTATAAAT

TAAATCACTTTACGCGT

For the shRNA sequences presented below, only the 21 specific nucleotides are listed.

Integrin 1-1: ATAATGTGATCCAGCTAATCA

Integrin 1-2: ATCCCACTTCAATCTCACCAA

FAK-1: AGACCTGGCATCTTTGATATT

FAK-2: AACCTGGCATCTTTGATATTA

MLCK-1: ACACTGTCACCGTCCAAGAGA

MLCK-2 :CGACAATGATAACGAGACCTT

YAP-1: CGACATCTTCTGGTCAAAGAT

YAP-2: CGGCTGCCACCAAGCTAGATA

Cell culture reagents

Lipopolysaccharide (LPS) (#L4391, Sigma) was used at 100 ng/ml; phorbol 12-myristate

13-acetate (PMA, #P1585, Sigma) was used at 20 nM; N-formylmethionyl-leucyl-

phenylalanine (fMLP, #F3056, Sigma) was used at 1 μM; recombinant mouse and human

complement 5a (#2150-C5/CF and #2037-C5/CF, respectively, R & D Systems) was used

at 100 ng/ml; cigarette smoke extract (CSE, Murty Pharmaceuticals Inc., generated by

smoking on an Federal Trade Commission Smoke Machine, University of Kentucky’s

3R4F standard research cigarettes) was used at 600 μg/ml unless otherwise stated. The

PAD4 inhibitor GSK484 (#14788, Cayman Chemical) was used at 10 μM to inhibit

Neutrophil Extracellular Traps (NETs) formation, and 1.5 units/ml of DNase I

(#04536282001, Sigma) was used to digest NET scaffolds. Taurolidine (#T7329, Sigma)

was used at 50 μg/ml to neutralize LPS. Recombinant mouse and human neutrophil elastase

(NE) (#4517-SE-010, R & D Systems and #ab91099, Sigma, respectively) and

recombinant mouse and human metalloproteinase (MMP) 9 (#909-MM-010, R & D

Systems and #ab157344, Abcam, respectively) were used at 2 μg/ml unless otherwise

stated. Anti-Integrin 1 antibodies, clone AIIB2 (#MABT409, EMD Millipore) and clone

Ha2/5 (#5555003, BD Biosciences) were used at 10 μg/ml to inhibit Integrin 1 activity;

PF-562271 (#HY-10458, Medchem Express) was used at 1 μM to inhibit FAK activity;

PD184352 (#sc-202759, Santa Cruz Biotechnology) was used at 1 μM to inhibit MEK

4

activity; ML7 hydrochloride (#4310, Tocris) was used at 1 μM to inhibit MLCK activity;

blebbistatin (#S709901, Selchem Chemicals) was used at 5 μM to inhibit non-muscle

myosin II; and verteporfin (#SML0534, Sigma) was used at 1 μM to inhibit YAP activity.

Sivelestat (#3535, Tocris), MMP9 inhibitor 1 (#44278, Calbiochem), and Cathepsin G

inhibitor 1 (#219372, EMD Millipore) were used at 10 μM to inhibit NE, MMP9, and

Cathepsin G activity, respectively. mLaminin-111 (#3446-005-01, R & D Systems), hLN-

111, -121, -211, -221, -411, -421, -511 (Biolamina), mTSP-1 (#7859-TH-050, R & D

Systems), and hTSP-1 (#3074-TH, R & D Systems) were used as indicated below in the

methods section.

Antibodies

For Western blot analysis, antibodies against Integrin 1 (#sc-6622) and YAP (#sc10199)

were purchased from Santa Cruz Biotechnology; MLC2 (#3672), pThr18/Ser19-MLC2

(#3674), pT202/Y204-ERK1/2 (#9101), ERK1/2 (#9107S), HSP90 (#4877S), and FAK

(#3285) were from Cell Signaling; laminin-111 (#ab11575) and MLCK (#ab76092) were

from Abcam; TSP-1 (#MS-1066-P1ABX) was from Thermo Fisher Scientific, and pY397-

FAK (#NBP1-60837) was from Novus Biologicals. For immunofluorescence staining of

in vitro cultures, antibodies against Ki67 (#NB110-89717, Novus Biologicals), active

mouse Integrin 1 (clone 9EG7, #550531, BD Biosciences), active human Integrin 1

(Clone Huts-21, #556047, BD Pharmingen), myeloperoxidase (#A0398, Dako), and

Histone H2B (#ab52484, Abcam) were used. Alexa Fluor 568 phalloidin (#A12380,

Thermo Fisher Scientific) was used to stain F-actin. For immunofluorescence on tissue

samples, antibodies against Ly6G (clone 1A8, #551459, BD Pharmingen), RFP-mCherry

(#600-401-379, Rockland or #M11217, Invitrogen), Ki67 (#12075, Cell Signaling),

myeloperoxidase (#AF3667, R & D Systems), laminin-111 (#ab11575, Abcam), and

citrullinated histone H3 (#ab5103, Abcam) were used. For ELISA, an anti-elastase

antibody (#sc-9521, Santa Cruz Biotechnology) and an anti-DNA peroxidase conjugated

antibody (#11774425001, Roche) were used. For flow cytometry analysis, antibodies

against Integrin 1 (#142605), Integrin 2 (#103515), Integrin 4 (#103705), Integrin 5

(#103805), Integrin v (#104105), CD4 (#100428, clone GK1.5), CD8 (#100714, clone

53.6.7), TcR beta clone (#109222, clone H57-597), TcR gamma delta (#118106, clone

GL3), CD19 (#152406, clone 1D3), CD45 (#103138, clone 30-F11), NKp46 (#137716,

clone 29A1.4), CD11b (#101224, clone M1/70), CD11c (#117318, clone N418), Ly6C

(#128016, clone HK1.4), Ly6G (#127606, clone 1A8), GR1 (#108408, clone RB6-8C5),

and streptavidin (#405214) were purchased from Biolegend; Integrin 3 (#FAB2787P),

Integrin 6 (#FAB13501P), Integrin 7 (#FAB3518A), Integrin 8 (#AF4076), and

Integrin 9 (#FAB3827P) from R & D Systems; Integrin 10 (#PAC096Mu01) from

Cloud-Clone Corp.; and Integrin 1 (#037132) from US Biological Life Sciences.

Proliferation assay on LN-111 and TSP-1 coated hydrogel

In this assay, D2.0R cells were used on mLN-111- and mTSP-1-coated hydrogel, and

MCF-7 cells were used on hLN-111,-121, -211, -221, -411, -421, -511, and hTSP-1-coated

hydrogel. 96-well 0.2 kPa hydrogel plates (#SW96G-EC-0.2, Matrigen) were coated

overnight with 50 μg/ml hLN (Biolamina), 50 μg/ml mLN-111 (#3446-005-01, R & D

Systems), mTSP-1 (#7859-TH-050, R & D Systems) or hTSP-1 (#3074-TH, R & D

Systems). The next day, the coating solution was aspirated, and mCherry-luciferase MCF-

5

7 cells or D2.0R cells (2×103) were resuspended in 100 l of DMEM supplemented with

1% FCS and 10 μg/ml human or murine LN-111 and TSP-1, respectively, and added to the

coated plates. The following day, the medium was replaced with 100 μL of CM from

neutrophils cultured at indicated conditions. The CM was changed every four days.

Proliferation was measured by BLI after 14 days using a plate reader (SpectraMax i3,

Molecular Devices).

Extracellular matrix remodeling assay

In this assay, D2.0R cells were used on matrigel-coated culture plates or mLN-111- and

mTSP-1-coated hydrogel, and MCF-7 cells were used on hLN-111- and hTSP-1-coated

hydrogel. Murine recombinant proteases were used with D2.0R cells, while human

recombinant proteases were used with MCF-7 cells. Coated matrigel, laminin-111, or TSP-

1 was incubated with recombinant proteases or CM (with or without inhibitors, as indicated

in figure legends) overnight at 37 °C and washed twice with phosphate buffer saline (PBS)

before adding cancer cells to the culture. After 14 days, the number of cancer cells was

assessed by BLI as described above.

Isolation of neutrophils

Mouse neutrophils were harvested from eight-week-old female BALB/c mice. For

neutrophil isolation from NE KO and MMP9 KO mice, wild-type C57BL/6J mice from

Charles River Laboratories were used as controls; all the mice were eight-week old

females. The bone marrow of the femurs and tibias was isolated in sterile Hank’s buffered

salt solution (HBSS) without Ca2+/Mg2+ (#14175-095, Gibco) and containing

penicillin/streptomycin. The bone marrow cell pellets were resuspended in ammonium-

chloride-potassium (ACK) buffer (0.15 M NH4Cl, 10 mM KHCO3, 0.1 mM Na2-

ethylenediaminetetraacetic acid [EDTA] pH 7.4) and washed twice with HBSS without

Ca2+/Mg2+. Neutrophils were separated from mononuclear cells by layering 2 mL of the

cell suspension on 3 mL of 81% Percoll (#17-0891-02, GE Healthcare) and under 3 mL of

62% Percoll, followed by centrifugation at 2,500 x g for 20 min at 4 °C. The middle layer

enriched for neutrophils was washed twice in HBSS without Ca2+/Mg2+, and cells were

resuspended in serum-free DMEM.

Neutrophils were isolated from healthy female volunteers after approval by the IRB of

CSHL and after informed consent was obtained (IRB-13-025). Whole blood (10 mL) was

collected by venipuncture into a 15 mL centrifuge tube containing 2 mL of 0.5 M EDTA,

pH 8.0. Then, 5 mL of whole blood was layered on top of 5 mL of Polymorphprep

(#1114683, Axis-Shield) in a 15 mL tube and centrifuged at 500 x g for 30 min at room

temperature. The lower leukocyte band containing neutrophils was collected, washed, and

resuspended into 5 mL of ACK lysis buffer, washed twice in HBSS without Ca2+/Mg2+,

and finally resuspended in serum-free DMEM.

Western blot

For immunoblotting analysis, cells grown on matrigel or matrigel-coated 0.2 kPa hydrogel

were lysed on ice in lysis buffer (25 mM Tris [pH 6.8], 2% sodium dodecyl sulfate (SDS),

5% glycerol, 1% β-mercaptoethanol, 0.01% bromophenol blue) and the samples were

sonicated. Equal amounts of protein from each sample were loaded on SDS-

polyacrylamide gel electrophoresis, separated, and transferred onto nitrocellulose. The

6

immunoblots were incubated in blocking buffer (5% BSA, 10 mM Tris-HCl [pH 7.5], 500

mM NaCl) for 30 min at room temperature and probed with specific antibodies overnight

at 4 °C. Then, the immunoblots were washed three times for 10 min in Tris-buffered saline

Tween 20 (TBST, 10 mM Tris-HCl [pH 7.5], 500 mM NaCl, 0.1% Tween 20), incubated

with secondary antibodies for one hour at room temperature in blocking buffer, and washed

three times in TBST again. Immunodetection was performed using chemiluminescent

horseradish peroxidase (HRP) substrate (#RPN 2109, GE Healthcare).

Tissue lysate from lungs was isolated by washing the lung tissues once with cold PBS,

cutting them into smaller pieces, and homogenizing thoroughly in

radioimmunoprecipitation assay (RIPA) buffer (50 mM Tris HCl [pH 7.4], 1% NP-40,

0.5% sodium deoxycholate, 0.1% SDS, 150 mM NaCl, 50 mM NaF, and 2 mM EDTA)

with protease inhibitors (#11836145001, Roche). For 10 mg tissue, 500 μl of RIPA buffer

was used. After 30 min on ice, the samples were centrifuged at 10,000 x g for 20 min at 4

°C, and protein concentration was determined on the supernatant using a bicinchoninic acid

(BCA) protein assay (#23225, Thermo Fisher Scientific). Proteins (40 μg) were loaded on

SDS-polyacrylamide gel electrophoresis and processed as described above.

Immunofluorescence of cell cultures

Cells grown on 0.2 kPa hydrogel bound to a glass bottom for 14 days were fixed with 4%

PFA for 20 min at room temperature, rinsed twice in PBS, incubated in 50 mM of NH4Cl

for 10 min, and permeabilized with 0.5% Triton X-100 for 5 min. Cells were then incubated

in blocking buffer (PBS containing 1% BSA) for 30 min and incubated with antibodies

against active Integrin 1 (1:50) or Ki67 (1:100) in blocking buffer overnight at 4 °C. After

two washes in PBS, cells were incubated in the presence of phalloidin and fluorochrome-

conjugated secondary antibodies (1:250, Invitrogen) for 40 min, rinsed twice in PBS,

stained with DAPI for 5 min, rinsed in water, and placed in PBS for subsequent analysis.

Immunostaining of tissues samples

For paraffin-embedded tissue, the lungs were fixed overnight at 4 °C in 4% PFA,

transferred into PBS, processed using conventional methods, embedded in paraffin, and

sectioned at 8 μm. For optimal cutting temperature (OCT) compound-embedded tissue, the

lungs were fixed in 4% PFA overnight at 4 °C, transferred to 20% sucrose in PBS for 48

hours, frozen in OCT compound in a -80 °C freezer, and sectioned at 10 μm.

Paraffin-embedded tissue sections were deparaffinized and rehydrated, and antigen

retrieval was performed in EDTA buffer (10 mM Tris Base, 1 mM EDTA solution, 0.05%

Tween 20, pH 9.0). Sections were blocked with Fc Receptor blocker (#NB309, Innovex),

and incubated with 1 x blocking buffer (5% donkey serum [# D9663, Sigma], 2.5% BSA,

0.1% Triton X-100 in PBS). Then, sections were incubated with anti-myeloperoxidase

(1:100) and anti-citrullinated histone H3 antibodies (1:250) in 0.5 x blocking buffer

overnight at 4 °C. After three washes with PBS, the sections were incubated with

fluorochrome-conjugated secondary antibodies (1:150, Invitrogen) in 0.5 x blocking buffer

for 45 min in the dark at room temperature. After two washes with PBS and one with water,

sections were counterstained with DAPI and rinsed in water, and the slides were mounted

onto coverslips using mounting media (#17985-16, Electron Microscopy Sciences).

OCT compound-embedded tissue sections were post-fixed with ice-cold methanol and

acetone (1:1 ratio), rinsed with PBS, blocked with Fc receptor blocker (#NB309, Innovex)

7

and incubated with 1 x blocking buffer (5% donkey [#D9663, Sigma] or goat serum

[#X0907, Dako], 2.5% BSA, 0.1% Triton X-100 in PBS). Sections were then incubated

with either anti-RFP-mCherry (1:150); anti-Ki67 (1:100); anti-laminin-111 (1:100); anti-

laminin Ab19, Ab25, or Ab28 (10 ug/ml); anti-myeloperoxidase (1:100); anti-citrullinated

histone H3 antibodies (1:250); or anti-Ly6G (1:600) antibodies in 0.5 x blocking buffer

overnight at 4 °C. No staining was needed to detect the Fluorescence Ubiquitination Cell

Cycle Indicator (FUCCI)-expressing D2.0R cells on OCT compound-embedded tissue

sections. After three washes with PBS, the sections were incubated with fluorochrome-

conjugated secondary antibodies (1:250, Invitrogen) in 0.5 x blocking buffer for 45 min in

the dark at room temperature. After two washes with PBS and one with water, sections

were counterstained with DAPI and rinsed in water, and the slides mounted onto cover

slips using mounting media (#17985-16, Electron Microscopy Sciences).

Spontaneous metastasis assay with primary tumor removal

To test the effect of LPS-induced inflammation on dormant cells that had spontaneously

disseminated, mCherry-luciferase expressing MCF-7 cells (5 million per mouse) were

injected into the number 4 mammary fat pad of eight-week-old female nude mice in 50 μl

of PBS. These mice had been implanted with 17β-estradiol 0.36 mg/pellet (#SE-121,

Innovative Research of America) 72 h before MCF-7 cell injection. Tumors resulting from

orthotopic injection were resected after six weeks. The mice were re-implanted with new

17β-estradiol 0.36 mg/pellet five days after resection, and two days later, the mice were

treated with LPS and GSK484 as described above to assess the effect of experimental

inflammation on spontaneously disseminated, dormant cells.

Effects of tobacco smoke exposure on lung inflammation

To determine how tobacco smoke exposure affects neutrophil recruitment and laminin-111

remodeling in the lungs, eight-week-old female BALB/c were exposed to tobacco smoke

(TS) or filtered air for three weeks using a smoke exposure system (Dr. Kent Pinkerton

Laboratory, University of California, Davis). For the TS groups, mice were exposed five

days/week to an average concentration of 75 + 11 mg/m3 of tobacco smoke for 6 h/day

using 3R4F research cigarettes (Tobacco Research Institute, University of Kentucky),

which were burned at a rate of four cigarettes every 10 min, with a puff volume of 35 mL

over a duration of 2 s, once per minute. Both side-stream and mainstream cigarette smoke

was collected via a chimney and passed to a dilution and aging chamber to allow the

animals to acclimate to TS exposure. The TS exposure started at an initial concentration of

60 mg/m3 and was increased, ultimately achieving a final target concentration of 90 mg/m3.

After each six-hour exposure to TS, the mice were then kept in the same chamber but in

filtered air. For the control group, the mice were handled in the same way, but were exposed

to filtered air only for 24 h a day, 7 days/week for the duration of the study.

Effects of experimental inflammation on RapidCaP mice lung metastasis

The effect of LPS-induced lung inflammation was tested on the RapidCaP mouse model

with low spontaneous incidence of lung metastasis. LPS (50 μL at a concentration of 0.25

mg/ml or PBS as control) was administered intranasally on days 0, 3, and 6 with a P200

pipette into mice under anesthesia (2.5% isoflurane) that had developed prostate cancer but

had no metastasis detectable by BLI. The inhibitor GSK484 (PAD4 inhibitor, #17488,

8

Cayman Chemical) was used at 20 mg/kg (in 10% DMSO in PBS) to inhibit the formation

of NETs. The inhibitor was intraperitoneally injected, starting on the first day of LPS

treatment. On days when the mice received LPS administration, they were treated three

times with inhibitors (30 min before LPS administration, three hours after administration,

and six hours after administration). On all other days, one daily treatment was given,

continuing until the end of the experiment. To follow metastatic disease, mice were injected

intraperitoneally with luciferin (5 mg per mouse, #Luck-100, Goldbio) and imaged using

the IVIS Spectrum in vivo imaging system (#128201, PerkinElmer) every three days. If

the first round of LPS instillation did not result in lung metastasis as detected by BLI, a

second round of LPS instillation (43 days after the end of the first round and following the

same protocol) was performed on the remaining animals, which were all at a more

advanced disease stage but had remained free of lung metastases. Mice were followed for

up to 110 days and differences in lung metastasis among the three treatment groups (saline;

LPS + vehicle; LPS + PAD4 inhibitor) were analyzed by Kaplan-Meier lung metastasis-

free curves. The presence of lung metastasis was confirmed post-mortem using a

fluorescent microscope, as cancer cells also expressed tdTomato. If lung metastasis was

not detected post-mortem by whole lung fluorescence, the animal was considered

metastasis-free. As whole lung fluorescence analysis is not sensitive enough to detect

single isolated, or small clusters of cancer cells, the presence of cancer cells in the lungs

was also evaluated by immunofluorescence as described above.

Quantification of metastatic burden and metastatic foci

The metastatic burden was evaluated from lung sections stained with hematoxylin and

eosin, calculated as percentage of lung area. The number of metastatic foci normalized to

the evaluated lung area was also calculated from the same hematoxylin and eosin-stained

lung sections.

Quantification of neutrophils per field and percentage of NET-forming neutrophils

Neutrophils were counted as myeloperoxidase or Ly6G positive cells from at least three

representative immunofluorescence images (from 2 neighboring sections) from three

different mice. NET-forming neutrophils were counted as MPO and extracellular

citrullinated H3 positive cells from at least three representative immunofluorescence

images (from 2 neighboring sections) from three different mice. The percentage of NET-

forming neutrophils was calculated using the formula: (number of NET-forming

neutrophils/number of neutrophils)*100.

qRT-PCR analysis

RNA was prepared from total cell lysates or lung tissues using an RNeasy mini kit (#79254,

Qiagen) according to the manufacturer’s instructions. cDNA was synthesized using 500 ng

of cytoplasmic RNA using a RevertAid First Strand cDNA synthesis kit (#K1622, Thermo

Fisher Scientific), following the manufacturer’s instructions. Real-time PCR was

performed using Taqman gene expression master mix (#4369016, Applied Biosystems),

and the following primers from Applied Biosystems were used: Tbp (Mm 01277042), NE

(Mm 00469310), MMP9 (Mm 00442991), lama1 (Mm 01226102), lama2 (Mm 00550083),

lama3 (Mm 01254735), lama4 (Mm 01193660), lama5 (Mm 01222029), lamb1 (Mm

9

00801853), lamb2 (Mm 00493080), lamb3 (Mm 00493108), lamc1 (Mm 00711820),

lamc2 (Mm 00500494), and lamc3 (Mm 01324510).

The PCR reactions were performed on the StepOne Real-Time PCR system and

analyzed using the StepOneSoftware v2.1 (Applied Biosystems). Gene expression was

normalized to endogenous TBP expression, or relative expression of the respective gene

was determined after normalization to TBP and calculated with the following formula:

relative expression level = 2ddCT.

RNA in situ hybridization

RNA in situ hybridization was performed using the RNAscope 2.5 HD Reagent Kit-RED

(#322350, Advanced Cell Diagnostics), following the manufacturer’s instructions. The

following probes from Advanced Cell Diagnostics were used: lama1 (#494931), lamb1

(#517641), lamc1 (#517451), and positive control DapB (#310043).

NE and MMP activity assays

NE and MMP activities were measured in neutrophil CM. For NE activity, Neutrophil

Elastase 680 FAST Fluorescent Imaging Agent (0.5 μM, #NEV11169, PerkinElmer) was

incubated with neutrophil CM for 30 min in the dark, and the resultant fluorescence was

read at excitation/emission wavelengths of 663/690 nm using a plate reader (SpectraMax

i3, Molecular Devices). For MMP activity, Mca-PLGL-Dpa-AR-NH2 Fluorogenic MMP

Substrate (10 μM, #ES001, R & D Systems) was incubated with neutrophil CM for 30 min

in the dark, and fluorescence read at excitation/emission wavelengths of 320/405 nm using

a plate reader (SpectraMax i3, Molecular Devices).

To quantify the concentrations of active NE and MMPs in the samples, a standard curve

was generated using rNE or rMMP9 in DMEM. After subtracting background fluorescence

(from the soluble fluorescent substrate in medium without enzyme), the concentration was

calculated using the correlation coefficient of the standard curve. For protease activity from

lung samples, proteins were extracted in RIPA buffer on ice without protease inhibitors,

and 40 μg of protein was used with the fluorescent probes as described above.

Gelatin zymography

Conditioned medium from neutrophils (250,000, in 24-well plates containing 500 μl

serum-free DMEM), grown on plastic overnight, was mixed at a 1:1 ratio with loading

buffer (0.25 M Tris, pH 6.8, 2% SDS, 4% sucrose, bromophenol blue). Samples were

then loaded on 10% SDS-PAGE gels containing 1 mg/ml gelatin (#G1890, Sigma).

Following electrophoresis, the gels were rinsed twice in water and incubated in 2.5%

Triton X-100 for 90 min at room temperature. The gels were then washed twice in

substrate buffer (50 mM Tris pH 7.4, 200 mM NaCl, 2 mM CaCl2, 1 mM MgCl2) and

incubated in substrate buffer at 37 °C for 16 h. Gels were stained with 0.5% Coomassie

Blue R-250 (#F789-03, J.T. Baker; diluted in 10% ethanol and 10% acetic acid) and

destained in 10% ethanol and 10% acetic acid. Enzymatic activities appear as clear

bands in a blue background. For gelatin zymography from lung samples, proteins were

extracted in RIPA buffer on ice without protease inhibitors, and 40 μg of protein was mixed

at a 1:1 ratio with loading buffer before processing as described above.

Plasma sample collection from mice

10

Plasma samples were obtained from cardiac blood collection using a syringe with a 25 G

needle containing 25 μl of sodium citrate solution (#C3821, Sigma). Whole blood was

centrifuged at 4 °C at 1300 x g for 10 min, and the top plasma layer was collected.

Double-stranded (Ds) DNA quantification

DsDNA was quantified in plasma samples and CM using the Quant-iT PicoGreen dsDNA

assay kit (#P11496, Thermo Fisher Scientific), following the manufacturer’s instructions.

NET-ECM adhesion assay

96-well plates were coated with 50 g/ml of ECM protein for one hour at 37 °C. After two

washes in PBS, CM from neutrophils stimulated as indicated in the figure legends were

incubated on top of the coated wells for one hour at 37 °C. After two gentle washes with

PBS, dsDNA bound to the ECM proteins was quantified in the wells following the

manufacturer’s instructions (#P11496, Thermo Fisher Scientific).

NET-remodeled laminin-111 ELISA

To obtain monoclonal antibodies, hybridoma supernatants from individual hybridoma

colonies were screened by ELISA for the ability to recognize NET-remodeled laminin-

111. Positive hybridoma colonies were then isolated and seeded to establish pure

hybridoma clones from single cell colonies. Monoclonal antibodies (mAbs) were purified

from individual hybridoma clone culture supernatants. For ELISA, laminin-111, cleaved

laminin-111, or control proteins were coated (50 ng/well) on ELISA plates (#464718,

Thermo Fisher Scientific) following the manufacturer’s instructions. Prior to adding the

mAbs, the coated plate was blocked with PBS/0.5% BSA at 4 °C for six hours. After

blocking, mAbs (in PBS/0.5% BSA) were added to the ELISA plate and incubated at room

temperature for one hour, followed by three extensive washes with PBS/0.05% Tween 20.

The secondary antibody (#112-035-003, Jackson ImmunoResearch for anti-rat IgG HRP;

#115-035-003, Jackson ImmunoResearch for anti-mouse IgG HRP) was then added and

incubated at room temperature for 30 min, followed by three extensive washes with

PBS/0.05% Tween 20. Chromogenic binding signal was developed by using 3,3’,5,5’-

Tetramethylbenzidine ultra as the HRP substrate (#34028 Thermo Fisher Scientific),

following the manufacturer’s instructions. Data were collected by measuring the

absorbance at 450 nm with a plate reader (SpectraMax i3, Molecular Devices).

Treatment of mice with chimeric antibodies (chiAbs)

Mice injected with cancer cells at day 0 were treated with LPS on days 7, 10, and 13, as

described above. chiAbs (chiAb2, chiAb25, and chiAb28) were administered intravenously

at a dose of 200 μg/mouse to target laminin-111 in the lungs. chiAbs were given one day

before the first LPS administration, and then the treatment continued three times weekly

until the end of the experiment on day 33. Mouse IgG2A isotype was used as a control

(Clone C1.18.4, #BE0085, Bio X Cell, 200 μg/mouse). Although treatment with chiAb25

had a strong inhibitory effect on awakening, all mice treated with this antibody died

between days 22 and 25. Since Ab25, but not Ab28, binds full-length laminin, and since

no mice died when treated with chiAb28, DNase I, or PAD4/NE/MMP9 inhibitors, we

suspect that chiAb25 is toxic due to interference with normal laminin function.

11

Flow cytometry analysis

D2.0R cells (300,000) harvested in PBS containing 10 mM of EDTA were distributed in

96-well round-bottom plates and centrifuged at 2000 rpm for 1 min at 4 °C. The supernatant

was removed, and the cells were incubated in ice-cold Fluorescence Activated Cell Sorter

(FACS) buffer (1% FCS and 0.02% sodium azide in PBS) with Fc Block (#553142, BD

Biosciences, diluted 1:25) at 4 °C for 15 min. After one wash in FACS buffer, the cells

were incubated with antibody against integrin (1:100) for 30 min at 4 °C in the dark. If

unconjugated antibodies were used, the cells were washed once in FACS buffer and

incubated with fluorochrome-conjugated secondary antibodies (1:250, Invitrogen) for 30

min at 4 °C in the dark. The cells were then washed twice in FACS buffer and resuspended

in 450 μl of FACS buffer before analysis using a BD LSRFortessa instrument (BD

Biosciences) operated by FACSDIVA (BD Biosciences) software.

Plasma LPS quantification

Plasma endotoxin levels were measured using the Pierce LAL Chromogenic Endotoxin

Quantitation Kit (#88282, Thermo Fisher Scientific), following the manufacturer’s

instructions.

12

13

Fig. S1. Sustained lung inflammation promotes dormant cancer cell awakening.

(A) Quantification of the number of single, disseminated tumor cells (DTCs, murine

D2.0R) per lung area from untreated mice at days 7, 28 and 240 after injection (B) Mice

with D2.0R cells were monitored by bioluminescence imaging (BLI) over 8 months. (C)

LPS-induced sustained inflammation triggered awakening of murine breast cancer cells.

D2.0R cells expressing luciferase and mCherry were injected intravenously into syngeneic

BALB/c mice at day 0 and inflammation was induced through intranasal instillation of LPS

on days 7, 10, and 13. Mice were monitored by BLI every three days until metastatic burden

necessitated their euthanasia (n=5 mice per group; mean±SD). (D) Representative

micrographs of D2.0R cells (red), Ki67 (green), and DAPI (blue) stained lung sections at

day 28 from mice treated as indicated. Scale bars: 50 μm. (E) Mice with D2.0R cells were

treated as indicated, and metastatic burden in the lungs was quantified from hematoxylin

and eosin stained sections (n=5 mice per group; mean±SD). (F) LPS-induced sustained

inflammation triggered awakening of human breast cancer cells. MCF-7 cells expressing

luciferase and mCherry were injected intravenously into nude mice at day 0 and

inflammation was induced through intranasal instillation of LPS on days 7, 10, and 13.

Mice were monitored by BLI every three days until metastatic burden necessitated their

euthanasia (n=5 mice per group; mean±SD). (G) Representative micrographs of MCF-7

cells (red), Ki67 (green), and DAPI (blue) stained lung sections at day 33 from mice treated

as indicated. Scale bars: 50 μm. (H) Mice with MCF-7 cells were treated as indicated, and

metastatic burden in the lungs was quantified from hematoxylin and eosin staining (n=5

mice per group; mean±SD). (I, L) D2.0R murine breast cancer cells (I) or MCF-7 human

breast cancer cells (L) expressing luciferase and mCherry were injected intravenously into

syngeneic BALB/c mice or nude mice, respectively, at day 0, and inflammation was

induced through intranasal instillation of LPS on days 30, 33, and 36. Mice were monitored

by BLI every three days until metastatic burden necessitated their euthanasia (n=5 mice

per group; mean±SD). (J, M) Representative images of BLI at day 63. (K, N) Mice with

D2.0R (K) or MCF-7 (N) cells were treated as indicated, and metastatic burden in the lungs

was quantified from hematoxylin and eosin stained sections (n=5 mice per group;

mean±SD).

14

15

Fig. S2. Sustained lung inflammation promotes neutrophil recruitment and cell

cycle entry of dormant D2.0R cells.

(A) Experimental design used to test the effect of lung inflammation on neutrophil

recruitment. (B) Nasal LPS instillation induced neutrophil recruitment to lungs.

Immunostaining of lungs for Ly6G (red) with DAPI (blue) was used to assess the presence

of neutrophils in the lungs. Scale bar: 50 μm. (C) Quantification of neutrophils per field of

view from panel B (n=3 mice; mean±SD). (D) Visual representation of the FUCCI cell

cycle reporter. (E) Quantification of D2.0R cells in G0/G1 (black bar) or S/G2/M (red bar),

and clusters of cells (blue bar) in the lungs of mice treated as indicated (n=3 mice;

mean±SD; p<0.0001, Fisher’s exact test). (F) Representative micrographs of sections of

lungs with D2.0R cells expressing the FUCCI reporter (red, yellow and green)

counterstained with DAPI (blue), treated as indicated. Scale bars: 50 μm.

16

17

Fig. S3. Sustained lung inflammation promotes dormant cancer cell awakening

through neutrophil recruitment and correlates with the formation of NETs in the

lungs.

(A, B) Depletion of neutrophils using anti-Ly6G antibody. (A) Representative

immunostaining of lungs for myeloperoxidase (MPO, red) with DAPI (blue) after treating

mice treated with anti-Ly6G antibodies. MPO staining was used to detect neutrophils

because anti-Ly6G antibodies had been used to deplete neutrophils. Scale bar: 50 μm. (B)

Quantification of neutrophils per field of view (n=3 mice; mean±SD). (C) Experimental

design used to assess the effect of neutrophil depletion on LPS-induced inflammation.

(D-F) LPS-induced inflammation triggers neutrophil-dependent awakening. (D) Mice with

D2.0R cells were treated as indicated and monitored by bioluminescence imaging (BLI)

(n=5 mice per group; mean±SD). (E) Representative images of BLI signal on day 33. (F)

LPS-induced inflammation induced neutrophil-dependent awakening of D2.0R cells. Mice

with D2.0R cells were treated as indicated, and metastatic burden in the lungs was

quantified from hematoxylin and eosin stained sections (n=5 mice per group; mean±SD).

(G-I) LPS-induced inflammation drove neutrophil-dependent awakening of MCF-7 cells.

(G) Mice injected intravenously with MCF-7 cells and treated as indicated were monitored

by BLI every three days (n=5 mice per group; mean±SD). (H) Representative micrographs

of MCF-7 cells (red) in Ki67 (green) and DAPI (blue)-stained lung sections at day 33.

Scale bars: 50 μm. (I) Mice with MCF-7 cells were treated as indicated, and metastatic

burden in the lungs was quantified from hematoxylin and eosin stained sections (n=5 mice

for vehicle and LPS + Ly6G Ab groups, n= 3 mice for LPS + IgG group as two animals

had died from metastatic disease by this time point; mean±SD). (J-M) Nasal LPS

instillation induced NETs in the lungs. (J) Immunostaining of lungs for MPO (red) and

citrullinated histone H3 (green) with DAPI (blue) was used to assess the formation of NETs

in the lungs of mice treated as indicated. Scale bar: 50 μm. (K) Quantification of NET-

forming neutrophils in the lungs of mice treated as indicated (n=3 mice; mean±SD). (L)

ELISA quantification of NETs in the plasma of mice treated as indicated (n=3 mice per

group; mean±SD). (M) dsDNA was quantified in the plasma of mice treated as indicated

(n=3 mice per group; mean±SD).

18

19

Fig. S4. NETs promote awakening of dormant cancer cells after sustained lung

inflammation.

(A-C) NETs could be targeted with a PAD4 inhibitor or DNase I. (A) Quantification of

NET-forming neutrophils in the lungs of mice treated as indicated (n=3 mice; mean±SD).

(B) ELISA quantification of NETs in the plasma of mice treated as indicated (n=3 mice

per group; mean±SD). (C) dsDNA was quantified in the plasma of mice treated as indicated

(n=3 mice per group; mean±SD). (D) NETs could be targeted with DNase I-coated

nanoparticles (nanoDNase I). Immunostaining of lungs for MPO (red) and citrullinated

histone H3 (green) with DAPI (blue) was used to assess the formation of NETs in the lungs

of mice treated as indicated. Scale bar: 50 μm. (E) Quantification of NET-forming

neutrophils in the lungs of mice treated as indicated (n=3 mice; mean±SD). (F) ELISA

quantification of NETs in the plasma of mice treated as indicated (n=3 mice per group;

mean±SD). (G) Mice previously injected with D2.0R cells were treated as indicated, and

metastatic burden in the lungs was quantified from hematoxylin and eosin stained sections

(n=10 mice for vehicle and LPS groups; n=5 mice for DNase I and PAD4 inhibitor groups).

(H, I) DNase I-coated nanoparticles inhibit NET-mediated awakening of D2.0R cells. (H)

Mice were monitored by BLI (n=5 mice per group; mean±SD). (I) Mice with D2.0R cells

were treated as indicated, and metastatic burden in the lungs was quantified from

hematoxylin and eosin stained sections (n=5 mice per group; mean±SD). (J, K) LPS-

induced inflammation awakened MCF-7 cells in a NET-dependent manner. (J) Mice

previously injected with MCF-7 cells were treated as indicated and monitored by BLI (n=5

mice per group; mean±SD). (K) Mice with MCF-7 cells were treated as indicated, and

metastatic burden in the lungs was quantified from hematoxylin and eosin stained sections

(n=5 mice per group; mean±SD). (L, M) DNase I-coated nanoparticles inhibit NET-

mediated awakening of MCF-7 cells. (L) Mice with MCF-7 cells were treated as indicated

and monitored by BLI (n=5 mice per group; mean±SD). (M) Mice with MCF-7 cells were

treated as indicated, and metastatic burden in the lungs was quantified from hematoxylin

and eosin stained sections (n=5 mice per group; mean±SD). (N) Mice with D2.0R cells,

treated as indicated, were monitored by BLI. DNase I was first administered either at day

7 or day 14 and the treatment continued daily until day 33 (n=5 mice per group; mean±SD).

(O, P) Targeting NETs decreased neutrophil recruitment to the lungs. (O, P) Quantification

of neutrophils per field of view (n=3 mice; mean±SD).

20

21

Fig. S5. NETs promote dormant prostate and breast cancer cell awakening.

(A) Kaplan-Meier curve representing the percentage of lung metastasis-free RapidCaP

mice treated as indicated (n=6 mice for the vehicle group, n=5 for the LPS group and n=4

for the LPS + PAD4 inh. Group, p=0.02, a Mantel-Cox log-rank test). (B) Representative

micrographs of RapidCaP cancer cells (red, stained for tdTomato) in DAPI-stained lung

sections Scale bar: 50 μm. (C) Histological phenotypes of cancer cells in lungs at end point

(110 days for mice with no BLI-detectable metastasis, p=0.02, Fisher’s exact test). (D)

Experimental design. MCF-7 cells were allowed to form primary mammary tumors and to

spontaneously disseminate for 6 weeks before we resected the primary tumors. Seven days

after resection, the mice were treated with LPS. (E) Mice with MCF7 cells, treated as

indicated, were monitored by BLI. (n=5 mice per group; mean±SD). (F) Representative

images of BLI at day 33. (G) Representative micrographs of MCF-7 cells (red) in Ki67

(green) and DAPI (blue)-stained lung sections at day 33. Scale bars: 50 μm. (H) Mice with

MCF-7 cells were treated as indicated, and metastatic burden in the lungs was quantified

from hematoxylin and eosin stained sections (n=5 mice per group; mean±SD). (I) Exposure

to tobacco smoke induced neutrophil recruitment to the lungs. Quantification of neutrophils

per field of view (TSP, total suspended particules). (J-L) Tobacco smoke exposure at 90

TSP mg/m3 induced NETs in the lungs of mice. (J) Quantification of NET-forming

neutrophils in the lungs of mice treated as indicated (n=3 mice; mean±SD). (K) ELISA

quantification of NETs in the plasma of mice treated as indicated (n=3 mice per group;

mean±SD). (L) dsDNA was quantified in the plasma of mice treated as indicated (n=3 mice

per group; mean±SD). (M) LPS was quantified in the plasma of mice exposed to tobacco

smoke as indicated. (n=3 mice per group; mean±SD). (N) Targeting NETs reduced tobacco

smoke exposure-induced awakening. Representative immunostaining of lungs at day 30

for D2.0R cells (red) and Ki67 (green) with DAPI (blue), treated as indicated. Scale bars:

50 μm.

22

23

Fig. S6. Activation of neutrophils in vitro.

(A) D2.0R and MCF-7 cells were slow cycling on matrigel. Luciferase-expressing D2.0R,

D2.A1, and MCF-7 cells were cultured on matrigel for 15 days. BLI was used to quantify

cell number in the 3D cultures at indicated time points (n=3; mean±SD). (B) Representative

images of 3D culture show dormant D2.0R and MCF-7 cells and proliferative D2.A1 cells

after 15 days of culture. Scale bar: 100 μm. (C, D) Activation of neutrophils in vitro.

Immunostaining of mouse and human neutrophils (mPMNs (C) and hPMNs (D),

respectively) cultured as indicated. DAPI (blue), anti-MPO (red), and anti-histone H2B

(green) staining were used to assess NET formation. Scale bars: 100 μm. (E) NET-

containing Conditioned Media (CM) promote proliferation of dormant D2.0R cancer cells

on matrigel. Quantification of Ki67 positive D2.0R cells at day 14, cultured on matrigel

with the indicated treatment (n=3; mean±SD).

24

25

Fig. S7. Inducers of NETs have no direct effect on dormant cancer cell awakening,

while cigarette smoke extract induces NETs and awakening of dormant cancer cells.

(A-C) NET-containing CM induced awakening of MCF-7 cells in vitro on matrigel. (A)

BLI quantification over 15 days with indicated treatments (n=3; mean±SD). (B) BLI signal

at day 14 after indicated treatments. PAD4 inhibitor and DNase I were used during the

neutrophil culture to block or digest NET formation, respectively (n=3; mean±SD). (C)

Quantification of Ki67 positive MCF7 cells at day 14, cultured on matrigel with the

indicated treatment (n=3; mean±SD). (D, E) Factors that induce NETs and degranulation

have no effect on dormant cancer cells when added directly to cancer cell cultures. BLI of

luciferase-expressing D2.0R (D) and MCF-7 (E) cells, treated as indicated (n=3;

mean±SD). (F, G) Pretreatment of D2.0R cells with LPS before injection in vivo has no

effect on metastasis. (F) D2.0R cells were treated with LPS before injection into BALB/c

mice. Mice were monitored by BLI (n=5 mice per group; mean±SD). (G) Mice with D2.0R

cells were treated as indicated, and metastatic burden in the lungs was quantified from

hematoxylin and eosin stained sections (n=5 mice per group; mean±SD). (H) Activation

of neutrophils by Cigarette Smoke Extract (CSE) in vitro. Immunostaining of mouse

neutrophils cultured as indicated. DAPI (blue), anti-MPO (red), and anti-histone H2B

(green) staining were used to assess NET formation. Scale bar: 100 μm. (I) NET-

containing CM induced by cigarette smoke extract promoted awakening of D2.0R cells.

BLI signal at day 14 after indicated treatments. PAD4 inhibitor was used during neutrophil

culturing to block NET formation (n=3; mean±SD). (J) Cigarette Smoke Extract kills

cancer cells at high concentration. BLI of luciferase-expressing D2.0R cells, treated as

indicated (n=3; mean±SD).

26

27

Fig. S8. NET-associated neutrophil elastase (NE) and matrix metalloproteinase

(MMP) 9 activities in neutrophil conditioned medium (CM) promote awakening.

(A) NE and MMP9 were required for NET-induced awakening of MCF-7 cells in vitro.

BLI signal of luciferase-expressing MCF-7 cells 14 days after indicated treatments.

Cathepsin G (CG), NE, and MMP9 inhibitors were used during cancer cell culture (n=3;

mean±SD). (B, C) NE and MMP activities, measured with fluorescent probes, were

elevated in CM from neutrophils activated to form NETs. Quantification of NE (B) and

MMP (C) activities in the indicated neutrophil CM. The PAD4 inhibitor was used during

neutrophil culturing while NE and MMP9 inhibitors were added to the CM directly before

protease quantification (n=3; mean±SD). The samples for the vehicle condition were the

same as depicted in Fig. 4H as the experiments were done at the same time. (D)

Representative gelatin zymography of secreted MMP9 from PMNs cultured for 20 hours

as indicated (M.W., Molecular Weight). (E) Activation of NE and MMP9 Knock Out (KO)

neutrophils in vitro. Immunostaining of mouse neutrophils cultured as indicated. DAPI

(blue), anti-MPO (red), and anti-histone H2B (green) staining were used to assess NET

formation. Scale bar: 100 μm. (F) CM from NE and MMP9 KO neutrophils were not able

to induce awakening in vitro. BLI signal at day 14 after indicated treatments (n=3;

mean±SD).

28

29

Fig. S9. Neutrophil-derived Neutrophil elastase (NE) and matrix metalloproteinase

(MMP) 9 activities in inflamed lungs promote awakening.

(A, B) NE and MMP9 were highly expressed in neutrophils. Relative mRNA expression

of NE (A) and MMP9 (B) in D2.0R cells, D2.A1 cells, and neutrophils. (C) NET-

containing CM has no effect on expression of NE or MMP9 by D2.0R cells. mRNA

expression of NE and MMP9 in D2.0R cells treated as indicated. (D, E) mRNA expression

of NE (D) and MMP9 (E) in D2.0R cells expressing shRNA as indicated. (F) NET-

containing CM induced awakening of D2.0R cells expressing a NE or a MMP9 shRNA.

D2.0R cells expressing shRNA as indicated (two different sequences) were cultured on

matrigel for 14 days and proliferation was measured using the CellTiter 96 Aqueous One

Solution Cell Proliferation Assay from Promega (n=3; mean±SD). (G) Representative

gelatin zymography of secreted MMP9 from lung lysates of mice treated as indicated. (H,

I) NE and MMP activities were increased in LPS-treated lungs. NE (H) and MMP9 (I)

activity measured with fluorescent probes in lung lysates of mice treated as indicated (n=3

mice per group; mean±SD). (J) NE and MMP9 activities are required for NET-induced

awakening in vivo. Mice with D2.0R cells were treated as indicated, and metastatic burden

in the lungs was quantified from hematoxylin and eosin stained sections (n=10 mice for

vehicle and LPS groups; n=5 mice for LPS + NE inhibitor and LPS + MMP9 inhibitor

groups; mean±SD). (K) Quantification of neutrophils per field of view. (L) Experimental

design used to test the effects of NET-associated proteases on cancer cells vs. matrigel.

(M) BLI signal from luciferase-expressing D2.0R cells cultured on matrigel at day 14

under indicated conditions (n=3; mean±SD).

30

31

Fig. S10. Laminin cleavage by NET-associated NE and MMP9 mediates dormant

cancer cells’ awakening in vitro.

(A, B) D2.0R and MCF-7 cells were slow cycling on laminin-111 in vitro. Luciferase-

expressing D2.0R (A) and MCF-7 (B) cells were cultured on laminin-111 for 15 days. BLI

at indicated time points was used to quantify cell number in the 3D cultures (n=3;

mean±SD). (C) Culturing on laminin-111 allows NET-dependent control of dormancy and

awakening. BLI signal of luciferase-expressing MCF-7 cells after 14 days at indicated

conditions (PAD4 inhibitor was used during PMN culture, n=3; mean±SD). (D, E) NET-

containing CM promoted proliferation of dormant cancer cells on laminin-111.

Quantification of Ki67-positive D2.0R (D) or MCF-7 (E) cells at day 14, cultured on

laminin-111 with the indicated treatment (n=3; mean±SD). (F) NET-containing CM

induced by Cigarette Smoke Extract (CSE) degraded laminin-111. Cleavage of laminin-

111 after incubation with indicated CM was detected by SDS-PAGE under reducing and

denaturing conditions and coomassie blue staining. (G, H) NE and MMP9 were required

for laminin-111 cleavage and awakening. (G) Experimental design used for studies

represented in Fig. 4, C and E, and fig. S10H. Laminin-111 was incubated with

recombinant proteases for 48 hours at 37 °C and then washed with medium before culturing

D2.0R cells on the remodeled matrix. BLI was used to quantify cell number after 14 days

of culture. (H) Laminin-111 was incubated with indicated recombinant proteases for 48

hours at 37 °C, and then washed with medium before culturing MCF-7 cells on the

remodeled matrix. BLI was used to quantify the number of cancer cells 14 days later (n=3;

mean±SD). (I) Addition of cleaved laminin-111 to the culture induces awakening. BLI

signal of luciferase-expressing D2.0R cells after 14 days at indicated conditions (J, K)

Both NE and MMP9 are required for laminin-111 cleavage. (J) Laminin-111 was incubated

with indicated recombinant proteases for six hours at 37 °C. Cleavage of laminin-111 was

monitored by SDS-PAGE under reducing and denaturing conditions and Western blot

using a laminin-111 antibody. (K) Laminin-111 was incubated with the indicated

neutrophil PMN CM and inhibitors for six hours at 37 °C. Cleavage of laminin-111 was

monitored by SDS-PAGE under reducing and denaturing conditions and coomassie blue

staining.

32

33

Fig. S11. Multiple laminin isoforms and thrombospondin (TSP-1) can regulate

dormancy in vitro.

(A-C) Laminin-111 is present in the lungs of mice. (A) mRNA expression of all laminin

chains in the lungs of mice treated as indicated. (B) mRNA in situ hybridization of DapB,

lama1, lamb1 and lamc1 in the lungs of untreated mice. (C) Immunostaining of lungs

treated as indicated for DAPI (blue) and full-length laminin-111 (ab11575 from Abcam,

green). Scale bars: 50 μm. (D) Laminin is cleaved in the lungs of mice treated chronically

with LPS. Lung tissue lysate from mice treated as indicated was immunoblotted for

laminin-111 (LN-111). (E) NET-containing CM induced proliferation of quiescent MCF-

7 cancer cells cultured on human laminin (hLN)-111, -211, -411, and -511 as determined

by BLI after 14 days of culture (n=3; mean±SD). (F) NE and MMP9 both localize on the

DNA scaffold of NETs formed from LPS-treated murine neutrophils: DAPI (blue), NE

(green), and MMP9 (red). Scale bars: 50 μm. (G) dsDNA was quantified in the indicated

PMN CM. PAD4 inhibitor was used during neutrophil activation (n=3; mean±SD). (H)

NET-associated NE and MMP9 degraded TSP-1. TSP-1 was incubated with indicated

recombinant proteases or PMN CM for six hours at 37 °C. PAD4 inhibitor was added

during activation of PMN with LPS. Cleavage of TSP-1 was monitored by SDS-PAGE

under reducing and denaturing conditions followed by Western blot using a TSP-1

antibody. (I) Inhibiting NE and MMP9 activity did not prevent TSP1 cleavage.

Immunoblot of soluble TSP1 from lung tissue of mice treated as indicated. (J) Cleaved

TSP-1 was not sufficient to induce awakening. TSP-1 was incubated with indicated

recombinant proteases or PMN CM for 48 hours at 37 °C on 0.2 kPa hydrogel and then

washed with medium before culturing D2.0R cells on the remodeled matrix. BLI was used

to quantify the number of cancer cells 14 days later (schematic strategy represented in figs.

S9L and S10G) (n=3; mean±SD). (K, L) TSP-1 reduced NET-induced awakening.

Laminin-111 and TSP-1 were incubated with NET CM for 48 hours at 37 °C on a 0.2 kPa

hydrogel and then washed with medium before culturing D2.0R (K) or MCF-7 (L) cells on

the remodeled matrix. BLI was used to quantify the number of cancer cells after 14 days

of culture (n=3; mean±SD).

34

35

Fig. S12. NET-induced awakening is associated with activation of the integrin 1

outside-in signaling pathway.

(A, B) NET-associated NE and MMP9 activated integrin 1 and proliferation in dormant

cancer cells. (A) Immunostaining of MCF-7 cells cultured on matrigel-coated 0.2 kPa

hydrogel as indicated for DAPI (blue), F-actin (red), active integrin 1 (green), and Ki67

(green). Scale bars: 50 μm. (B) rNE and rMMP9 were sufficient to activate integrin 1 and

proliferation in dormant cancer cells. Immunostaining of D2.0R cells cultured on matrigel-

coated 0.2 kPa hydrogel as indicated for DAPI (blue), F-actin (red), and active integrin 1

(green). Scale bar: 50 μm. (C) BLI of luciferase-expressing MCF-7 cells cultured on

matrigel after 14 days under indicated conditions (n=3; mean±SD). (D) Immunobloting of

integrin 1, FAK, MLCK, YAP, and Heat Shock Protein 90 (HSP90) on D2.0R cells, 48 h

after doxycycline-induced shRNA depletion, as indicated. (E-K) D2.0R cells were cultured

on matrigel for 10 days under indicated conditions (as described in Supplemental

Methods), and cell lysate was analyzed by Western blot. Immunobloting of phospho-FAK

(Tyr397), phospho-ERK 1/2 (Thr202/Tyr204), and phospho-MLC2 (pThr18/Ser19) was

performed to analyze activity of these proteins. Immunoblot of FAK, ERK 1/2, MLC2, and

HSP90 were included as controls.

36

37

Fig. S13. Integrin 3 regulates NET-induced awakening and integrin signaling

knockdown does not kill dormant cancer cells in the lungs.

(A) D2.0R cells expressed integrin 3, 5, 6, 7, 8, 9 and v. D2.0R cells were stained for

integrin subunits as indicated and analyzed by flow cytometry. (B) Representative plots

of fluorescence intensity of indicated integrin staining in D2.0R cells expressing a control

shRNA or indicated integrin shRNA. (C) D2.0R cells expressing integrin shRNA as

indicated (two different sequences) were cultured on matrigel for 14 days, and proliferation

was measured using the CellTiter 96 Aqueous One Solution Cell Proliferation Assay from

Promega (n=3; mean±SD). (D) Integrin 1 and YAP knockdown did not kill dormant

cancer cells in the lungs. Representative micrographs of D2.0R cells (red) with DAPI-

staining (blue) in lung sections at day 33. Scale bar: 50 μm.

38

39

Fig. S14. Cleaved laminin antibodies can be used to detect NET-mediated laminin

remodeling in vivo.

(A) Inhibiting NETs and their associated proteases prevented laminin cleavage in vivo.

Immunoblot of soluble laminin-111 from lung tissue of mice treated as indicated. (B)

Laminin-111 was incubated with recombinant proteases for six hours at 37 °C. The

proteolytically remodeled laminin-111 was purified away from the proteases using a 100

kDa molecular weight cut-off column. The presence of laminin-111, NE, and MMP9 in

each phase was then assessed using Western blot analysis under reducing and denaturing

conditions with specific antibodies. The upper fraction containing the cleaved laminin-

111 was next dialyzed in PBS and used to immunize rats. (C) Antibodies against NE and

MMP9-cleaved laminin prevented NET-mediated awakening and integrin 1 activation.

Immunostaining for active integrin 1 (green), F-actin (red), and DAPI (blue) of D2.0R

cells cultured on laminin-111-coated 0.2 kPa hydrogel under indicated conditions. Scale

bar: 50 μm. (D) Ab28 recognizes cleaved laminin-111 but does not recognize full-length

laminin-111. ELISA was used to measure the binding of antibodies Ab2, Ab19, Ab25,

and Ab28 to cleaved laminin-111, full-length laminin 111, or neutravidin (negative

control, n=3; mean±SD; OD, Optical Density) (E) Ab28 detected proteolytically

remodeled laminin in vivo. Lung sections from mice treated with LPS were

immunostained for full-length laminin-111 (ab11575 from Abcam, green) and cleaved

laminin (red) with DAPI (blue) to monitor binding of the generated antibodies to laminin

in vivo. Red arrows point to epitope recognized by Ab28 in lung tissue from LPS treated

mice. Scale bar: 50 μm. (F) Immunostaining of lungs for DAPI (blue), full-length

laminin-111 (green), and cleaved laminin Ab28 (red), in mice treated as indicated. Red

arrows point to epitope recognized by Ab28. Scale bars: 50 μm.

40

41

Fig. S15. Laminin epitope is detectable in the same lung tissue regions as NETs and

awakening cancer cells; antibodies against NET-remodeled laminin block awakening

after LPS- or tobacco smoke exposure-induced inflammation.

(A) The laminin epitope was detectable close to NETs in the lungs of mice with sustained

inflammation. Representative immunostaining for MPO (red), citrullinated histone H3

(green), cleaved laminin Ab28 (white) and DAPI (blue) in the lungs of mice treated as

indicated. Lower row shows only the Ab28 channel. Scale bar: 50 μm. (B, C) The laminin

epitope was detectable close to the awakened cancer cells. (B) Quantification of D2.0R

cells in G0/G1 (black bar) or S/G2/M (red bar), and clusters of cells (blue bar) close to

remodeled laminin (detected with Ab28) in the lungs of mice treated as indicated (n=3

mice; mean±SD; p<0.0001, Fisher’s exact test). (C) Representative micrographs of

sections of lungs with D2.0R cells expressing the FUCCI reporter (red, yellow and green)

stained with cleaved laminin Ab28 (white) and DAPI (blue), treated as indicated.

Individual channels are shown for all examples. Scale bar as indicated. (D) BLI of

luciferase-expressing D2.0R cells cultured on laminin-111, 14 days after indicated

treatment (n=3; mean±SD). (E) Antibodies against NET-remodeled laminin prevented

inflammation-induced awakening in vivo. Mice with D2.0R cells were treated as indicated,

and metastatic burden in the lungs was quantified from hematoxylin and eosin stained

sections (n=5 mice per group; mean±SD). (F) Antibodies against NET-remodeled laminin

prevented smoking-induced awakening in vivo. Representative immunostaining of lungs

at day 30 for D2.0R cells (red) and Ki67 (green) with DAPI (blue), treated as indicated.

Scale bars: 50 μm.

42

Movie Legends

Movie S1. Neutrophil infiltration and neutrophil elastase activity is low in the lungs

of control animals.

Lung intravital imaging of a LysM-EGFP BALB/c mouse treated with PBS and injected

with the NE 680 FAST probe was performed to analyze the presence of neutrophils and

neutrophil elastase activity in the lungs. Neutrophils express EGFP (green), NE activity is

represented in red, and DNA (blue) is labeled by injection of DAPI. Time indicated is time

(h:mm:ss) after imaging was initiated, 18 hours after PBS instillation. Representative of

three mice.

Movie S2. Intranasal instillation of LPS induces high neutrophil recruitment and

neutrophil elastase activity in the lungs.

Lung intravital imaging of a LysM-EGFP BALB/c mouse treated with LPS and injected

with the NE 680 FAST probe was performed to analyze neutrophil recruitment and

neutrophil elastase activity in the lungs. Neutrophils express EGFP (green), NE activity is

represented in red, and DNA (blue) is labeled by injection of DAPI. Time indicated is time

(h:mm:ss) after imaging was initiated, 18 hours after LPS instillation. Representative of

three mice.

Movie S3. D2.0R cells are dormant in the lungs of control animals immediately after

PBS instillation.

A BALB/c mouse injected intravenously with FUCCI D2.0R cells at day 0 was subjected

to lung intravital imaging at day 8, after PBS instillation on day 7. NE 680 FAST probe

was used to detect neutrophil elastase activity. D2.0R cells express the FUCCI reporter

(red, green, or yellow as represented in fig. S2D), NE activity is represented in purple (no

signal was detected), and DNA (blue) is labeled by injection of DAPI. Time indicated is

time (h:mm:ss) after imaging was initiated. Representative of three mice.

Movie S4. D2.0R cells remain dormant in the lungs of control animals after two

PBS instillations.

A BALB/c mouse injected intravenously with FUCCI D2.0R cells at day 0 was subjected

to lung intravital imaging at day 11, after PBS instillation on days 7 and 10. NE 680 FAST

probe was used to detect neutrophil elastase activity. D2.0R cells express the FUCCI

reporter (red, green, or yellow as represented in fig. S2D), NE activity is represented in

purple (no signal was detected), and DNA (blue) is labeled by injection of DAPI. Time

indicated is time (h:mm:ss) after imaging was initiated. Representative of two mice.

Movie S5. D2.0R cells remain dormant in the lungs of control animals 21 days after

injection.

A BALB/c mouse injected intravenously with FUCCI D2.0R cells at day 0 was subjected

to lung intravital imaging at day 21, after PBS instillation on days 7, 10 and 13. NE 680

43

FAST probe was used to detect neutrophil elastase activity. D2.0R cells express the FUCCI

reporter (red, green, or yellow as represented in Fig. S2D), NE activity is represented in

purple (no signal was detected), and DNA (blue) is labeled by injection of DAPI. Time

indicated is time (h:mm:ss) after imaging was initiated. Representative of three mice.

Movie S6. D2.0R cells enter the G1/S transition of the cell cycle 4 days after the first

LPS intranasal instillation.

A BALB/c mouse injected intravenously with FUCCI D2.0R cells at day 0 was subjected

to lung intravital imaging at day 11, after LPS instillation on days 7 and 10. NE680 FAST

probe was used to detect neutrophil elastase activity. D2.0R cells express the FUCCI

reporter (red, green, or yellow as represented in fig. S2D), NE activity is represented in

purple, and DNA (blue) is labeled by injection of DAPI. Time indicated is time (h:mm:ss)

after imaging was initiated; there is a gap in timeframes between 22 min and 1h 44 min

due to inability to obtain good focus during this time period. Representative of three mice.

Movie S7. Clusters of dividing D2.0R cells are present in the lungs of mice 7 days after

the first LPS intranasal instillation.

BALB/c mice injected intravenously with FUCCI D2.0R cells at day 0 was subjected to

lung intravital imaging at day 14, after LPS instillation on days 7, 10, and 13. NE680 FAST

probe was used to detect neutrophil elastase activity. D2.0R cells express the FUCCI

reporter (red, green, or yellow as represented in fig. S2D), NE activity is represented in

purple, and DNA (blue) is labeled by injection of DAPI. Time indicated is time (h:mm:ss)

after imaging was initiated. Representative of three mice.

Movie S8. Established proliferative metastasis of D2.0R cells are present in the lungs

of mice 14 days after the first LPS intranasal instillation.

BALB/c mice injected intravenously with FUCCI D2.0R cells at day 0 was subjected to

lung intravital imaging at day 21, after LPS instillation on days 7, 10, and 13. NE 680

FAST probe was used to detect neutrophil elastase activity. D2.0R cells express the FUCCI

reporter (red, green, or yellow as represented in fig. S2D), NE activity is represented in

purple, and DNA (blue) is labeled by injection of DAPI. Time indicated is time (h:mm:ss)

after imaging was initiated. Representative of three mice.

References and Notes

1. M. S. Sosa, P. Bragado, J. A. Aguirre-Ghiso, Mechanisms of disseminated cancer cell

dormancy: An awakening field. Nat. Rev. Cancer 14, 611–622 (2014).

doi:10.1038/nrc3793 Medline

2. S. Malladi, D. G. Macalinao, X. Jin, L. He, H. Basnet, Y. Zou, E. de Stanchina, J. Massagué,

Metastatic latency and immune evasion through autocrine inhibition of WNT. Cell 165,

45–60 (2016). doi:10.1016/j.cell.2016.02.025 Medline

3. I. Romero, F. Garrido, A. M. Garcia-Lora, Metastases in immune-mediated dormancy: A new

opportunity for targeting cancer. Cancer Res. 74, 6750–6757 (2014). doi:10.1158/0008-

5472.CAN-14-2406 Medline

4. J. D. Farrar, K. H. Katz, J. Windsor, G. Thrush, R. H. Scheuermann, J. W. Uhr, N. E. Street,

Cancer dormancy. VII. A regulatory role for CD8+ T cells and IFN-gamma in

establishing and maintaining the tumor-dormant state. J. Immunol. 162, 2842–2849

(1999). Medline

5. M. Müller, F. Gounari, S. Prifti, H. J. Hacker, V. Schirrmacher, K. Khazaie, EblacZ tumor

dormancy in bone marrow and lymph nodes: Active control of proliferating tumor cells

by CD8+ immune T cells. Cancer Res. 58, 5439–5446 (1998). Medline

6. C. M. Ghajar, H. Peinado, H. Mori, I. R. Matei, K. J. Evason, H. Brazier, D. Almeida, A.

Koller, K. A. Hajjar, D. Y. R. Stainier, E. I. Chen, D. Lyden, M. J. Bissell, The

perivascular niche regulates breast tumour dormancy. Nat. Cell Biol. 15, 807–817 (2013).

doi:10.1038/ncb2767 Medline

7. D. Barkan, L. H. El Touny, A. M. Michalowski, J. A. Smith, I. Chu, A. S. Davis, J. D.

Webster, S. Hoover, R. M. Simpson, J. Gauldie, J. E. Green, Metastatic growth from

dormant cells induced by a col-I-enriched fibrotic environment. Cancer Res. 70, 5706–

5716 (2010). doi:10.1158/0008-5472.CAN-09-2356 Medline

8. B. L. Pierce, R. Ballard-Barbash, L. Bernstein, R. N. Baumgartner, M. L. Neuhouser, M. H.

Wener, K. B. Baumgartner, F. D. Gilliland, B. E. Sorensen, A. McTiernan, C. M. Ulrich,

Elevated biomarkers of inflammation are associated with reduced survival among breast

cancer patients. J. Clin. Oncol. 27, 3437–3444 (2009). doi:10.1200/JCO.2008.18.9068

Medline

9. J. P. Pierce, R. E. Patterson, C. M. Senger, S. W. Flatt, B. J. Caan, L. Natarajan, S. J. Nechuta,

E. M. Poole, X.-O. Shu, W. Y. Chen, Lifetime cigarette smoking and breast cancer

prognosis in the After Breast Cancer Pooling Project. J. Natl. Cancer Inst. 106, djt359

(2014). doi:10.1093/jnci/djt359 Medline

10. A. H. Wu, S. L. Gomez, C. Vigen, M. L. Kwan, T. H. M. Keegan, Y. Lu, S. Shariff-Marco,

K. R. Monroe, A. W. Kurian, I. Cheng, B. J. Caan, V. S. Lee, J. M. Roh, J. Sullivan-

Halley, B. E. Henderson, L. Bernstein, E. M. John, R. Sposto, The California Breast

Cancer Survivorship Consortium (CBCSC): Prognostic factors associated with

racial/ethnic differences in breast cancer survival. Cancer Causes Control 24, 1821–1836

(2013). doi:10.1007/s10552-013-0260-7 Medline

11. S. Murin, K. E. Pinkerton, N. E. Hubbard, K. Erickson, The effect of cigarette smoke

exposure on pulmonary metastatic disease in a murine model of metastatic breast cancer.

Chest 125, 1467–1471 (2004). doi:10.1378/chest.125.4.1467 Medline

12. J. M. De Cock, T. Shibue, A. Dongre, Z. Keckesova, F. Reinhardt, R. A. Weinberg,

Inflammation Triggers Zeb1-Dependent Escape from Tumor Latency. Cancer Res. 76,

6778–6784 (2016). doi:10.1158/0008-5472.CAN-16-0608 Medline

13. S. K. Jorch, P. Kubes, An emerging role for neutrophil extracellular traps in noninfectious

disease. Nat. Med. 23, 279–287 (2017). doi:10.1038/nm.4294 Medline

14. N. Branzk, V. Papayannopoulos, Molecular mechanisms regulating NETosis in infection and

disease. Semin. Immunopathol. 35, 513–530 (2013). doi:10.1007/s00281-013-0384-6

Medline

15. C. Carmona-Rivera, W. Zhao, S. Yalavarthi, M. J. Kaplan, Neutrophil extracellular traps

induce endothelial dysfunction in systemic lupus erythematosus through the activation of

matrix metalloproteinase-2. Ann. Rheum. Dis. 74, 1417–1424 (2015).

doi:10.1136/annrheumdis-2013-204837 Medline

16. T. A. Fuchs, A. Brill, D. Duerschmied, D. Schatzberg, M. Monestier, D. D. Myers Jr., S. K.

Wrobleski, T. W. Wakefield, J. H. Hartwig, D. D. Wagner, Extracellular DNA traps

promote thrombosis. Proc. Natl. Acad. Sci. U.S.A. 107, 15880–15885 (2010).

doi:10.1073/pnas.1005743107 Medline

17. A. Brill, T. A. Fuchs, A. S. Savchenko, G. M. Thomas, K. Martinod, S. F. De Meyer, A. A.

Bhandari, D. D. Wagner, Neutrophil extracellular traps promote deep vein thrombosis in

mice. J. Thromb. Haemost. 10, 136–144 (2012). doi:10.1111/j.1538-7836.2011.04544.x

Medline

18. S. L. Wong, M. Demers, K. Martinod, M. Gallant, Y. Wang, A. B. Goldfine, C. R. Kahn, D.

D. Wagner, Diabetes primes neutrophils to undergo NETosis, which impairs wound

healing. Nat. Med. 21, 815–819 (2015). doi:10.1038/nm.3887 Medline

19. J. Cools-Lartigue, J. Spicer, B. McDonald, S. Gowing, S. Chow, B. Giannias, F. Bourdeau,

P. Kubes, L. Ferri, Neutrophil extracellular traps sequester circulating tumor cells and

promote metastasis. J. Clin. Invest. 123, 3446–3458 (2013). doi:10.1172/JCI67484

Medline

20. S. Tohme, H. O. Yazdani, A. B. Al-Khafaji, A. P. Chidi, P. Loughran, K. Mowen, Y. Wang,

R. L. Simmons, H. Huang, A. Tsung, Neutrophil extracellular traps promote the

development and progression of liver metastases after surgical stress. Cancer Res. 76,

1367–1380 (2016). doi:10.1158/0008-5472.CAN-15-1591 Medline

21. D. Barkan, H. Kleinman, J. L. Simmons, H. Asmussen, A. K. Kamaraju, M. J. Hoenorhoff,

Z. Y. Liu, S. V. Costes, E. H. Cho, S. Lockett, C. Khanna, A. F. Chambers, J. E. Green,

Inhibition of metastatic outgrowth from single dormant tumor cells by targeting the

cytoskeleton. Cancer Res. 68, 6241–6250 (2008). doi:10.1158/0008-5472.CAN-07-6849

Medline

22. J. Park, R. W. Wysocki, Z. Amoozgar, L. Maiorino, M. R. Fein, J. Jorns, A. F. Schott, Y.

Kinugasa-Katayama, Y. Lee, N. H. Won, E. S. Nakasone, S. A. Hearn, V. Küttner, J.

Qiu, A. S. Almeida, N. Perurena, K. Kessenbrock, M. S. Goldberg, M. Egeblad, Cancer

cells induce metastasis-supporting neutrophil extracellular DNA traps. Sci. Transl. Med.

8, 361ra138 (2016). doi:10.1126/scitranslmed.aag1711 Medline

23. S. B. Koh, P. Mascalchi, E. Rodriguez, Y. Lin, D. I. Jodrell, F. M. Richards, S. K. Lyons, A

quantitative FastFUCCI assay defines cell cycle dynamics at a single-cell level. J. Cell

Sci. 130, 512–520 (2017). doi:10.1242/jcs.195164 Medline

24. H. Cho, T. Herzka, W. Zheng, J. Qi, J. E. Wilkinson, J. E. Bradner, B. D. Robinson, M.

Castillo-Martin, C. Cordon-Cardo, L. C. Trotman, RapidCaP, a novel GEM model for

metastatic prostate cancer analysis and therapy, reveals myc as a driver of Pten-mutant

metastasis. Cancer Discov. 4, 318–333 (2014). doi:10.1158/2159-8290.CD-13-0346

Medline

25. D. Barkan, J. E. Green, An in vitro system to study tumor dormancy and the switch to

metastatic growth. J. Vis. Exp. 2011, e2914 (2011). Medline

26. A. Hosseinzadeh, P. R. Thompson, B. H. Segal, C. F. Urban, Nicotine induces neutrophil

extracellular traps. J. Leukoc. Biol. 100, 1105–1112 (2016). doi:10.1189/jlb.3AB0815-

379RR Medline

27. R. William, G. Watson, H. P. Redmond, J. M. Carthy, D. Bouchier-Hayes, Taurolidine, an

antilipopolysaccharide agent, has immunoregulatory properties that are mediated by the

amino acid taurine. J. Leukoc. Biol. 58, 299–306 (1995). doi:10.1002/jlb.58.3.299

Medline

28. M. Egeblad, Z. Werb, New functions for the matrix metalloproteinases in cancer progression.

Nat. Rev. Cancer 2, 161–174 (2002). doi:10.1038/nrc745 Medline

29. K. Kessenbrock, V. Plaks, Z. Werb, Matrix metalloproteinases: Regulators of the tumor

microenvironment. Cell 141, 52–67 (2010). doi:10.1016/j.cell.2010.03.015 Medline

30. V. Papayannopoulos, K. D. Metzler, A. Hakkim, A. Zychlinsky, Neutrophil elastase and

myeloperoxidase regulate the formation of neutrophil extracellular traps. J. Cell Biol.

191, 677–691 (2010). doi:10.1083/jcb.201006052 Medline

31. K. D. Metzler, C. Goosmann, A. Lubojemska, A. Zychlinsky, V. Papayannopoulos, A

myeloperoxidase-containing complex regulates neutrophil elastase release and actin

dynamics during NETosis. Cell Reports 8, 883–896 (2014).

doi:10.1016/j.celrep.2014.06.044 Medline

32. A. Beliveau, J. D. Mott, A. Lo, E. I. Chen, A. A. Koller, P. Yaswen, J. Muschler, M. J.

Bissell, Raf-induced MMP9 disrupts tissue architecture of human breast cells in three-

dimensional culture and is necessary for tumor growth in vivo. Genes Dev. 24, 2800–

2811 (2010). doi:10.1101/gad.1990410 Medline

33. R. Catena, N. Bhattacharya, T. El Rayes, S. Wang, H. Choi, D. Gao, S. Ryu, N. Joshi, D.

Bielenberg, S. B. Lee, S. A. Haukaas, K. Gravdal, O. J. Halvorsen, L. A. Akslen, R. S.

Watnick, V. Mittal, Bone marrow-derived Gr1+ cells can generate a metastasis-resistant

microenvironment via induced secretion of thrombospondin-1. Cancer Discov. 3, 578–

589 (2013). doi:10.1158/2159-8290.CD-12-0476 Medline

34. T. El Rayes, R. Catena, S. Lee, M. Stawowczyk, N. Joshi, C. Fischbach, C. A. Powell, A. J.

Dannenberg, N. K. Altorki, D. Gao, V. Mittal, Lung inflammation promotes metastasis

through neutrophil protease-mediated degradation of Tsp-1. Proc. Natl. Acad. Sci. U.S.A.

112, 16000–16005 (2015). doi:10.1073/pnas.1507294112 Medline

35. J. A. Aguirre Ghiso, Inhibition of FAK signaling activated by urokinase receptor induces

dormancy in human carcinoma cells in vivo. Oncogene 21, 2513–2524 (2002).

doi:10.1038/sj.onc.1205342 Medline

36. J. A. Aguirre Ghiso, K. Kovalski, L. Ossowski, Tumor dormancy induced by downregulation

of urokinase receptor in human carcinoma involves integrin and MAPK signaling. J. Cell

Biol. 147, 89–104 (1999). doi:10.1083/jcb.147.1.89 Medline

37. D. Liu, J. Aguirre Ghiso, Y. Estrada, L. Ossowski, EGFR is a transducer of the urokinase

receptor initiated signal that is required for in vivo growth of a human carcinoma. Cancer

Cell 1, 445–457 (2002). doi:10.1016/S1535-6108(02)00072-7 Medline

38. F. Calvo, N. Ege, A. Grande-Garcia, S. Hooper, R. P. Jenkins, S. I. Chaudhry, K. Harrington,

P. Williamson, E. Moeendarbary, G. Charras, E. Sahai, Mechanotransduction and YAP-

dependent matrix remodelling is required for the generation and maintenance of cancer-

associated fibroblasts. Nat. Cell Biol. 15, 637–646 (2013). doi:10.1038/ncb2756 Medline

39. R. O. Hynes, Integrins: Bidirectional, allosteric signaling machines. Cell 110, 673–687

(2002). doi:10.1016/S0092-8674(02)00971-6 Medline

40. T. Shibue, M. W. Brooks, R. A. Weinberg, An integrin-linked machinery of cytoskeletal

regulation that enables experimental tumor initiation and metastatic colonization. Cancer

Cell 24, 481–498 (2013). doi:10.1016/j.ccr.2013.08.012 Medline

41. A. Caudrillier, K. Kessenbrock, B. M. Gilliss, J. X. Nguyen, M. B. Marques, M. Monestier,

P. Toy, Z. Werb, M. R. Looney, Platelets induce neutrophil extracellular traps in

transfusion-related acute lung injury. J. Clin. Invest. 122, 2661–2671 (2012).

doi:10.1172/JCI61303 Medline

42. K. Pantel, C. Alix-Panabières, Bone marrow as a reservoir for disseminated tumor cells: A

special source for liquid biopsy in cancer patients. Bonekey Rep. 3, 584 (2014).

doi:10.1038/bonekey.2014.79 Medline

43. A. Pommier, N. Anaparthy, N. Memos, Z. L. Kelley, A. Gouronnec, R. Yan, C. Auffray, J.

Albrengues, M. Egeblad, C. A. Iacobuzio-Donahue, S. K. Lyons, D. T. Fearon,

Unresolved endoplasmic reticulum stress engenders immune-resistant, latent pancreatic

cancer metastases. Science 360, eaao4908 (2018). doi:10.1126/science.aao4908 Medline

44. K. Nakano, S. Suzuki, C. Oh, Significance of increased secretion of glucocorticoids in mice

and rats injected with bacterial endotoxin. Brain Behav. Immun. 1, 159–172 (1987).

doi:10.1016/0889-1591(87)90018-3 Medline

45. V. Delgado-Rizo, M. A. Martínez-Guzmán, L. Iñiguez-Gutierrez, A. García-Orozco, A.

Alvarado-Navarro, M. Fafutis-Morris, Neutrophil extracellular traps and its implications

in inflammation: An overview. Front. Immunol. 8, 81 (2017).

doi:10.3389/fimmu.2017.00081 Medline

46. D. F. Quail, O. C. Olson, P. Bhardwaj, L. A. Walsh, L. Akkari, M. L. Quick, I.-C. Chen, N.

Wendel, N. Ben-Chetrit, J. Walker, P. R. Holt, A. J. Dannenberg, J. A. Joyce, Obesity

alters the lung myeloid cell landscape to enhance breast cancer metastasis through IL5

and GM-CSF. Nat. Cell Biol. 19, 974–987 (2017). doi:10.1038/ncb3578 Medline

47. M. B. Headley, A. Bins, A. Nip, E. W. Roberts, M. R. Looney, A. Gerard, M. F. Krummel,

Visualization of immediate immune responses to pioneer metastatic cells in the lung.

Nature 531, 513–517 (2016). doi:10.1038/nature16985 Medline

48. N. Faust, F. Varas, L. M. Kelly, S. Heck, T. Graf, Insertion of enhanced green fluorescent

protein into the lysozyme gene creates mice with green fluorescent granulocytes and

macrophages. Blood 96, 719–726 (2000). Medline

49. E. A. Greenfield, Antibodies: A Laboratory Manual (Cold Spring Harbor Laboratory Press,

ed. 2, 2014).

50. S. R. V. Knott, A. Maceli, N. Erard, K. Chang, K. Marran, X. Zhou, A. Gordon, O. E.

Demerdash, E. Wagenblast, S. Kim, C. Fellmann, G. J. Hannon, A computational

algorithm to predict shRNA potency. Mol. Cell 56, 796–807 (2014).

doi:10.1016/j.molcel.2014.10.025 Medline